CN101899396A - A kind of composite microbial system of the glucosinolate of degrading and application thereof - Google Patents
A kind of composite microbial system of the glucosinolate of degrading and application thereof Download PDFInfo
- Publication number
- CN101899396A CN101899396A CN2010101847055A CN201010184705A CN101899396A CN 101899396 A CN101899396 A CN 101899396A CN 2010101847055 A CN2010101847055 A CN 2010101847055A CN 201010184705 A CN201010184705 A CN 201010184705A CN 101899396 A CN101899396 A CN 101899396A
- Authority
- CN
- China
- Prior art keywords
- lichtheimia
- microbial system
- composite microbial
- strain
- rapeseed meal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses the composite microbial system of a kind of degraded glucosinolate (be called for short sulphur glucoside), this composite microbial system is by two strain moulds and one the strain candida tropicalis is composite forms.Two strain moulds be from septic rapeseed meal the screening and get, the result of Sequence Identification is respectively: Lichtheimia (Lichtheimia sp.JN3C) and terreus (Aspergillus terreus).Lichtheimia (Lichtheimia sp.JN3C) on May 13rd, 2010 in China's typical culture collection center preservation.Deposit number is: CCTCCM2010114.Candida tropicalis is provided by biotechnology institute of Southern Yangtze University friendship.The invention belongs to technical field of microbe application.The invention also discloses the application in sulphur glucoside, robust fibre and the raising albumen in the degraded rapeseed meal of this composite microbial system.The composite ratio of terreus, Lichtheimia and candida tropicalis is 0.6ml: 0.8ml: 1.0ml, behind solid state fermentation, the sulphur glucoside degradation rate in the rapeseed meal is reached more than 90%, protein content is brought up to 48.47% (butt), and crude fiber content is reduced to 2.78% from 14.5% (butt).In the biological detoxication of rapeseed meal and quality-improving, has good utility value.
Description
Technical field
The present invention relates to a kind of composite microbial system and application thereof of the glucosinolate of degrading, belong to the using microbe technical field.
Technical background
Contain higher protein content in the dish dregs of rice.But owing to contain antinutritional factor, especially glucosinolates such as phytic acid, tannin, robust fibre (being called for short the sulphur glucoside) in the rapeseed meal.From hundreds of plants, found more than 120 kind of sulphur glucoside at present.The sulphur glucoside can cause feeding animal thyromegaly, thereby causes its growth retardation, makes rapeseed meal be difficult to the reason place of in addition fully using as the high-quality feed protein resource, and the sulphur glucoside seems particularly important in the rapeseed meal so remove.At present, remove sulphur glucoside method physics method, chemical method, biological process and genetic method etc. are arranged, physical chemistry mails to toward sulphur glucoside removal effect is preferably arranged, but can cause the amounts of protein loss, with an organic solvent can cause the drying of certain environmental pollution, material to need lot of energy and can only work many defectives such as the effect of removing simultaneously a kind of antinutritional factor wherein.The heredity method is the direction of giving priority to future.Microorganism solid fermentation send out because have economy, advantage such as environmental pollution is little, easy and detoxification is thorough.It is the present domestic main mode of rapeseed meal biological detoxication of carrying out.
Yet the sulphur glucoside is a class material that contains different alkyl, alkyl can be multiple situations such as alkane, alkene and aromatic hydrocarbon, and enzyme has the specificity of height, a kind of enzyme often can only play the degraded effect to a kind of material wherein, single bacterium enzyme that solid state fermentation produces is more single, often cause sulphur glucoside degradation efficiency not high, not have the influence of consideration during current research dish dregs of rice sulphur glucoside degraded simultaneously wherein tannin, phytic acid, robust fibre and Protein content.The two strain moulds that this experiment is adopted have good sulphur glucoside degradation effect, it is reported candida tropicalis have the ability of increasing percent protein preferably and candida tropicalis composite after, can utilize synthetic self the tropina of the inorganic nitrogen that adds in the dish dregs of rice.So two strain moulds and the composite fungus strain of a strain zymic have not only well reduced glucosinolate content in the dish dregs of rice, and reduced coarse-fibred content to a certain extent, improved protein content (tannin and phytic acid content do not have influence substantially), improved the feeding value of the dish dregs of rice greatly.
Summary of the invention
The composite microbial system that the purpose of this invention is to provide a kind of glucosinolate of degrading, and the application in sulphur glucoside, robust fibre and the raising protein content in the degraded dish dregs of rice.
In order to realize above purpose, the technical solution adopted in the present invention is:
The composite fungus strain of a kind of microorganism provided by the invention, be to constitute by two strain moulds and a strain candida tropicalis, two strain moulds are that separation and purification has obtained from septic rapeseed meal, one strain candida tropicalis (Candidatropicalis) is provided by Southern Yangtze University Foodstuffs Academy cereal functional component research department, two strain moulds are identified by Sangon Biotech (Shanghai) Co., Ltd., qualification result is Lichtheimia (Lichtheimia sp.) and terreus (Aspergillus terreus), Lichtheimia (Lichtheimia sp.JN3C) is protected a surname in China typical culture collection center on May 13rd, 2010, and deposit number is: CCTCC M2010114.
The mould of the present invention septic rapeseed meal sample that has drawn from, the experiment initial stage is the screening that index is carried out bacterial classification with sulphur glucoside degradation rate only, has promptly finally determined terreus and Lichtheimia two strain moulds by the experiments such as screening of primary dcreening operation, multiple sieve, fermention medium sulphur glucoside degradation rate mensuration and composite bacterial strain.Carry out composite to select two strain moulds as basis and candida tropicalis.
(the NH of adding 3% in the rapeseed meal of 15g
4)
2SO
4Make the glucose of inorganic nitrogen-sourced and 1%, and select 30 ℃ of leavening temperatures, material-water ratio 1: 1.3, under the condition of fermentation time 70h, after preparing bacteria suspension with 5ml aseptic water washing test tube slant, with 0.6ml: 0.8ml: 1.0ml (terreus: Lichtheimia: be that proportioning is carried out solid state fermentation candida tropicalis).
After above condition was carried out solid state fermentation, the degradation rate of sulphur glucoside reached more than 90%, and protein content brings up to 48.47% from 38.01% (butt), and coarse-fibred content is reduced to 2.78% by 14.5% (butt), and tannin and phytic acid content slightly reduce.Improved the feeding quality of the dish dregs of rice significantly.
Description of drawings
Fig. 1 is the dull and stereotyped bacterium colony picture of cultivating of Lichtheimia (Lichtheimia sp.JN3C) and terreus (Aspergillus terreus).
Fig. 2 is the degradation rate curve over time of sulphur glucoside.
Fig. 3 is protein and coarse-fibred variation diagram before and after the fermentation.
Embodiment
Embodiment 1: the screening of bacterial strain
1 substratum
Basic medium: add water about 90 ℃ with dish dregs of rice grouts by 1: 6 (g/ml), boiling water bath heating 30min, cooled and filtered, getting filtrate is basic medium.
The separation of bacterial substratum: add extractum carnis 0.05% in the basic medium, peptone 0.15%, NaCl 0.5%, and agar 2%, 0.15% is received its mycin, PH7.0-7.2.
Separate fungi culture medium: basic medium adds K
2HPO
40.1%, KCl 0.5%, MgSO
40.05%, FeSO
40.001%, agar 2%, paraxin 0.1%, PH nature.
Bacterial classification sieves substratum again: basic medium is removed protein, adds 2% agar after the filtration, the PH nature.
Solid-state fermentation culture medium: the 15g dish dregs of rice after crushed.
The screening of 2 advantage degradation bacteria strains
2.1 the separation of bacterial classification, purifying and screening
The earth 1g that fetches earth prepares soil diluent and dilution gradient, each the dilution gradient do two parallel, with gradient dilution liquid separate application to the separation of bacterial substratum with separate fungi culture medium, the macroscopic bacterium colony that the gradient that selection is fit to will be turned out is according to morphological specificity difference, simultaneously in conjunction with microscopic examination, can differentiate microorganism to a certain extent in view of the above, bacterium on the flat board is received on the LB substratum, mould and yeast are transferred on PDA and the YEPD substratum separation and purification respectively 2~3 times, and microscopy is to obtain pure culture.Will be through the bacterium after the separation and purification, yeast and mould are transferred in the multiple sieve substratum, bacterium 2 days, yeast 3 days, mould was observed growing state after 5 days, and growing way is very poor or will suffer exit sieving the bacterium that does not see growth on the substratum again always.The growing way fermention medium that preparation spore suspension or seed liquor insert after the sterilization behind the actication of culture preferably carries out solid state fermentation, measures the sulphur glucoside degradation rate of this bacterium.
Carry out compositely with candida tropicalis again through the bacterial strain after the above-mentioned screening, add 3% (NH this moment in the solid-state fermentation culture medium
4)
2SO
4The glucose of making inorganic nitrogen-sourced and 1% is for the yeast utilization, to produce tropina.Go out more excellent composite microbial system with the degraded of sulphur glucoside and the index screening that rises to of protein content.
The degradation rate of sulphur glucoside measure select for use the Palladous chloride method (Wang Zhenghua, Wei Jingshi, Shen Jian. thioglucoside in the rapeseed cake is had the bacterial screening research [J] of efficient degradation effect. JOURNAL OF MICROBIOLOGY, 2000,20 (1): 57~59).
In the formula: adopt the Palladous chloride method to measure the light absorption value of the butt attitude dish dregs of rice before E1 represents to ferment
The light absorption value that adopts the Palladous chloride method to measure after E2 represents to ferment
3 results
Through the primary dcreening operation of bacterial classification, remained 13 strain yeast behind separation and purification and the multiple sieve, 41 strain bacteriums, 13 strain moulds are received through carrying out the test of sulphur glucoside degradation rate in the solid-state fermentation culture medium of sterilization back again, finally get sulphur glucoside degraded 4 strain moulds preferably.
Four strain moulds are composite through two strains, and the composite and composite solid state fermentation that carries out of four strains of three strains is that index is screened with sulphur glucoside degradation rate, finally selects mould C4 and C8 compounded combination.
After mould C4, C8 and candida tropicalis were composite, the sulphur glucoside degradation rate of composite microbial system reached the highest at 70h.This moment, sulphur glucoside degradation rate reached more than 90%, saw accompanying drawing 2.At 0h certain degradation rate being arranged also in the accompanying drawing, is because through behind the high pressure steam sterilization, the content of sulphur glucoside also has certain reduction.
The proportioning of embodiment 2 bacterial classifications is to the influence of sulphur glucoside degradation rate and protein content
The preparation of yeast starter liquid: after 3 days, picking one encircles in the YEPD liquid nutrient medium that the 250ml triangular flask is equipped with 50ml yeast in activation on the YEPD solid test tube slant, 120r/min, and 28 ℃ of shaking tables are cultivated about 16h the yeast starter liquid of system.
The preparation of spore suspension: mould is being transferred to another test tube slant activation on the PDA slant medium about 5 days, treat the spore maturation after, with the spore suspension of the aseptic water washing inclined-plane system of 5ml.
Add 3% (NH in the solid-state fermentation culture medium again
4)
2SO
4Make the glucose of inorganic nitrogen-sourced and 1%, and select 30 ℃ of leavening temperatures, material-water ratio 1: 1.3, spore suspension and the yeast starter liquid of getting different volumes are composite, and mould and zymic inoculum size and composite situation see Table 1.(the dish dregs of rice of this moment are not made sterilising treatment to measure sulphur glucoside degradation rate and protein content behind the fermentation 70h, and after just water having been joined the dish dregs of rice, the dish dregs of rice are the mud shape, and mass transfer and heat-transfer effect are poor, place for some time so add the dish dregs of rice of entry, make that the aqueous dish dregs of rice are looser).
Table 1 mould and zymic compound proportion (unit: ml)
Protein content after the fermentation=(total nitrogen-inorganic nitrogen) * 6.25.The mensuration of total nitrogen adopts triumphant formula nitriding, and the mensuration boric acid absorption process of inorganic nitrogen (Zhang Youjuan is etc. the improvement of Miniature coulomb titrimeter for measuring nitrogen content [J] in the inorganic ammonium salt for Zhang Xiuying, Wang Lin. chemical research and application, 2001,13 (6): 699-700.) and some modifications.
After the above-mentioned condition of process is carried out solid state fermentation, measure the sulphur glucoside and the protein content of each level, final definite with C4: C8: candida tropicalis is the proportioning degraded sulphur glucoside of 0.6ml: 0.8ml: 1.0ml and increases percent protein best.Wherein the degradation rate of sulphur glucoside is 93.5%, has reached the sulphur glucoside degradation rate under sterilising conditions.Protein content brings up to 48.47% from 38.01% (butt), sees accompanying drawing 3.
Nutritive value for the Comprehensive Assessment dish dregs of rice, the fermentation combination of selection level 1, measure before and after the fermentation robust fibre, tannin and phytic acid content change and the rate of recovery situation of the fermentation back dish dregs of rice, the result shows: robust fibre is reduced to 2.78% from 14.5% (butt).Tannin and phytic acid content slightly reduce.The rate of recovery of the dish dregs of rice is 88.7%.Improved the feeding value of the dish dregs of rice after the fermentation greatly.
The evaluation of embodiment 3 bacterial classifications
1.1 the morphological observation of bacterial strain
Bacterial strain is received on the solid medium, under suitable condition, cultivated the flat-plate bacterial colony form of for some time observation bacterial classification.
1.2 the molecular biology identification of bacterial classification
The bacterium that this experiment is separated to is sent to Sangon Biotech (Shanghai) Co., Ltd. and identifies.
1.3 result
1.3.1 dull and stereotyped morphology is identified
After last 5 day, the bacterium colony layer is thin, little, round at the PDA flat board for bacterial strain C4.The spore head is intensive, and the surface is segmentation dress, and khaki color is to tawny, the top capsule semisphere of conidial head, stigma bilayer.See accompanying drawing 1.The C8 bacterial strain is after cultivating 48h on the PDA flat board, and colony diameter can reach about 6cm, and the similar cotton shape of colony's form still can be grown under 37 ℃ of conditions, and bacterium colony becomes grey by white gradually in the culturing process.Sporocyst is smooth transparent, and shape is ellipse or pyriform.See accompanying drawing 1.
1.3.2 molecular biology identification
Two strain moulds are identified by Sangon Biotech (Shanghai) Co., Ltd. and finish that the result of the Sequence Identification of C4 is terreus (Aspergillus terreus).
IS067?C4 ITS?rDNA 567bp
CGAGTGCGGGTCTTTATGGCCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCG
CCAGCGTTGCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACATG
AACCCTGTTCTGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGA
TCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAG
TGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGT
CATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGGCTCCCGGGGGACGGGCCCG
AAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCCGTAGGCCC
GGCCGGCGCCCGCCGACGCATTTATTTGCAACTTGTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGG
ATACCCGCTGAACTTAAGCATATCAAT
C8 Sequence Identification result is Lichtheimia (Lichtheimia sp.).
IS039C8 ITS district 685bp
CATTACTGAGAGGTTATTAAGACTCTTGGGTTGAGTTTCTTTGCTCTTCTCTTGAGTTTCCTCACGGTT
TTGTGCAATGTTGGGTCACCTTGGTTGACTCTGCCCTAAGTATTGGGCTGGCCTTTGGGGCCCCTAGTA
TGATTTATCATACTAACCCCAGAGGTTATTTCTACTATGTCTATGAATTGATGTATGAAAAAGTTATTTGT
TAACTTGAAGGCTTTTCTGTAAAAAGTGAGTCTTTAAAAACAACTCTTGGCAATGGATCTCTTGGTTC
TCGCATCGATGAAGAGCGTAGCAAAGTGCGATAATTATTGCGACTTGCATTCATAGTGAATCATCGAGT
TCTTGAACGCATCTTGCGCCTAGTAGTCAATCTACTAGGCACAGTTGTTTCAGTATCTGCATCCACCAA
TCAATACAACTTGCTTGTGTTGGAACTGGGCTTACTTTTGATGGCATTTGGTTGCTGTCATGGCCTTAA
ATGTATTTAGTCCTAGGTGTTAACTTGTTAATGCCGGATGGAGACTCTAGAGTGCCTTAGAAGCAGCTT
GGTTAGTGAGTTCATAATTCCAAGTGTTAGTCTTTTATTGAACTGGGTTTCTAGTCTATGGGACTTACTT
GAGAGTCGACCTCTCTAGTAAATCAAACTCACATCTAGATCTGAAATCAACTGAGATCACCC
Claims (5)
1. the composite microbial system and the application thereof of an efficient degradation glucosinolate (being called for short the sulphur glucoside).It is characterized in that its composite microbial system is made of two strain moulds and a strain candida tropicalis, two strain moulds are to separate from the septic dish dregs of rice and get, and Sequence Identification result is Lichtheimia (Lichtheimia sp.JN3C) and terreus (Aspergillus terreus).Lichtheimia is preserved in Chinese typical culture collection center preservation on May 13rd, 2010, and deposit number is CCTCC M2010114.One strain candida tropicalis bacterium gives birth to engineering college's friendship by Southern Yangtze University and provides.
2. as the application of right 1 described composite microbial system, it is characterized in that: the used composite microbial system rapeseed meal sulphur glucoside that is used for degrading.
3. as the application of right 1 described composite microbial system, it is characterized in that: used composite microbial system be used for the degrading robust fibre of rapeseed meal.
4. as the application of right 1 described composite microbial system, it is characterized in that: used composite microbial system is used for improving the protein content of rapeseed meal.
5. as right 1 described composite microbial system, it is characterized in that: the composite ratio of terreus, Lichtheimia and candida tropicalis is 0.6ml: 0.8ml: 1.0ml.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010101847055A CN101899396A (en) | 2010-05-27 | 2010-05-27 | A kind of composite microbial system of the glucosinolate of degrading and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010101847055A CN101899396A (en) | 2010-05-27 | 2010-05-27 | A kind of composite microbial system of the glucosinolate of degrading and application thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN101899396A true CN101899396A (en) | 2010-12-01 |
Family
ID=43225318
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2010101847055A Pending CN101899396A (en) | 2010-05-27 | 2010-05-27 | A kind of composite microbial system of the glucosinolate of degrading and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101899396A (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102028099A (en) * | 2010-12-09 | 2011-04-27 | 江南大学 | Preparation method of feed protein |
CN108707556A (en) * | 2018-06-11 | 2018-10-26 | 华南农业大学 | A kind of horizontal stalk fungal strain and its application in producing cellulase |
CN110885872A (en) * | 2019-07-18 | 2020-03-17 | 西南大学 | Screening and identifying method for strain with high sinapiside degradation capability |
-
2010
- 2010-05-27 CN CN2010101847055A patent/CN101899396A/en active Pending
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102028099A (en) * | 2010-12-09 | 2011-04-27 | 江南大学 | Preparation method of feed protein |
CN102028099B (en) * | 2010-12-09 | 2012-10-10 | 江南大学 | Preparation method of feed protein |
CN108707556A (en) * | 2018-06-11 | 2018-10-26 | 华南农业大学 | A kind of horizontal stalk fungal strain and its application in producing cellulase |
CN108707556B (en) * | 2018-06-11 | 2019-10-18 | 华南农业大学 | A kind of horizontal stalk fungal strain and its application in production cellulase |
CN110885872A (en) * | 2019-07-18 | 2020-03-17 | 西南大学 | Screening and identifying method for strain with high sinapiside degradation capability |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101555461B (en) | Bacterial strain LT3 producing alkalescence cellulase and breeding method and initial optimization of cellulase production conditions thereof | |
CN101285046B (en) | Mutant strain streptomyces albus TUST2 and process for producing epsilon-polylysine and salts thereof by using the mutant strain | |
CN107815478B (en) | Method for producing kasugamycin by fermenting streptomyces aureofaciens BJX007 | |
CN108728373B (en) | Compound bacterium for efficiently degrading quinoa straws and application thereof | |
CN110373359A (en) | A kind of streptomyces albus X-18 and the method using bacterium production epsilon-polylysine | |
CN101503663A (en) | A strain of Acetobacter gluconicum and screen purification method thereof | |
CN111534439A (en) | Penicillium oxalicum SDF-25 strain and application thereof | |
CN102363748B (en) | New fungus Acremonium sp. DPZ-SYz-2-3 for high efficiency cellulose degradation and application thereof | |
CN106434475B (en) | One streptomycete category polysaccharide degradation bacteria and its cultural method and application | |
CN112094750B (en) | Rhizopus oryzae for producing ergothioneine | |
CN102660480B (en) | Soybean antigenic protein degradation strain and application thereof | |
CN102417890B (en) | Sinorhizobium meliloti and method for applying same for fermenting to produce manganese peroxidase | |
CN101899396A (en) | A kind of composite microbial system of the glucosinolate of degrading and application thereof | |
CN104560766A (en) | Actinoplanes strain and application thereof | |
CN106635885B (en) | A kind of entomopathogenic nematode symbiotic bacteria and its application | |
CN104762229A (en) | A bacillus subtilis strain and applications thereof | |
CN111909877A (en) | Application of Siamese bacillus B11 in prevention and/or treatment of chestnut branch blight | |
CN114149945B (en) | High-yield cellulase bacteria and application thereof | |
CN110305819A (en) | One plant of feather efficient degrading bacterial strain and its application | |
CN112812978B (en) | Edible fungus pleurotus eryngii and application thereof | |
CN107815426B (en) | Special strain for fermentation production of kasugamycin and application thereof | |
CN112725194B (en) | Fungus Flavodon sp.x10 for high yield of cellulase and application thereof | |
CN102337235B (en) | Complex bacterial agent for efficiently ungluing bast fiber and preparation method for Complex bacterial agent | |
CN110835610B (en) | Composite microbial inoculum suitable for degrading straw and preparation method thereof | |
CN103525710A (en) | Penicillium oxalicum BAM-1 as well as separation and purification method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20101201 |