CN101899511B - Method for detecting bovine leukocyte adhesion deficiency by applying allele specific polymerase chain reaction (AS-PCR) - Google Patents
Method for detecting bovine leukocyte adhesion deficiency by applying allele specific polymerase chain reaction (AS-PCR) Download PDFInfo
- Publication number
- CN101899511B CN101899511B CN2010102256052A CN201010225605A CN101899511B CN 101899511 B CN101899511 B CN 101899511B CN 2010102256052 A CN2010102256052 A CN 2010102256052A CN 201010225605 A CN201010225605 A CN 201010225605A CN 101899511 B CN101899511 B CN 101899511B
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- bovine
- adhesion deficiency
- leukocyte adhesion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of livestock molecular detection, in particular relates to a method for detecting bovine leukocyte adhesion deficiency by applying an allele specific polymerase chain reaction (AS-PCR). A specific PCR primer used by a method for detecting bovine adhesion deficiency is prepared and comprises a CD18 gene amplification primer, wherein the length of a mutant amplification product is 500bp, a primer 1 is 5'AAGATGACGAGGAGCAGAA 3', and a primer 2 is 5'GTCCATCAGGTAGTACAGGC 3'; and the length of a wild amplification product is 818bp, a primer 3 is 5'CAAGGGCTACCCCATCGA 3', and a primer 4 is 5'CAGGACTGCGTGGCTAAA 3'. The specific primer used by the method for detecting the bovine leukocyte adhesion deficiency can be directly applied to in-vitro screening of disease-causing genes of the bovine adhesion deficiency so as to contribute to the early elimination of an individual with the bovine adhesion deficiency.
Description
Technical field
The invention belongs to animal molecular detection technology field, be specifically related to a kind of method in vitro detection bovine leukocyte adhesion defects (BLAD).
Background technology
Leukocyte adhesion deficiency (Bovine LeukocyteAdhesion Deficiency; Be called for short BLAD) be a kind ofly can influence the immune autosomal recessive inheritance defective of ox; In U.S. cows, find (Hagemoser et al., 1983) first in nineteen eighty-three.This hereditary defect mainly is to be called by leukocyte surface a kind of to integrate (Gerardi et al. due to the plain P-glycoprotein expression defective; 1996); Because when inflammatory reaction; Series reaction can take place in the neutrophil leucocyte in the peripheral blood, comprise by chemotactic substance and inflammatory stimulus thing sensitization, adhere on the blood vessel endothelium, pass vessel wall, in matrix to the inflammation part chemotactic, finally arrive the position that cause of disease is invaded; Pathogenic agent is directly made a response etc.; And wherein the most key be that neutrophil leucocyte and blood vessel endothelium adhesion molecule interact and adhere on the blood vessel endothelium, (Springer et al., 1990 must could take place by the plain glycoprotein molecule mediation of the integration of neutrophils surface in this process; Nagahata et al., 1995).When the expression level of integrating element is lower than 1%, serious infection can appear clinically, even entail dangers to life.Integrating plain molecule is the heterodimer that is linked to each other and constitute with non covalent bond by α subunit (CD11) and β subunit (CD18); Each integrates plain molecule all is to constitute ability functionating (Kishimoto et al., 1987 by alpha subunit and common β subunit; Springer et al., 1990).Shuster et al. (1992) has carried out sequential analysis to the CD18 encoding sox of the holstein cow of suffering from BLAD and has found two point mutation; One of them sudden change (A 383G) has caused the change of the 128th amino acids that is positioned at the outer high conservative region of born of the same parents in this gp; Become glycocoll by aspartic acid; Cause plain expression of integration of leukocyte surface obviously to be reduced or shortage, thereby cause clinical onset.Clinically, the individual white corpuscle of falling ill is 7-20 a times of normal individual, and the plain expression of leukocyte surface integration weakens or do not have expression (Nagahataet al., 1997), and the BLAD diseased individuals also shows as does not like motion, grows and is obstructed, liver, kidney sex change, splenomegaly; Infectation of bacteria repeatedly is Catarrhal bronchopneumonia etc. widely, also can be observed multiple pulmonary necrosis kitchen range, gastritis; Membrana oralis ulcer, serious periodontitis, gingival atrophy; Necrotic laryngitis, under the jaw soft tissue expand, slight (Nagahata et al., 1995 such as diarrhoea; Van Garderen et al., 1994)
China He Sitan breeding oxen comprises the cattle on the hoof and the embryo of import mainly from state's imports such as the U.S., Canada, Germany and Australia and New Zealands.China did not have enough knowledge to this disease and paid attention in the past, had introduced a large amount of potential BLAD carrier, and the holstein cows of introducing simultaneously that does not have the pedigree data in a large number is the potential carrier equally.The breeding oxen of these introductions makes the DUMPS carrier number of China increase in a large amount of uses of China, owing to do not have the detection technique of autonomous property right, thereby can't announce the detected result of cow, and be difficult to infer the route of transmission of DUMPS according to pedigree.China is at the early-stage to the work of heredopathia unfolded; The work of in the actual breeding of milk cow, carrying out is also few; And only be confined to (Li Yanhua etc. in the laboratory; 2008), we should in time detect the carrier of DUMPS in frozen semen and the cow and eliminate in production practice, to reduce the loss of economic benefit.
Summary of the invention
The objective of the invention is to overcome the defective that prior art exists, seek a kind of simple and effective method in vitro detection bovine leukocyte adhesion defects.
Realize that technological line of the present invention is as follows:
The present invention has set up a kind of AS-PCR method that fast, accurately detects the bovine leukocyte adhesion defects, and its concrete steps are following:
(1) design of primers: the ox CD18 sequence that provides according to GenBank (accession number: 281877), and, utilize biology primer-design software Premier 5, designed the AS-PCR amplimer according to the characteristic of AS-PCR.This primer is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.This primer sequence sees for details shown in the embodiment 1 in the embodiment.
(2) allele-specific PCR (AS-PCR): extract ox blood appearance genomic dna, according to the direct judged result of pcr amplification.If the purpose fragment of amplification is 818bp (seeing SEQ ID NO:2), then is healthy individuals; If the purpose fragment that amplifies is 818bp and 500bp (seeing sequence table SEQ ID NO:2 and 3), then is heterozygote, i.e. BLAD disease carrier; If the individual purpose fragment that amplifies is 500bp (seeing SEQ ID NO:3), then be the homozygote that causes a disease.
Compared with prior art, positively effect of the present invention is:
A kind of method and Auele Specific Primer that quick and precisely screens somatotype BLAD is provided, directly applied to the Disease-causing gene screening of Niu Kaizhan BLAD, be beneficial to the forepart elimination of BLAD diseased individuals.The AS-PCR technology is compared with enzyme incision technology does not need restriction endonuclease, and has saved the endonuclease reaction process, have easy, cost is low, be suitable for the extensive advantage such as all SNP that detects, can detect; The AS-PCR technology requires 3 ' end of primer just to drop on the mutating alkali yl to design of primers, can not influence pcr amplification again, so design of primers is just particularly important with the AS-PCR reaction conditions.In order to improve the specificity of primer, can introduce a mispairing the 3rd or the 4th of 3 ' end; Traditional single tube AS-PCR technology is two pairs of primers to be put into same system increase; Possibly there is competition between the primer; Cause a certain fragment to be preponderated and other segmental amplifications are died down; Influence result's judgement, and when groping condition, consider the influence of factors such as annealing temperature of concentration ratio, each primer of 4 primers.And the two step AS-PCR technology that the present invention sets up are that two primers are separately expanded; Set up two PCR reaction systems to increasing with a dna sample; Get equivalent amplified production mixing point sample then and detect and to judge genotype, reduced the difficulty that the AS-PCR reaction conditions is groped greatly.
Description of drawings
Sequence table SEQ ID NO:1 is the total sequence of purpose fragment (comprising 500bp and 818bp purpose fragment) that the present invention increases.
Wherein, The 1-19 bit base is the special primer (being the primer of numbering 1 in specification sheets embodiment 1 step 3) of amplification bovine leukocyte adhesion defects gene C D18 for sequence table SEQ ID:4; The 481-500 bit base is the special primer (being the primer of numbering 2 in specification sheets embodiment 1 step 3) of amplification bovine leukocyte adhesion defects gene C D18 for sequence table SEQ ID:5, and the purpose fragment that this a pair of primer amplification goes out is 500bp; The 464-481 bit base is the special primer (being the primer of numbering 3 in specification sheets embodiment 1 step 3) of amplification bovine leukocyte adhesion defects gene C D18 for sequence table SEQ ID:6; The 1264-1281 bit base is the special primer (being the primer of numbering 4 in specification sheets embodiment 1 step 3) of amplification bovine leukocyte adhesion defects gene C D18 for sequence table SEQ ID:7, and this purpose fragment that primer amplification is gone out is 818bp; Mutational site, 481 bit base position.In sequence table SEQ ID NO:1; Have in two primers and comprise mutational site 481; This be according to allele-specific PCR (allele specific polymerase chain reaction, AS-PCR principle designed, that is: to different two pairs of parallel primers of allelotrope design; A pair of wild-type primer PQ and a pair of mutant primer WM, the purpose segment of using these two pairs of primers to increase respectively and contain oppositional allele.As shown in Figure 4: the 3 ' end of primer P and M is positioned on the allelotrope, and P and M primer are in the opposite direction; This contains the purpose fragment of allelotrope a to primer amplification PQ, and this contains the purpose fragment of allelotrope b to primer amplification WM, distinguishes different allelotrope according to purpose fragment length and quantity variance then.The AS-PCR technology does not need restriction enzyme, only needs a step pcr amplification and detected through gel electrophoresis can distinguish the different gene type.
Sequence table SEQ ID NO:2 and SEQ ID NO:3 are the purpose fragments of the bovine leukocyte adhesion defects that increases of the present invention, have wherein comprised the special primer of amplification bovine leukocyte adhesion defects gene C D18 among the SEQ ID NO:2-3.
Sequence table SEQ ID:4 is the special primer (being the primer of numbering 1 in specification sheets embodiment 1 step 3) of amplification bovine leukocyte adhesion defects gene C D18
Sequence table SEQ ID:5 is the special primer (be the primer of in specification sheets embodiment 1 step 3 numbering 2) of amplification ox from cell adhesion dcc gene CD18.
Sequence table SEQ ID:6 is the special primer (being the primer of numbering 3 in specification sheets embodiment 1 step 3) of amplification bovine leukocyte adhesion defects gene C D18.
Sequence table SEQ ID:7 is the special primer (being the primer of numbering 4 in specification sheets embodiment 1 step 3) of amplification bovine leukocyte adhesion defects gene C D18.
Fig. 1: be techniqueflow chart of the present invention.
Fig. 2: with blood sample DNA the CD18 gene is carried out the AS-PCR amplification, agarose detects electrophorogram.Sepharose concentration is 2%.The numbering explanation as follows among the figure: 1,2 swimming lane is healthy cows genotype, and the product length of amplification is 818bp; 3 is recessive carrier cows genotype, and the product length of amplification is 818bp and 500bp; M is Marker (2000bp).
Fig. 3: be the purpose fragment of the bovine leukocyte adhesion defects that increases of the present invention, the sequence of underscore is the 818bp fragment and the segmental common area of 500bp of amplification among the figure.The boldface letter that this gene fragment begins with the end is a primer sequence.
Fig. 4: be allelotrope PCR schematic diagram.
Embodiment
Below in conjunction with embodiment and contrast accompanying drawing the present invention is done further explain.
Embodiment 1: bovine leukocyte adhesion defects (BLAD) genotype identification
1, the collection of milk cow blood sample and processing
Get the about 10mL of milk cow blood sample, add EDTA500 μ L (making final concentration the is 25mmol/L) anti-freezing of 0.5mol/L, 4 ℃ of centrifugal (8000rpm) 10min abandon supernatant liquid; Separate white corpuscle, add zero(ppm) water, shake up; Make EF, centrifugal 10min abandons supernatant liquid.After repeating twice, in deposition, add 1 * SET1 mL and 10% sodium lauryl sulphate (SDS, final concentration are 0.5%), slowly add Proteinase K (final concentration is 50～100 μ g/mL) again, place 55 ℃ of water-bath digestion 8～10h, preserve subsequent use in 4 ℃ of refrigerators.
2, from the milk cow blood sample, extract total NDA
(1) gets postdigestive sample, add isopyknic balance phenol (pH 8.0), slowly put upside down centrifuge tube 10min, 4 ℃ of centrifugal (8000rpm) 10min.
(2) the careful supernatant that contains DNA of drawing moves in another centrifuge tube, adds balance phenol once more, repeats aforesaid operations.
(3) add isopyknic balance phenol/chloroform/primary isoamyl alcohol (volume ratio is 25: 24: 1) in the supernatant of drawing, slowly put upside down centrifuge tube 10min, 4 ℃ of centrifugal (8000rpm) 10min.
(4) add isopyknic chloroform/primary isoamyl alcohol (volume ratio is 24: 1) after the absorption supernatant, slowly put upside down centrifuge tube 10min, 4 ℃, the centrifugal 10min of 8000rpm.
(5) draw supernatant, add the absolute ethyl alcohol of 1/10 volume 3mol/L NaAC and 2 times of volumes, rotate centrifuge tube rapidly, the floss of visible white, promptly total DNA places 30min in-20 ℃.
(6) take out sample after freezing,, remove upper strata ethanol, add 70% ethanol 1mL washing precipitation, centrifugal (80000rpm) 5～8min in the centrifugal 5～8min of 10000rpm rotating speed.
(7) add 70% ethanol repeated washing once, centrifugal (80000rpm) 5～8min.
(8) discard ethanol, the residual ethanol of at room temperature volatilizing adds an amount of TE dissolving DNA.
(9) DNA appearance is diluted to certain concentration, deposits in-20 ℃ of refrigerators and preserve subsequent use.
3, design of primers
According to bovine leukocyte adhesion defects gene C D18 sequence (accession number: 281877), utilize biology primer-design software Premier 5, design AS-PCR amplimer.This primer is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
Primer sequence is following:
Mutant (the product length of amplification is 500bp):
Primer 1 (forward primer): 5 ' AAGATGACGAGGAGCAGAA 3 ', (seeing shown in the sequence table SEQ ID NO:4),
Primer 2 (reverse primer): 5 ' GTCCATCAGGTAGTACAGGC 3 ' (seeing shown in the sequence table SEQ ID NO:5); Wild-type (the product length of amplification is 818bp):
Primer 3 (forward primer): 5 ' CAAGGGCTACCCCATCGA 3 ' (seeing shown in the sequence table SEQ ID NO:6),
Primer 4 (reverse primer): 5 ' CAGGACTGCGTGGCTAAA 3 ' (seeing shown in the sequence table SEQ ID NO:7).
4, AS-PCR amplification
PCR reaction TV is 20 μ L (seeing table 1).Amplification program is:: 45s (carrying out 35 circulations from second step, 94 ℃ of sex change to the, four steps 72 extensions) is extended in 94 ℃ of preheating 10min → 94 ℃ sex change 45s → 65 ℃ 45s → 72, and 72 ℃ are extended 10min → 15 ℃ 10min.
Table 1PCR reaction system
The PCR product that 1F/1R and 2F/2R amplify is got 3 μ L respectively and is mixed, and 2% agarose gel electrophoresis (100V, electrophoresis 20min) after ethidium bromide (EB) dyeing, is observed band at gel imaging system.
5, BLAD genotype result judges
Genotype identification result is as shown in Figure 2 for bovine leukocyte adhesion defects (BLAD), in the AS-PCR of gene C D18 product electrophoretogram, if the individual purpose fragment that amplifies is 500bp, then is the homozygote that causes a disease; If the purpose fragment that amplifies is 818bp and 500bp, then is heterozygote, i.e. BLAD disease carrier; If the purpose fragment of amplification is 818bp, then is healthy individuals.
Reference
1.Hagemoser?W?A.Roth?J?A，Lofstedt?J，et?al.Granulocytopathy?in?a?Holstein?heifer.J?Am?V?etM?ed?A?ssoc，1983，183：1093～1094
2.Gerardi?A?S.Bovine?leukocyte?adhesion?deficiency：a?review?of?a?modern?disease?and?its?imp?licat?ions.Res?V?et?Sci，1996，61：183～186.
3.Springer?TA.Adhesion?receptors?of?the?immune?system.Nature，1990，346(4)：425～434.
4.Nagahata?H，Taniyama?H，Izum?isaw?a?Y，et?al.Radiographic?and?immunohistochemical?anylysis?of?leukocyte?adhesion?deficiency?in?Holsteins?heifers.Can?J?V?et?Res，1995，59：316～318.
5.Kishimoto，T.K.，Hollander，N.，Roberts，T.M.，Anderson，D.C.&Springer，T.A.Heterogeneous?mutations?in?the?beta?subunit?common?to?the?LFA-1，Mac-1，and?p150，95glycoproteins?cause?leukocyte?adhesion?deficiency.Cell，1987，50：193-202.
6.Shuster?D?E，KehriliM?E?Jr，Ackermann?M?R，et?al.Ident?ificat?ion?and?prevalence?of?a?genetic?defect?that?causes?leukocyte?adhesion?deficiency?in?Hostein?cattle.Proc?Natl?Acad?Sci，1992，89：9225～9229.
7.Nagahata?H，Saw?ada?C，H?iguch?i?H，et?al.Fcreceptor-mediated?phagocytosis，superoxide?production?and?calcium?signaling?of?beta2?integrin-deficient?bovine?neut?rophils.Microbiol?Immunol，1997，41：747～750.
8.Van?Garderen?E，muller?K?E，Went?ink?G?H，et?al.Post-mortem?findings?in?calves?suffering?from?bovine?leukocyte?adhesion?deficiency(BLAD).V?et?Q，1994，16：24～26.
9. Li Yan is magnificent, Zhang Shengli, Liu Zhenjun etc. the present Research of Chinese holstein cattle complex vertebral malformation and prospect. and Chinese milk cow, 2008, (6): 27-29
Claims (1)
1. the combination of primers that detects of a bovine leukocyte adhesion defects AS-PCR is characterized in that the dna sequence dna of described combination of primers is as follows:
The amplimer of gene C D18:
Mutant: amplified production length is 500bp,
Primer 1, forward primer: 5 ' AAGATGACGAGGAGCAGAA 3 ',
Primer 2, reverse primer: 5 ' GTCCATCAGGTAGTACAGGC 3 ';
Wild-type: amplified production length is 818bp;
Primer 3:5 ' CAAGGGCTACCCCATCGA 3 ',
Primer 4:5 ' CAGGACTGCGTGGCTAAA 3 '.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102256052A CN101899511B (en) | 2010-07-09 | 2010-07-09 | Method for detecting bovine leukocyte adhesion deficiency by applying allele specific polymerase chain reaction (AS-PCR) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102256052A CN101899511B (en) | 2010-07-09 | 2010-07-09 | Method for detecting bovine leukocyte adhesion deficiency by applying allele specific polymerase chain reaction (AS-PCR) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101899511A CN101899511A (en) | 2010-12-01 |
| CN101899511B true CN101899511B (en) | 2012-08-08 |
Family
ID=43225428
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102256052A Expired - Fee Related CN101899511B (en) | 2010-07-09 | 2010-07-09 | Method for detecting bovine leukocyte adhesion deficiency by applying allele specific polymerase chain reaction (AS-PCR) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101899511B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140147842A1 (en) | 2011-01-12 | 2014-05-29 | Sekisui Medical Co. Ltd | Method for detecting single nucleotide polymorphisms |
| CN104946626A (en) | 2011-01-12 | 2015-09-30 | 积水医疗株式会社 | Eluent for ion-exchange chromatography, and method of analyzing nucleic acid chains |
| CN103443274A (en) * | 2011-03-31 | 2013-12-11 | 积水医疗株式会社 | Sample nucleic acid for single nucleotide polymorphism detection purposes, pcr primer for preparing sample for single nucleotide polymorphism detection purposes, and method for preparing sample for single nucleotide polymorphism detection purposes wh |
| CN102888421B (en) * | 2012-06-01 | 2015-08-26 | 中国检验检疫科学研究院 | BLAD CD18 wild-type and the dual-gene type of saltant type (A/G type) heterozygote plasmid and construction process thereof |
| CN103146823A (en) * | 2013-02-27 | 2013-06-12 | 西北农林科技大学 | Method for designing SNP (single-nucleotide polymorphism) molecular marker with base substitution or insertion deletion |
| CN105177136A (en) * | 2015-09-09 | 2015-12-23 | 中国农业大学 | Molecular detection method for screening Holstein BLAD (bovine leukoeyte adhesion defieieney) disease carriers |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1970793A (en) * | 2006-11-30 | 2007-05-30 | 北京奶牛中心 | Method for screening excellent breeding cattle with normal CD18 gene and dedicated primer therefor |
| CN101041862A (en) * | 2007-04-09 | 2007-09-26 | 中国农业大学 | Method for sifting Holstein cow BLAD carrier and special primer and reagent case |
-
2010
- 2010-07-09 CN CN2010102256052A patent/CN101899511B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1970793A (en) * | 2006-11-30 | 2007-05-30 | 北京奶牛中心 | Method for screening excellent breeding cattle with normal CD18 gene and dedicated primer therefor |
| CN101041862A (en) * | 2007-04-09 | 2007-09-26 | 中国农业大学 | Method for sifting Holstein cow BLAD carrier and special primer and reagent case |
Non-Patent Citations (1)
| Title |
|---|
| Poli M.等.PCR screening for carriers of bovine leukocyte adhesion deficiency (BLAD) and uridine monophosphate synthase (DUMPS)in Argentine Holstein cattle.《Veterinary Medicine》.1996,第43卷(第1-10期),第163-168页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101899511A (en) | 2010-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Genetic polymorphism of TLR4 gene and correlation with mastitis in cattle | |
| Koshchaev et al. | Allelic variation of marker genes of hereditary diseases and economically important traits in dairy breeding cattle population | |
| CN101899511B (en) | Method for detecting bovine leukocyte adhesion deficiency by applying allele specific polymerase chain reaction (AS-PCR) | |
| CN110541025B (en) | Detection method, primer composition and kit for Duchenne muscular dystrophy gene defect | |
| Griesbeck-Zilch et al. | Analysis of key molecules of the innate immune system in mammary epithelial cells isolated from marker-assisted and conventionally selected cattle | |
| Schuetz et al. | Implication of complex vertebral malformation and bovine leukocyte adhesion deficiency DNA-based testing on disease frequency in the Holstein population | |
| Verbeke et al. | Pathogen-group specific association between CXCR1 polymorphisms and subclinical mastitis in dairy heifers | |
| Zhang et al. | Whole-genome resequencing from bulked-segregant analysis reveals gene set based association analyses for the Vibrio anguillarum resistance of turbot (Scophthalmus maximus) | |
| Paiva et al. | Incidence of bovine leukocyte adhesion deficiency, complex vertebral malformation, and deficiency of uridine-5-monophosphate synthase carriers in brazilian girolando cattle. | |
| Agung et al. | Myostatin gene analysis in the first generation of the Belgian Blue cattle in Indonesia | |
| CN101705306B (en) | Method for detecting bovine uridine monophosphate synthase deficiency disease by using AS-PCR | |
| CN107022544B (en) | Pig ESR1 gene as molecular marker related to immune traits and application thereof | |
| CN101899526B (en) | Method for selecting molecular marker for goat yeaning traits | |
| Wu et al. | Restriction fragment length polymorphism in the exon 2 of the BoLA-DRB3 gene in Chinese Holstein of the south China | |
| CN102703440A (en) | Goat SH2B1 gene single nucleotide polymorphism loci and detection method thereof | |
| Rahimi et al. | Genotyping BLAD, DUMPS and κ-CSN loci in Holstein young bulls of the national animal breeding center of Iran. | |
| Ibrahim et al. | Sequence-based typing-study on the relationship between subclinical mastitis and BoLA-DRB3. 2* allelic polymorphism in Egyptian cows | |
| Eydivandi et al. | Study of factor XI deficiency in Khuzestan cattle population of Iran | |
| CN101130822B (en) | Specificity amplification primer for detecting cattle CVM carrier | |
| JP5897704B2 (en) | Detection of Brachyspina mutation | |
| US10770183B2 (en) | Methods of assessing a risk of developing necrotizing meningoencephalitis | |
| CN102776288A (en) | Kit for detecting 15bp insertion mutation in ninth exon of bovine coagulation factor XI gene | |
| CN105420402B (en) | A kind of and the relevant molecular labeling of milk cow somatic cell score and its application | |
| HM et al. | Genetic polymorphism of CD18 gene in Karan Fries young bull calves using PCR-RFLP analysis | |
| Siswanti et al. | Detection of factor XI deficiency (FXID) and complex vertebral malformation (CVM) in Bali cattle |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120808 Termination date: 20180709 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |