CN101891618B - 2-[(2,3,4-trialkoxy-6-acyl) phenyl] acetic ester as well as preparation method and application thereof - Google Patents

2-[(2,3,4-trialkoxy-6-acyl) phenyl] acetic ester as well as preparation method and application thereof Download PDF

Info

Publication number
CN101891618B
CN101891618B CN2010102114460A CN201010211446A CN101891618B CN 101891618 B CN101891618 B CN 101891618B CN 2010102114460 A CN2010102114460 A CN 2010102114460A CN 201010211446 A CN201010211446 A CN 201010211446A CN 101891618 B CN101891618 B CN 101891618B
Authority
CN
China
Prior art keywords
phenyl
tri
alkoxy
acyl group
preparation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN2010102114460A
Other languages
Chinese (zh)
Other versions
CN101891618A (en
Inventor
吴乔
黄培强
张洪奎
郑忠辉
林圣彩
占艳艳
庄佳佳
陈航姿
沈月毛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xiamen University
Original Assignee
Xiamen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xiamen University filed Critical Xiamen University
Priority to CN2010102114460A priority Critical patent/CN101891618B/en
Publication of CN101891618A publication Critical patent/CN101891618A/en
Application granted granted Critical
Publication of CN101891618B publication Critical patent/CN101891618B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention discloses 2-[(2,3,4-trialkoxy-6-acyl) phenyl] acetic ester as well as a preparation method and application thereof and relates to an organic micromolecule compound. The preparation method comprises the following steps of: converting 2,3,4-trialkoxy benzaldehyde 1 used as a raw material into 3-(2,3,4-trialkoxy) phenylpropionic acid 2 by using Meldrum acid; under the action of polyphosphoric acid, carrying out intramolecular acylation on the 3-(2,3,4-trialkoxy) phenylpropionic acid 2 to obtain corresponding idenone hydride 3; carrying out an addition reaction on the idenone hydride 3 with a Grignard reagent and dewatering into indene hydride 4 by using acid; treating the indene hydride 4 by using osmium tetroxide to obtain dihydroxyl indene hydride 5; oxidizing the dihydroxyl indene hydride 5 respectively by using sodium periodate and sodium chlorite to obtain 2-[(2,3,4-trialkoxy-6-acyl) phenyl] acetic acid 7; and finally, reacting the 2-[(2,3,4-trialkoxy-6-acyl) phenyl] acetic acid 7 with anhydrous alcohol to obtain the 2-[(2,3,4-trialkoxy-6-acyl) phenyl] acetic ester 8 as the target product in the presence of thionyl chloride. The 2-[(2,3,4-trialkoxy-6-acyl) phenyl] acetic ester can activate monophosphate activated protein kinase and is useful for preparing anti-diabetic medicaments.

Description

2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester and preparation method thereof and application
Technical field
The present invention relates to a kind of organic micromolecule compound, especially relate to 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetate compounds and preparation method thereof and hypoglycemic pharmaceutical use.
Background technology
Mellitus have become the third-largest disease of serious harm human health after cardiovascular diseases, cancer.Estimate that according to the World Health Organization by 2015, global diabetic subject possibly reach about 300,000,000.Mellitus are because hypoinsulinism or insulin resistant cause in the body is the incretion metabolism disease of characteristic with hyperglycemia and glycosuria.Clinically, (NIDDM, (reaching more than 90%) NIDDM) is in the great majority with type ii diabetes.At present; The main medicine of treatment type ii diabetes has biguanides, sulfonylurea, thiazolidinediones and α one glucosidase inhibitor etc.; Though these antidiabetic medicines have certain curative effect clinically, still exist the curative effect weak point, can not specially be directed against the cause of disease and problems such as effective mitigate the disease and drug side effect.Therefore, the novel antidiabetic medicine of research and development is not only very urgent clinically but also have importance.
Adenylic acid(AMP) activated protein kinase (AMP-activated protein kinase; AMPK) extensively be present in the various eukaryotic cells; Be considered to Eukaryotic " maincenter cellular energy setter ", the complex body that it is made up of catalytic subunit α, adjusting subunit β and γ.AMPK receives the adjusting of AMP/ATP ratio, and when ratio rose, adenosine phosphate (AMP) just combined with AMPK γ; Start upper reaches kinases LKB1 phosphorylation AMPK α, thereby activate AMPK, promote catabolic pathway (like glycolysis-, fats oxidn etc.) to produce ATP; Close metabolic pathway of synthesizing (like glyconeogenesis, lipogenesis and albumen synthetic etc.) simultaneously to reduce consumption (Hardie DG, et al., the J.Physiol. of ATP; 2006,574,7-15; Viollet B, et al., J.Physiol., 2006,574,41-53; Hardie DG, et al., Physiology., 2006,21,48-60).Therefore, in recent years AMPK be considered to develop the treatment diabetes medicament a very important target spot (Viollet B, et al., J.Physiol., 2006,574,41-53).Discover that the biguanides antidiabetic medicine can suppress glycogen output through the phosphorylation level that improves AMPK α, promotes the utilization of peripheral tissues to sugar; Thereby play effect (Zhou G, et al., the J.Clin.Invest. of lowering blood glucose; 2001,108,1167-1174).But, at present, still have many researchs to be intended to screen the antidiabetic medicine of target AMPK of new generation, in the hope of replacing biguanides because the effective dose of N1,N1-Dimethylbiguanide is big and significant side effects.
Summary of the invention
The object of the present invention is to provide novel 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester (TAPA) of a class formation and preparation method thereof.
Another object of the present invention is to provide the application of one type of 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester (TAPA) in the preparation antidiabetic medicine.
The structure of 2-according to the invention [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester is following:
Figure BSA00000159444800021
2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester is a kind of tri-alkoxy substituted aromatics, and is water insoluble, is dissolved in acetone, organic solvents such as acetonitrile; Depend on R 1, R 2Or R 3Difference, these compounds can be solid or liquid.
The preparation route of 2-according to the invention [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester is following:
Figure BSA00000159444800022
The preparation method of 2-according to the invention [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester may further comprise the steps:
1) preparation 3-(2,3, the 4-tri-alkoxy) phenylpropionic acid 2
With 2 of 1.0～1.5 times of mole numbers, 2-dimethyl--1,3-diox-4,6-diketone (Meldrum acid) is dissolved in triethylammonium formate (TEAF) solution, processes 0.2～1.0mol/L solution; Add 2,3 again, 4-tri-alkoxy phenyl aldehyde (standard substance) is with reaction mass heated, be stirred to and react completely; Cooling adds frozen water down, is acidified to pH=1 again, extracts back united extraction liquid, washing; Drying concentrates the back residue and obtains 3-(2,3, the 4-tri-alkoxy) phenylpropionic acid 2 with purification by silica gel column chromatography;
2) preparation hydrogenation indone 3
3-(2,3, the 4-tri-alkoxy) phenylpropionic acid 2 that step 1) is prepared be equivalent to 3-(2; 3,4-tri-alkoxy) 15～25 times polyphosphoric acid (PPA) of phenylpropionic acid weight stirs, after reacting completely; Cooling adds frozen water down, after the extraction, and united extraction liquid; Washing, drying concentrates the back residue and obtains hydrogenation indone 3 with purification by silica gel column chromatography;
3) preparation hydrogenation indenes 4
With step 2) the hydrogenation indone 3 for preparing is dissolved in the dry methylene chloride, processes 0.05～0.15mol/L solution, under the protection of inert gas, stirs, and adds the Grignard reagent R of 1.5～4.5 times of mole numbers that are equivalent to hydrogenation indone mole number 2MgX (R 2=C1～C10 alkyl, X=Cl, Br), be warming up to room temperature after adding Grignard reagent, continue to be stirred to and react completely; Be acidified to pH=1 under the cooling, stir the back and extract united extraction liquid; Washing, drying concentrates the back residue and obtains hydrogenation indenes 4 with purification by silica gel column chromatography;
4) preparation dihydroxyl hydrogenation indenes 5
The hydrogenation indenes 4 that step 3) is prepared is dissolved in the acetone solution, processes 0.05～0.2mol/L solution, stirs; Add the Toluidrin and the N-methyl-N-morpholine oxide (NMO) that are equivalent to 1～3 times of mole number of hydrogenation indenes, after the stirring, add the perosmic anhydride solution of 3%～20% mole number that is equivalent to the hydrogenation indenes; Reaction mixture is stirred to reacts completely, add saturated sodium thiosulfate solution, stir; Decompression is extracted after steaming down and removing acetone; United extraction liquid, drying concentrates the back residue and obtains dihydroxyl hydrogenation indenes 5 with purification by silica gel column chromatography;
5) preparation 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetaldehyde 6
The dihydroxyl hydrogenation indenes 5 that step 4) is prepared is dissolved in THF/aqueous solution, processes 0.1～0.5mol/L solution, adds the sodium periodate that is equivalent to dihydroxyl hydrogenation indenes 1.0～2.0 mole numbers; Be stirred to and react completely adding silica gel, stirring; Filter, will filtrate concentrates, and residue obtains 2-[(2 with purification by silica gel column chromatography; 3,4-tri-alkoxy-6-acyl group) phenyl] acetaldehyde 6;
6) preparation 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetate 7
2-[(2,3, the 4-tri-alkoxy-6-acyl group) phenyl] acetaldehyde 6 that step 5) is prepared is dissolved in THF/butanol/water solution, processes 0.1～0.5mol/L solution; Add under stirring and be equivalent to 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] the 2-methyl-2-butene of 6～12 times of mole numbers of acetaldehyde and the SODIUM PHOSPHATE, MONOBASIC of 2～5 times of mole numbers, cooling adds the Textone of 2～5 times of mole numbers down; Be stirred to then and react completely adding saturated sodium bisulfite solution under the cooling, stirring, extraction; United extraction liquid, washing, drying; Concentrate the back residue and obtain 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetate 7 with purification by silica gel column chromatography;
7) preparation 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester (TAPA)
2-[(2,3, the 4-tri-alkoxy-6-acyl group) phenyl] acetate 7 that step 6) is prepared is dissolved in the absolute alcohol, processes 0.1～0.5mol/L solution; Stir, add and be equivalent to 2-[(2,3; 4-tri-alkoxy-6-acyl group) phenyl] sulfur oxychloride of 1～3 times of acetate mole number, be stirred to and react completely, decompression is steamed down and is removed excessive alcohol; Residue obtains 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester (TAPA) with purification by silica gel column chromatography.
In step 1), said 2,2-dimethyl--1,3-diox-4, the consumption of 6-diketone (Meldrum acid) is 1.2 times of mole numbers of tri-alkoxy phenyl aldehyde preferably; Said concentration of reactants is 0.7mol/L preferably, preferably 85～90 ℃ of the temperature of reaction; Said acidifying can be adopted the 6mol/L hcl acidifying; Said extraction can be adopted ethyl acetate extraction; Said washing can be adopted the saturated nacl aqueous solution washing.
In step 2) in, the add-on of said polyphosphoric acid is 18～20 times of 3-(2,3, the 4-tri-alkoxy) phenylpropionic acid weight preferably; Preferably 50～60 ℃ of the temperature of said reaction; Said extraction can be adopted ethyl acetate extraction; Said washing can be adopted the saturated nacl aqueous solution washing.
In step 3), the concentration of said hydrogenation indone is 0.05～0.1mol/L preferably; The add-on of said Grignard reagent is 3～4 times of mole numbers of hydrogenation indone preferably; Said acidifying can be adopted hcl acidifying, preferably 0 ℃ of said acidifying temperature; Said extraction can be adopted dichloromethane extraction; Said washing can be adopted the saturated nacl aqueous solution washing.
In step 4), said acetone solution, by volume, and acetone: water can be 10: 1～and 3: 2, be preferably acetone: water=10: 1; Said saturated sodium thiosulfate solution is to contain to be equivalent to 2 times of mole numbers of hydrogenation indenes; Said extraction can be adopted ethyl acetate extraction; Said hydrogenation indenes concentration is 0.1mol/L preferably; The add-on of said Toluidrin is 1.0 times of mole numbers of hydrogenation indenes preferably; The add-on of said N-methyl-N-morpholine oxide is 1.5 times of mole numbers of hydrogenation indenes preferably.
In step 5), said THF/aqueous solution, by volume, THF: water can be (1～3): 1, be preferably THF: water=2: 1; Said silica gel can adopt 200～400 purpose silica gel; The concentration of made dihydroxyl hydrogenation indenes is 0.2～0.3mol/L preferably; The add-on of said sodium periodate is 1.1～1.2 times of dihydroxyl hydrogenation indenes mole number preferably.
In step 6), said THF/butanol/water solution, by volume, THF: the trimethyl carbinol: water can be (4～10): (2～4): 1, be preferably THF: the trimethyl carbinol: water can be 8: 3: 1; Said adding saturated sodium bisulfite solution is to contain to be equivalent to 2～5 times of mole numbers of 2-aryl acetaldehyde; Said extraction can be adopted dichloromethane extraction; Said washing can be adopted the saturated nacl aqueous solution washing; The add-on of said 2-methyl-2-butene is 2-[(2 preferably; 3,4-tri-alkoxy-6-acyl group) phenyl] 7～8 times of acetaldehyde mole number, the add-on of said SODIUM PHOSPHATE, MONOBASIC is 2-[(2 preferably; 3,4-tri-alkoxy-6-acyl group) phenyl] 3～4 times of acetaldehyde mole number; The add-on of said Textone is 2～3 times of 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetaldehyde mole number preferably.
Rapid 7) in, the concentration of 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetate is 0.2～0.3mol/L preferably; The add-on of said sulfur oxychloride is 1.0～1.5 times of 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetate mole number preferably.
Prove through cell and mouse experiment, 2-according to the invention [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester can reduce effectively through the phosphorylation level that improves AMPK α C57BL/KsJ-m+ /+Lepr Db(db/db) glucose level of mouse (being the type ii diabetes mouse) has the application prospect of good initiative antidiabetic medicine, and 2-according to the invention [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester (TAPA) can be used for preparing antidiabetic medicine.
Compare with N1,N1-Dimethylbiguanide class medicine, the useful effect concentration that 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetate compounds is used to reduce mouse blood sugar is lower, and chemical structure and preparation method are more simple.The preparation method of this type novel cpd and hypoglycemic effect thereof do not appear in the newspapers at present.
Description of drawings
Fig. 1 is the influence of TAPA1 to the AMPK α phosphorylation level of mouse normal liver cell AML12.Experimental result shows that TAPA1 can improve the phosphorylation level of AMPK α, but can not influence the proteic expression level of AMPK α.Use solvent DMSO, TAPA1 (10 μ M) and the positive control Metformin (1mM) of TAPA1 to handle AML12 cell 12h respectively.Detect phosphorylation level (p-AMPK α) and the AMPK α protein expression level (AMPK α) of AMPK α with immunoblot experiment (Western blotting).
Fig. 2 is the TAPA1 effect variation of type ii diabetes mouse model db/db mouse blood sugar down.Experimental result shows that TAPA1 can reduce the fasting blood glucose level of db/db mouse.X-coordinate is time time (day), and ordinate zou is blood glucose value Blood glucoselevel (mM); A represents solvent control group (n=8), and b represents TAPA1 experimental group (n=8); Use the SPSS13.0 statistical software experimental data is carried out statistical study, the gained experimental data is represented with mean ± standard error; Two factor variance analyses and fisher check are adopted in control group and experimental group variance analysis, and * representes p＜0.05, the tool significance of difference.
Fig. 3 is the influence of TAPA1 to db/db mouse liver AMPK α phosphorylation level.Experimental result shows that TAPA1 can significantly improve the phosphorylation level of AMPK α in the db/db mouse liver."-" expression solvent control group, "+" expression TAPA1 experimental group; P-AMPK α and AMPK α represent the phosphorylation level of mouse liver AMPK α and the protein level of AMPK α respectively.
Fig. 4 is the influence that TAPA1 expresses db/db mouse liver glyconeogenesis key gene.Experimental result shows that TAPA1 can significantly suppress db/db mouse liver glyconeogenesis key enzyme G6pc and Pepck expression of gene level.G6Pase: G-6-Pase, Pepck: phosphoenolpyruvate carboxylation kinases; X-coordinate is represented G-6-Pase (G6pase) and phosphoenolpyruvate carboxylation kinases (Pepck) respectively; Ordinate zou is the relative multiple (mRNA relativeexpression level) of gene expression dose; A represents solvent control group (n=8), and b represents TAPA1 experimental group (n=8).Use the SPSS13.0 statistical software experimental data is carried out statistical study, the gained experimental data is represented with mean ± standard error; Two factor variance analyses and fisher check are adopted in control group and experimental group variance analysis, and * representes p＜0.05, the tool significance of difference.
Embodiment
Through embodiment the present invention is described further below.
Embodiment 1
2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] ETHYLE ACETATE (compound TAPA1, R 1=CH 3, R 2=n-C 7H 15, R 3=C 2H 5)
1) preparation of 3-(2,3, the 4-trimethoxy) phenylpropionic acid
With 2,2-dimethyl--1,3-diox-4,6-diketone (Meldrum acid) (12mmol) is dissolved in the 17mL triethylammonium formate solution, processes 0.7mol/L solution, adds 2,3 again, 4-TMB (10mmol).Reactant stirs 5h 95～100 ℃ of heating.Be cooled to 0 ℃, stir with the 6mol/L hcl acidifying to pH=1.With ethyl acetate extraction (15mLx 3), united extraction liquid is with saturated nacl aqueous solution washing, anhydrous magnesium sulfate drying.Filter, concentrate the back residue and obtain 3-(2,3, the 4-trimethoxy) phenylpropionic acid (compound 2, R with purification by silica gel column chromatography 1=CH 3), productive rate 85%.
2) 4,5,6-trimethoxy-2, the preparation of 3-bihydrogen-1-indenone
3-(2,3, the 4-trimethoxy) phenylpropionic acid (5mmol) and polyphosphoric acid (23g) are stirred 8h down at 55 ℃.Cooling adds frozen water 100mL down, and with ethyl acetate extraction (20mL x 3), united extraction liquid is with saturated nacl aqueous solution washing, anhydrous magnesium sulfate drying.Filter, concentrate the back residue and obtain 4,5 with purification by silica gel column chromatography, 6-trimethoxy-2,3-bihydrogen-1-indenone (compound 3, R 1=CH 3), productive rate 80%.
3) 1-n-heptyl-4,5, the preparation of 6-trimethoxy-3H-indenes
4,5,6-trimethoxy-2,3-bihydrogen-1-indenone (1mmol) is dissolved in the 50mL dry methylene chloride, under the nitrogen protection, slowly drips n-heptyl magnesium bromide Grignard reagent (3mmol) down in 0 ℃ of stirring.Be warming up to room temperature after adding Grignard reagent, continue to stir 1.5h.Cooling drips 6mol/L hydrochloric acid 50mL down.Tell organic layer after stirring 1h, water layer is with dichloromethane extraction (20mL x 3), and united extraction liquid is with saturated nacl aqueous solution washing, anhydrous magnesium sulfate drying.Filter, concentrate the back residue and obtain 1-n-heptyl-4,5 with purification by silica gel column chromatography, 6-trimethoxy-3H-indenes (compound 4, R 1=CH 3, R 2=n-C 7H 15), productive rate 82%.
4) 1-n-heptyl-4,5,6-trimethoxy-2,3-dihydro indenes-1, the preparation of 2-glycol
1-n-heptyl-4,5,6-trimethoxy-3H-indenes (1mmol) be dissolved in the 10mL acetone (10/1, v/v) in the solution, in down careful Toluidrin (1mmo) and the N-methyl N-morpholine oxide (1.5mmol) of adding of 0 ℃ of stirring.After stirring 0.5h, drip perosmic anhydride solution (0.1mmol).Reaction mixture is at room temperature stirred 24h.In this reaction mixture, add saturated sodium thiosulfate solution (2mmol), stir 3h.Decompression boils off down behind the acetone with ethyl acetate extraction (15mL x 3), and united extraction liquid washs anhydrous magnesium sulfate drying with saturated nacl aqueous solution.Filter, concentrate the back residue and obtain 1-n-heptyl-4,5 with purification by silica gel column chromatography, 6-trimethoxy-2,3-dihydro indenes-1,2-glycol (compound 5, R 1=CH 3, R 2=n-C 7H 15), productive rate 90%.
5) preparation of 2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] acetaldehyde
1-n-heptyl-4,5,6-trimethoxy-2,3-dihydro indenes-1,2-glycol (1mmol) are dissolved in 5mL THF/water, and (2/1, v/v) in the solution, adding sodium periodate (1.1mmol) under stirring continues to stir 8h under the room temperature.Add 2g silica gel (200～400 order), stir 15min.Filter, filter residue is with the washing of 10mL ETHYLE ACETATE, and filtrate decompression concentrates, and residue obtains 2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] acetaldehyde (compound 6, R with purification by silica gel column chromatography 1=CH 3, R 2=n-C 7H 15), productive rate 90%.
6) preparation of 2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] acetate
2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] acetaldehyde (1mmol) be dissolved in 8mL THF/butanol/water (8/3/1, v/v/v) in the solution.Stir adding 2-methyl-2-butene (8mmol) and SODIUM PHOSPHATE, MONOBASIC (3mmol) down, 0 ℃ adds Textone (3mmol) down.At room temperature stir 40min then.Cooling adds saturated sodium bisulfite solution (3mmol) down, stirs 10min.With dichloromethane extraction (15mLx 3), united extraction liquid is with saturated nacl aqueous solution washing, anhydrous magnesium sulfate drying.Filter, concentrate the back residue and obtain 2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] acetate (compound 7, R with purification by silica gel column chromatography 1=CH 3, R 2=n-C 7H 15), productive rate 93%.
7) preparation of 2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] ETHYLE ACETATE (TAPA1)
2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] acetate (1mmol) is dissolved in the 5mL absolute ethyl alcohol, and slow dripping thionyl chloride (1.2mmol) at room temperature stirs 12h with reaction mixture under 0 ℃ of stirring.Boil off excess ethyl alcohol under the decompression, residue obtains 2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] ETHYLE ACETATE (TAPA1, R with purification by silica gel column chromatography 1=CH 3, R 2=n-C 7H 15, R 3=C 2H 5), productive rate 80%.Product is a white crystal, Mp:45～52 ℃ (EtOAc/PE); IR (film) v Max: 3437,2931,2856,1737,1681,1494,1454,1403,1334,1163,1138,1117,1030cm -1 1H NMR (400MHz, CDCl 3) δ: 0.70～0.99 (m, 3H), 1.01～1.50 (m, 11H), 1.50～1.85 (m, 2H), 2.75～2.95 (m, 2H), 3.68～3.98 (m, 11H), 4.00～4.23 (m, 2H), 7.05 (s, 1H) ppm; 13C NMR (100MHz, CDCl 3) δ: 14.1,14.3,22.6,24.4,29.1,29.2,31.7,31.9,41.0,56.2,60.6,60.8,61.1,108.4,121.8,133.6,145.1,151.8,152.8,172.1,203.1ppm; MS (ESI): 403m/z (M+Na +) .Anal.Calcd.forC 21H 32O 6: C, 66.29; H, 8.48.Found:C, 66.16; H, 8.72.
Embodiment 2
2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] n-amyl acetate (compound TAPA2, R 1=CH 3, R 2=n-C 7H 15, R 3=n-C 5H 11)
Step 1) to the step 6) of preparation compound TAPA2 is identical with step 1) to the step 6) among the embodiment one.Preparation compound TAPA2 is an initiator with 2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] acetate (preparation method sees embodiment one, step 6)).
2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] acetate (1mmol) is dissolved in the anhydrous Pentyl alcohol of 5mL, and slow dripping thionyl chloride (1.2mmol) at room temperature stirs 12h with reaction mixture under 0 ℃ of stirring.After decompression boiled off excessive Pentyl alcohol down, residue obtained 2-[(2,3, the positive capryloyl of 4-trimethoxy-6-) phenyl] n-amyl acetate (TAPA2, R with purification by silica gel column chromatography 1=CH 3, R 2=n-C 7H 15, R 3=n-C 5H 11), productive rate 75%.Product is a viscous liquid, IR (film) v Max: 2954,2932,2857,1736,1684,1455,1168,1005cm -1. 1H NMR (400MHz, CDCl 3) δ: 0.86-0.91 (m, 6H), 1.29-1.34 (m, 12H), 1.60-1.70 (m, 4H), 2.86 (t, J=7.2Hz, 2H), 3.84-3.92 (m, 11H), 4.08 (t, J=6.8Hz, 2H), 7.03 (s, 1H) ppm; 13C NMR (100MHz, CDCl 3) δ: 13.9,14.0,22.3,22.6,24.3,28.0,28.3,29.1,29.2,31.7,31.8,41.0,56.2,60.7,61.0,64.7,108.4,121.8,133.7,145.1,151.8,152.8,172.1,203.0ppm; MS (ESI) m/z445 (M+Na +) .Anal.Calcd.for C 24H 38O 6: C, 68.22; H, 9.06; Found:C, 68.34; H, 9.35.
Embodiment 3
TAPA1 among the employing Western blotting method detection embodiment one is to the influence of AMPK α phosphorylation level among the mouse normal liver cell AML12.
TP is following:
1) lysis
Cell inoculation is on culture plate, and certain hour is handled in dosing behind the growth 24h, abandons nutrient solution; Wash once with the PBS damping fluid, add then and contain the PMSF of 1mmol/L and lysis buffer cell pyrolysis liquid (the 50mM HEPES (pH 7.4) of Cocktail (face with before adding, per 100 μ L lysates add 1 μ L); 100mM NaCl; 10%glycerol, 1%Triton-X-100,1.5mMMgCl 2, 25mM NaF) and 400 μ L, ultrasonication on ice, 4 ℃, collect supernatant behind the centrifugal 30min of 13000rpm, survey protein concentration.
2) mensuration of protein concentration
A.96 every hole adds 200 μ L Bradford protein determination liquid in the orifice plate, establishes 3 holes for every group;
B. blank: every hole adds 2 μ L Lysis buffer lysate mixings;
C. standard: every hole adds the BSA (being dissolved in Lysis Buffer) that 2 μ L concentration are 1mg/mL;
D. sample: every hole adds 2 μ L mixings;
E. survey OD 595, calculation sample concentration in ELIASA.
3) protein electrophoresis
Get 20-40 μ g protein sample, add equal-volume 2 * SDS sample buffer, 100 ℃ are boiled 6min, electrophoresis in discontinuous SDS-PAGE glue, voltage 100V, treat sample get into separation gel after voltage be adjusted to 150V.
4) electrotransfer
Electricity changes liquid in 4 ℃ of precoolings, cut behind the glue will the pretreated pvdf membrane of onesize methyl alcohol and filter paper be dipped in the electricity commentaries on classics liquid; After pvdf membrane was affixed on glue, the two sides covered filter paper, catches up with most bubble, be loaded in the electric turn trough towards the anodal order by film, in one 20 ℃ of electricity change (100V, 60min).
5) antigen antibody reaction
A. sealing: confining liquid room temperature sealing 1h;
B. an anti-reaction: sealing caudacoria and corresponding one anti-incubated at room 1-2h;
C. two anti-reactions: TBST washes 3 times, and each 5min adds corresponding two and resists incubated at room 1-2h.
6) ECL detects
TBST washes 3 times, each 10min.The A liquid of ECL and B liquid are mixed with 1: 1 (V/V), in the darkroom, drip in the film surface, hatch the 1min post-exposure.
Test-results is following:
As shown in Figure 1, with TAPA1 (being dissolved in DMSO) handle mouse normal liver cell AML12 (10 μ M, 12h) after, can significantly improve the phosphorylation level of AMPK α; With the antidiabetic medicine N1,N1-Dimethylbiguanide (Metformin is dissolved in phosphate buffered saline buffer PBS) of positive control handle cell (1mM, 12h) after, improve the phosphorylation level of AMPK α too.
Test-results shows that compound TAPA1 can reach the ability that improves AMPK α phosphorylation level with N1,N1-Dimethylbiguanide equally with 1/100 drug level.
Embodiment 4
Adopt the mouse tail vein blood sampling to measure the blood sugar method and measure the hypoglycemic ability of TAPA1 type ii diabetes mouse model db/db mouse.
TP is following:
Get the db/db mouse (male, 8 ages in week) of 16 hyperglycemia, be divided into experimental group (TAPA1 administration group at random; Earlier TAPA1 is dissolved in DMSO and is made into the 1M mother liquor; Get aequum then and 3 times of emulsifier by volume Tween-80 mix; After leaving standstill 15min; Slowly add saline water, flick the TAPA1-DMSO-Tween-80 mixture is dissolved in the saline water to form the aqueous solution lentamente) with control group (group of solvents: with DMSO replacement TAPA1-DMSO solution, collocation method is the same).Take the mode administration of abdominal injection, TAPA1 dosage is 50mg/kg, and group of solvents injected in mice and experimental group once a day, are injected fasting mouse 18h after 15 days continuously with the solvent that configures of volume, and the tail vein is got blood again, surveys its fasting blood sugar with blood glucose meter.
Test-results is following:
As shown in Figure 2, before the drug-treated, the fasting blood glucose level of control group and experimental mice does not have difference (p＞0.05) basically; But after TAPA1 handled 15 days, the fasting blood glucose level of db/db mouse significantly reduced (p＜0.05) test-results and shows that TAPA1 can significantly reduce the hungry blood sugar level of type ii diabetes model db/db mouse.
Embodiment 5
After adopting the method detection TAPAl processing of Western bloting and Realtime PCR, the variation of the phosphorylation level of AMPK α and glyconeogenesis pathway key enzyme gene expression in the db/db mouse liver.
TP is following:
The disconnected neck of handling 15 days through TAPA1 among the embodiment six of mouse is put to death, get liver and test as follows.
1) the tissue total protein extracts and Western blotting:
With the cell pyrolysis liquid in the TP among the embodiment five mouse liver is organized in homogenate on ice and grinds (0.1g organizes with the homogenate of 1ml lysate) and ultrasonic degradation, 4 ℃, collect supernatant behind the centrifugal 30min of 13000rpm, promptly required protein solution.The operation steps of determination of protein concentration and Western blotting is then with reference to the TP of embodiment five.
2) total tissue RNA is extracted and real-time fluorescence PCR (Realtime-PCR):
Total RNA extracts the RNeasy Mini Kit working instructions of experimental technique with reference to Qiagen company.
After RNA extracts, agarose gel electrophoresis with 1% and quality and the concentration of total RNA that spectrophotometric determination obtains.The measured RNA of matter is visible two bright bands when electrophoresis detection, be respectively 28S and 18SRNA, and last band are bright in back one.The purity of RNA that spectrophotometric determination obtains, the ratio of general requirement A260/A280 is greater than 1.8.
Using the Fermentas reversed transcriptive enzyme, is template with total RNA, and rt synthesizes cDNA.Experimental procedure is following: add 2 μ g RNA samples, 1 μ L dT18 (50 μ M) adds the H of no RNAase 2O to 15 μ L mixing is placed 5min sex change RNA, is placed 2min on ice rapidly for 70 ℃.5 * Frist-Strand the buffer that adds 5 μ L, 1.25 μ L do not have the dNTP (10 μ M) of RNA enzyme, and 1 μ L RNA enzyme inhibitors and 1 μ L reversed transcriptive enzyme react 60min under 40 ℃ of conditions, and last packing sample is also frozen for use in-20 ℃.
With cDNA is template, detects the expression level of related gene mRNA in the glyconeogenesis path with the Realtime-PCR method.
Primer sequence:
G6pc：Sense：5′-CACCGACTACTACAGCAACAGC-3′
Antisense：5′-ATC?CCAACCACAAGATGACG-3′；
Pepck：Sense：5′CATTGAGGGTATCATCTTTGGTGG?3′
Antisense：5′CAGGTATTTGCCGAAGTTGTAGC?3′.
Test-results is following:
As shown in Figure 3, after TAPA1 handled, the phosphorylation level of AMPK α significantly improved in the db/db mouse liver.As shown in Figure 4, after TAPA1 handled, the gene expression dose of glyconeogenesis pathway key enzymatic glucose in the db/db mouse liver-6-Phosphoric acid esterase (G6pc) and phosphoenolpyruvate carboxylation kinases (Pepck) was significantly suppressed.
Test-results shows, the gene expression dose that TAPA1 can significantly improve the phosphorylation level of AMPK α in the type ii diabetes model db/db mouse liver and significantly reduce its liver glyconeogenesis pathway key enzyme.

Claims (10)

1.2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester is characterized in that its structure is following:
2. the preparation method of 2-as claimed in claim 1 [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester is characterized in that the preparation route of said 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester is following:
Figure FSB00000889356400012
The preparation method of said 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester may further comprise the steps:
1) preparation 3-(2,3, the 4-tri-alkoxy) phenylpropionic acid 2
With 2 of 1.0～1.5 times of mole numbers, 2-dimethyl--1,3-diox-4,6-diketone (Meldrum acid) is dissolved in the triethylammonium formate solution, processes 0.2～1.0mol/L solution; Add 2,3 again, 4-tri-alkoxy phenyl aldehyde is with reaction mass heated, be stirred to and react completely; Cooling adds frozen water down, is acidified to pH=1 again, extracts back united extraction liquid, washing; Drying concentrates the back residue and obtains 3-(2,3, the 4-tri-alkoxy) phenylpropionic acid 2 with purification by silica gel column chromatography;
2) preparation hydrogenation indone 3
3-(2,3, the 4-tri-alkoxy) phenylpropionic acid 2 that step 1) is prepared be equivalent to 3-(2; 3,4-tri-alkoxy) 15～25 times polyphosphoric acid of phenylpropionic acid weight stirs, after reacting completely; Cooling adds frozen water down, after the extraction, and united extraction liquid; Washing, drying concentrates the back residue and obtains hydrogenation indone 3 with purification by silica gel column chromatography;
3) preparation hydrogenation indenes 4
With step 2) the hydrogenation indone 3 for preparing is dissolved in the dry methylene chloride, processes 0.05～0.15mol/L solution, under the protection of inert gas, stirs, and adds the Grignard reagent R of 1.5～4.5 times of mole numbers that are equivalent to hydrogenation indone mole number 2MgX, R 2=C1～C10 alkyl, X=Cl, Br are warming up to room temperature after adding Grignard reagent, continue to be stirred to react completely, and cooling is acidified to pH=1 down, and stir the back and extract, united extraction liquid, washing, drying, residue obtains hydrogenation indenes 4 with purification by silica gel column chromatography after concentrating;
4) preparation dihydroxyl hydrogenation indenes 5
The hydrogenation indenes 4 that step 3) is prepared is dissolved in the acetone solution, processes 0.05～0.2mol/L solution, stirs; Add the Toluidrin and the N-methyl-N-morpholine oxide that are equivalent to 1～3 times of mole number of hydrogenation indenes, after the stirring, add the perosmic anhydride solution of 3%～20% mole number that is equivalent to the hydrogenation indenes; Reaction mixture is stirred to reacts completely, add saturated sodium thiosulfate solution, stir; Decompression is extracted after steaming down and removing acetone; United extraction liquid, drying concentrates the back residue and obtains dihydroxyl hydrogenation indenes 5 with purification by silica gel column chromatography;
5) preparation 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetaldehyde 6
The dihydroxyl hydrogenation indenes 5 that step 4) is prepared is dissolved in THF/aqueous solution, processes 0.1～0.5mol/L solution, adds the sodium periodate that is equivalent to dihydroxyl hydrogenation indenes 1.0～2.0 mole numbers; Be stirred to and react completely adding silica gel, stirring; Filter, will filtrate concentrates, and residue obtains 2-[(2 with purification by silica gel column chromatography; 3,4-tri-alkoxy-6-acyl group) phenyl] acetaldehyde 6;
6) preparation 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetate 7
2-[(2,3, the 4-tri-alkoxy-6-acyl group) phenyl] acetaldehyde 6 that step 5) is prepared is dissolved in THF/butanol/water solution, processes 0.1～0.5mol/L solution; Add under stirring and be equivalent to 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] the 2-methyl-2-butene of 6～12 times of mole numbers of acetaldehyde and the SODIUM PHOSPHATE, MONOBASIC of 2～5 times of mole numbers, cooling adds the Textone of 2～5 times of mole numbers down; Be stirred to then and react completely adding saturated sodium bisulfite solution under the cooling, stirring, extraction; United extraction liquid, washing, drying; Concentrate the back residue and obtain 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetate 7 with purification by silica gel column chromatography;
7) preparation 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester
2-[(2,3, the 4-tri-alkoxy-6-acyl group) phenyl] acetate 7 that step 6) is prepared is dissolved in the absolute alcohol, processes 0.1～0.5mol/L solution; Stir, add and be equivalent to 2-[(2,3; 4-tri-alkoxy-6-acyl group) phenyl] sulfur oxychloride of 1～3 times of acetate mole number, be stirred to and react completely, decompression is steamed down and is removed excessive alcohol; Residue obtains 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester with purification by silica gel column chromatography.
3. the preparation method of 2-as claimed in claim 2 [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester; It is characterized in that in step 1), said 2,2-dimethyl--1; 3-diox-4, the consumption of 6-diketone (Meldrum acid) is 1.2 times of mole numbers of tri-alkoxy benzaldehyde; Said concentration of reactants is 0.7mol/L, and the temperature of reaction is 85～90 ℃; Said acidifying is to adopt the acidifying of 6mol/L Hydrogen chloride; Said extraction is to adopt ethyl acetate extraction; Said washing is to adopt the saturated nacl aqueous solution washing.
4. the preparation method of 2-as claimed in claim 2 [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester is characterized in that in step 2) in, the add-on of said polyphosphoric acid is 18～20 times of 3-(2,3, the 4-tri-alkoxy) phenylpropionic acid weight; The temperature of said reaction is 50～60 ℃; Said extraction is to adopt ethyl acetate extraction; Said washing is to adopt the saturated nacl aqueous solution washing.
5. the preparation method of 2-as claimed in claim 2 [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester is characterized in that in step 3) the concentration of said hydrogenation indone is 0.05～0.1mol/L; The add-on of said Grignard reagent is 3～4 times of mole numbers of hydrogenation indone; Said acidifying is to adopt hcl acidifying, and said acidifying temperature is 0 ℃; Said extraction is to adopt dichloromethane extraction; Said washing is to adopt the saturated nacl aqueous solution washing.
6. the preparation method of 2-as claimed in claim 2 [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester is characterized in that in step 4), said acetone solution, and by volume, acetone: water is 10: 1～6: 4; Said extraction is to adopt ethyl acetate extraction; Said hydrogenation indenes is 0.1mol/L; The add-on of said Toluidrin is 1.0 times of mole numbers of hydrogenation indenes; The add-on of said N-methyl-N-morpholine oxide is 1.5 times of mole numbers of hydrogenation indenes.
7. the preparation method of 2-as claimed in claim 2 [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester is characterized in that in step 5), said THF/aqueous solution, and by volume, THF: water is 1～3: 1; Said silica gel is 200～400 purpose silica gel; The concentration of made dihydroxyl hydrogenation indenes is 0.2～0.3mol/L; The add-on of said sodium periodate is 1.1～1.2 times of dihydroxyl hydrogenation indenes mole number.
8. the preparation method of 2-as claimed in claim 2 [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester; It is characterized in that in step 6); Said THF/butanol/water solution, by volume, THF: the trimethyl carbinol: water is 4～10: 2～4: 1; Said extraction is to adopt dichloromethane extraction; Said washing is to adopt the saturated nacl aqueous solution washing; The add-on of said 2-methyl-2-butene is 7～8 times of 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetaldehyde mole number, and the add-on of said SODIUM PHOSPHATE, MONOBASIC is 3～4 times of 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetaldehyde mole number; The add-on of said Textone is 2～3 times of 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetaldehyde mole number.
9. the preparation method of 2-as claimed in claim 2 [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester is characterized in that rapid 7) in, the concentration of 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetate is 0.2～0.3mol/L; The add-on of said sulfur oxychloride is 1.0～1.5 times of 2-[(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetate mole number.
10. the application of 2-as claimed in claim 1 [(2,3,4-tri-alkoxy-6-acyl group) phenyl] acetic ester in the preparation antidiabetic medicine.
CN2010102114460A 2010-06-23 2010-06-23 2-[(2,3,4-trialkoxy-6-acyl) phenyl] acetic ester as well as preparation method and application thereof Expired - Fee Related CN101891618B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2010102114460A CN101891618B (en) 2010-06-23 2010-06-23 2-[(2,3,4-trialkoxy-6-acyl) phenyl] acetic ester as well as preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2010102114460A CN101891618B (en) 2010-06-23 2010-06-23 2-[(2,3,4-trialkoxy-6-acyl) phenyl] acetic ester as well as preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN101891618A CN101891618A (en) 2010-11-24
CN101891618B true CN101891618B (en) 2012-10-31

Family

ID=43100997

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2010102114460A Expired - Fee Related CN101891618B (en) 2010-06-23 2010-06-23 2-[(2,3,4-trialkoxy-6-acyl) phenyl] acetic ester as well as preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN101891618B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102351702B (en) * 2011-08-18 2014-08-13 厦门大学 Synthesis method of hypoglycemic drug molecule TAPA (2-[(2, 3, 4-trialkoxy-6-acyl) phenyl] acetic ester)
KR102220170B1 (en) * 2018-01-17 2021-02-25 성균관대학교산학협력단 Ketide compounds, method for manufacturing, and use for treating diabetes thereof
MX2021003282A (en) * 2018-09-22 2021-06-08 Torrent Pharmaceuticals Ltd Methods of producing pyrazole compounds.

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101260039A (en) * 2008-03-13 2008-09-10 中国烟草总公司郑州烟草研究院 Method for preparing low grade aliphatic acid polyatomic alcohol mixing ester and application thereof in tobacco
CN101402573A (en) * 2008-11-19 2009-04-08 厦门大学 Bihydroxyl-2-acyl benzene acetic acid ester, producing method and uses thereof
CN101574667A (en) * 2009-06-08 2009-11-11 南京工业大学 Solid acid catalyst, preparation thereof and application thereof in esterification reaction

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101260039A (en) * 2008-03-13 2008-09-10 中国烟草总公司郑州烟草研究院 Method for preparing low grade aliphatic acid polyatomic alcohol mixing ester and application thereof in tobacco
CN101402573A (en) * 2008-11-19 2009-04-08 厦门大学 Bihydroxyl-2-acyl benzene acetic acid ester, producing method and uses thereof
CN101574667A (en) * 2009-06-08 2009-11-11 南京工业大学 Solid acid catalyst, preparation thereof and application thereof in esterification reaction

Also Published As

Publication number Publication date
CN101891618A (en) 2010-11-24

Similar Documents

Publication Publication Date Title
CN100528154C (en) Malonyl-COA decarboxylase inhibitors useful as metabolic modulators
Malapaka et al. Identification and mechanism of 10-carbon fatty acid as modulating ligand of peroxisome proliferator-activated receptors
CN101891618B (en) 2-[(2,3,4-trialkoxy-6-acyl) phenyl] acetic ester as well as preparation method and application thereof
CN110072861A (en) For treating the disubstituted pyrazole class compound of disease
Teramura et al. Glucose content in the liquid hydrolysate after dilute acid pretreatment is affected by the starch content in rice straw
CN110787197A (en) Quinoa bran extract and extraction method and application thereof
NO146225B (en) APPARATUS FOR EXTRACING MEAT FROM SMALL SHELLS.
CN103450163A (en) Indazole compounds, preparation method, and pharmaceutical applications thereof
CN103044353B (en) Febuxostat pharmaceutical co-crystal and preparation method thereof
CN110407703A (en) The preparation method of Indobufen impurity
CN101940785B (en) Hydrogen sulfide-producing enzyme preparation and use thereof
CN105982885A (en) Application of bavachinin and analogs of bavachinin
CN108558851A (en) A kind of-oxazoles of cumarin-ethylene type alpha-glucosidase restrainer and its preparation method and application
CN108440362A (en) A kind of preparation method of vildagliptin intermediate
CN103833734B (en) A kind of synthetic method of N-aminoethyl terpinene dimaleoyl imino imdazole derivatives
Qiu et al. Inhibition of mevalonate 5-diphosphate decarboxylase by fluorinated substrate analogs
CN102234284B (en) Fluorine-containing ticlopidine analogues, and preparation method and application thereof
CN102060864A (en) Salicylide schiff's base and transition metal compound and preparation method thereof
CN104971053A (en) Ranitidine hydrochloride composition tablet medicine for treating digestive system diseases
Kalko et al. Chronopharmacological study of hepatoprotective activity of the drug «Antral®»
CN109456254A (en) 1-DNJ-hydroxylated chalcone heterozygote derivative and its preparation method and application
CN108586542A (en) A kind of ONO types Schiff-base Palladium (II) complex and its preparation method and application containing multiple coordination sites
CN104940363B (en) A kind of inside and outside hypoglycemic purposes of trifoliate orange extract
CN104016935A (en) Benzoxazole derivative as well as preparation method and application thereof
CN108530438A (en) A kind of-oxazole type alpha-glucosidase restrainer of benzothiazole and its preparation method and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20121031

Termination date: 20200623

CF01 Termination of patent right due to non-payment of annual fee