CN101899515A - Microsatellite marker for weight character screening of six week-age duck, kit and application thereof - Google Patents

Abstract

The invention provides a microsatellite marker for weight character screening of six week-age duck, a kit and application thereof. The microsatellite marker is an amplification product of a primer pair SEQ ID No.2&3, and a protogene of the microsatellite marker is shown by SEQ ID No.1. The microsatellite marker and the kit can be used for assisting in duck breeding, quickly and accurately assist in screening, and have the advantages of early screening, time saving, low cost, and high accuracy.

Description

Be used for microsatellite marker, its test kit and the application of 6-week-old ducks weight character screening

Technical field

The present invention relates to technical field of molecular biology, be specifically related to be used for microsatellite marker, its detection kit and the application of 6-week-old ducks weight character screening.

Background technology

Little satellite is called the simple sequence repetition again, and (Sample Sequence Repeats SSR), is a core sequence with 1-6 base generally, the tandem repetitive sequence that joins end to end and form.This sequence is present in nearly all Eukaryotic genome, and the transcribed spacer of gene and intron and exon and control region all have the distribution of little satellite.In the different plant species, the content of microsatellite sequence has nothing in common with each other, just there is a microsatellite locus in the average every 50-150kb of eukaryote, and there is a microsatellite locus in every interval 6kb in the human genome, and there is a microsatellite locus in then every interval 20-39kb in the birds genome.And the abundance of various microsatellite sequences also has nothing in common with each other in different plant species.For example, in the mankind and mammal genome, the abundantest microsatellite sequence is (AC) n; Then maximum in Plant Genome with (AT) n.In the eukaryotic gene group, the dinucleotides microsatellite sequence is the abundantest, about low 10 times of the sequence content of the little satellite of trinucleotide than dinucleotides microsatellite sequence, and the microsatellite sequence of the little satellite of tetranucleotide is then less relatively.

Compare with other molecule marker, microsatellite marker has following characteristics: (1). and extensively be randomly distributed in the eukaryotic gene group, exon and intron all have distribution; (2). can detect its polymorphism by pcr amplification according to the conservative property flanking sequence design primer of little satellite both sides; (3). highly polymorphic, the information content height; (4). little satellite flanking sequence conservative property is higher between the species that disengaging time is lacked in the evolution, and as the specificity micro-satellite primers amplification turkey genome of usefulness chickens such as Reed, 54% primer has pcr amplification product (5). codominant inheritance; (6). the sequence of little satellite is generally shorter, even the DNA of part degraded also has and enough is used for the microsatellite sequence that increases, this point more is better than the VNTR of RAPD and longer target gene sequences, thereby has important use be worth in the research of ancient DNA and medical jurisprudence are identified; (7). along with capillary electrophoresis technique and development of technologies, full-automatic extensive gene type assay has become possibility.

Since Skinner in 1974 etc. at first find little satellite this mark be widely used in that organic evolution, genetics are identified, the researchs such as location of germ plasm resource analysis and construction of genetic atlas, functional gene and quantitative character.At present, the method for seeking microsatellite locus mainly contains following three kinds: (1). and the genomic library that the genomic library method is used for little satellite research at present is divided three classes: little insertion fragment library, insert the special library of fragment library and karyomit(e) greatly.Be used widely owing to be convenient to the research of follow-up little satellite structure in little insertion fragment library.The insertion clip size that small segment inserts in the library is generally 200-600bp, specific practice is: with the total DNA of several digestion with restriction enzyme, separate endonuclease bamhi with sepharose then, reclaim the fragment of 200-600bp, be connected with corresponding carrier again and transform special fungus strain, the core repetitive probe of radioelement of having used mark contains the positive colony of target tumor-necrosis factor glycoproteins by the radioactivity screening by hybridization, measures the sequence clone microsatellite locus of positive colony at last.(2). the comparative genomics research method along with Human Genome Project examining order finish and other important economical trait animal-plant gene batch total is carried out with drawing, the biologist will have the molecular genetics basis of model animals and more profoundly be familiar with and understand, how to utilize the large number of biological information of model animals, carrying out the vegeto-animal molecule genetics research of other species by means of the research method of comparative genomics will be biological important research content in this century, the separation of microsatellite marker is no exception, pig, ox, the screening of a large amount of microsatellite markers of important economic animal such as chicken provides possibility for the separation of close species and the general microsatellite marker of multiple species.This method is used the pcr amplification that the more species of microsatellite marker carry out close species, therefrom filter out some and have specific amplification products, amplified fragments size and the approaching polymorphic site of former species, and whether be polymorphic microsatellite marker with the discrepant species of former species by the order-checking post analysis for the amplified fragments size.The advantage of this method is can filter out some to be common to some spore research and to make up the relatively polymorphic microsatellite marker of genetic map.

Body weight is one important in the duck qualitative character, and it can react the growth and development state of bird, and is most important to culturing.To the microsatellite marker of this proterties of duck body weight, can provide actual parameter for assistant breeding, improve breeding efficiency.

Summary of the invention

The purpose of this invention is to provide a kind of microsatellite marker, its detection kit and application that is used for the 6-week-old ducks weight character screening.

The present invention is by design micro-satellite primers and fluorescence labeling microsatellite primer, utilize pcr amplification to obtain little satellite fragment of different lengths, electrophoresis under ABI sequenator GS-RUN-360-P0P4default module, electrophoresis result is utilized Crimap2.4 software component gene genetic linkage map with GenesScan3.7 and the analysing amplified clip size of Genemapper.On the basis of the gene genetic picture that makes up, be decided to be method with Haley recurrence interval important economical trait is carried out the QTL location, the location adopts model to be:

y＝μ+P(Q|M)[C _alA+C _dlD]+e

Wherein: μ is a population mean;

When P (Q|M) is the known mark genotype, the probability of QTL marker gene type;

C _AlRegression coefficient for i individual additivity component at given seat in the colony;

A is the additive effect of QTL;

C _DlRegression coefficient for i individual dominance component at given seat in the colony;

D is the dominant effect of QTL;

E is the residual error effect.

Found that, by primer SEQ ID No.2﹠amp; The microsatellite marker of 3 signs and 6 all body weight in age (W6) proterties are linked.And then, the invention provides the microsatellite marker that is used for 6-week-old ducks body weight (W6) screening, wherein advantage allelotrope is the microsatellite marker shown in the SEQ ID No.1.

The present invention further provides the primer of the above-mentioned microsatellite marker that is used to increase.At primer sequence described in the preferred embodiment of the invention be:

Pf：CAGACTCCTGGAAACCTTCT，

Pr：TGGGTTTTTGAACACAGATA。

Further, the present invention also provides the test kit that contains above-mentioned primer.This test kit also further comprises one or more in the following reagent: PCR damping fluid, Mg ²⁺, archaeal dna polymerase, dNTPs.

Microsatellite marker of the present invention and test kit can be used for the assistant breeding of duck, and assisting sifting fast and accurately has early screening, saves time, with low cost, advantage of high accuracy.

Embodiment

Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is ordinary method.Used test materials among the following embodiment if no special instructions, is to buy from routine biochemistry reagent shop and obtains.% among the following embodiment if no special instructions, is the quality percentage composition.Quantitative test in following examples all is provided with repeated experiments three times, results averaged.

Pick up from the individual blood sample of each 40 duck of 15 duck colonies (A-O) of Beijing Golden Star Duck Center at random, colony comprises 2 Beijing ducks guarantor kind of groups M and N, 2 cherry valley duck strains of introducing from Britain cherry paddy company (C, D), 11 Beijing duck artificially breeding strains (A, B, E-L, O)

Embodiment 1 microsatellite marker is related with weight character

1, primer information:

5 ' end is marked with the primer of HEX or FAM phosphorous acid acid amides fluorophor:

Table 1

2. fowl blood taking and handling

Duck factory collects 15 familys purebred Beijing duck blood sample of about 650 individualities altogether, the wing venous blood collection, and each individuality is taked the 0.5ml blood sample, adds the 0.2ml antithrombotics, fully mixing.After normal temperature is taken back the laboratory, add fowl blood lysate liquid with 1: 9 ratio, normal temperature cracking anticoagulation after 48 hours-20 ℃ of preservations standby.

3.. the extraction of duck genomic dna

(1) gets 0.4ml cracking blood (1ml blood adds 9ml fowl blood lysate liquid) and put into the 1.5ml centrifuge tube, add the TE dilution according to circumstances;

(2) add proteolytic enzyme k to final concentration 200 μ g/ml, mixing, 55 ℃ of water-baths digested 24-36 hour, added Proteinase K according to circumstances, continued digestion;

(3) add the saturated phenol of equal-volume Tris, jog 10mim, the centrifugal 10min of 12000rpm;

(4) supernatant is transferred in the new centrifuge tube;

(5) use isopyknic phenol: chloroform (1: 1) and each extracting of chloroform are once;

(6) upper water is added to 1/10 volumes of acetic acid sodium (pH5.2) and 2 times of volume dehydrated alcohol deposit D NA, and the cotton-shaped DNA to densification about precipitation at room temperature 1min occurs;

(7) choose with the clean first DNA of Tip rifle and put into new centrifuge tube, with 70% washing with alcohol DNA precipitation twice, vacuum is drained the back and is added 100-200 μ l TE (PH8.0) dissolving DNA;

(8) 0.7% agarose electrophoresis Preliminary detection concentration and purity, with each sample DNA concentration dilution to 20ng/ μ l.

4.PCR amplification

For above mentioned each little satellite fluorescent primer is carried out determining of PCR reaction conditions (annealing temperature Tm) respectively, the condition that indivedual primers are groped in the past is unsatisfactory, determines a suitable annealing temperature so need carry out the grads PCR reaction again.After determining, condition carries out the extensive duck PCR of colony scanning again.

PCR reaction system (15 μ l):

Upstream primer (10mM) 0.5 μ l

Downstream primer (10mM) 0.5 μ l

dNTP(10mM) 1.2μl

10×PCR?Buffer 1.5μl

Taq enzyme 0.3 μ l

Template (20ng/ μ l) 2.0 μ l

dd?H ₂O 9.0μl

Reaction conditions:

Beginning, 94 ℃ of pre-sex change 5min; The centre, 94 ℃ of 30S, 58.1 ℃ of 30S, 72 ℃ of 35S, totally 35 circulations; At last, 72 ℃ are extended 7min, 4 ℃ of preservations.React in 96 orifice plates and carry out, should do negative control.

5. carry out gene type assay with test kit

This test kit comprises: a pair of (the SEQ ID No.2﹠amp of pcr amplification primer; 3), pcr amplification enzyme, restriction enzyme HaeIII and Rsa I and damping fluid thereof.

According to the size of the difference that is marked at primer 5 ' end fluorescence, amplified fragments and avoid pairing between primer as far as possible, with primer to being placed in the group, the PCR product by the primer title according to clip size and add the combination that the fluorescent mark color distinction is carried out.Deionized water with sterilization dilutes PCR product 3-10 doubly, get 1 μ l cut back, add 10 μ l deionized formamides, 0.15 μ lGenescan-350ROXTM or Genescan-500ROXTM, behind the mixing that fully vibrates under 3100 sequenator GS-RUN-36-POP4default Module (d system) electrophoresis 36-44 minute.Use Genescan 3.7 and Genemapper 1.1 software analysis pcr amplified fragment sizes, use Genepop 3.4, each loci gene type relevant information of each family of Cervus 2.0 software analysis behind the manual synchronizing.

The nucleotide sequence of extension increasing sequence is shown in SEQ ID No.1, and wherein 5 ' 219～240 zone is core area.

Table 2 gene type assay result

" No., OHet, Ehet, PIC " represents " site allelotrope number, actual heterozygosity, theoretical heterozygosity and information content " respectively in the table

6. filial generation character screening

To each batch body weight in age in filial generation detail record 6 week of selecting and remain in advance.The big duck of screening 6 week body weight in age propagates.The result shows that the Beijing duck progeny population after screening is improved in genomic level, and the advantage gene frequency has obtained raising in various degree.

Result such as following table:

Claims (7)

1. the microsatellite marker that is used for the 6-week-old ducks weight character screening, it is the amplified production of following primer:

Pf：CAGACTCCTGGAAACCTTCT，

Pr：TGGGTTTTTGAACACAGATA。

2. microsatellite marker as claimed in claim 1, its nucleotide sequence is shown in SEQ IDNo.1.

3. the primer of the described microsatellite marker of claim 1 is used to increase.

4. primer as claimed in claim 2, it is:

Pf：CAGACTCCTGGAAACCTTCT，

Pr：TGGGTTTTTGAACACAGATA。

5. the test kit that contains claim 3 or 4 described primers.

6. test kit as claimed in claim 5, it also comprises in the following reagent one or more: PCR damping fluid, Mg ²⁺, archaeal dna polymerase, dNTPs.

7. claim 1 or 2 described microsatellite markers, claim 3 or 4 described primers or claim 5 or 6 application of described test kit in the duck seed selection.