CN101897960A - hNgR-Fc fusion protein vaccine for promoting regeneration and functional recovery of central nerves - Google Patents
hNgR-Fc fusion protein vaccine for promoting regeneration and functional recovery of central nerves Download PDFInfo
- Publication number
- CN101897960A CN101897960A CN2010101466570A CN201010146657A CN101897960A CN 101897960 A CN101897960 A CN 101897960A CN 2010101466570 A CN2010101466570 A CN 2010101466570A CN 201010146657 A CN201010146657 A CN 201010146657A CN 101897960 A CN101897960 A CN 101897960A
- Authority
- CN
- China
- Prior art keywords
- hngr
- regeneration
- protein vaccine
- gold
- amalgamation protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention belongs to the field of biomedicine and relates to an hNgR-Fc fusion protein vaccine for promoting the regeneration and the functional recovery of central nerves. The hNgR-Fc fusion protein vaccine is a composition prepared by the following steps of: dissolving purified hNgR-Fc fusion protein in a buffer solution, mixing the obtained solution with isometric colloidal gold to obtain a mixed solution, and then adding a stabilizer in the mixed solution to obtain the composition. The vaccine has the effect of better immunization and less toxic and side effect and can promote the regeneration and the functional recovery of the central nerves.
Description
Technical field
The invention belongs to biomedical sector, relate to a kind of hNgR-Fc amalgamation protein vaccine that can promote nervus centralis regeneration and functional rehabilitation.
Background technology
(Colloidal gold CG) is meant a kind of existence of nanogold particle to gold colloidal, and promptly the gold particle size is about between 1～100nm, exists in solution.Gold colloidal is the aqueous solution of gold chloride, belongs to suspension, is electronegative colloid.The glue goldc grains is the same with other glue also to have double-deck electric structure, and the center is the glue gold nuclear that many golden molecules constitute, and it is outer to be AuO
2 -And the adsorption layer of part counter ion formation, glue gold nuclear is formed the glue goldc grains together with adsorption layer.Gold colloidal belongs to monocrystalline and polycrystalline microgranule as other nano-particle, have small-size effect, surface of good and interfacial effect, targeting and slow releasing function etc.At present, gold colloidal is mainly used in immuno-gold labeling technology and related sensor technology, also is not applied to the research report of immunological adjuvant.
The routine immunization adjuvant that present humans and animals is used mainly is emulsive oil-water adjuvant, metallic salt adjuvant (as aluminium adjuvant), complete freund adjuvant (Complete Freund ' s adjuvant, CFA) and not exclusively freund adjuvant (Incomplete Freund ' s adjuvant, IFA) etc.But the polypeptide that they are more weak to antigenicity, particularly recombinant antigen poor effect, or there is serious adverse, the injection back often causes aseptic suppuration in the injection site, sometimes also can form granuloma, and have secular oil to be stranded in tissue, problem such as easily cause allergic reaction.
Studies show that, compare that the main cause of nervus centralis (CNS) regeneration failure is because the existence of multiple regeneration inhibition molecule in the damage microenvironment with the successful regeneration behind the peripheral nerve injury.Found that at present this axon regeneration suppresses molecule and mainly contains three kinds: Nogo-A, MAG (Myelin-associated glycoprotein) and OMgp (Oligodendrocyte-myelin glycoprotein), although three's protein structure is obviously different, but all can pass through a coreceptor Nogo-66 receptor (Nogo-66receptor, NgR) and the possible signal path in downstream, participate in the inhibitory action of neuranagenesis.Although there are some researches show myeloid tissue's homogenate of employing or myelin extract immune animal treatment spinal cord injury (Spinal cord injury, SCI) can seal its inhibitory action by producing antibody, promote the recovery of Spinal Cord, but myeloid tissue's homogenate or myelin extract component are complicated especially, and the risk of bringing out autoimmune disease is high.In view of the special target molecule effect of NgR; selecting NgR is that immunogen both can promote axon regeneration after the spinal cord injury; neuron is played a protective role; can farthest reduce the risk that brings out autoimmune disease again; thereby opened up the new way that overcomes CNS regeneration failure, provide new opportunity for further disclosing the exploitation of mechanism of nerve regeneration and related drugs.
Summary of the invention
The purpose of this invention is to provide the regenerated hNgR-Fc amalgamation protein vaccine of a kind of promotion nervus centralis, improving its immune effect, and reduce its toxic and side effects.
The regenerated hNgR-Fc amalgamation protein vaccine of promotion nervus centralis of the present invention is the compositions of being made by following method:
The hNgR-Fc fusion rotein of purification is dissolved in the buffer, gained solution mix with isopyknic gold colloidal mixed liquor, in mixed liquor, add stabilizing agent.
The concentration of hNgR-Fc fusion rotein in compositions is 30～60 μ g/ml.
The pH value of described buffer is 4～9.
Described buffer is that concentration is the sodium citrate buffer solution of 0.005～0.015M.
The particle diameter of described gold colloidal is 10～50nm.
Described stabilizing agent is a Macrogol 2000 0, and its concentration in compositions is 200～500 μ g/ml.
The present invention as immunogen, and adopts the immunological adjuvant of gold colloidal as protein vaccine with hNgR-Fc (Fragment cristallizable) fusion rotein.Receptor-Fc fusion rotein has been proved to be except antibody drug, removes the another effective means of unnecessary ligand molecular in the body.Receptor domain is carried out the function of binding partner in fusion rotein, and the Fc part can have multiple effect, as using general labelling two anti-detections, can be by using affinity chromatograph purification easily with combining of protein A, prolong drug half-life in vivo greatly, extra biological effect can be provided, (Antibody dependent cell mediated cytotoxicity ADCC) waits immunoregulatory activity to the cytotoxicity that mediates as complement activation, antibody dependent cellular.Compare with antibody drug, receptor-Fc fusion rotein can carry out loaded down with trivial details antibody screening and humanization process, and has advantages such as affinity height, immunogenicity be low.
Colloid gold particle labelled protein (antibody, antigen) is the combination that attracts generation by the charges of different polarity, and this combination does not influence protein biological activity and immunocompetence, and this provides theoretical foundation for gold colloidal as immunological adjuvant.The nano-particle good uniformity, with it as adjuvant, can effectively avoid carrier effect, delay antigenic release, lasting enhancing body humoral immunization and stimulation lymphopoiesis, antigen particles that the more important thing is its parcel is that the first-selection of macrophage (M φ) and dendritic cell (DC) is engulfed target, for the effective immune response of realizing body steps essential step.Nano-particle also can form hydrogel, is particularly suitable for doing protein/polypeptide class pharmaceutical carrier, and does not need crosslinked other reagent or adjuvant.
Preparation colloidal nano gold grain has multiple diverse ways, and the present invention adopts the nanogold particle of the different grain of trisodium citrate reduction method preparation warp.For verifying the reliability of the nanometer gold that trisodium citrate reduction method prepares, utilize the ascorbic acid reducing process to prepare the close nanometer gold of particle diameter and compare experiment.Identify the size and the uniformity of the nanogold particle of preparation by bore hole observation, Tyndall phenomenon, visible light method and scanning electron microscope.
For observing the influence of nanogold particle to the rat immunity function, the nanometer gold that the present invention has designed different-grain diameter and 9 combinations of three kinds of dosage preferably of three kinds of uniformitys carries out intramuscular injection to SD (Sprague-Dawley) rat, and has designed one group of normal control experiment; Observation simultaneously has or not the experimental allergic encephalomyelitis, and (Exprerimental allergic encephalomyelitis, generation EAE) is with the safety of proof with the nanometer gold immune rat.Adopt tetrazolium bromide (Thiazolyl blue, MTT) the propagation situation of colorimetric method for determining peripheral blood and spleen lymphocyte.Because IL-2 is the lymphopoietic crucial immunological enhancement factor of T, and the activated T cell produces the important indicator that the power of IL-2 ability can be used as the evaluation body's immunity, and the present invention adopts the IL-2 level in ELISA method detection peripheral blood separation of serum and the spleen lymphocyte.The result shows: the nanometer gold of different-grain diameter and dosage all can promote the propagation of SD rat peripheral blood and spleen lymphocyte in various degree, wherein 15nm/0.6ml dosage group and 25nm/0.4ml dosage group have stronger facilitation to rat peripheral blood lymphocyte propagation, and 15nm/0.6ml dosage group is then the strongest to spleen lymphocyte propagation facilitation.Compare with the normal control group, the gold colloidal of different-grain diameter various dose all can promote the secretion of peripheral blood and spleen lymphocyte IL-2, wherein peripheral blood 15nm/0.6ml dosage group facilitation is the most obvious, and then 15nm/0.6ml and 25nm/0.6ml dosage group facilitation are stronger in the spleen.The safety evaluatio result of nanometer gold confirms that nanometer gold has very strong safety as immunological adjuvant.
For obtaining the hNgR-Fc fusion rotein of a large amount of natural expression, the present invention is a template with carrier for expression of eukaryon pcDNA-hNgR-Fc plasmid (preservation of this laboratory), obtains the hNgR-Fc fragment through pcr amplification.The primer is as follows:
Forward?primer：5′GGAATTC
CATATGAAGAGGGCGTCCGCTGG?3′
Nde I restriction enzyme site
Reverse?pr?imer：5′CCG
CTCGAGTTACCCCGGGGACAGGGAGAG?3′
Xho I restriction enzyme site
The primer two ends are introduced Nde I and Xho I restriction enzyme site respectively, the hNgR-Fc fragment of pcr amplification, behind Nde I and Xho I double digestion, reclaim purification and it is cloned in the pET30a+ of same double digestion expression vector (Invitrogen) acquisition pET-hNgR-Fc recombinant expression plasmid.Through PCR, enzyme action and order-checking identify correct after with recombinant plasmid transformed abduction delivering to the E.coli BL-21pLys competent cell, and the destination protein of expressing is identified by SDS-PAGE.Come target protein hNgR-Fc in the broken bacterium supernatant of enrichment and purification by Protein A affinity column then, and carry out that SDS-PAGE analyzes and Western blot evaluation.
With the hNgR-Fc fusion rotein that obtains key component, prepare the hNgR-Fc amalgamation protein vaccine with the 15nm gold colloidal as immunological adjuvant, and tentatively the vaccine that obtains is carried out the effect observation by experiment in external, the body as vaccine.
Description of drawings
Now in conjunction with the accompanying drawings the present invention is described in further detail.
Figure 1A is that particle diameter is the electron-microscope scanning picture of 15nm gold colloidal;
Figure 1B is that particle diameter is the electron-microscope scanning picture of 50nm gold colloidal;
Fig. 2 is the spectral scan curve chart of nano gold sol, and the colloid gold particle uv-visible absorption spectra of the diameter 8～13nm of the diameter 10,15,25,50,60,70,98,147 of trisodium citrate reduction method preparation, the colloid gold particle of 160nm and the preparation of ascorbic acid reducing process detects;
Fig. 3 A is that the graph of a relation between peripheral blood lymphocyte propagation and the nanogold particle diameter (compares * *, p＜0.01 with the normal control group; *, p＜0.05);
Fig. 3 B is that the graph of a relation between spleen lymphocyte propagation and the nanogold particle diameter (compares * *, p＜0.01 with the normal control group; *, p＜0.05);
Fig. 4 A be the graph of a relation between IL-2 level and the nanogold particle diameter in the serum (with the normal control group relatively, * *, p＜0.01);
Fig. 4 B be the graph of a relation between IL-2 level and the nanogold particle diameter in the spleen lymphocyte (with the normal control group relatively, * *, p＜0.01);
Fig. 5 A is the PCR qualification result figure of recombiant plasmid pET-hNgR-Fc, wherein 1,2 is respectively false positive and positive colony, and M is Wide Range DNA Marker (500-15000);
Fig. 5 B is recombiant plasmid pET-hNgR-Fc enzyme action qualification result figure, wherein M:DNA MarkerLamda-Hind III Digest; 1:pET-30a (+); 2:pET-hNgR-Fc; 3:pET-hNgR-Fc XhoI single endonuclease digestion; 4:pET-hNgR-Fc Nde I+Xho I double digestion;
Fig. 5 C is the SDS-PAGE figure as a result of the prokaryotic expression of reorganization hNgR-Fc fusion rotein and purification, and wherein 1: inductive thalline breaks the bacterium supernatant; 2: inductive full bacterium lysate; 3: not inductive full bacterium lysate; 4: the reorganization hNgR-Fc fusion rotein of purification;
Fig. 5 D is the Western blot qualification result figure of reorganization hNgR-Fc fusion rotein, wherein 1: not inductive full bacterium lysate; 2: inductive full bacterium lysate; 3: not inductive thalline breaks the bacterium supernatant; 4: inductive thalline breaks the bacterium supernatant;
Fig. 6 is the spectral scan detection curve figure of vaccine stability;
Fig. 7 is the figure as a result that the ELISA method detects the anti-NgR antibody titer in the immune rat serum;
Fig. 8 A is that hNgR-Fc amalgamation protein vaccine immune serum can neutralize and suppresses the inhibitory action of molecule MAG to nervous process, in the culture fluid of handling with MAG in advance, cultivate neonate rat Dorsal root ganglion neuron (Dorsalroot ganglia, DRG), after adding control serum, hNgR-Fc vaccine immunity serum and NgR antibody cultivation 24h respectively without the hNgR-Fc vaccine immunity, the growing state figure of neurite, scale: 25 μ m;
Fig. 8 B is that hNgR-Fc amalgamation protein vaccine immune serum can neutralize and suppresses the inhibitory action of molecule MAG to nervous process, each organizes the statistical analysis figure of the average projection length of neuron, wherein data are expressed as: mean ± standard error (comparing * *, p＜0.01 with MAG+ control serum group);
Fig. 9 A is a hemisection of spinal cord damage model behavioristics testing result, and BBB appraisal result figure (compares *, p＜0.05 with simple damage (SCI) group; *, p＜0.01)
Fig. 9 B is a hemisection of spinal cord damage model behavioristics testing result, and the grid walking is figure as a result, (compares *, p＜0.05 with the SCI group; *, p＜0.01)
Fig. 9 C is spinal cord half a cross-section model behavior testing result, and footprint is figure (red-label rat half sole is slapped after the blue markings) as a result;
Fig. 9 D is a hemisection of spinal cord damage model behavioristics testing result, and footprinting is figure as a result, (comparing * *, p＜0.01 with the SCI group);
Figure 10 A is yellow (the Nuclear yellow of nuclear, NY) retrograde tracing labelling SCI group and SCI+hNgR-Fc immune group pars affecta potential head side (apart from about 5mm place, upstream, damage location center) spinal cord crown (crosscut) and rip cutting slice map, the result shows that hNgR-Fc amalgamation protein vaccine inoculation can promote axonal regeneration after the spinal cord injury, and scale is respectively 300 μ m and 149.82 μ m;
Figure 10 B is yellow (the Nuclear yellow of nuclear, NY) the retrograde tracing result shows that hNgR-Fc amalgamation protein vaccine inoculation can promote axonal regeneration after the spinal cord injury, represent that with the fluorescence intensity of the regeneration aixs cylinder fiber of the retrograde labelling in the spinal cord axonal regeneration situation (compares with the SCI group, *, p＜0.01);
Figure 11 is the as a result figure of histological observation hNgR-Fc amalgamation protein vaccine inoculation to the influence of Spinal Cord neuron, and the result shows that the inoculation of hNgR-Fc amalgamation protein vaccine has significant protective effect to the Spinal Cord neuron, scale: 100 μ m.
Specific implementation method
Embodiment 1: trisodium citrate reduction method prepares nanometer gold
Elder generation is with the HAuCl of 0.1g/l
4Aqueous solution 50ml is heated to boiling, under agitation adds the 10g/l trisodium citrate aqueous solution immediately rapidly, can prepare the nanometer gold of different-grain diameter respectively according to the difference that adds the trisodium citrate aqueous solution amount.
For verifying that further trisodium citrate reduction method prepares the reliability of nanometer gold, the present invention designs with ascorbic acid reduction method for preparing nanometer gold and tests in contrast.Will be at the 1%HAuCl of 4 ℃ of pre-coolings
4Aqueous solution 1ml, 0.2mol/l K
2CO
31.5ml, distilled water 25ml mixing.Under agitation add 1ml 0.7% aqueous ascorbic acid, present aubergine immediately.Add distilled water to 100ml, be heated to solution and become till the transparent red color, the colloid gold particle diameter is 8～13nm.
Identify the size and the uniformity of the nanogold particle of preparation by bore hole observation, Tyndall phenomenon, visible light method and scanning electron microscope.The result shows that the size and the uniformity of the nanogold particle of preparation all meet the requirements.
Embodiment 2: immune animal
The present invention choose 8～10 age in week 60 of normal adult SD rats, body weight 200～220g, male and female are regardless of.Adopt three kinds of better nanometer gold of the particle diameter uniformity, three kinds of dosage of every kind of particle diameter, totally 9 combinations add a control experiment group, totally 10 processing.Handle 1～3 combination and inject nanometer gold 0.2ml, 0.4ml and three kinds of dosage groups of 0.6ml that diameter is 10nm respectively, handle 0.2ml, 0.4ml and three kinds of dosage groups of 0.6ml that 4～6 combinations are respectively 15nm, handle 0.2ml, 0.4ml and three kinds of dosage groups of 0.6ml that 7～9 combinations are respectively 25nm.Handling 10 is the normal control group, is left intact.Every group 6, the common cubed feed of feeding, free diet water inlet.Immunization ways is the hindlimb muscle multi-point injection, and injection in per two days 1 time is injected 4 times altogether, handles at the 4th injection back 7d.
Embodiment 3: the safety evaluatio of nanometer gold
Consider that nanometer gold might stimulate the autoimmune response of body generation at the marrowbrain normal structure, bring out rat allergic encephalomyelitis (Experimnetal allergic Encephalomyelitis, EAE), thereby a series of toxic and side effects symptom takes place, and the present invention has observed rat EAE simultaneously, and a situation arises.The result shows that all rats reduce at immunity all appearance activities in back second day, diet, keeps after one day and progressively alleviates, and after this body weight increases gradually, does not have dead rat.EAE symptom and performance all do not appear in first immunisation to immune overall process.Confirm that nanometer gold does not induce rat EAE, have biological safety preferably.
Embodiment 4:MTT method detects lymphocytic propagation
1, draws materials
(1) the SD rat is carried out intraperitoneal anesthesia with 1% pentobarbital sodium, behind 75% alcohol disinfecting, open the abdominal cavity; Syringe extracts heart blood 3～4ml fast.Wherein 1ml transfers in the EP pipe of anticoagulant heparin sodium, is kept in 4 ℃ of refrigerators; 1ml transfers in the EP pipe that does not add anticoagulant, and room temperature is placed, the centrifugal 20min of 2000rpm after the coagulation, and-20 ℃ of preservations in the EP pipe of absorption serum are standby.
(2) get the spleen of rat fast, in PBS liquid, clean immediately.Get fast subsequently 0.1g in 1ml EP pipe and in liquid nitrogen, change over to after the quick-freezing in-70 ℃ of refrigerators preserve standby.
(3) take by weighing spleen 0.1g in addition, change in the 5ml centrifuge tube after continuing to clean with Hank ' s liquid, add the RPMI1640 culture fluid, use when 4 ℃ of preservations are waited to get spleen lymphocyte.
2, the MTT of peripheral blood lymphocyte detects
(1) get anticoagulation 1ml and 1: 1 mixing of Hank ' s liquid in the 5ml centrifuge tube after, fill in the 5ml centrifuge tube of 2ml cell separation liquid careful the adding, with the centrifugal 15min of 2000rpm, collects supernatant;
(2) put into the 5ml centrifuge tube that contains Hank ' s liquid, fully behind the mixing, with the centrifugal 10min of 1500～2000rpm.Supernatant is removed in suction, and precipitation promptly obtains required cell through washing 2 times repeatedly;
(3) add 1ml RPMI1640 culture fluid (containing 10% calf serum) suspension cell;
(4) add cell suspension 200 μ l (establishing multiple hole) in 96 hole aseptic culture plates, every hole adds MTT solution 15 μ l.After vibrating gently, 37 ℃ of incubation 3h;
(5) every hole adds dimethyl sulfoxide (DMSO) 100 μ l, gently vibration.After treating that first arm granule dissolves fully, use microplate reader in 590nm wavelength measurement OD value.
3, the MTT of spleen lymphocyte detects
(1) in superclean bench, the taking-up of the spleen in the culture fluid is placed in the culture dish, reject the spleen surrounding tissue, be trimmed to pasty state repeatedly, place 200 purpose cells sieve to go up and gently grind spleen with piston with shears, the culture fluid flushing filters cell and sieves in another culture dish, is collected in the centrifuge tube;
(2) the centrifugal 10min of 1500rpm abandons supernatant, and the ammonium chloride solution that adds a little sterilization is with lysed erythrocyte, and behind the 5min, the same centrifugal supernatant of abandoning, cell use 1640 liquid of serum-free to wash one time;
(3) with 1ml RPMI1640 culture fluid (containing 10% calf serum) suspension cell, in 96 hole aseptic culture plates, add cell suspension 200 μ l (establishing multiple hole), every hole adds MTT solution 12 μ l, after vibrating gently, 37 ℃ of incubation 3h; (4) every pipe adds an amount of dimethyl sulfoxide 100 μ l, gently the vibration, treat that first arm granule dissolves fully after, with microplate reader in 590nm wavelength measurement OD value.
The result shows, the nanometer gold of different-diameter and dosage all has in various degree influence to the propagation of SD rat peripheral blood and spleen lymphocyte, wherein 15nm/0.6ml dosage group and 25nm/0.4ml dosage group have stronger facilitation to rat peripheral blood lymphocyte propagation, and 15nm/0.6ml dosage group is then the strongest to spleen lymphocyte propagation facilitation.
The detection of embodiment 5:IL-2 level
Behind the colloid gold immune rat, aseptic condition by the heart extracting blood separation of serum, is got spleen, isolated lymphocytes down simultaneously.The PRMI RPMI-1640 that adopts 10ml to contain 5%FBS is made cell suspension, centrifugal 10min.NH through 0.17M
4The Cl splitting erythrocyte, the washing of PRMI RPMI-1640 expects that with platform blue liquid detects cytoactive, determines that living cells surpasses 90%.PRMI 1640 with 10%FBS adjusts splenocyte final concentration to 5 * 10
6/ ml is inoculated in 48 well culture plates, puts 37 ℃ 5% CO
2Cultivate 48h in the incubator.The centrifugal 10min of room temperature collects supernatant.The ELISA method detects the content of IL-2 in serum and the cells and supernatant.Experimental technique is undertaken by the test kit explanation: 20min takes out test kit before the experiment from refrigerator, and balance is to room temperature; By the test kit explanation standard substance are diluted to variable concentrations, establish blank, simultaneously testing sample was diluted by 1: 50; Except that blank well, respectively variable concentrations standard substance and dilute sample 100 μ l/ holes are added in the respective aperture, shrouding glue is sealed reacting hole, hatches 90min for 37 ℃; With cleaning mixture thorough washing ELISA Plate 4～6 times, seal is done on the filter paper; Except that blank well, every hole adds biotinylation one anti-working solution 100 μ l; Fully shrouding glue is sealed reacting hole behind the mixing, hatches 60min for 37 ℃; Wash plate as stated above 4～6 times; Except that blank well, every hole adds enzyme labelled antibody working solution 100 μ l, and shrouding glue is sealed reacting hole, hatches 30min for 37 ℃; It is the same to wash plate; Add developer 100 μ l/ holes, lucifuge is hatched 10～15min for 37 ℃; Add stop buffer 100 μ l/ holes, behind the mixing at once (in the 5min) measure 450nm place light absorption value.Light absorption value and corresponding concentration according to standard substance are made standard curve, and light absorption value per sample reads the concentration of IL-2 correspondence on standard curve.The result shows, compare with the normal control group, the gold colloidal of different-grain diameter various dose all can promote the secretion of peripheral blood and spleen lymphocyte IL-2, wherein 15nm/0.6ml dosage group is the strongest to the secretion facilitation of rat peripheral blood lymphocyte IL-2, and 15nm/0.6ml dosage group and 25nm/0.6ml dosage group then all have stronger facilitation to the secretion of spleen lymphocyte IL-2.
Embodiment 6: people NgR-Fc construction of prokaryotic expression vector and evaluation
For obtaining the people NgR-Fc fusion rotein of a large amount of natural expression, the present invention is a template with carrier for expression of eukaryon pcDNA-hNgR-Fc plasmid (preservation of this laboratory), obtains the hNgR-Fc fragment through pcr amplification.The primer is as follows:
Forward?pr?imer：5′GGAATT
CCATATGAAGAGGGCGTCCGCTGG?3′
Nde I restriction enzyme site
Reverse?primer：5′CCG
CTCGAGTTACCCCGGGGACAGGGAGAG?3′
Xho I restriction enzyme site
The primer two ends are introduced Nde I and Xho I restriction enzyme site respectively, the hNgR-Fc fragment of pcr amplification, behind Nde I and Xho I double digestion, reclaim purification and it is cloned in the pET30a+ of same double digestion expression vector (Invitrogen), obtain the pET-hNgR-Fc recombinant expression plasmid, the correctness of checking carrier construction is identified in the performing PCR of going forward side by side, enzyme action and order-checking.
Embodiment 7: expression, purification and the evaluation of people NgR-Fc soluble fusion protein
To identify correct recombinant plasmid transformed to E.coli BL-21pLys competent cell through enzyme action and order-checking, with the amplification of LB culture medium, and at OD
600Adding IPTG when reaching 0.8 left and right sides is 0.5mmol/L to final concentration, and abduction delivering 3h is by the expression of SDS-PAGE Preliminary detection target protein hNgR-Fc.Come target protein hNgR-Fc in the broken bacterium supernatant of enrichment and purification by Protein A affinity column then, and carry out that SDS-PAGE analyzes and Western-blot (antibody with anti-people Fc resists as) evaluation.Finally obtained the higher people NgR-Fc fusion rotein of purity.
The vaccineization of embodiment 8:hNgR-Fc fusion rotein
The hNgR-Fc fusion rotein of purification is mixed formation hNgR-Fc amalgamation protein vaccine with the 15nm gold colloidal.Consider the stability of gold colloidal, select 0.01M sodium citrate buffer solution (pH=6.0) dissolving hNgR-Fc antigen for use, and mixing back adding stabilizing agent Macrogol 2000 0 (PEG20000) to final concentration 500 μ g/ml with 15nm gold colloidal mixing equal-volume.Select for use 0.01M sodium citrate buffer solution (pH=6.0) reason as follows: adopt trisodium citrate reduction method when one, preparing gold colloidal, this buffer main component is a trisodium citrate, does not introduce new ion, disturbs little to gold colloidal stability; Two, trisodium citrate is as a kind of clinical anticoagulant of using, avirulence; Three, the pH of gold colloidal is close with this pH of buffer.
HNgR-Fc amalgamation protein vaccine process and component are as follows: after the hNgR-Fc fusion rotein of getting 50 μ g purification is dissolved in the 0.01M sodium citrate buffer solution (pH=6) of 0.6ml, mix with 0.6ml 15nm gold colloidal (containing 0.05%PEG) equal-volume, add stabilizing agent PEG20000 at last to final concentration 500 μ g/ml.
Embodiment 9: animal immune and antibody titer detect
50 μ g hNgR-Fc fusion rotein with purification prepare protein vaccine as stated above as antigen, and adopt hindlimb muscle multi-point injection method immunity SD rat (n=6 only).First immunisation is after 2 weeks, booster immunization once, booster immunization is once again after 1 week.Establish simultaneously Freund adjuvant (Freund ' s adjuvant, FA) and gold colloidal (Colloidal gold, CG) contrast.Adopt 50 μ g hNgR-Fc and complete Freund's adjuvant (CFA) during the Freund adjuvant initial immunity, the full Freund adjuvant (IFA) that toos many or too much for use during booster immunization, immunization method is identical.
Behind the booster immunization 2 times, by the heart extracting blood separation of serum and adopt the ELISA method to detect antibody titer.Method is as follows: coated elisa plate in advance, with bag be cushioned liquid (the 0.05M carbonate buffer solution is 1 μ g/ml with its dilution of antigen NgR pH9.6), every hole 100 μ l, blank does not wrap quilt, 4 ℃ are spent the night.(PBS-T 0.05%Tween-20) will wrap by good ELISA Plate washing 3 times, each 2min with cleaning mixture after abandoning liquid.Every hole adds the BSA confining liquid of 100 μ l 1%, 37 ℃ of sealing 1h.Discard confining liquid, wash 3 times.Add different dilution antiserums, every hole 100 μ l are hatched 1h for 37 ℃.Wash the goat-anti rat IgG-HRP (China fir in Beijing) that adds dilution in 1: 10000 after 3 times, every hole 100 μ l are hatched 1h for 37 ℃, after washing 4 times, every hole adds 100 μ l TMB colour developing liquid, and behind 37 ℃ of colour developing 20min, every hole adds 50 μ l stop buffer (2M concentrated sulphuric acid) cessation reactions.Read absorbance (OD value) at 450nm wavelength place with microplate reader.The OD value is judged as the positive greater than negative hole more than 3 times.With the negative contrast of preimmune serum.The result shows that all rats through the hNgR-Fc fusion protein immunization all produce anti-NgR antibody, tires all obviously to be better than Freund adjuvant greater than 1: 6400 and nanometer gold immunological adjuvant; The NgR antibody test is negative in the gold colloidal control rats serum.
Embodiment 10: antiserum is to the influence of neurite growth
Under anatomic microscope, (Dorsal root ganglia DRG), changes in 2ml 0.25% tryptic digestive juice, acts on 20min in 37 ℃ of incubators to win the newborn SD rat dorsal root ganglion in the D-Hank ' of aseptic pre-cooling s liquid one by one; The centrifugal 5min of 1000rpm inhales and removes trypsinization liquid, adds FBS and stops digestion; The centrifugal 5min of 1000rpm inhales and removes FBS, adds DMEM/F12 culture medium (containing 1%FBS) and makes single cell suspension, is seeded in the 35mm Corning culture dish that does not wrap quilt, places 37 ℃ of incubators to hatch 50min; Collect not adherent cell suspension, the centrifugal 5min of 1000rpm changes to Neurobasal (NB) culture medium piping and druming evenly, behind the cell counting with 10
6Individual/ml cell density is seeded in 24 well culture plates of poly-D-lysine bag quilt.
With PBS the MAG protein concentration is transferred to 100ng/ μ l in advance.Treat that the DRG neuron of above-mentioned cultivation changes liquid, every hole 400 μ l NB after adherent.Be divided into 3 groups at random, every group is repeated 2 times.First group: add 1 μ l MAG with without the control serum (1: 100) of hNgR-Fc amalgamation protein vaccine immunity; Second group: add 1 μ l MAG and hNgR-Fc amalgamation protein vaccine immune serum (1: 100); The 3rd group: add 1 μ l MAG and NgR antibody (1: 1000).The above-mentioned cell of respectively organizing is fixed with 4% paraformaldehyde after cultivating 24h, adopts the projection length after Image-ProPlus 5.0 software measurements are cultivated 24h, carries out neurite growth analysis (Neuriteoutgrowth assay).Be to reduce error, test under 200 times of inverted microscopes 10 visuals field of picked at random at every turn and measure, experiment repeats 3 times, answers the hole detection at every turn, averages and carries out statistical analysis.The result shows, hNgR-Fc amalgamation protein vaccine immune serum can in and MAG to the inhibitory action of neurite growth.
Embodiment 11: observe vaccination to the reconstruction of injured spinal cord effect at body
With the hNgR-Fc amalgamation protein vaccine of preparation, the inoculation rat, inoculation method is the same.After 2 weeks of immunity, preparation rat spinal cord half crosscut damage model, in conjunction with bundle road tracking, histological observation and behavioristics's detection technique, the functional rehabilitation situation after regeneration situation, neuronal survival situation and the spinal cord injury of the 6 blind method observation in a week back Spinal Cord nervus lateralis fiber.The detail operations process is as follows: after the spinal cord dorsal column damage, and each treated animal 16～18h before perfusion, yellow (Nuclear yellow NY), represents the axonal regeneration situation with the fluorescence intensity of the regeneration aixs cylinder fiber of the retrograde labelling in the spinal cord at sciatic nerve injection nuclear.The survival condition that histological observation then adopts HE and Nissl's staining method to observe injured neuron respectively.Adopt behavioristics's method (BBB scoring, grid walking, footprint) to detect the recovery situation of hindering rear flank limb function simultaneously.The result shows, the hNgR-Fc amalgamation protein vaccine both can promote axonal regeneration after the spinal cord injury, again neuron was had significant protective effect, also can promote the recovery of function after the spinal cord injury.
HNgR-Fc gene order table
＜110〉Military Medical Univ No.3, P.L.A. field operations Surgery Research Institute
＜120〉the hNgR-Fc amalgamation protein vaccine of regeneration of promotion nervus centralis and functional rehabilitation
<130>/
<160>/
<170>PatentIn?version?3.1
<210>1
<211>2037
<212>DNA
＜213〉homo sapiens (Homo sapiens)
<400>1
1?atgaagaggg?cgtccgctgg?aggaagcagg?ctgctggcat?gggtgttatg?gctacaggcc
61?tggagggtag?caacaccatg?ccctggtgct?tgtgtgtgct?acaatgagcc?caaggtaaca
121?acaagctgcc?cccagcaggg?tctgcaggct?gtgcccactg?gcatcccagc?ctctagccag
181?cgaatcttcc?tgcatggcaa?ccgaatctct?cacgtgccag?ctgcgagctt?ccagtcatgc
241?cgaaatctca?ctatcctgtg?gctgcactct?aatgcgctgg?ctcggatcga?tgctgctgcc
301?ttcactggtc?tgaccctcct?ggagcaacta?gatcttagtg?ataatgcaca?gcttcatgtc
361?gtggacccta?ccacgt?tccacggcctgggc?cacctgcaca?cactgcacct?agaccgatgt
421?ggcctgcggg?agctgggtcc?cggcctattc?cgtggactag?cagctctgca?gtacctctac
481?ctacaagaca?acaatctgca?ggcactccct?gacaacacct?ttcgagacct?gggcaacctc
541?acgcatctct?ttctgcatgg?caaccgtatc?cccagtgtgc?ctgagcacgc?tttccgtggc
601?ctgcacagtc?ttgaccgcct?cctcttgcac?cagaaccatg?tggctcgtgt?gcacccacat
661?gccttccggg?accttggccg?cctcatgacc?ctctacctgt?ttgccaacaa?cctctccatg
721?ctgcctgcag?aggtcctaat?gcccctgagg?tctctgcagt?acctgcgact?caatgacaac
781?ccctgggtgt?gtgactgccg?ggcacgtcca?ctctgggcct?ggctgcagaa?gttccgaggt
841?tcctcatcag?aggtgccctg?caacctgccc?caacgcctgg?cagaccgtga?tcttaagcgc
901?ctcgctgcca?gtgacctaga?gggctgtgct?gtggcttcag?gacccttccg?tcccatccag
961?accagtcagc?tcactgatga?ggagctgctg?agcctcccca?agtgctgcca?gccagatgct
1021?gcagacaaag?cctcagtact?ggaacccggg?aggccagctt?ctgccggaaa?cgccctcaag
1081?ggacgtgtgc?ctcccggtga?cactccacca?ggcaatggct?caggccctcg?gcacatcaat
1141?gactctccat?ttggaacttt?gcccagctct?gcagagcccc?cactgactgc?cctgcggcct
1201?gggggttccg?agccaccagg?acttcccacc?actggtcccc?gcaggaggcc?aggttgttcc
1261?cggaagaatc?gcacccgcag?ccactgccgt?ctgggccagg?cgggaagtgg?ggccagtgga
1321?acaggggacg?cagagggttc?aggggctctg?gctagcgaca?aaactcacac?atgcccactg
1381?tgcccagcac?ctgaactcct?ggggggaccg?tcagccttcc?tcttcccccc?aaaacccaag
1441?gacaccctca?tgatctcccg?gacccctgag?gtcacatgcg?tggtggtgga?cgtgagccac
1501?gaagaccctg?aggtcaagtt?caactggtac?gtggacggcg?tggaggtgca?taatgccaag
1561?acaaagccgc?gggaggagca?gtacaacagc?acgtaccgtg?tggtcagcgt?cctcaccgtc
1621?ctgcaccagg?actggctgaa?tggcaaggag?tacaagtgca?aggtctccaa?caaagccctc
1681?ccagccccca?tcgagaaaac?catctccaaa?gccaaagggc?agccccgaga?accacaggtg
1741?tacaccctgc?ccccatcccg?ggatgagctg?accaagaacc?aggtcagcct?gacctgcctg
1801?gtcaaaggct?tctatcccag?cgacatcgcc?gtggagtggg?agagcaatgg?gcagccggag
1861?aacaactaca?agaccacgcc?tcccgtgctg?gactccgacg?gctccttct?tcctctacagc
1921?aagctcaccg?tggacaagag?caggtggcag?caggggaacg?tcttctcatg?ctccgtgatg
1981?catgaggctc?tgcacaacca?ctacacgcag?aagagcctct?ccctgtcccc?ggggtaa
Claims (8)
1. promoting the hNgR-Fc amalgamation protein vaccine of nervus centralis regeneration and functional rehabilitation, it is characterized in that, is the compositions of being made by following method:
The hNgR-Fc fusion rotein of purification is dissolved in the buffer, gained solution mix with isopyknic gold colloidal mixed liquor, in mixed liquor, add stabilizing agent.
2. according to the hNgR-Fc amalgamation protein vaccine of the described promotion nervus centralis regeneration of claim 1 with functional rehabilitation, it is characterized in that: the concentration of hNgR-Fc fusion rotein in compositions is 30～60 μ g/ml.
3. according to the hNgR-Fc amalgamation protein vaccine of the described promotion nervus centralis regeneration of claim 1 with functional rehabilitation, it is characterized in that: the pH value of described buffer is 4～9.
4. according to the hNgR-Fc amalgamation protein vaccine of claim 1 or 3 described promotion nervus centralis regeneration and functional rehabilitation, it is characterized in that: described buffer is a sodium citrate buffer solution.
5. according to the hNgR-Fc amalgamation protein vaccine of the described promotion nervus centralis regeneration of claim 2 with functional rehabilitation, it is characterized in that: described buffer is that concentration is the sodium citrate buffer solution of 0.005～0.015M.
6. according to the hNgR-Fc amalgamation protein vaccine of the described promotion nervus centralis regeneration of claim 1 with functional rehabilitation, it is characterized in that: the particle diameter of described gold colloidal is 10～50nm.
7. according to the hNgR-Fc amalgamation protein vaccine of the described promotion nervus centralis regeneration of claim 1 with functional rehabilitation, it is characterized in that: described stabilizing agent is a Macrogol 2000 0.
8. according to the hNgR-Fc amalgamation protein vaccine of the described promotion nervus centralis regeneration of claim 6 with functional rehabilitation, it is characterized in that: described stabilizing agent is a Macrogol 2000 0, and its concentration in compositions is 200～500 μ g/ml.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101466570A CN101897960B (en) | 2010-04-14 | 2010-04-14 | hNgR-Fc fusion protein vaccine for promoting regeneration and functional recovery of central nerves |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101466570A CN101897960B (en) | 2010-04-14 | 2010-04-14 | hNgR-Fc fusion protein vaccine for promoting regeneration and functional recovery of central nerves |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101897960A true CN101897960A (en) | 2010-12-01 |
| CN101897960B CN101897960B (en) | 2012-09-12 |
Family
ID=43224100
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101466570A Expired - Fee Related CN101897960B (en) | 2010-04-14 | 2010-04-14 | hNgR-Fc fusion protein vaccine for promoting regeneration and functional recovery of central nerves |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101897960B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105458288A (en) * | 2015-12-02 | 2016-04-06 | 青岛大学 | Preparation method of gold nanoparticle |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1768858A (en) * | 2004-10-18 | 2006-05-10 | 郑宏志 | Composition and method for repairing nerve damage and enhancing functional recovery of nerve |
| CN101288771A (en) * | 2007-04-19 | 2008-10-22 | 上海交通大学医学院 | Preparation method of anti-human Nogo-66 receptor protein vaccine and application thereof |
-
2010
- 2010-04-14 CN CN2010101466570A patent/CN101897960B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1768858A (en) * | 2004-10-18 | 2006-05-10 | 郑宏志 | Composition and method for repairing nerve damage and enhancing functional recovery of nerve |
| CN101288771A (en) * | 2007-04-19 | 2008-10-22 | 上海交通大学医学院 | Preparation method of anti-human Nogo-66 receptor protein vaccine and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 《Biomaterial》 20110723 Yongtong Wang等 The use of a gold nanoparticle-based adjuvant to improve the therapeutic efficacy of hNgR-Fc protein immunization in spinal cord-injured rats 第7988-7998页 1-8 第32卷, 第31期 2 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105458288A (en) * | 2015-12-02 | 2016-04-06 | 青岛大学 | Preparation method of gold nanoparticle |
| CN105458288B (en) * | 2015-12-02 | 2018-06-12 | 青岛大学 | A kind of preparation method of nanogold particle |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101897960B (en) | 2012-09-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Teicher et al. | Approaches to defining the mechanism of enhancement by Fluosol-DA 20% with carbogen of melphalan antitumor activity | |
| Yuhas | Active versus passive absorption kinetics as the basis for selective protection of normal tissues by S-2-(3-aminopropylamino)-ethylphosphorothioic acid | |
| Cleveland Jr et al. | Ischemic preconditioning in human and rat ventricle | |
| CN107427510A (en) | The purposes of Pune's cloth woods combined immunization checkpoint inhibitor | |
| EP4338803A2 (en) | Process for the preparation of erythrocytes loaded with one or more substances of pharmaceutical interest and so obtained erythrocytes | |
| US20090136521A1 (en) | Method for Selectively Depleting Hypoxic Cells | |
| Clark | Effects of immunosympathectomy on development of high blood pressure in genetically hypertensive rats | |
| SG182237A1 (en) | A method for the preparation of a high-temperature stable oxygen-carrier-containing pharmaceutical composition and the use thereoff | |
| CN107233569A (en) | Antibody preparation and method | |
| DE69634982T2 (en) | PROCESS FOR INCREASING HEMATOPOIETIC CELLS | |
| CN102510753A (en) | Method for the preparation of a heat stable oxygen carrier-containing pharmaceutical composition | |
| WO2014001177A1 (en) | Pharmaceutical composition for treatment of the pulmonary form of altitude sickness caused by lack of oxygen and reduced air pressure | |
| Kowalczyk et al. | Erythropoietin update 2011 | |
| Marsh et al. | Factors influencing hematopoietic spleen colony formation in irradiated mice. IV. The effect of erythropoietic stimuli | |
| Aschner | Brain, kidney and liver 203Hg‐methyl mercury uptake in the rat: relationship to the neutral amino acid carrier | |
| CN101897960B (en) | hNgR-Fc fusion protein vaccine for promoting regeneration and functional recovery of central nerves | |
| Jochem | Haematological, blood gas and acid-base effects of central histamine-induced reversal of critical haemorrhagic hypotension in rats | |
| Macho et al. | Neuropeptide Y (NPY): a coronary vasoconstrictor and potentiator of catecholamine-induces coronary constriction | |
| US20150374796A1 (en) | Use of haemoglobin of annelids for treating cancer | |
| US8742073B2 (en) | Method for the preparation of a high-temperature stable oxygen-carrier-containing pharmaceutical composition and the use thereof | |
| Ekong et al. | New antisickling agent 3, 4-dihydro-2, 2-dimethyl-2H-1 benzopyran-6-butyric acid | |
| CN101113179A (en) | Human antibody sample molecule TEM8-Fc based on tumour endocytosis sign 8 and its application in tumour treatment | |
| JPS6296857A (en) | Method of testing incompatible reaction cause substance in blood formulation | |
| WO2023274105A1 (en) | Preparation method for and application of biomimetic nano-protective agent for counteracting cardiotoxicity and systemic toxicity of doxorubicin | |
| Nikravesh et al. | The effect of camphor on the male mice reproductive system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120912 Termination date: 20150414 |
|
| EXPY | Termination of patent right or utility model |