CN101899424A - Protein related to synthesis of mono-vinyl chlorophyll a and coding gene thereof - Google Patents
Protein related to synthesis of mono-vinyl chlorophyll a and coding gene thereof Download PDFInfo
- Publication number
- CN101899424A CN101899424A CN2009102383820A CN200910238382A CN101899424A CN 101899424 A CN101899424 A CN 101899424A CN 2009102383820 A CN2009102383820 A CN 2009102383820A CN 200910238382 A CN200910238382 A CN 200910238382A CN 101899424 A CN101899424 A CN 101899424A
- Authority
- CN
- China
- Prior art keywords
- chlorophyll
- sequence
- gene
- ala
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a protein related to synthesis of mono-vinyl chlorophyll a and a coding gene thereof. The protein related to the synthesis of the mono-vinyl chlorophyll a is a protein as the following 1) or 2): 1) a protein composed of an amino acid sequence shown in a sequence 2 of a sequence table; and 2) a protein derived from 1), related to the synthesis of mono-vinyl chlorophyll a, and obtained by substituting and/or deleting and/or adding one or more amino acid residues in an amino acid residue sequence of the sequence 2 in the sequence table. Experiments prove that the protein provided by the invention can convert divinyl chlorophyll a into the mono-vinyl chlorophyll a.
Description
Technical field
The present invention relates to biological technical field, particularly a kind of and single ethene chlorophyll a synthesizes relevant albumen and encoding gene thereof.
Background technology
Chlorophyll is that plant carries out photosynthetic important pigment, and its effect is to catch luminous energy and luminous energy is transferred to reactive center, and growth and the output thereof of plant is played a very important role.According to the difference of ethylene lateral chain number, chlorophyll can be divided into 3,8-divinyl chlorophyll (DV Chls) and 3-ethene chlorophyll (single ethene chlorophyll, MV Chls).Under normal circumstances, it all is MV chls that nearly all plant and bacterium are used for photosynthetic chlorophyll, that only find i.e. " the marine prochlorophyte Prochlorococcus marinus " utilization of class marine organisms at present is DV Chls (Chisholm SW, Frankel SL, Goericke R, Olson RJ, Palenik B, Waterbury JB, West-Johnsrud L, Zettler ER (1992) Prochlorococcus marinus nov.gen.nov.sp.:A marine prokaryote containing divinylchlorophyll a and b.Arch.Microbiol.157:297-300).
The biosynthetic diversity of chlorophyll is that it is single ethene chlorophyll (MV Chls) and the parallel approach of divinyl chlorophyll (DV Chls) synthetic, DV Chls and intermediate product thereof are catalytically converted into MV Chls and intermediate product (Rebeiz CA thereof by C-8 vinyl reductase enzyme, Kolossov VL, Briskin D, GawienowskiM (2003) Chloroplast biogenesis:chlorophyll biosynthetic heterogeneity, multiple biosynthetic routes, and biological spin-offs, in:Nalwa HS (Ed.), Handbook of Photochemistry and Photobiology, vol.4, American Scientific, Los Angeles:183-248).Up to now, five kinds of chlorophyllous intermediate products of divinyl have been detected, be respectively divinyl Mg-protoporphyrin IX (DV Mg-proto), divinyl Mg-protoporphyrin monomethyl ester (DV Mg-Proto monomethyl ester), (DV Pchlide a) for divinyl protochlorophyllide a, divinyl chlorophyllide a (DV Chlide a) and the divinyl chlorophyll a (DV Chl is (Kolossov VL a), Bohnert HJ, Rebeiz CA (2006) Chloroplast biogenesis 92:In situ screening for divinyl chlorophyll (ide) a reductase mutants by spectrofluorometry Analytical Biochemistry 348:192-197).At present unclear is that these divinyl intermediate materials are to have extensive specific C-8 vinyl reductase enzyme catalysis or generate corresponding single ethene intermediate material (Rebeiz CA by a plurality of C-8 vinyl reductase enzymes (each enzyme all has specific substrate) catalysis by one, Kolossov VL, Briskin D, Gawienowski M (2003) Chloroplast biogenesis:chlorophyll biosynthetic heterogeneity, multiple biosynthetic routes, and biological spin-offs, in:Nalwa HS (Ed.), Handbook of Photochemistry and Photobiology, vol.4, American Scientific, Los Angeles:183-248).Corresponding C-8 vinyl reductase gene DVR, bciA and slr1923 (Nagata N now from Arabidopis thaliana, green sulphur bacteria Chlorobium tepidum and cyanobacteria Synechocystis sp.PCC6803, have been cloned respectively, Tanaka R, Satoh S, Tanaka A (2005) Identification of a vinyl reductase gene for chlorophyll synthesis in Arabidopsis thaliana and implications for the evolution of Prochlorococcus Species.PlantCell 17:233-240; Chew AGM, Bryant DA (2007) Characterization of a Plant-likeProtochlorophyllide a Divinyl Reductase in Green Sulfur Bacteria.J Biol Chem 282:2967-2975; Islam MR, Aikawa S, Midorikawa T, Kashino Y, Satoh K, KoikeH (2008) slr1923 of Synechocystis sp.PCC6803 is essential for conversion of 3,8-divinyl (proto) chlorophyll (ide) to 3-monovinyl (proto) chlorophyll (ide) .Plant Physiology 148:1068-1081).Existing experimental results show that: use NADPH as reductive agent, the green sulphur bacteria Chlorobium tepidum BciA protein of reorganization is reduced into MV Pchlide a (Chew AGM, Bryant DA (2007) Characterization of a Plant-like Protochlorophyllide a DivinylReductase in Green Sulfur Bacteria.J Biol Chem 282:2967-2975) with DV Pchlide a; The Arabidopis thaliana DVR protein of reorganization is reduced into MV Chlide a with DV Chlide a, but 4 kinds of DV materials such as DV Pchlide a, DV Chlide b, DV Chl a, DV Chl b can not be converted into corresponding M V material (Nagata N, Tanaka R, Tanaka A (2007) The major route for chlorophyll synthesis includes[3,8-divinyl]-chlorophyllide a reduction in Arabidopsis thaliana.Plant Cell Physiol 48:1803-1808).Up to now, comprise in the monocotyledons of paddy rice and also do not clone divinyl reductase enzyme (being C-8 vinyl reductase enzyme) gene.
Summary of the invention
The object of the present invention is to provide a kind of and single ethene chlorophyll a to synthesize relevant albumen, derive from paddy rice (Oryza sativa L.).
Provided by the invention and single ethene chlorophyll a synthesizes relevant albumen, is following 1) or 2) protein:
1) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 2;
2) with the amino acid residue sequence of sequence in the sequence table 2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and synthetic relevant with single ethene chlorophyll a by 1) deutero-protein.
Above-mentioned proteic encoding gene also belongs within protection scope of the present invention.
The synthetic relevant proteic encoding gene of above-mentioned and single ethene chlorophyll a is following 1)-4) in arbitrary described gene:
1) its encoding sequence be in the sequence table sequence 1 from 5 ' terminal the 9th to 1226 deoxyribonucleotides;
2) its nucleotide sequence is the sequence 1 in the sequence table;
3) under stringent condition with 1) or 2) gene recombination and the dna molecular of encoding said proteins;
4) with 1) or 2) gene have the homology more than 90% and the dna molecular of encoding said proteins.
The recombinant vectors, transgenic cell line or the reorganization bacterium that contain said gene also belong within protection scope of the present invention.
Above-mentioned recombinant vectors is specifically as follows and inserts the recombinant expression vector that said gene obtains between the multiple clone site of pET30.
The total length of amplification said gene or its arbitrary segmental primer are to also belonging within protection scope of the present invention.
Above-mentioned albumen or above-mentioned gene are that application in single ethene chlorophyll a also belongs within protection scope of the present invention transforming the divinyl chlorophyll a.
Experimental results show that: albumen provided by the invention can be converted into the divinyl chlorophyll a single ethene chlorophyll a.
Description of drawings
Fig. 1 is the field plant photo of rice mutant 824ys and wild-type parent 824B, A, seedling phase wild-type (left side) and 824ys mutant (right side) plant phenotype, B, productive phase wild-type (left side) and 824ys mutant (right side) plant phenotype.
Fig. 2 detects rice mutant 824ys and the chlorophyll retention time (left side) of wild-type parent 824B (WT) and the difference of absorption peak (right side) for HPLC.
Fig. 3 is that the HPLC of OsDVR zymetology reaction product detects spectrogram, and wherein the left side is a retention time, and the right is an absorption peak; Be followed successively by from top to bottom: A1 is normal single ethene chlorophyll a (MV Chla) of separating from wild-type parent 824B chlorophyll; A2 is the divinyl chlorophyll a of separating from mutant 824ys chlorophyll (DV Chla); A3 is DV Chla and the reacted pigment of BL21/pET30 empty carrier; A4 is DV Chla and the reacted pigment of BL21/pET30-Osdvr expressed protein; A5 is DV Chla and the reacted pigment of BL21/pET30-OsDVR expressed protein.
Embodiment
The invention will be further described below in conjunction with specific embodiment, but the present invention is not limited to following examples.
Among the following embodiment, if no special instructions, be ordinary method.
It is of the present invention that to finish the genetic resources that is relied on as follows:
Long-grained nonglutinous rice strain 824B in August, 2004, is cultivated voluntarily by Sichuan Agricultural University, and cultivating used male parent is the fragrant 1B of D, and female parent is ridge 46B.The non-patent literature of putting down in writing this long-grained nonglutinous rice strain 824B is: Huang Xiaoqun, Wang Pingrong, Zhao Haixin, Deng Xiaojian. the genetic analysis of a new rice chlorophyll deletion mutantion gene and molecule marker location. and rice in China science, 2007,21 (4): 355-359).
Other material that the present invention relates to is as follows:
Mutant 824ys, the non-patent literature of putting down in writing this material be (Huang Xiaoqun, Wang Pingrong, Zhao Haixin, Deng Xiaojian. the genetic analysis of a new rice chlorophyll deletion mutantion gene and molecule marker location. rice in China science, 2007,21 (4): 355-359).
LB/kan substratum (liquid), its composition is: Tryptones (Tryptone) 10g, yeast extract (YeastExtract) 5g, sodium-chlor (NaCl) 5g, agar powder (Agar power) 15g, PH 7.0, be settled to 1L, when the sterilization postcooling arrives about 50 ℃, add kantlex (Kan) 50mg, make the LB/kan substratum; Do not add agar powder in the above-mentioned composition and then make the LB/kan nutrient solution.
The clone and the checking thereof of embodiment 1, paddy rice divinyl chlorophyll a reductase gene
One, the clone of paddy rice divinyl chlorophyll a reductase gene
1, the discovery of gene
The inventor has separated a spontaneous mutant 824ys (Fig. 1) in paddy rice (product are " 824B "), this mutant shows yellowish green blade profile in the whole growth phase, chlorophyll content reduces, and chloroplast(id) is grown and is suppressed, and plant-growth is slow, the significantly minimizing of tillering waits (Huang Xiaoqun, Wang Pingrong, Zhao Haixin, Deng Xiaojian. the genetic analysis of a new rice chlorophyll deletion mutantion gene and molecule marker location. the rice in China science, 2007,21 (4): 355-359).Genetic analysis finds that this mutant is controlled by a pair of recessive nuclear gene.By the map based cloning method, identified one with Arabidopis thaliana divinyl chlorophyllide a (DV Chlide is reductase gene (DVR) homologous gene Os03g22780 a), called after OsDVR.OsDVR is positioned on paddy rice the 3rd the short arm of a chromosome, its nucleotide sequence is shown in sequence table sequence 1, its open reading frame (ORF) is that (sequence 1 is totally 1241 bases from 5 ' the 9th to 1226 at end, the 9-1226 position of open reading frame in sequence 1, wherein the 9-11 position is an initiator codon, and the 1224-1226 position is a terminator codon).ORF is made up of 1218 Nucleotide, the albumen shown in the sequence 2 in the code sequence tabulation, and sequence 2 is made up of 405 amino acid, and molecular weight is about 43kD.By http://www.cbs.dtu.dk/services/TargetP/ prediction, its amino acids coding contains 58 amino acid whose chloroplast(id) target sequences at N-terminal, shows that this protein is positioned on the chloroplast(id).The open reading frame of this gene in the 824ys mutant (ORF) has 9 nucleotide deletions, also be sequence 1 from 5 ' end the 960th to 968 disappearances, cause 3 amino acid whose disappearances.
2, the clone of paddy rice divinyl chlorophyll a reductase gene
Synthetic following primer is right:
P1:5 ' CA
GGATCCATGGCTGCCCTCCTCCTCT 3 ' (underscore is a BamH I restriction enzyme site)
P2:5 ' GAA
GAATTCCGAGGCCTAGAAGATGGT 3 ' (underscore is an EcoR I restriction enzyme site)
The DNA that extracts with the blade of normal green rice long-grained nonglutinous rice strain 824B is a template, carry out pcr amplification with primer P1 and P2, obtain the fragment of 1241bp, this fragment is connected on pMD-18-T (TaKaRa) carrier, be built into pMD-OsDVR, be transformed into then in the e. coli jm109 bacterial strain, check order behind the screening positive clone.Sequencing result shows: the fragment that amplification obtains has the sequence shown in the sequence 1 in the sequence table, and its open reading frame is the 9th to the 1226th.The divinyl reductase gene DVR homology of this gene and Arabidopis thaliana is found in the sequence alignment analysis, therefore this fragment called after OsDVR that will check order.
In addition, the DNA that extracts from the blade of paddy rice 824ys mutant is a template, carry out pcr amplification with primer P1 and P2, obtain the fragment of 1232bp, this fragment is connected on the pMD-18-T carrier, be built into pMD-Osdvr, be transformed into then in the e. coli jm109 bacterial strain, check order behind the screening positive clone.Sequencing result shows: fragment the 960th to 968 of sequence shown in the sequence 1 in sequence table that amplification obtains lacked 9 Nucleotide, with this fragment called after Osdvr that checked order.
3, the chlorophyll HPLC of long-grained nonglutinous rice strain 824B and mutant 824ys analyzes
Because the divinyl reductase gene DVR homology of this gene OsDVR and Arabidopis thaliana, according to document (NagataN, Tanaka R, Satoh S, Tanaka A (2005) Identification of a vinyl reductase gene forchlorophyll synthesis in Arabidopsis thaliana and implications for the evolution ofProchlorococcus Species.Plant Cell 17:233-240) knows, if the inline ethylene reductase disappearance of plant materials, the biosynthetic final product of plant inner chlorophyll should be a divinyl chlorophyll so.Caused the 824ys mutation type surface in order further to be confirmed to be the OsDVR transgenation, the present invention has carried out the HPLC detection to the chlorophyll of wild-type rice strain 824B and mutant 824ys.
At first use the chlorophyll in 100% acetone extraction wild-type long-grained nonglutinous rice strain 824B and the mutant 824ys blade, with HPLC two kinds of chlorophyll are analyzed respectively then, the HPLC testing conditions is a moving phase: methyl alcohol: acetonitrile: acetone=1: 3: 1,40 ℃, 1ml/min, applied sample amount 5 μ l (4.6mm i.d. * 150mm long; C18,5 μ m, Agilent), the pigment of the wash-out wavelength monitoring of 660nm in the post.
The result as shown in Figure 2, the retention time of wash-out mutant chlorophyll a has shifted to an earlier date about 18 seconds than wild-type 824B, absorption peak red shift 10nm, the absorption peak of wild-type chlorophyll a are 430nm and 664nm, mutant is 440nm and 664nm; The retention time of wash-out chlorophyll b and wild-type 824B are basic identical, but variation has also taken place in absorption peak, the absorption peak of wild-type chlorophyll b is 462nm and 648nm, mutant is 472nm and 652nm, the chlorophyll that shows mutant is divinyl chlorophyll a and divinyl chlorophyll b (Shedbalkar VP, Rebeiz CA (1992) Chloroplast biogenesis:Determination of the molar extinction coefficients ofdivinyl chlorophyll a and b and their pheophytins.Anal Biochem 207:261-266; Nakanishi H, Nozue H, Suzuki K, Kaneko Y, Taguchi G, Hayashida N (2005) Characterization of the Arabidopsis thaliana mutant pcb2 whichaccumulates divinylchlorophylls.Plant Cell Physiol 46:467-473; Nagata N, Tanaka R, Satoh S, Tanaka A (2005) Identification of a vinyl reductase gene for chlorophyll synthesis in Arabidopsisthaliana and implications for the evolution of Prochlorococcus Species.Plant Cell17:233-240), simultaneously illustrate that also sudden change has taken place the divinyl reductase enzyme in the mutant, vinyl can not be reduced to ethyl, thereby can not generate normal single ethene chlorophyll.
The chlorophyll a of sample and the retention time of b and absorbing wavelength are that retention time and the absorbing wavelength of according to standard sample chlorophyll a and b is determined, and standard model chlorophyll a and b are available from Sigma company.
Two, the functional verification of paddy rice divinyl chlorophyll a reductase gene encoded protein
1, the structure of recombinant vectors
PMD-OsDVR that empirical tests in the step 2 of step 1 is correct and pMD-Osdvr are connected on the expression vector pET30 (Novagen) that same enzyme was cut with BamHI and EcoRI double digestion, constitute recombinant expression vector pET30-OsDVR and pET30-Osdvr.With recombinant expression vector pET30-OsDVR and pET30-Osdvr transformed into escherichia coli bacterial strain BL21, at 37 ℃, incubated overnight on the LB/kan substratum, select mono-clonal in 37 ℃, shaking culture in the LB/kan nutrient solution, extract plasmid DNA (OMEGA test kit), with BamHI and EcoRI double digestion, agarose gel electrophoresis detects OsDVR and whether the Osdvr gene inserts among the carrier pET30, the clone who detection is contained the recombinant expression vector of OsDVR and Osdvr gene serves the order-checking of Hai Yingjun company, the clone of the OsDVR of the correct insertion of screening pET30 and the recombinant expression vector of Osdvr gene, called after BL21/pET30-OsDVR and BL21/pET30-Osdvr.
2, abduction delivering
Reference literature (Nagata N, Tanaka R, Satoh S, Tanaka A (2005) Identification ofa vinyl reductase gene for chlorophyll synthesis in Arabidopsis thaliana and implications for the evolution of Prochlorococcus Species.Plant Cell 17:233-240; Nagata N, Tanaka R, Tanaka A (2007) The major route for chlorophyll synthesis includes[3,8-divinyl]-chlorophyllide a reduction in Arabidopsis thaliana.Plant Cell Physiol 48:1803-1808) method BL21/pET30-OsDVR and BL21/pET30-Osdvr are carried out abduction delivering, concrete grammar is as follows: select BL21/pET30-OsDVR respectively, BL21/pET30-Osdvr and BL21 (the empty carrier contrast CK) mono-clonal that contains empty carrier pET30 are in 20 ℃, shaking culture is spent the night in the LB/kan nutrient solution, get 1ml bacterium liquid respectively in 100ml LB/kan nutrient solution, add IPTG (final concentration is 0.5mM) behind 30 ℃ of shaking culture 30min, in 30 ℃ of inducing culture 7h, 4 ℃ of centrifugal 10min of 10000rpm, precipitation is with containing 6.7ug ml
-1N,O-Diacetylmuramidase and 3.3ug ml
-1The solution of the 50mM Tris-HCl of DNaseI enzyme suspends, and lysate is put into-20 ℃ of refrigerators and preserved.
Detect expressed protein with the SDD-polyacrylamide gel electrophoresis.The result is presented at about 43KD place, BL21/pET30-OsDVR and BL21/pET30-Osdvr all have tangible protein, and contrast empty carrier CK does not have, and illustrates that OsDVR and Osdvr gene expressed protein in BL21, and being consistent of proteinic molecular weight and supposition.
3, enzymatic reaction checking protein function
With BL21/pET30-OsDVR expressed proteins, mutant contrast (pET30-Osdvr expressed proteins) and empty carrier contrast respectively with the divinyl chlorophyll a in reaction buffer 30 ℃ react 10min, use the acetone termination reaction then, change in the ether, dry up through nitrogen, be dissolved in acetone again, detect with HPLC at last, moving phase: methyl alcohol: acetonitrile: acetone=1: 3: 1,40 ℃, 1ml/min, sample size 5ul (4.6mm i.d. * 150mm long; C185um, Agilent) (Nagata N, Tanaka R, Tanaka A (2007) The major route for chlorophyllsynthesis includes[3,8-divinyl]-chlorophyllide a reduction in Arabidopsis thaliana.PlantCell Physiol 48:1803-1808), the pigment of the wash-out wavelength monitoring of 660nm in the post.
Wherein, reaction substrate divinyl chlorophyll a is to separate by HPLC from the chlorophyll of paddy rice 824ys mutant.Separation method is the step 3 with reference to step 1, at first use the chlorophyll in the 100% acetone extraction mutant 824ys blade, with HPLC its chlorophyll is separated then, the HPLC testing conditions is a moving phase: methyl alcohol: acetonitrile: acetone=1: 3: 1,40 ℃, 1ml/min, applied sample amount 5 μ l (4.6mm i.d. * 150mm long; C18,5 μ m, Agilent), the pigment of the wash-out wavelength monitoring of 660nm in the post.As shown in Figure 2, the retention time of wash-out mutant divinyl chlorophyll a contrasts (available from Sigma company than normal single ethene chlorophyll a, or by with quadrat method from the blade of normal green rice kind lixiviate with separate) shifted to an earlier date about 18 seconds, (absorption peak of normal single ethene chlorophyll a contrast is 430nm and 664nm to absorption peak red shift 10nm, and mutant divinyl chlorophyll a is 440nm and 664nm), collect the divinyl chlorophyll a in corresponding retention time.
The result as shown in Figure 3, after divinyl chlorophyll a (DV Chla) and the qualitative response of BL21/pET30-OsDVR expressed proteins, the retention time and the absorption peak of a wherein big pigment change, identical with single ethene chlorophyll a (MV Chla) (referring to the A5 among Fig. 3) becomes, and after DV Chla and the qualitative response of BL21/pET30-Osdvr expressed proteins, or with BL21/pET30 empty carrier reaction after, the retention time of its pigment is all the same with DVChla with absorption peak, (respectively referring to A4 among Fig. 3 and A3) do not change, show that the BL21/pET30-OsDVR expressed protein is converted into single ethene chlorophyll a with the divinyl chlorophyll a, can not to transform the divinyl chlorophyll a be single ethene chlorophyll a and mutant contrast and empty carrier contrast.This proof 824ys mutant is that the sudden change by the OsDVR gene is caused, the OsDVR genes encoding has the divinyl chlorophyll a reductase enzyme OsDVR of function, and the present invention confirms that first it is single ethene chlorophyll a (being normal chlorophyll a) that divinyl chlorophyll a reductase enzyme transforms the divinyl chlorophyll a.
Sequence table
＜110〉Sichuan Agricultural University
＜120〉synthetic relevant albumen and the encoding gene thereof of a kind of and single ethene chlorophyll a
<160>2
<210>1
<211>1241
<212>DNA
＜213〉paddy rice (Oryza sativa L.)
<400>1
caggatccat?ggctgccctc?ctcctctcct?cccacctcac?cgccgcctcc?tcatcctcca 60
ccacgtcccc?cactgctcga?ccggcgccaa?gcttcgtctc?cttccgcgcc?gccaacgccg 120
cccctaaggg?tgcccgtcgg?ggttggcctt?tccttgcttc?gtcggtagag?ccaccgcctg 180
ctgcgtcggc?ggcgcagccg?ttccggtcac?tggcgccgtc?ggagaccacc?gtgctggtca 240
cgggcgccac?gggctacatc?gggcgttatg?tcgtccgcga?gctcctccgc?cgcggccacc 300
ccgtggtcgc?cgtggcgcgc?ccccggagcg?ggctgcgcgg?ccgcaacggc?cccgacgagg 360
tcgtcgcgga?cctcgccccc?gcccgcgtcg?tcttctccga?cgtcaccgac?gcgggcgcgc 420
tccgcgccga?cctgtcgccg?cacggcccca?tccacgccgc?ggtgtgctgc?ctcgccagcc 480
gcggcggcgg?cgtgcgggac?tcgtggcgcg?tggactaccg?cgccacgctg?cacaccctcc 540
aggcggcgcg?cggcctcggc?gccgcgcact?tcgtcctcct?ctccgccgtc?tgcgtccaga 600
agccgctcct?cgagttccag?cgcgccaagc?tcaggttcga?gggcgagctc?gccgccgagg 660
cgtcgcgcga?cccgtccttc?acctacagca?tcgtccgccc?caccgccttc?ttcaagagcc 720
tgggcggcca?ggtcgagacc?gtcaagaacg?gccagcccta?cgtcatgttc?ggcgacggga 780
agctctgcgc?ctgcaagccc?atcagcgagg?aggacctcgc?cgcgttcatc?gccgactgca 840
tctccgacga?gggcaaggcc?aacaagatcc?tccccatcgg?cgggccgggg?aaggcgctga 900
cgccgctgga?gcaaggggag?atgctgttcc?ggctgctggg?gcgcgagccc?aggttcatca 960
aggtgccgat?ccaggtcatg?gacgccgcca?tctgggtgct?cgacgcgctg?gccaaggtgt 1020
tccccggggt?ggaggacgcg?gcggagttcg?gcaagatcgg?gaggtactac?gcgtcggaga 1080
gcatgctggt?gctcgacccg?gacaccggcg?agtacagcga?cgagatgacg?cccagctacg 1140
gcagcgacac?gctcgagcag?ttcttcgaga?gggtgatcag?ggaaggcatg?gcagggcagg 1200
agctcggcga?gcagaccatc?ttctaggcct?cggaattctt?c 1241
<210>2
<211>405
<212>PRT
＜213〉paddy rice (Oryza sativa L.)
<400>2
Met?Ala?Ala?Leu?Leu?Leu?Ser?Ser?His?Leu?Thr?Ala?Ala?Ser?Ser?Ser
1 5 10 15
Ser?Thr?Thr?Ser?Pro?Thr?Ala?Arg?Pro?Ala?Pro?Ser?Phe?Val?Ser?Phe
20 25 30
Arg?Ala?Ala?Asn?Ala?Ala?Pro?Lys?Gly?Ala?Arg?Arg?Gly?Trp?Pro?Phe
35 40 45
Leu?Ala?Ser?Ser?Val?Glu?Pro?Pro?Pro?Ala?Ala?Ser?Ala?Ala?Gln?Pro
50 55 60
Phe?Arg?Ser?Leu?Ala?Pro?Ser?Glu?Thr?Thr?Val?Leu?Val?Thr?Gly?Ala
65 70 75 80
Thr?Gly?Tyr?Ile?Gly?Arg?Tyr?Val?Val?Arg?Glu?Leu?Leu?Arg?Arg?Gly
85 90 95
His?Pro?Val?Val?Ala?Val?Ala?Arg?Pro?Arg?Ser?Gly?Leu?Arg?Gly?Arg
100 105 110
Asn?Gly?Pro?Asp?Glu?Val?Val?Ala?Asp?Leu?Ala?Pro?Ala?Arg?Val?Val
115 120 125
Phe?Ser?Asp?Val?Thr?Asp?Ala?Gly?Ala?Leu?Arg?Ala?Asp?Leu?Ser?Pro
130 135 140
His?Gly?Pro?Ile?His?Ala?Ala?Val?Cys?Cys?Leu?Ala?Ser?Arg?Gly?Gly
145 150 155 160
Gly?Val?Arg?Asp?Ser?Trp?Arg?Val?Asp?Tyr?Arg?Ala?Thr?Leu?His?Thr
165 170 175
Leu?Gln?Ala?Ala?Arg?Gly?Leu?Gly?Ala?Ala?His?Phe?Val?Leu?Leu?Ser
180 185 190
Ala?Val?Cys?Val?Gln?Lys?Pro?Leu?Leu?Glu?Phe?Gln?Arg?Ala?Lys?Leu
195 200 205
Arg?Phe?Glu?Gly?Glu?Leu?Ala?Ala?Glu?Ala?Ser?Arg?Asp?Pro?Ser?Phe
210 215 220
Thr?Tyr?Ser?Ile?Val?Arg?Pro?Thr?Ala?Phe?Phe?Lys?Ser?Leu?Gly?Gly
225 230 235 240
Gln?Val?Glu?Thr?Val?Lys?Asn?Gly?Gln?Pro?Tyr?Val?Met?Phe?Gly?Asp
245 250 255
Gly?Lys?Leu?Cys?Ala?Cys?Lys?Pro?Ile?Ser?Glu?Glu?Asp?Leu?Ala?Ala
260 265 270
Phe?Ile?Ala?Asp?Cys?Ile?Ser?Asp?Glu?Gly?Lys?Ala?Asn?Lys?Ile?Leu
275 280 285
Pro?Ile?Gly?Gly?Pro?Gly?Lys?Ala?Leu?Thr?Pro?Leu?Glu?Gln?Gly?Glu
290 295 300
Met?Leu?Phe?Arg?Leu?Leu?Gly?Arg?Glu?Pro?Arg?Phe?Ile?Lys?Val?Pro
305 310 315 320
Ile?Gln?Val?Met?Asp?Ala?Ala?Ile?Trp?Val?Leu?Asp?Ala?Leu?Ala?Lys
325 330 335
Val?Phe?Pro?Gly?Val?Glu?Asp?Ala?Ala?Glu?Phe?Gly?Lys?Ile?Gly?Arg
340 345 350
Tyr?Tyr?Ala?Ser?Glu?Ser?Met?Leu?Val?Leu?Asp?Pro?Asp?Thr?Gly?Glu
355 360 365
Tyr?Ser?Asp?Glu?Met?Thr?Pro?Ser?Tyr?Gly?Ser?Asp?Thr?Leu?Glu?Gln
370 375 380
Phe?Phe?Glu?Arg?Val?Ile?Arg?Glu?Gly?Met?Ala?Gly?Gln?Glu?Leu?Gly
385 390 395 400
Glu?Gln?Thr?Ile?Phe
405
Claims (7)
1. an albumen is following 1) or 2) protein:
1) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 2;
2) with the amino acid residue sequence of sequence in the sequence table 2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and synthetic relevant with single ethene chlorophyll a by 1) deutero-protein.
2. the described proteic encoding gene of claim 1.
3. encoding gene according to claim 2 is characterized in that: described proteic encoding gene is following 1)-4) in arbitrary described gene:
1) its encoding sequence be in the sequence table sequence 1 from 5 ' terminal the 9th to 1226 deoxyribonucleotide;
2) its nucleotide sequence is the sequence 1 in the sequence table;
3) under stringent condition with 1) or 2) gene recombination and the described proteic dna molecular of coding claim 1;
4) with 1) or 2) gene have the homology 90% or more and the described proteic dna molecular of claim 1 of encoding.
4. the recombinant vectors, transgenic cell line or the reorganization bacterium that contain claim 2 or 3 described genes.
5. recombinant vectors according to claim 4 is characterized in that: described recombinant vectors is for inserting the recombinant expression vector that claim 2 or 3 described genes obtain between the multiple clone site of pET30.
6. total length or its arbitrary segmental primer of amplification claim 2 or 3 described genes are right.
7. the described albumen of claim 1, claim 2 or 3 described genes are application in single ethene chlorophyll a transforming the divinyl chlorophyll a.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102383820A CN101899424B (en) | 2009-12-03 | 2009-12-03 | Protein related to synthesis of mono-vinyl chlorophyll a and coding gene thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102383820A CN101899424B (en) | 2009-12-03 | 2009-12-03 | Protein related to synthesis of mono-vinyl chlorophyll a and coding gene thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101899424A true CN101899424A (en) | 2010-12-01 |
| CN101899424B CN101899424B (en) | 2012-01-04 |
Family
ID=43225345
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009102383820A Expired - Fee Related CN101899424B (en) | 2009-12-03 | 2009-12-03 | Protein related to synthesis of mono-vinyl chlorophyll a and coding gene thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101899424B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517263A (en) * | 2011-12-20 | 2012-06-27 | 四川农业大学 | Divinyl reductase from Cucumis sativus L. and application thereof |
| CN102517262A (en) * | 2011-12-20 | 2012-06-27 | 四川农业大学 | Divinyl reductase from corn and coding gene and application thereof |
-
2009
- 2009-12-03 CN CN2009102383820A patent/CN101899424B/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517263A (en) * | 2011-12-20 | 2012-06-27 | 四川农业大学 | Divinyl reductase from Cucumis sativus L. and application thereof |
| CN102517262A (en) * | 2011-12-20 | 2012-06-27 | 四川农业大学 | Divinyl reductase from corn and coding gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101899424B (en) | 2012-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Divinyl chlorophyll (ide) a can be converted to monovinyl chlorophyll (ide) a by a divinyl reductase in rice | |
| Fabre et al. | Characterization and expression analysis of genes encoding α and β carbonic anhydrases in Arabidopsis | |
| Yu et al. | Downregulation of chloroplast RPS1 negatively modulates nuclear heat-responsive expression of HsfA2 and its target genes in Arabidopsis | |
| Hajheidari et al. | Proteome analysis of sugar beet leaves under drought stress | |
| Kieselbach et al. | The proteome of the chloroplast lumen of higher plants | |
| Takabayashi et al. | Three novel subunits of Arabidopsis chloroplastic NAD (P) H dehydrogenase identified by bioinformatic and reverse genetic approaches | |
| Doyle et al. | An α‐amylase (At4g25000) in Arabidopsis leaves is secreted and induced by biotic and abiotic stress | |
| Nikghalb et al. | Expanding the scope of Sortase‐mediated ligations by using Sortase homologues | |
| Frendo et al. | Localisation of glutathione and homoglutathione in Medicago truncatula is correlated to a differential expression of genes involved in their synthesis | |
| CN102317312A (en) | Plants having enhanced yield-related traits and/or abiotic stress tolerance and a method for making the same | |
| CA2236267A1 (en) | Plant vde genes and methods related thereto | |
| WO1997017447A9 (en) | Plant vde genes and methods related thereto | |
| CN101899424B (en) | Protein related to synthesis of mono-vinyl chlorophyll a and coding gene thereof | |
| US8546648B2 (en) | Rubisco activase with increased thermostability and methods of use thereof | |
| Yu et al. | Genome-wide identification of genes encoding putative secreted E3 ubiquitin ligases and functional characterization of PbRING1 in the biotrophic protist Plasmodiophora brassicae | |
| Li et al. | Regulation of nitrogen starvation responses by the alarmone (p) ppGpp in rice | |
| Zhang et al. | Distinct photorespiratory reactions are preferentially catalyzed by glutamate: glyoxylate and serine: glyoxylate aminotransferases in rice | |
| Strašková et al. | Isolation of the cyanobacterial YFP-tagged photosystem I using GFP-Trap® | |
| Hara et al. | Characterization of two genes, Sig1 and Sig2, encoding distinct plastid σ factors in the moss Physcomitrella patens: phylogenetic relationships to plastid σ factors in higher plants | |
| Castro‐Rodríguez et al. | Medicago truncatula Yellow Stripe‐like7 encodes a peptide transporter participating in symbiotic nitrogen fixation | |
| CA2567983A1 (en) | Nucleotide sequences and polypeptides encoded thereby useful for modifying plant characteristics | |
| Ostersetzer et al. | Immunological detection of proteins similar to bacterial proteases in higher plant chloroplasts | |
| Rinalducci et al. | De novo sequence analysis and intact mass measurements for characterization of phycocyanin subunit isoforms from the blue‐green alga Aphanizomenon flos‐aquae | |
| Bolte et al. | Complementation of a phycocyanin-bilin lyase from Synechocystis sp. PCC 6803 with a nucleomorph-encoded open reading frame from the cryptophyte Guillardia theta | |
| Noda et al. | ATL54, a ubiquitin ligase gene related to secondary cell wall formation, is transcriptionally regulated by MYB46 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120104 Termination date: 20171203 |