CN101892295A - Method for authenticating copy number of target genes in transgenic animal - Google Patents

Abstract

The invention discloses a method for authenticating the copy number of target genes in a transgenic animal. The method provided by the invention comprises the following steps of: taking genome DNA of the transgenic animal as a template; performing fluorescence quantitative PCR by respectively using a target gene primer and a reference gene primer to respectively obtain a fluorescence quantitative PCR result of the target genes and reference genes of the transgenic animal; taking a standard substance with the target genes in a different copy number as the template; performing the fluorescence quantitative PCR by using the target gene primer and the reference gene primer respectively to obtain the fluorescence quantitative PCR result of the target genes and the reference genes in the standard substance; establishing a standard curve relative to the difference values of the cycle indexes of the target genes and the reference genes and the natural logarithm of the copy number of the target genes; and determining the copy number of the target genes in the transgenic animal. The method has the characteristics of simplicity, easy implementation, and accuracy and reliability because the results are consistent by using a conventional Southern blot method.

Description

A kind of method of identifying copy number of target genes in the transgenic animal

Technical field

The present invention relates to a kind of method of identifying copy number of target genes in the transgenic animal.

Background technology

Transgenic animal (transgenic animals) are exactly with laboratory method the goal gene that people need to be imported its genome, the gene integration that makes foreign gene and animal itself together, and breed with the division of cell, obtain in animal body expressing, and can stably entail offspring's animal.The external structure gene that is incorporated on the animal gene group is called transgenosis, is called transgenic product by the protein of transgenes encoding, influences the animal proterties by transgenic product.If transgenosis can entail filial generation, will form transgenic animal system or colony.Along with deepening continuously and experimental technique constantly perfect of Study on Transgenic Animal, transgenic technology has obtained using widely, almost annual all have the achievement in research that attracts people's attention to report that some transgenosis achievement has entered practicability and business-like development phase.The consequent is safety and the detection problem of transgenic animal.

Genetically modified effect depends on foreign gene stably express in animal body.Yet the repetition transgenic sequence expression effect in animal body of different copy numbers is different, the not even expression that has.This is a ubiquitous phenomenon in the transgenic research, in addition characteristics such as the production cost height of transgenic animal, cycle length.Therefore, in the early screening of transgenic animal, by Molecular Detection filter out insert foreign gene, copy number transgenic animal suitable, stably express have important theory to be worth and practice significance.

The method that tradition is measured gene copy number is Southern Blotting.Fact proved that it is effective a, method accurately really, but we are not difficult also to find in actual mechanical process, its time-consuming, effort also needs a large amount of DNA samples simultaneously, even will use radio isotope (Mason etc., 2003).In recent years the real-time fluorescence quantitative PCR of Xing Qiing (realtime quantitative polymerasechain reaction, realtimequantitative PCR) technology has remedied above deficiency (Ingham etc., 2001; Song etc., 2002; Mason etc., 2003).The real-time fluorescence quantitative PCR technology is to be released by U.S. Applied Biosystems company in 1996, it is by adding fluorophor in the PCR reaction system, utilize the accumulation of fluorescent signal to monitor whole PCR process, the method for by typical curve unknown template being carried out quantitative analysis at last in real time.Its major advantage is: (1) does not need to carry out the aftertreatment of PCR, has reduced the pollution that may cause in the operating process to greatest extent; (2) quick, cheap; (3) avoid using radio isotope with harm; (4) only need a spot of DNA sample; (5) provide a quantitative widely dynamics range, can carry out accurate quantification the different samples that copy number differs greatly.Because this technology not only realized the leap of PCR from qualitative to quantitative, and compares with conventional PCR, it have specificity stronger, effectively solve characteristics such as PCR pollution problem, level of automation height, be used widely at present.

Real-time fluorescence quantitative PCR comprises the probe class and two big classes non-probe class, is simple and easy to extensively be adopted by many quantitative experiments with advantages such as, susceptibility height, favorable repeatability because of it as the SYBR Green dye method of non-probe class.

Summary of the invention

The object of the present invention is to provide a kind of method of identifying copy number of target genes in the transgenic animal, provide fundamental basis for evaluation, the screening of transgenic animal, is that the scale operation of transgenic animal is created essential condition with application simultaneously.

Method provided by the invention comprises the steps:

Genomic dna with transgenic animal is a template, carries out quantitative fluorescent PCR with target gene primer and internal control gene primer respectively, obtains the fluorescent quantitative PCR result of target gene and the internal control gene of transgenic animal respectively;

Standard substance with the target gene that contains different copy numbers are template, carry out quantitative fluorescent PCR with target gene primer and internal control gene primer respectively, obtain the target gene in the standard substance and the fluorescent quantitative PCR result of internal control gene respectively;

Fluorescent quantitative PCR result according to target gene in the standard substance and internal control gene, structure is determined the copy number of the target gene in the transgenic animal then about the typical curve of the natural logarithm of the difference of the cycle index of target gene and internal control gene and copy number of target genes.

The above-mentioned standard substance that contain the target gene of different copy numbers are the genomic dna of non-transgenic animal and the transgenosis plasmid that contains single copy targeting gene to be mixed obtain.The collocation method of standard substance can carry out according to prior art.

Above-mentioned animal can be any animal except that the people, specifically can be pig, ox, sheep, chicken, duck, rabbit or mouse.

Above-mentioned target gene can be a pig GH gene; The nucleotide sequence of described pig GH gene is shown in sequence in the sequence table 5.

The nucleotide sequence of the forward primer of above-mentioned target gene primer is shown in sequence in the sequence table 1, and the nucleotide sequence of reverse primer is shown in sequence in the sequence table 2; The nucleotide sequence of the forward primer of above-mentioned internal control gene primer is shown in sequence in the sequence table 3, and the nucleotide sequence of reverse primer is shown in sequence in the sequence table 4.

Target gene among the present invention can be foreign gene.

Experimental results show that: method provided by the invention is a template design primer with the target gene dna sequence dna that changes over to, at first, carry out real-time fluorescence quantitative PCR with detection primer, confidential reference items primer then with the plasmid of proportional diluted and the DNA production standard product of non-transgenic pig; Set up the natural logarithm (log of copy number according to the amplification of standard substance ₅N) with the typical curve of Δ Ct value, thereby obtain the copy number of target gene, this method is simple, with the unanimity as a result of traditional Southern blot method, illustrates accurately and reliably.Method of the present invention is that the expansion of real-time fluorescence quantitative PCR is used and extension.

Description of drawings

Fig. 1: TRE-GH58 carrier collection of illustrative plates.

Fig. 2: TRE-GH58 detects primer 1 (TRE terminator zone) amplified production electrophorogram, and wherein 1,2,5 and 6 is the positive individuals that detect, and 3 and 4 is negative individuals, and M is marker I.

Fig. 3: TRE-GH58 detects primer 2 (TRE promoter region and GH zone) amplified production electrophorogram, and wherein 1,2,3 and 5 is the positive individuals that detect, and the 4th, negative individuals, M is marke I.

Fig. 4: the amplification curve diagram of standard substance.

Fig. 5: the solubility curve figure of standard substance.

Fig. 6: the solubility curve figure of goal gene.

Fig. 7: the solubility curve figure of internal control gene.

Fig. 8: by the typical curve of standard substance amplification foundation.

Fig. 9: the result of Southern blot (being standard substance among the figure).

Embodiment

The invention will be further described below in conjunction with specific embodiment, but the present invention is not limited to following examples.

Among the following embodiment, if no special instructions, be ordinary method.

Embodiment 1, determine copy number of foreign gene in the transgenic animal

One, the preparation of transgenic animal (GH transgenic pig)

1, with TRE be framework, structure contains pig GH genophore (TRE-GH58 carrier) (see figure 1).

The synthetic TRE promotor that contains, the dna fragmentation of multiple clone site and SV40polyA (called after TRE-MSC-SV40polyA gene, its nucleotide sequence are shown in sequence in the sequence table 6, and AudioCodes Bioisystech Co., Ltd in Beijing is synthetic).Above-mentioned synthetic dna fragmentation 95 ℃ 10 minutes, place frozen water immediately, it is standby after with ZraI. (available from NEB company, article No. R0659L) and PciI (available from NEB company, article No. R0655L) double digestion to handle the back; Be connected with aforementioned TRE-MSC-SV40polyA fragment behind pUC19 plasmid (available from precious biological, article No. FD3219) ZraI. and the PciI double digestion (ligase enzyme available from promega company, article No. M1804); Transform DH5 α (available from the full formula in Beijing King Company, article No. CD201) competence intestinal bacteria by company's requirement operation steps; Bacterium liquid is coated with agarose gel plate, overnight incubation in 37 ℃ of incubators; Choose single colony inoculation and cultivate in liquid LB substratum, part bacterium liquid send company's order-checking (invitrogen Beijing company); It is standby to choose the correct carrier of sequencing result (called after TRE58 carrier).

Extract pig (the Large White strain is available from new basic source, Tangshan City boar company limited) ear vein blood, extract total RNA (available from hundred Tykes, article No. RP4002) according to the test kit schedule of operation; According to the test kit schedule of operation total RNA reverse transcription being become cDNA (available from TOYOBO company, article No. TRT-101) is primer amplification pig growth hormone gene (GH) fragment (sequence 5 in nucleotide sequence such as the sequence table) with GH-L and GH-R:

GH-L:AT AAGCTTCCACCATGGCTGCAGGCCCTCGGACC (following stroke horizontal line partly is the HindIII restriction enzyme site)

GH-R:CG TCTAGAACTAGAAGGCACAGCTGCT (following stroke horizontal line partly is an Xba I restriction enzyme site)

Reaction system is that reaction system is 50 μ l, 5 μ L, 10 * Buffer, 8 μ L 2.5mM dNTP, 1 μ L, 20 μ M primer GH-L, 1 μ L, 20 μ M primer GH-R, 0.5 μ L 5U/ μ L high-fidelity Tag polysaccharase, the 100ng pig cDNA is a template, add ultrapure water to 50 μ L (the high-fidelity enzyme is precious biological available from Dalian, article No. DR010A).Pcr amplification program: 95 ℃ of 5min; 95 ℃ of 20s, 68 ℃ of 20s, 72 ℃ of 30s circulate 30 times; Last 72 ℃ are extended 5min.

Pcr amplification product send company's order-checking (invitrogen Beijing company), filter out order-checking (sequence is seen sequence 5) correct back PCR product (called after GH gene) and reclaim purifying (operation steps is seen company's test kit), with HindIII, Xba I double digestion purified product with QIAGEN sepharose test kit; Use the TRE58 carrier of HindIII, the above-mentioned preparation of Xba I double digestion simultaneously; Pcr amplification product is connected, transforms (operation steps and reagent are the same) with carrier after enzyme is cut, and picking list bacterium colony send company's order-checking, and it is standby to choose the correct carrier (called after TRE-GH58 carrier) of order-checking.Above-mentioned plasmid carries out plasmid and goes intracellular toxin to carry greatly (available from OMEGA company, article No.: D6948), after plasmid extracts, ScaI is (available from Fermanta company, article No.: ER0431) to specifications isogeneity is reclaimed (available from QIAGEN company behind the linearization for enzyme restriction, article No.: 12562), obtain the standby of linearizing TRE-GH58 carrier.

2, change the preparation of TRE-GH gene pig

Utilize traditional pronuclear-stage embryos microinjection that linearizing TRE-GH58 vector injection is gone in protokaryon phase pig (Large White strain) embryo's protokaryon, at NCSU 23 substratum (available from millipore company, the product article No.: embryo culture to 8 cell stage after will injecting MR-182-D), be transplanted to the sow horn of uterus of oestrusing synchronous external by the vagina uterine neck.

3, transgenic pig quantitative PCR detection

This research has prepared 126 former generation microinjection pigs altogether, and through the PCR detection 9 pigs being arranged is the exogenous origin gene integrator pig.

(1) pig blood extracting genome DNA

Gather 50ml blood from the pig precaval vein of 126 former generation microinjections, use traditional method for extracting DNA.

(2) conventional P CR augmentation detection

DNA with step (1) is a template, and design TRE-GH58 detects primer 1 (TRE terminator zone):

Forward primer: 5 ' ACCTATCTCAGCGATCTGTC 3 ',

Reverse primer: 5 ' TGGGTCTCGCGGTATCATTG 3 '.

Expanding fragment length is 124bp.Reaction system is 50 μ l, and 5 μ L, 10 * Buffer, 8 μ L 2.5mM dNTP, 1 μ L, 20 μ M primer PL, 1 μ L, 20 μ M primer PR, 0.5 μ L 5U/ μ L high-fidelity Tag polysaccharase add ultrapure water to 50 μ L.Pcr amplification program: 95 ℃ of 5min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 30s, 72 ℃ of 5m, 16 ℃ of 5min circulate 30 times.Pcr amplification product detects (see figure 2) with 2% agarose gel electrophoresis.

For the result who guarantees to detect, design TRE-GH58 simultaneously and detect primer 2 (TRE promoter region and GH zone), purpose fragment 149bp.The primer 2 sequence is as follows:

Forward primer: 5 ' GATCGCCTGGAGAATTCGAG 3 ',

Reverse primer: 5 ' CACGTCACCCTTCAGAACAC 3 '.

Identical with above-mentioned PCR reaction system, amplification program is: 95 ℃ of 5min; 94 ℃ of 30s, 59 ℃ of 30s, 72 ℃ of 30s circulate 32 times; 72 ℃ of 5m, 16 ℃ of 5min.Pcr amplification product detects (see figure 3) with 2% agarose gel electrophoresis.Through twice evaluation, tentatively determine 9 of extremely significant transgenic pigs, numbering is respectively: 92,94,97,108,120,125,127,141 and 143.

3) genomic dna of above-mentioned 9 transgenic pigs of preservation is standby.

Two, contain the acquisition of standard substance of the foreign gene of different copy numbers

Transgenosis plasmid and non-transgenic pig genomic dna is mixed, the standard control product that contain 1,5,10 copy are set respectively, with fluorescent quantitation primer 1 amplification transgenic fragment, product length is 339bp; As confidential reference items, its product length is 249bp with pig GAPDH confidential reference items primer amplification house-keeping gene GAPDH.

The concrete method to set up of standard substance is as follows: will contain transgenosis plasmid TRE-GH and mix with the non-transgenic pig DNA, specific as follows: as to suppose that the plasmid size that 1. contains 1 transgenic fragment is a bp, 2. non-transgenic pig genomic dna consumption is b ng, and 3. the genomic dna monoploid size of non-transgenic pig is 3 * 10 ⁹Bp, 4. transgenic pig all is a heterozygote, transgenic fragment completely random (or the head links to each other) from beginning to end inserts on the karyomit(e), the transgenic positive pig genomic dna of b ng contains the expression vector quality (ng) of n pig GH gene copy for (this example is for changeing pig GH gene so, in non-transgenic pig body, itself also express, so be n-1 in the following formula):

$\frac{(n-1)\&times;a\&times;\mathrm{<figure-callout\; id="2"\; label="b"\; filenames="HSA00000009773400012.png,HSA00000009773400021.png"\; state="\{\{state\}\}">b</figure-callout>}}{2\&times;3\&times;{10}^9}$

Then, the expression vector (representing different copy numbers) with different mass mixes the structure standard substance with the non-transgenic pig genomic dna (containing 1 copy) of 10ng.

Three, fluorescence quantitative PCR detection

1, the fluorescence quantitative PCR detection of the genomic dna of transgenic pig and standard substance

The genomic dna of 9 transgenic pigs that step 1 is obtained carries out following fluorescence quantitative PCR detection respectively with the standard substance of the foreign gene that contains different copy numbers that step 2 obtains:

With pig GH gene order is reference, and design fluorescent quantitation primer 1 is done detection, purpose fragment 339bp, and sequence is as follows:

Forward primer 5 ' ATCCCAGTGGGCTTGGTGTG 3 ',

Reverse primer 5 ' CACGGCGTTGGCAAATAGGC 3 '.

Pig GAPDH confidential reference items primer is:

Forward primer: 5 ' TGAACGGATTTGGCCGCAT 3 '

Reverse primer: 5 ' TTCTCCATGGTCGTGAAGA 3 '

Wherein, the genomic dna of transgenic pig can first gradient dilution, carry out quantitative fluorescent PCR again after the selected optimum concn, last sample system is according to sample on the TaKaRa quantification kit specification sheets, reaction system is 20 μ l, 10 μ L2 * Mixturer, 1 μ L, 20 μ M forward primers, 1 μ L, 20 μ M reverse primers, 1ul DNA add ultrapure water to 20 μ L.Pcr amplification program: 95 ℃ of 5min; 94 ℃ of 20s, 59 ℃ of 30s, 72 ℃ of 30s circulate 40 times; Last 72 ℃ are extended 5min.

Experiment is carried out on Applied Biosystems 7500 serial quantitative real time PCR Instruments, and reaction result uses 7500System SDS Software V1.4.0 software to collect, analyze experimental result, and each sample is all done three repetitions.This experiment with the GAPDH gene as internal control gene correcting sample difference.

2, fluorescent quantitative PCR result

1) the fluorescent quantitative PCR result of standard substance

Amplification curve and solubility curve are all collected with analysis by 7500System SDS Software V1.4.0 software and are obtained.

The amplification curve (see figure 4) of standard substance has shown one group of parallel curves that spacing equates, shows that real-time quantitative PCR detects gene copy number the favorable linearity scope is arranged.

Natural logarithm (log with copy number ₅N) being ordinate zou, is X-coordinate with cycle index (Δ Ct) value, makes quantitative criterion curve (as shown in Figure 8), and obtains quantitative equation y=-0.2689x+4.2904, and the y in the equation is log ₅N (also being the natural logarithm of copy number of foreign gene), x are Δ Ct (also being the difference of target gene and internal standard gene Ct value).Software is further analyzed demonstration, the straight-line regression coefficient R of typical curve ²=0.9948, the Ct value of all standard substance big deviation occurs without any standard substance substantially point-blank, shows the preparation success of standard substance.

In order to assess the specificity of reaction, the melting curve of standard substance is analyzed (see figure 5), show that to have and have only one near 90 ℃ unimodal, the specificity of primer amplification is very good.

2) the fluorescent quantitative PCR result of the genomic dna of transgenic pig

Melting curve analysis (seeing Fig. 6, Fig. 7) is also carried out in amplification to purpose fragment (pig GH gene) and confidential reference items GAPDH gene, shows that the specificity of two pairs of primer amplifications is very good, near 90 ℃, all have and have only one unimodal; The negative control of two primers and blank all do not have amplified peak (data not shown).But, can significantly find out the peak value of two solubility curves and not exclusively coincidence, the purpose fragment is at 90.5 ℃, confidential reference items GAPDH gene then is near 89.5 ℃.Thereby the also accuracy of Zheng Ming experiment is for asking copy number condition all set according to typical curve.

3) ask copy number according to typical curve

Be numbered 92,94,97,108,120,127 and 143 transgenic pig GH gene copy number and be 2, be numbered 125 and 141 copy number and be 3; Consider the expression of endogenous GH in the non-transgenic pig genomic dna, therefore, the copy number of foreign gene pig GH gene is respectively 1 and 2.

Four, the copy number of Southern blot checking transgenic positive pig

Get detected 9 the transgenic positive pig genomic dna 20 μ g of PCR in the step 1, carry out Southernblot, the gray scale scanning results of hybridization is determined copy number.Concrete steps are as follows:

With pGH-L:AACTGGCTGCTGACACCTAC; PGH-R:

TGAAGACCCTGCTGAGGAACGH is a probe primer, and transgenic positive pig genomic dna is a masterplate, amplification 220bp.According to test kit process specifications system application of sample, the PCR working procedure is as follows: 95 ℃ of 5min, and 94 ℃ of 45S, 56 ℃ of 1min, 72 ℃ of 1min, (the probe mark test kit is available from innogen-cn company, article No.: DDLK-010) for 30 back 72 ℃ of extension 10min of circulation.With the PCR product is that probe carries out southen hybridization detection.Carry out according to the test kit operation instructions that (hybridization kit is available from innogen-cn company, article No.: DIGD-210).

Do typical curve with the positive reference substance (see figure 9) that contains 1,5,10 copy number respectively, being provided with of the standard substance of the setting of reference substance and above-mentioned steps two is identical.Thereby, obtain the calculation formula of gray-scale value and transgenosis copy number: N (copy number)=0.2628 * gray-scale value+0.2542 (R ²=0.9947) it is consistent with The above results to calculate the transgenosis copy numbers of 9 positive pigs by formula, thereby has verified that further above-mentioned quantifying PCR method checks the accuracy of copy number.

The above results shows that the copy number that carries out the transgenic animal foreign gene with real-time quantitative PCR is simple, consequently accurately and reliably; For scale operation and the application and development of transgenic animal creates favorable conditions.

Sequence table

＜110〉Institute of Animal Sciences, Chinese Academy of Agricultural Sciences

＜120〉a kind of method of identifying copy number of target genes in the transgenic animal

<130>CGGNARL102061

<160>6

<210>1

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>1

atcccagtgg?gcttggtgtg 20

<210>2

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>2

cacggcgttg?gcaaataggc 20

<210>3

<211>19

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>3

tgaacggatt?tggccgcat 19

<210>4

<211>19

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>4

ttctccatgg?tcgtgaaga 19

<210>5

<211>657

<212>DNA

<213>555

<400>5

ccaccatggc?tgcaggccct?cggacctccg?tgctcctggc?tttcgccctg?ctctgcctgc 60

cctggactca?ggaggtgggc?gccttcccag?ccatgccctt?gtccagccta?tttgccaacg 120

ccgtgctccg?ggcccagcac?ctgcaccaac?tggctgccga?cacctacaag?gagtttgagc 180

gcgcctacat?cccggaggga?cagaggtact?ccatccagaa?cgcccaggct?gccttctgct 240

tctcggagac?catcccggcc?cccacgggca?aggacgaggc?ccagcagaga?tcggacgtgg 300

agctgctgcg?cttctcgctg?ctgctcatcc?agtcgtggct?cgggcccgtg?cagttcctca 360

gcagggtctt?caccaacagc?ctggtgtttg?gcacctcaga?ccgcgtctac?gagaagctga 420

aggacctgga?ggagggcatc?caggccctga?tgcgggagct?ggaggatggc?agcccccggg 480

caggacagat?cctcaagcaa?acctacgaca?aatttgacac?aaacttgcgc?agtgatgacg 540

cgctgcttaa?gaactacggg?ctgctctcct?gcttcaagaa?ggacctgcac?aaggctgaga 600

catacctgcg?ggtcatgaag?tgtcgccgct?tcgtggagag?cagctgtgcc?ttctagt 657

<210>6

<211>606

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>6

ctcgagttta?ctccctatca?gtgatagaga?acgtatgtcg?agtttactcc?ctatcagtga 60

tagagaacga?tgtcgagttt?actccctatc?agtgatagag?aacgtatgtc?gagtttactc 120

cctatcagtg?atagagaacg?tatgtcgagt?ttactcccta?tcagtgatag?agaacgtatg 180

tcgagtttat?ccctatcagt?gatagagaac?gtatgtcgag?tttactccct?atcagtgata 240

gagaacgtat?gtcgaggtag?gcgtgtacgg?tgggaggcct?atataagcag?agctcgttta 300

gtgaaccgtc?agatcgcctg?gagaattcga?gctcggtacc?cggggatcct?ctagtcagct 360

gacgcgtgct?agcgcggccg?catcgataag?cttgtcgacg?atatctctag?aggatcataa 420

tcagccatac?cacatttgta?gaggttttac?ttgctttaaa?aaacctccca?cacctccccc 480

tgaacctgaa?acataaaatg?aatgcaattg?ttgttgttaa?cttgtttatt?gcagcttata 540

atggttacaa?ataaagcaat?agcatcacaa?atttcacaaa?taaagcattt?ttttcactgc 600

ctcgag 606

Claims (5)

1. a method of identifying copy number of target genes in the transgenic animal comprises the steps:

Genomic dna with transgenic animal is a template, carries out quantitative fluorescent PCR with target gene primer and internal control gene primer respectively, obtains the fluorescent quantitative PCR result of target gene and the internal control gene of transgenic animal respectively;

Standard substance with the target gene that contains different copy numbers are template, carry out quantitative fluorescent PCR with target gene primer and internal control gene primer respectively, obtain the target gene in the standard substance and the fluorescent quantitative PCR result of internal control gene respectively;

Fluorescent quantitative PCR result according to target gene in the standard substance and internal control gene, structure is determined the copy number of the target gene in the transgenic animal then about the typical curve of the natural logarithm of the difference of the cycle index of target gene and internal control gene and copy number of target genes.

2. method according to claim 1 is characterized in that: the described standard substance that contain the target gene of different copy numbers are the genomic dna of non-transgenic animal and the transgenosis plasmid that contains single copy targeting gene to be mixed obtain.

3. method according to claim 1 and 2 is characterized in that: described animal is pig, ox, sheep, chicken, duck, rabbit or mouse.

4. according to the arbitrary described method of claim 1-3, it is characterized in that: described target gene is a pig GH gene; The nucleotide sequence of described pig GH gene is shown in sequence in the sequence table 5.

5. method according to claim 4 is characterized in that: the nucleotide sequence of the forward primer of described target gene primer is shown in sequence in the sequence table 1, and the nucleotide sequence of reverse primer is shown in sequence in the sequence table 2; The nucleotide sequence of the forward primer of described internal control gene primer is shown in sequence in the sequence table 3, and the nucleotide sequence of reverse primer is shown in sequence in the sequence table 4.

Images