CN101899115A - Stable CD3-CD19 resisting mini-type difunctional antibody of disulfide bond and preparation method thereof - Google Patents

Abstract

The invention relates to a stable CD3-CD19 resisting mini-type difunctional antibody of disulfide bond and a preparation method thereof. The preparation method comprises the steps of based on the CD3-CD19 resisting antibody, introducing amino acid Cys mutation in the CD3VL-resisting 100th amino acid Ser and CD3VH-resisting 44th amino acid Gly, wherein the expressed product has the structure of disulfide bond formed by the CD3VL-resisting 100th and the CD3VH-resisting 44th cysteines shown in the sequences 3 and 4. The stable CD3-CD19 resisting mini-type difunctional antibody of disulfide bond introduces cysteine mutation in the bits of VL-100 and VH-44 in the CD3-resisting variable region, and the disulfide bond is formed in a bacterium periplasm cavity between the variable region fragments of the two expressed single chains, i.e., between the CD3VL-CD19VH resisting segment and the CD19VL-CD3VH resisting segment, thereby enhancing the stability of the antibody; besides, a mutational site is located in a conservative framework region and two mutational sites in the space conformation are closer enough without generating tension so that the activity of the transformed difunctional antibody remains unchanged and the stability is enhanced.

Description

CD 3-CD 19 resisting mini-type difunctional antibody that disulfide linkage is stable and preparation method thereof

Technical field

The invention belongs to the antibody field, relate to miniature bifunctional antibody, especially stable CD 3-CD 19 resisting mini-type difunctional antibody of disulfide linkage and preparation method thereof.

Background technology

Non-Hodgkin lymphoma (NHL) is one group and originates from adenoid malignant tumour that its M ﹠ M has occupied the 5th of malignant tumour.Traditional chemicotherapy for early, mid-term patient's satisfactory effect, but then curative effect is not good enough for patients with terminal, especially the lower patient of pathological grading.A large amount of cases can not be fully recovered because of small remaining kitchen range, and the root of recurrence after being.Generally adopt high-dose chemotherapy and systemic radiation therapy for patients with terminal, associating bone marrow transplantation (BMT) and autologous peripheral blood stemcell transplant (PBSCT), high-dose chemotherapy and systemic radiation therapy do not have selectivity, very big to normal tissue injury, the normal appearance than tangible toxic side effects, so neoplasm targeted therapy has become an important channel of improving result of treatment.In recent years, the biotherapy method is widely used in oncotherapy, and especially monoclonal antibody has been received good therapeutic action because of its specific target tropism, high-affinity.The appearance of tumor associated antigen and corresponding monoclonal antibody thereof makes a kind of research with medicine of selectivity antitumor action of preparation that very big development arranged.

It is in nineteen eighty-two that monoclonal antibody abbreviation monoclonal antibody is used to disease treatment the earliest, and people such as U.S. Stamford medical center Levy utilize the antiidiotype monoclonal antibody treatment B cell lymphoma of preparation, and treatment back patient's state of an illness is alleviated, the disappearance of knurl body.The anti-CD20 human mouse chimeric antibody of drugs approved by FDA Rituximab in 1997

Listing, people's antagonist medicine has produced great expectation.9 kinds of anti-tumour antibody medicine Zevalin, Mylotarg, Bexxar, Mabthera, Erbitux, Avastin, Herceptin, Campath, the Cetuximab of U.S. FDA approved listing at present, wherein the sales volume of Mabthera is above 3,000,000,000 dollars, cookle level medicine ranks have been entered, but along with the increase of the case load that uses monoclonal antibody to treat, the problem of drug resistance is also more and more obvious.Grow up thereupon ¹³¹The mouse endogenous antibody Bexxar of I mark and ⁹⁰The Zevalin antibody of Y mark, mechanism of action is different with Rituximab, has overcome drug resistance, but it is short to alleviate the time length, easy secondary tumor, and toxic side effects is big, and patient tolerability is poor.And it is generally acknowledged that ADCC is the important mechanisms of antibody performance lethal effect, monoclonal antibody combines the performance lethal effect by the Fc section with effector cell's surface activation acceptor Fc γ R I/Fc γ R III, but the T cell with immunologic cytotoxicity effect can not effectively be mediated because the surface lacks above-mentioned acceptor, thereby has weakened the immunological effect of body to tumour.The antibody mab molecular weight is big simultaneously, is difficult to penetrate tumor tissues, and these drawbacks have all limited the application of monoclonal antibody.When therefore making the antibody miniaturization, make the immunity system of the more effective stimulation body of antibody again, thereby reduce chemical sproof generation.Through the research of recent two decades, a kind ofly can discern two kinds of antigenic miniature bifunctional antibodies of difference simultaneously and brought dawn for solving Immune escape of tumor.

Miniature bifunctional antibody is a kind of form of genetic engineering antibody, because only contain complete anti-variable region fragment in the molecule, molecular weight is reduced greatly,, can not produce the HAMA reaction so immunogenicity is little, and easily penetrate fine and close tumour barrier, can enter solid tumor microcirculation on every side, transformation period weak point in the body is again in default of the Fc fragment, lost the receptors bind effect of Fc mediation, it can be concentrated to target site fast.Contain 2 antigen binding sites simultaneously, these two kinds of antigens can be the antigen molecules that is positioned on the same cell, also can be the differentiation antigens on tumor associated antigen (TAA) or the immune effector cell, and what most miniature bifunctional antibodies adopted is a kind of form in back.According to antigenic difference, miniature bifunctional antibody can be raised the different sorts effector cell with lethal effect around the target cell, wherein Jie Dao effector cell mainly contains T cell (CD3), NK cell (CD16), Monocytes and neutrophil leucocyte (CD64 or CD89) etc., target cell comprises the NHL (CD19 or CD20) in bone-marrow-derived lymphocyte source, mammary cancer (Her2), prostate cancer (EpCAM) etc.

The building mode of miniature bifunctional antibody has multiple, common form that tanscFv/BiTE is arranged, Diabody, taDb etc., Diabody molecular weight minimum in these three kinds of forms.CD 3-CD 19 resisting mini-type difunctional antibody is that the expression product by 2 cistron CD3VL-CD19VH under the promotor phoA control and CD19VL-CD3VH constitutes, VH is connected by Linker (being small peptide GlyGlyGlyGlySer) with VL in the same cistron, because of the G4S small peptide shorter, it is sterically hindered that same intracistronic VH and VL are produced, can not match, can only oppositely match with VH and the VL on another cistron, form dimer under folding enzymes during expression in bacterium pericentral siphon chamber and the help of molecular chaperones, 2 scFv fragments in this dimer are to be formed by connecting by non covalent bond, the inactivation that dissociates easily, less stable.

Summary of the invention

The objective of the invention is to overcome the deficiencies in the prior art part, a kind of novel, small-sized, stable, stable CD 3-CD 19 resisting mini-type difunctional antibody of tumor-targeting therapeutical agent disulfide linkage and preparation method thereof efficiently that can mediate effector cell's specific killing tumour cell is provided.

The objective of the invention is to be achieved through the following technical solutions:

The CD 3-CD 19 resisting mini-type difunctional antibody that a kind of disulfide linkage is stable is based on anti-CD3-anti-CD 19 antibodies, at anti-CD3V _LThe 100th amino acids Ser and anti-CD3V _HThe 44th amino acids Gly introduces amino acid Cys sudden change, expresses after product and has by sequence 3 the anti-CD3V shown in the sequence 4 _L-100 and anti-CD3V _HThe structure that the disulfide linkage that-44 halfcystine forms connects.

And described amino acid Cys sudden change is at the weight chain variable region of anti-CD3 mouse monoclonal antibody HIT3a.

And the molecular weight of described expression after product is 55kDa.

The preparation method of the CD 3-CD 19 resisting mini-type difunctional antibody that a kind of disulfide linkage is stable, be made up of following steps:

(1) utilization PCR and overlap PCR method are at anti-CD3V _LThe 100th amino acids Ser and anti-CD3V _HThe 44th amino acids Gly introduces amino acid Cys sudden change, obtains 2 mutant nucleotide sequences;

(2) with above-mentioned sequence clone in intermediate carrier pB11d1-100 and pBYZ11d2-44, cut, verify and obtain anti-CD3V through enzyme _L-anti-CD19V _HWith anti-CD19V _L-anti-CD3V _HGene fragment;

(3) two gene fragments that step (2) is obtained are fused among the colibacillus expression plasmid pAYZ-dsCD3CD19, then plasmid pAYZ-dsCD3CD19 is transformed among the competence intestinal bacteria 16C9, cultivates, enzyme is cut and sequence verification expression vector establishment success;

(4) single bacterium colony that step (3) empirical tests plasmid pAYZ-dsCD3CD19 is successfully constructed is cultivated, and carries out the cracking of bacterium after the cultivation and slightly carries, and obtains crude extract;

(5) crude extract that step (4) is obtained carries out purifying and evaluation, obtains the stable CD 3-CD 19 resisting mini-type difunctional antibody of disulfide linkage.

And the culturing process of described single bacterium colony is as follows:

(1) with single colony inoculation in the 2YT substratum that contains the 0.1mg/mL penbritin, 37 ℃ of shaking culture 8h;

(2) transfer in 28 ℃ of shaking culture 28h of the Ap5 substratum that contains the 0.1mg/mL penbritin in 1: 2 ratio, 4 ℃, the centrifugal collection thalline of 2500 * g.

Advantage of the present invention and positively effect are:

1, the miniature bifunctional antibody of the present invention's preparation is the Diabody form, it is a kind of miniature bifunctional antibody of molecular weight minimum, CD3 is a T lymphocytic cell surface special molecular, can raise T lymphocyte by it with lethal effect, and CD19 is the special sign in bone-marrow-derived lymphocyte surface, pre-B lymphocyte, immature B lymphocyte, ripe bone-marrow-derived lymphocyte, activate in the bone-marrow-derived lymphocyte expression is all arranged, organizing at plasmocyte, lymph multipotential stem cell and other does not all have expression.Most of NHL originate from bone-marrow-derived lymphocyte, and B cell NHL more than 95% expresses CD19 antigen, and CD19 antigen relatively exposes, and also do not have free CD19 in the human serum and exist, so CD19 can be used as the target spot of treatment B cell lymphoma.

2, the stable CD 3-CD 19 resisting mini-type difunctional antibody of disulfide linkage of the present invention's preparation is further to transform to form the V in the anti-cd 3 antibodies variable region on the CD 3-CD 19 resisting mini-type difunctional antibody basis _L-100 and V _HIntroduce cysteine mutation for-44,2 single-chain antibody variable regions (scFv) fragment after the expression forms disulfide linkage in bacterium pericentral siphon chamber, strengthened the stability of antibody, again because the mutational site is positioned at V _LAnd V _HConservative skeleton district, 2 mutational sites distance is enough near in the space conformation, can not produce tension force, thereby improved bifunctional antibody activity is remained unchanged, and has reached so not only to have strengthened stability but also kept active purpose.

Description of drawings

Fig. 1 is the structure schema of pAYZ-dsCD3CD19 of the present invention.

Fig. 2-1 is the anti-CD3V of the present invention _L-anti-CD19V _H, anti-CD19V _L-anti-CD3V _HGene fragment and expression vector pAYZ-dsCD3CD19 double digestion are after the picture group of agarose gel electrophoresis analytical results, wherein M:marker; Lane1: anti-CD3V _L-anti-CD19V _HFragment is after mluI, nheI double digestion glue reclaim; Lane2: anti-CD19V _L-anti-CD3V _HGene fragment is after nheI, notI double digestion glue reclaim.

Fig. 2-2 is Fig. 2-1 comparison diagram, wherein M:marker; Lane1: expression vector pAYZ-dsCD3CD19 is after mluI, notI double digestion are identified.

Fig. 3 makes up for the anti-CD19 expression vector of the anti-CD3-of the present invention pAYZ-dsCD3CD19.

Fig. 4-1 is that Diabody purifying of the present invention is after SDS-PAGE and western-blot analytical results, wherein M:marker; Lane1:Diabody is 12%SDS-PAGE gel electrophoresis result behind His-tag protein purification column purification; Lane2:ds-Diabody is 12% reduced form SDS-PAGE gel electrophoresis result behind His-tag protein purification column purification; Lane3:ds-Diabody is 12%SDS-PAGE gel electrophoresis result behind His-tag protein purification column purification.

Fig. 4-2 is that Diabody purifying of the present invention is after SDS-PAGE and western-blot analytical results, wherein M:marker; Lane1:Diabody is the western-blot analytical results behind His-tag protein purification column purification; Lane2:ds-Diabody is the western-blot analytical results after reduced form SDS-PAGE gel electrophoresis behind the His-tag protein purification column purification; Lane3:ds-Diabody is the western-blot analytical results behind His-tag protein purification column purification.

Fig. 5 combines activity for facs analysis Diabody of the present invention and ds-Diabody with R aji cell and Jurkat cell, ds-Diabody combines active picture group with HIT3a, HIT19a competition, wherein

Fig. 5-1 is hatched figure for Raji cell and PBS.

Fig. 5-2 is hatched for Raji cell and Diabody.

Fig. 5-3 is hatched for Raji cell and ds-Diabody.

Fig. 5-4 is hatched jointly for Raji cell and ds-Diabody and HIT19a monoclonal antibody, and wherein a:PBS is a negative control, b:HIT19a monoclonal antibody, c: anti-CD19ds-Diabody of anti-CD3-and HIT19a.

Fig. 5-5 is hatched for Jurkat cell and PBS.

Fig. 5-6 is hatched for Jurkat cell and Diabody.

Fig. 5-7 is hatched for Jurkat cell and ds-Diabody.

Fig. 5-8 is hatched jointly for Jurkat cell and ds-Diabody and HIT3a monoclonal antibody; A:PBS is a negative control, b:HIT3a monoclonal antibody, c:ds-Diabody and HIT3a.

Fig. 6 for Diabody of the present invention and ds-Diabody in 37 ℃ of PBS that contain 0.2% human serum albumin (HSA), under 37 ℃ of conditions after the incubation different time points, FACS detects active with combining of Raji cell, %activity=tx combination rate/t0 combination rate * 100%.

Fig. 7 for Diabody of the present invention and ds-Diabody in 37 ℃ of PBS that contain 0.2% human serum albumin (HSA), under 37 ℃ of conditions after the incubation different time points, FACS detects and combines activity with the Jurkat cell, %activity=tx combination rate/t0 combination rate * 100%.

Fig. 8 is imitated target than the per-cent that kills and wounds target cell Raji for the external ds-Diabody different concns of the present invention mediates PBL down with difference.

Fig. 9 for the external different antibodies of the present invention under 500ng/ml concentration, mediation PBL is imitated target than the per-cent that kills and wounds target cell Raji with difference, and does contrast with PBS.

Figure 10 for the external Diabody of the present invention and ds-Diabody under 500ng/ml concentration, mediation PBL is imitated target than the per-cent that kills and wounds irrelevant target cell K562 with difference.

Embodiment

Below in conjunction with embodiment, the present invention is further described, and following embodiment is illustrative, is not determinate, can not limit protection scope of the present invention with following embodiment.

The stable CD 3-CD 19 resisting mini-type difunctional antibody (ds-Diabody) of disulfide linkage among the present invention is the V by anti-CD3 mouse source property monoclonal antibody HIT3a _H, V _LAnd the V of anti-CD19 mouse source property monoclonal antibody HIT19a _H, V _LFor the basis constitutes, anti-CD3scFv that relates to and anti-CD19scFv are positioned at the weight chain variable region of anti-CD3 and anti-CD19 mouse monoclonal antibody HIT3a and HIT19a.The present invention will resist CD3V on the basis of anti-CD3-anti-CD 19 antibodies _LThe 100th amino acids Ser and anti-CD3V _HThe 44th amino acids Gly introduces cysteine mutation, wherein constitutes 2 anti-CD3V of cistron of ds-Diabody _L-anti-CD19V _HWith anti-CD19V _L-anti-CD3V _HMiddle V _LAnd V _HBetween connect by small peptide GlyGlyGlyGlySer, between the expression product of 2 cistrons by anti-CD3V _L-100 and anti-CD3V _HThe disulfide linkage that-44 halfcystine forms connects, gene coded sequence is 1401bp, rite-directed mutagenesis after in the intestinal bacteria solubility efficiently express and purifying after, its molecular weight is 55kDa, their gene coded sequence and amino acid are formed shown in the sequence explanation, and rite-directed mutagenesis locus gene sequence and aminoacid sequence change as following table.

Table 1 CD 3-CD 19 resisting mini-type difunctional antibody rite-directed mutagenesis site

The mutational site	Codon before the sudden change	Sudden change back codon	Amino acid before the sudden change	Sudden change back amino acid
					CD3V L-100	TCG?	TGT?	Ser?	Cys?
CD3V H-44	GGT?	TGC?	Gly?	Cys?

The preparation method of the stable CD 3-CD 19 resisting mini-type difunctional antibody of disulfide linkage among the present invention, step is as follows:

1. at anti-CD3V _LThe 100th amino acids Ser and anti-CD3V _HThe 44th amino acids Gly introduces cysteine mutation, makes up intermediate carrier pB11d1-100, pBYZ11d2-44 and recombinant expression plasmid pAYZ-dsCD3CD19 (see and make up schema 1):

1.1PCR rite-directed mutagenesis

1.1.1PCR the anti-CD3V of rite-directed mutagenesis _LV in the fragment _L-100 is Cys:

Reaction 1: reaction system 50 μ L

Primer 1:5 ' CTAGCGC ACGCGTACGCTGACATCGAGCTCACTCAGTCTCC 3 '

(Mlu?I)

Primer 2: 5 ' TGGTCCCACAGCCGAACG 3 '

10×PCR?Buffer(Mg2+plus) 5.0μL

dNTP?Mixture(10mM) 1.0μL

Primer 1 (10 μ mol/L) 3.0 μ L

Primer 2 (10 μ mol/L) 3.0 μ L

Pfu archaeal dna polymerase (5U/ μ L) 1.0 μ L

Contain anti-CD3V _L/ anti-CD19V _HSegmental template pB11d1 2.0 μ L

Sterilization deionized water 35.0 μ L

The pcr amplification program is:

94 ℃ of pre-sex change 3min continue with 94 ℃ of sex change 1min, 58 ℃ of annealing 1min, and 72 ℃ are extended 40s, totally 30 circulations, 72 ℃ are extended 10min.Reaction product is through 1.5% agarose gel electrophoresis, and glue reclaims and purifying.

Reaction 2: reaction system 50 μ l

Primer 3:5 ' CGTTCGGCTGTGGGACCA 3 '

Primer 4:5 ' GCGCGCTAGCCTATGAGGAGACTGTGAGAGTGGTGCC 3 '

10×PCR?Buffer(Mg2+plus) 5.0μL

dNTP?Mixture(10mM) 1.0μL

Primer 3 (10 μ mol/L) 3.0 μ L

Primer 4 (10 μ mol/L) 3.0 μ L

Pfu archaeal dna polymerase (5U/ μ L) 1.0 μ L

Anti-CD3V _L/ anti-CD19V _HTemplate pB11d1 2.0 μ L

Sterilization deionized water 35.0 μ L

The pcr amplification program is:

94 ℃ of pre-sex change 3min continue with 94 ℃ of sex change 1min, 58 ℃ of annealing 1min, and 72 ℃ are extended 1min, totally 30 circulations, 72 ℃ are extended 10min.Reaction product is through 1.5% agarose gel electrophoresis, and glue reclaims and purifying.

1.1.2PCR the anti-CD3V of rite-directed mutagenesis _HV in the fragment _H-44 is Cys:

Reaction 3: reaction system 50 μ L

Primer 5:5 ' GCGC ACGCGTACGCTGACATTGTGCTCACCCAGTCTCC 3 '

(Mlu?I)

Primer 6:5 ' CATTCCAGGCACTGTCCAG 3 '

10×PCR?Buffer(Mg2+plus) 5.0μL

dNTP?Mixture(10mM) 1.0μL

Primer 5 (10 μ mol/L) 3.0 μ L

Primer 6 (10 μ mol/L) 3.0 μ L

Pfu archaeal dna polymerase (5U/ μ L) 1.0 μ L

Contain anti-CD19V _L/ anti-CD3V _HTemplate pBYZ11d2 2.0 μ L

Sterilization deionized water 35.0 μ L

The pcr amplification program is:

94 ℃ of pre-sex change 3min continue with 94 ℃ of sex change 1min, 58 ℃ of annealing 1min, and 72 ℃ are extended 1min, totally 30 circulations, 72 ℃ are extended 10min.Reaction product is through 1.5% agarose gel electrophoresis, and glue reclaims and purifying.

Reaction 4: reaction system 50 μ L

Primer 7:5 ' CTGGACAGTGCCTGGAATG 3 '

Primer 8:5 ' GAATATC GCATGCGGTGGTCATGAGGAGACGGTGACCGTG 3 '

(sph?I)

10×PCR?Buffer(Mg2+plus) 5.0μL

dNTP?Mixture(10mM) 1.0μL

Primer 7 (10 μ mol/L) 3.0 μ L

Primer 8 (10 μ mol/L) 3.0 μ L

Pfu archaeal dna polymerase (5U/ μ L) 1.0 μ L

Contain anti-CD19V _L/ anti-CD3V _HTemplate pBYZ11d2 2.0 μ L

Sterilization deionized water 35.0 μ L

The pcr amplification program is:

94 ℃ of pre-sex change 3min continue with 94 ℃ of sex change 1min, 58 ℃ of annealing 1min, and 72 ℃ are extended 1min, totally 30 circulations, 72 ℃ are extended 10min.Reaction product is through 1.5% agarose gel electrophoresis, and glue reclaims and purifying.

1.2PCR splicing and amplification

1.2.1PCR the splicing, anti-CD3V increases _L(100-Cys)/anti-CD19V _HFragment is (following with anti-CD3V _L ^*/ anti-CD19V _HExpression)

Overlap PCR splicing reaction system (25 μ L system):

React 1 product, 1.5 μ L (50ng)

React 2 products, 1.5 μ L (50ng)

10×PCR?Buffer(Mg2+plus) 2.5μL

dNTP?Mixture(10mM) 0.5μL

Pfu archaeal dna polymerase (5U/ μ L) 0.5 μ L

Sterilization deionized water 18.5 μ L

The pcr amplification program is:

94 ℃ of pre-sex change 3min continue with 94 ℃ of sex change 1min, 60 ℃ of annealing 1min, and 72 ℃ are extended 1min, totally 10 circulations, 72 ℃ are extended 10min.

The anti-CD3V of pcr amplification _L ^*/ anti-CD19V _HFragment adds isopyknic amplified reaction solution (25 μ L) in above-mentioned splicing reaction product:

10×PCR?Buffer(Mg2 ⁺plus) 2.5μL

dNTP?Mixture(10mM) 0.5μL

Primer 1 (10 μ mol/L) 3.0 μ L

Primer 4 (10 μ mol/L) 3.0 μ L

Pfu archaeal dna polymerase (5U/ μ L) 1.0 μ L

Sterilization deionized water 15.0 μ L

The pcr amplification program is:

94 ℃ of pre-sex change 3min continue with 94 ℃ of sex change 1min, 55 ℃ of annealing 1min, and 72 ℃ are extended 1.5min, totally 30 circulations, 72 ℃ are extended 10min.Reaction product is through 1.5% agarose gel electrophoresis, and glue reclaims and purifying.

1.2.2PCR the splicing, anti-CD19V increases _L/ anti-CD3V _H(44-Cys) fragment is (following with anti-CD19V _L/ anti-CD3V _H ^*Expression)

Overlap PCR splicing reaction system (25 μ L system):

React 3 products, 1.5 μ L (50ng)

React 4 products, 1.5 μ L (50ng)

10×PCR?Buffer(Mg2+plus) 2.5μL

dNTP?Mixture(10mM) 0.5μL

Pfu archaeal dna polymerase 0.5 μ L

Sterilization deionized water 18.5 μ L

The pcr amplification program is:

94 ℃ of pre-sex change 3min continue with 94 ℃ of sex change 1min, 60 ℃ of annealing 1min, and 72 ℃ are extended 1min, totally 10 circulations.72 ℃ are extended 10min.

The anti-CD19V of pcr amplification _L-anti-CD3V _H ^*Fragment adds isopyknic amplified reaction solution (25 μ L) in above-mentioned splicing reaction product:

10×PCR?Buffer(Mg2+plus) 2.5μL

dNTP?Mixture(10mM) 0.5μL

Primer 5 (10 μ mol/L) 3.0 μ L

Primer 8 (10 μ mol/L) 3.0 μ L

Pfu archaeal dna polymerase 1.0 μ L

Sterilization deionized water 15.0 μ L

The pcr amplification program is:

94 ℃ of pre-sex change 3min continue with 94 ℃ of sex change 1min, 55 ℃ of annealing 1min, and 72 ℃ are extended 1.5min, totally 30 circulations, 72 ℃ are extended 10min.Reaction product is through 1.5% agarose gel electrophoresis, and glue reclaims and purifying.

1.3 make up intermediate carrier pB11d1-100 and pBYZ11d2-44

1.3.1 endonuclease reaction system

Anti-CD3V _L ^*-anti-CD19V _HFragment and carrier pB11d1 cut anti-CD19V through Mlu I/Nhe I enzyme _L/ anti-CD3V _H ^*Fragment and carrier pBYZ11d2 cut through Mlu I/Sph I enzyme.

Mlu I endonuclease reaction system (50 μ L)

Substrate 1.0 μ g

10×buffer3 2.0μL

Mlu?I(10U/μL) 1.0μL

Add deionization H ₂O to final volume be 37 ℃ of 4h of 20 μ L

Nhe I endonuclease reaction system (25 μ L)

Substrate 1.0 μ g

10×buffer2 2.5μL

Nhe?I(10U/μL) 1.0μL

Add deionization H ₂O to final volume be 37 ℃ of 4h of 25 μ L

Sph I endonuclease reaction system (25 μ L)

Substrate 1.0 μ g

10×buffer2 2.5μL

Sph?I(10U/μL) 1.0μL

Add deionization H ₂O is to 37 ℃ of 4h of final volume 25 μ L

1.3.2 ligation system

The ligation system of intermediate carrier pB11d1-100 (20 μ L)

Anti-CD3V _L ^*/ anti-CD19V _H225ng

pB11d1400ng

10×buffer 2.0μL

T4Ligase(5U/μL) 1.0μL

Add deionization H ₂O is to 16 ℃ of 16h of final volume 20 μ L

The ligation system of intermediate carrier pBYZ11d2-44 (20 μ L)

Anti-CD19V _L/ anti-CD3V _H ^*225ng

pBYZ11d2 400ng

10×buffer 2.0μL

T4Ligase(5U/μL) 1.0μL

Add deionization H ₂O is to 16 ℃ of 16h of final volume 20 μ L

Ligation product transformed competence colibacillus intestinal bacteria 16C9 is inoculated on 2 * YT agarose culture plate of Amp+ and spends the night, the amplification of picking positive bacteria, and the upgrading grain is correct through checking order, and intermediate carrier successfully constructs.

1.4 construction of expression vector pAYZ-dsCD3CD19

1.4.1PCR from middle carrier pB YZ11d2-44 amplification st II-anti-CD19V _L/ anti-CD3V _H ^*Gene fragment

By the PCR reaction, at anti-CD19V _L/ anti-CD3V _H ^*Gene fragment 5 ' end adds leading peptide st II sequence and NheI restriction enzyme site, and 3 ' end adds Not I restriction enzyme site, the gene fragment st II-anti-CD3VH of anti-CD19VL/ ^*Cut through Nhe I/Not I enzyme again.

PCR reaction system (50 μ L)

Primer 95 ' CTTCGA GCTAGCTACCCGGGGATCCTCTAGAG 3 '

(Nhe?I)

Primer 105 ' CGCACCT GCGGCCGCTGAGGAGACGGTGACCGTG 3 '

(Not?I)

10×PCR?Buffer 5.0μL

dNTP(10mM) 1.0μL

Primer 9 (10 μ mol/L) 3.0 μ L

Primer 10 (10 μ mol/L) 3.0 μ L

Pfu archaeal dna polymerase (5U/ μ L) 1.0 μ L

pBYZ11d2-44 3.0μL

Sterilization deionized water 33.0 μ L

The pcr amplification program is:

94 ℃ of pre-sex change 3min continue with 94 ℃ of sex change 1min, 55 ℃ of annealing 1min, and 72 ℃ are extended 2min, totally 30 circulations, 72 ℃ are extended 10min.

Nhe I endonuclease reaction system: the same.

Not I endonuclease reaction system:

Substrate 1.0 μ g

10×buffer 22.0μL

NotI(10U/μL) 1.0μL

Adding the deionized water final volume is 37 ℃ of 4h of 20 μ L

1.4.2 construction of expression vector pAYZ-dsCD3CD19

The anti-CD3V of gene fragment _L*-anti-CD19V _HCut through Mlu I/Nhe I enzyme, expression vector pAYZ cuts through Mlu I/NotI enzyme, the anti-CD3VH* of the anti-CD19VL/ of stII-with Nhe I/Not I enzyme is cut connects (Fig. 2-1), construction of expression vector pAYZ-dsCD3CD19 by Mlu I/Nhe I/NotI restriction enzyme site.

The ligation system of expression vector pAYZ-dsCD3CD 19 (20 μ L)

St II-anti-CD19V _L/ anti-CD3V _H ^*250ng

Anti-CD3V _L ^*/ anti-CD19V _H225ng

pAYZ 400ng

10×buffer 2.0μL

T4Ligase(5U/μL) 0.5μL

Add deionization H ₂O is to 16 ℃ of 16h of final volume 20 μ L

Ligation product transformed competence colibacillus intestinal bacteria 16C9 is inoculated on 2 * YT agarose culture plate of Amp+ and spends the night, the amplification of picking positive bacteria, and the upgrading grain is cut (Fig. 2-2) and order-checking correct (sequence explanation) through enzyme, and expression vector establishment is (Fig. 3) successfully.

2. expression, purifying, the evaluation of the stable CD 3-CD 19 resisting mini-type difunctional antibody of disulfide linkage

2.1 the expression of the CD 3-CD 19 resisting mini-type difunctional antibody that disulfide linkage is stable

Picking contains single bacterium colony of recombinant plasmid, be inoculated into (1.6% Tryptones in the 2YT substratum that contains penbritin (0.1mg/mL), 1% yeast extract, 0.5%NaCl), behind 37 ℃ of shaking culture 8h, in 1: 2 ratio transfer (0.6g/L yeast extract, 11g/L acid hydrolyzed casein, 1.5g/L glucose in the Ap5 substratum that contains penbritin (0.1mg/mL), 1.2g/L NaCl, 3.73g/L KCl, 1.07g/L NH4Cl, 0.19g/L MgSO4,0.12moL/L trolamine, pH 7.4), 28 ℃ of shaking culture 28h, 4 ℃ of centrifugal collection thalline.Behind the freeze thawing bacterial sediment, add outer pericentral siphon chamber extracting solution (the Tutofusin tris 25mmol/L of bacterium, ethylenediamine tetraacetic acid (EDTA) 1mmol/L, phenylmethylsulfonyl fluoride (PMSF) 0.1mmol/L, sucrose 200g/L (W/V), NaCl 200mmol/L, pH7.5), 4 ℃ of concussion cracking 1h, 12000r/min, 4 ℃ of centrifugal 30min, collecting supernatant liquor is the crude extract of expression product.

2.2 the purifying of the CD 3-CD 19 resisting mini-type difunctional antibody that disulfide linkage is stable

Supernatant liquor behind the 0.45 μ m filtering with microporous membrane, is splined on anti-His-tag affinity column, with binding buffer liquid (0.01M NaH through the PBS dialysed overnight ₂PO ₄2H ₂O, 0.01M Na ₂HPO ₄12H ₂O, 0.05M NaCl, the 20mmol/L imidazoles, pH7.4) and elution buffer (0.01M NaH ₂PO ₄2H ₂O, 0.01M Na ₂HPO ₄12H ₂O, 0.05M NaCl, the 500mmol/L imidazoles, pH7.4) gradient elution, FPLC collects elution peak, and gained bifunctional antibody albumen concentrates and the PBS displacement through the albumen evaporating column, and kit is quantitative for the BCA protein quantification, the about 5mg/L of output, and product is a solubility expression.

2.3 the evaluation of the CD 3-CD 19 resisting mini-type difunctional antibody that disulfide linkage is stable

12%SDS-PAGE analysis ds-Diabody has a protein band, and (the ds-Diabody molecular weight is about 55kD at the 45kD place, but because the albumen space conformation causes its molecular weight to be positioned near the 45kD), respectively there is a protein band at reduced form protein electrophoresis analysis 26kD and 28kD place, and (ds-Diabody disulfide linkage under the reductive agent effect disconnects, form 2 cistron expressed proteins bands), (Fig. 4-1) conforms to theoretical value.

The albumen of Western blot after to purifying is analyzed, have at molecular weight 28kD place the specific reaction band (anti-His-tag antibody can only with the protein band hybridization that has the segmental molecular weight 28kD of His-tag, do not have specific reaction with the 26kD protein band).(Fig. 4-2)

Below be the active test of carrying out according to the stable CD 3-CD 19 resisting mini-type difunctional antibody of disulfide linkage that method for preparing goes out of associated biomolecule, testing method and result are as follows:

1. the immunologic competence of stable CD 3-CD 19 resisting mini-type difunctional antibody (ds-Diabody) bifunctional antibody of disulfide linkage

1.1 it is active that stable CD 3-CD 19 resisting mini-type difunctional antibody (ds-Diabody) indirect immunofluorescence of disulfide linkage is measured the combination of bifunctional antibody

Get certain density purifying ds-Diabody and with 1 * 10 ⁶4 ℃ of common incubation 1h of Raji cell or Jurkat cell, 300 * g, 4 ℃ of centrifugal 5min abandon supernatant liquor, and cold PBS washes cell, repeats 3 times.Cell again with 4 ℃ of common incubation 1h of mouse-anti His-tag monoclonal antibody (1: 1000 dilution), 300 * g, 4 ℃ of centrifugal 5min, abandon supernatant liquor, PBS washes cell, repeats 3 times, how anti-the rabbit anti-mouse igg that cell is resuspended in 20 μ l FITC marks is, 4 ℃ of common incubation 30min, 300 * g, 4 ℃ of centrifugal 5min, abandon supernatant liquor, PBS washes cell, repeats 2 times, and FACS measures fluorescence intensity.With monoclonal antibody HIT3a and HIT19a as positive control, and with CD 3-CD 19 resisting mini-type difunctional antibody (Diabody) relatively.

The result shows that the stable CD 3-CD 19 resisting mini-type difunctional antibody of disulfide linkage can combine with Raji and Jurkat cell-specific, illustrate that this bifunctional antibody has and CD3 and CD19 target antigen binding ability, and close with the CD 3-CD 19 resisting mini-type difunctional antibody binding ability before transforming, kept biologic activity (Fig. 5-1,5-2,5-3,5-5,5-6,5-7).

1.2 stable CD 3-CD 19 resisting mini-type difunctional antibody (ds-Diabody) the competitive immunization fluorescence of disulfide linkage suppresses experiment:

Get certain density purifying ds-Diabody and mix with anti-CD19 monoclonal antibody HIT19a or anti-CD3 monoclonal antibody HIT3a respectively, again with 1 * 10 ⁶4 ℃ of common incubation 1h of Raji cell or Jurkat cell, 300 * g, 4 ℃ of centrifugal 5min abandon supernatant liquor, and PBS washes cell, repeats 3 times.How anti-the rabbit anti-mouse igg of 20 μ l FITC marks is, 4 ℃ of common incubation 30min, and 300 * g, 4 ℃ of centrifugal 5min abandon supernatant liquor, and PBS washes cell, repeats 2 times, and FACS measures fluorescence intensity.

Monoclonal antibody HIT19a and HIT3a respectively with Raji cell and the independent incubation of Jurkat cell, cell is near 100% in conjunction with positive rate, and ds-Diabody mixes with above-mentioned monoclonal antibody, with Raji cell or the common incubation of Jurkat cell, cell only has 63.3% and 51.1% (Fig. 5-4,5-8) in conjunction with positive rate again.Illustrate that the full resistive connection that this bifunctional antibody can suppress same epi-position closes.

2. the stable external serum stability of CD 3-CD 19 resisting mini-type difunctional antibody (ds-Diabody) of disulfide linkage detects

CD 3-CD 19 resisting mini-type difunctional antibody (Diabody) before ds-Diabody behind the purifying and the transformation is placed 37 ℃ of PBS that contain 0.2% human serum albumin (HSA) respectively, incubation 0h, 0.5h, 1h, 4h, 8h, 12h, 24h, 48h and 72h under 37 ℃ of conditions; Get antibody after hatching respectively in above-mentioned different time points, with 1 * 10 ⁶4 ℃ of common incubation 1h of Raji cell or Jurkat cell, 4 ℃, the centrifugal 10min of 300 * g; Abandon supernatant, PBS washes cell 2 times, abandons supernatant; Cell is resuspended among the 100 μ L PBS, add anti-His-tag monoclonal antibody, making its final concentration is 10 μ g/mL, hatch 1h for 4 ℃, PBS washes 3 times, abandon supernatant, cell is resuspended in the sheep anti-mouse igg polyclonal antibody of 20 μ L FITC marks, incubate 40min for 4 ℃, to 4 ℃, 2000rpm, centrifugal 10min, PBS wash 3 times, abandon supernatant, cell is resuspended among the 300 μ L PBS, after 300 order nylon cloths filter, the FCM fluorescence intensity, the sheep anti-mouse igg polyclonal antibody that only adds the FITC mark in the homotype contrast, ds-Diabody is constant substantially in conjunction with activity more than the incubation 72h in 37 ℃ of PBS that contain 0.2% human serum albumin (HSA) after testing, and obviously descending in conjunction with active of diabody illustrates through the stable anti-CD19 bifunctional antibody of the anti-CD3-biologic activity of transformed disulfide linkage more stable.(Fig. 6,7)

3. the vitro cytotoxicity experiment of the stable CD 3-CD 19 resisting mini-type difunctional antibody (ds-Diabody) of disulfide linkage mediation

Calcein acetoxymethyl ester (Calcein-AM) is a kind of endochylema fluorescent marker, pair cell is nontoxic, no fluorescence own, the water-soluble green fluorescence material that the catalysis of cell lactonase generates behind the infiltration cell is difficult for appearing cell, target cell hatches jointly with the effector cell after with its mark, at lethal effect in the time, the survival target cell only has a small amount of background to overflow, and by the target cell killed and wounded or dead cell since the damaged film of cytolemma have more fluorescent substance and spill in the nutrient solution, by the fluorescence intensity in the quantitative assay nutrient solution on the fluorescent scanning instrument, with maximum release supernatant (the representing cell 100% to discharge) comparison of target cell control wells.Can calculate the effector cell and kill and wound target cell %.

Concrete experimental procedure is as follows:

The preparation of PBL: separate healthy people with density gradient centrifugation (Ficoll-Hypaque) and be rich in mononuclearcell in the hematoblastic tunica albuginea, cell density is adjusted to 3 * 10 ⁶/ mL adds IL-2 (50U/mL), and with the RPMI1640 substratum that contains 10%FCS, sterile culture 72h under 37 ℃, 5%CO2 and saturated humidity condition gets the cell of suspension growth.

With target cell CD19 ⁺The Raji cell cultures to logarithmic growth after date, harvested cell.

Inoculation target cell (Raji) and effector cell (PBLs) is to 96 orifice plates: adjustment target cell density is 1 * 10 ⁶/ ml, add final concentration and be the RPMI 1640 substratum incubation cell 1h of Calcein-AM of 10 μ mol/L after, according to every hole 1 * 10 ⁴/ ml adds 96 orifice plates.

The effector cell is according to imitating target than 25: 1,12.5: 1, added activatory PBL in 6: 1 and 3: 1 respectively, and set up grouping to add the (500ng/ml of different concns, 50ng/ml, 5ng/ml), dissimilar antibody, each experimental port is all established three multiple holes, sets up spontaneous release of target cell and the maximum control group that discharges simultaneously.Specifically be grouped as follows:

Each target is imitated than (4 kinds of targets are imitated ratio), and every kind of antibody concentration (3 kinds of antibody concentration) is grouped as follows

1.PBL+PBS+Raji

2.PBL+Diabody+Raji

3.PBL+ds-Diabody+Raji

4.PBL+ anti-CD3scFv (antiCD3scFv)+anti-CD 19scFv (antiCD19scFv)+Raji

5.PBL+ the anti-Pgp of anti-CD3/ (antiCD3/antiPgp)+Raji

Wherein: Diabody is the CD 3-CD 19 resisting mini-type difunctional antibody before transforming;

Anti-CD3scFv is the anti-CD3 strand variable region antibody that contains the same antigen epi-position with ds-Diabody

Anti-CD19scFv is the anti-CD19 strand variable region antibody that contains the same antigen epi-position with ds-Diabody

The anti-Pgp of anti-CD3/ is the bifunctional antibody of anti-CD3 and anti-P glycoprotein

Every experimental port reaction system 100 μ l, the anti-Pgp bifunctional antibody of wherein anti-CD3/ is irrelevant antibody control.

Other establishes PBL+PBS+K562, PBL+diabody+K562, and the irrelevant cell control group of PBL+ds-Diabody+K562, wherein K562 is irrelevant target cell, gets diabody and ds-Diabody 500ng/ml, imitating the target ratio is 25: 1.

The centrifugal 4min of 250 * g makes the effector cell contact with target cell.At 37 ℃, 5%CO ₂After cultivating 4h under the condition, centrifugal 300 * g, 5min, each group is got supernatant 80 μ l respectively, measures fluorescence intensity with Fluoroskan Ascent FL (Thermo) fluorescence microplate reader, and excitation wavelength is 438nm, and emission wavelength is 535nm.Be calculated as follows the percentage of specific killing: cell killing per-cent %=(the spontaneous release of test group-target cell) * 100/ (the spontaneous release of the maximum release-target cell of target cell).The maximum release of target cell is the Triton-X100 that adds final concentration 1% in spontaneous release aperture, incubation 45min, experimental result such as Fig. 8,9,10.

The result shows, under the situation that ds-Diabody exists, activated T lymphocyte can the specificity cracking be expressed the target cell Raji of CD19, and along with increasing of antibody concentration, the effect of activated T lymphocytolysis target cell strengthens gradually.When effect target ratio increases gradually, the effect of activated T lymphocytolysis target cell strengthens gradually, and when expressing negative K562 cell as target cell with CD19, the percentage of the lysis of ds-Diabody mediation does not have significant difference with the PBS that does not add antibody, disclosed the stable CD 3-CD 19 resisting mini-type difunctional antibody of disulfide linkage and had the effect that specificity mediation activated T lymphocyte kills and wounds CD19 expression male tumour cell, and the power of lethal effect demonstrates effect target ratio and dosage is proportional.

SEQUENCELISTINNG

＜110〉Inst. of Hematology, Chinese Academy of Medical Sciences

＜120〉stable CD 3-CD 19 resisting mini-type difunctional antibody of disulfide linkage and preparation method thereof

<130>2010-05-12

<160>4

<170>PatentIn?version?33

<210>1

<211>705

<212>DNA

＜213〉anti-CD3VL100 position is the anti-CD19VH of anti-CD3VL/ of cysteine mutation

<400>1

gctgacatcg?agctcaccca?gtctccagca?atcatgtctg?catctccagg?ggagaaggtc 60

accatgacct?gcagtgccag?ctcaagtgta?agttacatga?actggtacca?gcagaagtca 120

ggcacctccc?ccaaaagatg?gatttatgac?acatccaaac?tggcttctgg?agtccctgct 180

cgcttcagtg?gcagtgggtc?tgggacctct?tactctctca?caatcagcgg?catggaggct 240

gaagatgctg?ccacttatta?ctgccagcag?tggagtagta?acccattcac?gttcggctgt 300

gggaccaagc?tggagctgaa?acggggtggc?ggagggtcgc?aggtccagct?gcagcagtct 360

ggggctgagc?tggtgaggcc?tgggtcctca?gtgaagattt?cctgcaaggc?ttctggctat 420

gcattcagta?gctactggat?gaactgggtg?aagcagaggc?ctggacaggg?tcttgagtgg 480

attggacaga?tttatcctgg?agatggtgat?actaactaca?atggaaagtt?caagggtcaa 540

gccacactga?ctgcagacaa?atcctccagc?acagcctaca?tgcagctcag?cggcctgaca 600

tctgaggact?ctgcggtcta?tttctgtgca?agaaagacca?ttagttcggt?agtagatttc 660

tactttgact?actggggcca?aggcaccact?ctcacagtct?cctca 705

<210>2

<211>696

<212>DNA

＜213〉anti-CD3VH44 position is the anti-CD3VH of anti-CD19VL/ of cysteine mutation

<400>2

gacattgtgc?tcacccagtc?tccaaaattc?atgtccacat?cagtaggaga?cagggtcagc 60

tcacctgcaa?aggccagtca?gaatgtgggt?actaatgtag?cctggtatca?acagaaacca 120

ggacaatctc?ctaaaccact?gatttactcg?gcaacctacc?ggaacagtgg?agtccctgat 180

cgcttcacag?gcagtggatc?tgggacagat?ttcactctca?ccatcactaa?cgtgcagtct 240

aaagacttgg?cagactattt?ctgtcaacaa?tataacaggt?atccgtacac?gtccggaggg 300

gggaccaagc?tggaaataaa?acggggtggc?ggagggtcgc?aggtgcagct?gcagcagtct 360

ggggctgaac?tggcaagacc?tggggcctca?gtaaagatgt?cctgcaaggc?ttctggctac 420

acctttacta?ggtacacgat?gcactgggta?aaacagaggc?ctggacagtg?cctggaatgg 480

attggataca?ttaatcctag?ccgtggttat?actaattaca?atcagaagtt?caaggacaag 540

gccacattga?ctacagacaa?atcctccagc?acagcctata?tggagctcac?taggctgaca 600

tctgaggact?ctgcagtcta?ttactgtgca?agatattacg?atgatcatta?cagccttgac 660

tactggggcc?aaggcaccac?ggtcaccgtc?tcctca 696

<210>3

<211>235

<212>PRT

＜213〉anti-CD3VL100 position is the anti-CD19VH of the anti-CD3VL/ of cysteine mutation

<400>3

 

Ala?Asp?Ile?Glu?Leu?Thr?Gln?Ser?Pro?Ala?Ile?Met?Ser?Ala?Ser?Pro

1 5 10 15

Gly?Glu?Lys?Val?Thr?Met?Thr?Cys?Ser?Ala?Ser?Ser?Ser?Val?Ser?Tyr

20 25 30

Met?Asn?Trp?Tyr?Gln?Gln?Lys?Ser?Gly?Thr?Ser?Pro?Lys?Arg?Trp?Ile

35 40 45

Tyr?Asp?Thr?Ser?Lys?Leu?Ala?Ser?Gly?Val?Pro?Ala?Arg?Phe?Ser?Gly

50 55 60

Ser?Gly?Ser?Gly?Thr?Ser?Tyr?Ser?Leu?Thr?Ile?Ser?Gly?Met?Glu?Ala

65 70 75 80

Glu?Asp?Ala?Ala?Thr?Tyr?Tyr?Cys?Gln?Gln?Trp?Ser?Ser?Asn?Pro?Phe

85 90 95

Thr?Phe?Gly?Cys?Gly?Thr?Lys?Leu?Glu?Leu?Lys?Arg?Gly?Gly?Gly?Gly

100 105 110

Ser?Gln?Val?Gln?Leu?Gln?Gln?Ser?Gly?Ala?Glu?Leu?Val?Arg?Pro?Gly

115 120 125

Ser?Ser?Val?Lys?Ile?Ser?Cys?Lys?Ala?Ser?Gly?Tyr?Ala?Phe?Ser?Ser

130 135 140

Tyr?Trp?Met?Asn?Trp?Val?Lys?Gln?Arg?Pro?Gly?Gln?Gly?Leu?Glu?Trp

145 150 155 160

Ile?Gly?Gln?Ile?Tyr?Pro?Gly?Asp?Gly?Asp?Thr?Asn?Tyr?Asn?Gly?Lys

165 170 175

Phe?Lys?Gly?Gln?Ala?Thr?Leu?Thr?Ala?Asp?Lys?Ser?Ser?Ser?Thr?Ala

180 185 190

Tyr?Met?Gln?Leu?Ser?Gly?Leu?Thr?Ser?Glu?Asp?Ser?Ala?Val?Tyr?Phe

195 200 205

Cys?Ala?Arg?Lys?Thr?Ile?Ser?Ser?Val?Val?Asp?Phe?Tyr?Phe?Asp?Tyr

210 215 220

Trp?Gly?Gln?Gly?Thr?Thr?Leu?Thr?Val?Ser?Ser

225 230 235

<210>4

<211>232

<212>PRT

＜213〉anti-CD3VH44 position is the anti-CD3VH of anti-CD19VL/ of cysteine mutation

<400>4

Asp?Ile?Val?Leu?Thr?Gln?Ser?Pro?Lys?Phe?Met?Ser?Thr?Ser?Val?Gly

1 5 10 15

Asp?Arg?Val?Ser?Ser?Pro?Ala?Lys?Ala?Ser?Gln?Asn?Val?Gly?Thr?Asn

20 25 30

Val?Ala?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Gln?Ser?Pro?Lys?Pro?Leu?Ile

35 40 45

Tyr?Ser?Ala?Thr?Tyr?Arg?Asn?Ser?Gly?Val?Pro?Asp?Arg?Phe?Thr?Gly

50 55 60

Ser?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Thr?Asn?Val?Gln?Ser

65 70 75 80

Lys?Asp?Leu?Ala?Asp?Tyr?Phe?Cys?Gln?Gln?Tyr?Asn?Arg?Tyr?Pro?Tyr

85 90 95

Thr?Ser?Gly?Gly?Gly?Thr?Lys?Leu?Glu?Ile?Lys?Arg?Gly?Gly?Gly?Gly

100 105 110

Ser?Gln?Val?Gln?Leu?Gln?Gln?Ser?Gly?Ala?Glu?Leu?Ala?Arg?Pro?Gly

115 120 125

Ala?Ser?Val?Lys?Met?Ser?Cys?Lys?Ala?Ser?Gly?Tyr?Thr?Phe?Thr?Arg

130 135 140

Tyr?Thr?Met?His?Trp?Val?Lys?Gln?Arg?Pro?Gly?Gln?Cys?Leu?Glu?Trp

145 150 155 160

Ile?Gly?Tyr?Ile?Asn?Pro?Ser?Arg?Gly?Tyr?Thr?Asn?Tyr?Asn?Gln?Lys

165 170 175

Phe?Lys?Asp?Lys?Ala?Thr?Leu?Thr?Thr?Asp?Lys?Ser?Ser?Ser?Thr?Ala

180 185 190

Tyr?Met?Glu?Leu?Thr?Arg?Leu?Thr?Ser?Glu?Asp?Ser?Ala?Val?Tyr?Tyr

195 200 205

Cys?Ala?Arg?Tyr?Tyr?Asp?Asp?His?Tyr?Ser?Leu?Asp?Tyr?Trp?Gly?Gln

210 215 220

Gly?Thr?Thr?Val?Thr?Val?Ser?Ser

225 230

Claims (5)

1. the CD 3-CD 19 resisting mini-type difunctional antibody that disulfide linkage is stable is characterized in that: based on anti-CD3-anti-CD 19 antibodies, at anti-CD3V _LThe 100th amino acids Ser and anti-CD3V _HThe 44th amino acids Gly introduces amino acid Cys sudden change, expresses after product and has by sequence 3 the anti-CD3V shown in the sequence 4 _L-100 and anti-CD3V _HThe structure that the disulfide linkage that-44 halfcystine forms connects.

2. the stable CD 3-CD 19 resisting mini-type difunctional antibody of disulfide linkage according to claim 1 is characterized in that: described amino acid Cys sudden change is at the weight chain variable region of anti-CD3 mouse monoclonal antibody HIT3a.

3. the stable CD 3-CD 19 resisting mini-type difunctional antibody of disulfide linkage according to claim 1 is characterized in that: the molecular weight of described expression after product is 55kDa.

4. the preparation method of the stable CD 3-CD 19 resisting mini-type difunctional antibody of a disulfide linkage as claimed in claim 1 is characterized in that being made up of following steps:

(1) utilization PCR and overlap PCR method are at anti-CD3V _LThe 100th amino acids Ser and anti-CD3V _HThe 44th amino acids Gly introduces amino acid Cys sudden change, obtains 2 mutant nucleotide sequences;

(2) with above-mentioned sequence clone in intermediate carrier pB11d1-100 and pBYZ11d2-44, cut, verify and obtain anti-CD3V through enzyme _L-anti-CD19V _HWith anti-CD19V _L-anti-CD3V _HGene fragment;

(3) two gene fragments that step (2) is obtained are fused among the colibacillus expression plasmid pAYZ-dsCD3CD19, then plasmid pAYZ-dsCD3CD19 is transformed among the competence intestinal bacteria 16C9, cultivates, enzyme is cut and sequence verification expression vector establishment success;

(4) single bacterium colony that step (3) empirical tests plasmid pAYZ-dsCD3CD19 is successfully constructed is cultivated, and carries out the cracking of bacterium after the cultivation and slightly carries, and obtains crude extract;

(5) crude extract that step (4) is obtained carries out purifying and evaluation, obtains the stable CD 3-CD 19 resisting mini-type difunctional antibody of disulfide linkage.

5. the preparation method of the CD 3-CD 19 resisting mini-type difunctional antibody that disulfide linkage according to claim 4 is stable is characterized in that: the culturing process of described single bacterium colony is as follows:

(1) with single colony inoculation in the 2YT substratum that contains the 0.1mg/mL penbritin, 37 ℃ of shaking culture 8h;

(2) transfer in 28 ℃ of shaking culture 28h of the Ap5 substratum that contains the 0.1mg/mL penbritin in 1: 2 ratio, 4 ℃, the centrifugal collection thalline of 2500 * g.

Images