CN101886086B - Trehalose-6-phosphate synthase gene sequence derived from Selaginella pulvinata Maxim and method for cloning same - Google Patents

Abstract

The invention discloses a trehalose-6-phosphate synthase (TPS) gene sequence derived from Selaginella pulvinata Maxim. The sequence has a nucleotide sequence expressed by SEQIDNO.1 and is a novel TPS gene sequence which enables the research objects of the TPS gene to be further expanded from escherichia coli, fungi and other microorganisms and a small number of limited plant bodies to multiple kinds of plant bodies such as the Selaginella pulvinata Maxim and the like. According to the excellent drought resistance, salt tolerance and the like expressed by trehalose which is catalytically synthesized by the TPS gene in the plant body of the Selaginella pulvinata Maxim, if the TPS gene is transformed into genes of corn and other plants by transgenic technology, new plant varieties with corresponding excellent drought resistance, salt tolerance and the like can be cultured. The invention also discloses a method for cloning the TPS gene sequence derived from the Selaginella pulvinata Maxim.

Description

A kind of trehalose-6-phosphate synthase gene order and cloning process thereof that derives from the cushion Selaginella tamariscina

Technical field

The invention belongs to the plant gene engineering technology field, particularly a kind of trehalose-6-phosphate synthase gene order and cloning process thereof that derives from the cushion Selaginella tamariscina.

Background technology

Cushion Selaginella tamariscina (Selaginella pulvinata Maxim) is the Selaginaceae Rock lily plant, is commonly called as " nine dead Herba Hylothelephii Verticillatis ".It generally is grown in the rock seam of bare hills and mountains and arid more, and is extremely drought-resistant, also cold-resistant.In the weather arid, sprig is just rolled, and cuddles up in a heap, to keep intravital moisture.In case obtain rainwater, temperature raises, and the sprig that crispaturas can open and flat coming.There are some researches show that this type of cushion Selaginella tamariscina resurrection plant body contains a large amount of stress metabolite-trehaloses.

Trehalose is claimed Yeast sugar again; Be through α-1 by two pyranoid ring glucose molecules; The nonreducing sugar that 1 glycosidic link links, its physico-chemical property is very stable, can under mal-conditions such as high temperature, high and cold, high salt and dry dehydration, play a protective role to biomass cells.Trehalose is kept high tenuigenin osmotic pressure as the osmoregulation material through osmoregulation, guarantees the normal physiological function of cell under drought stress; In water-stressed conditions, can keep the liquid-flow phase of cytolemma, prevent that permeability of cell membrane from increasing, and fusion phenomenon occurs; Can participate in the peptide chain folding through hydrogen bond action by the place of water molecule, maintain proteinic space structure and function under the lack of water situation.

In vivo; The biosynthetic process of trehalose is: earlier by trehalose-6-phosphate synthase (trehalose-6-phosphate synthase; TPS) reaction of catalysis uridine diphosphoglucose (UDP) and 6-glucose 1-phosphate1-generates the 6-phosphotrehalose UDP-transglucosylase; (treha1ose-6-phosphate phosphatase, dephosphorylation under effect TPP) finally generate trehalose at the trehalose-6-phosphate phosphoesterase again.Wherein, trehalose-6-phosphate synthase is a key enzyme in this route of synthesis; Different biological intravital trehalose-6-phosphate synthases have different features separately, as promptly existing evident difference at aspects such as encoding sox and structures.

People study one of main policies of trehalose at present, are through the cloning and expression research to the above-mentioned route of synthesis genes involved of trehalose, strengthen the metabolism of its route of synthesis, thereby realize trehalose enrichment in vivo.Wherein trehalose-6-phosphate synthase (TPS) becomes one of main perpetual object, and many scientists have carried out unremitting effort in this regard.People are more relatively with utilization to the research of TPS gene in the bodies such as intestinal bacteria and fungi, and are also very limited to the development research of TPS gene in the plant materials but at present.

Summary of the invention

Main purpose of the present invention is exactly to the limitation of prior art to plant materials intracellular trehalose-6-phosphate synthase (TPS) gene development research; A kind of gene order that derives from the trehalose-6-phosphate synthase of plant cushion Selaginella tamariscina is provided, is applied to make it in other genetically modified crops to have corresponding good performances such as drought resistance and salt tolerance with expectation.

Another object of the present invention provides a kind of cloning process of said gene sequence.

In order to realize the foregoing invention purpose, the technical scheme that the present invention adopts is following:

A kind of trehalose-6-phosphate synthase gene order that derives from the cushion Selaginella tamariscina, this sequence have the described nucleotide sequence like SEQ ID NO.1.

Its pairing aminoacid sequence such as SEQ ID NO.2 are said.

Above-mentioned nucleotide sequence can be through the method that comprises the steps, from plant cushion Selaginella tamariscina blade, extracts total RNA, designs primer, carries out clones such as pcr amplification, order-checking and obtain:

(1) extraction and the purifying of total RNA:

Can adopt various general RNA process for extracting and purification process, from plant cushion Selaginella tamariscina blade, extract the total RNA of cushion Selaginella tamariscina blade that obtains purifying;

RNA process for extracting commonly used is a lot; Like test kit method (Trizol method), hot borate method, guanidine isothiocyanate method, phynol method, dodecyl SULPHONIC ACID. sodium method, cetyl trimethylammonium bromide method, and various improve one's methods etc., all can be used for the extraction of the total RNA of cushion Selaginella tamariscina blade; Preferred Trizol method among the present invention.

Purifying mainly is for the DNA that removes among total RNA pollutes, and obtains the total RNA of cushion Selaginella tamariscina blade of purifying, carries out needs such as detection by quantitative to satisfy follow-up expression to goal gene.RNA purification process commonly used comprises: dnase digestion method (being called for short the D method), sour phenol degeneration methods (being called for short the S method), EDTA method (being called for short the E method) etc.; Preferred dnase digestion method among the present invention.

(2) clone of intermediate segment:

Synthesizing of A, intermediate segment cDNA first chain

With the total RNA of cushion Selaginella tamariscina blade of above-mentioned steps (1) purifying as template; With oligod (T) 18:5 '-GCTGTCAACGATACGCTACGTAACGGCATGACAGTG (T) 18-3 ' is the reverse transcription primer; It is synthetic to carry out cDNA first chain; CDNA first chain that obtains is as the cDNA template of pcr amplification among the following step B;

B, pcr amplification

As the cDNA template, utilize following upstream primer jf1 and downstream primer jx1 with cDNA first chain of aforementioned steps A gained intermediate segment, carry out pcr amplification:

jf1: 5’-TGGTCGTAAGGTTATGTTGGG-3’，

jx1: 5’-TGTTCGGGCATTGTTGTCAT-3’；

Amplification obtains the trehalose-6-phosphate synthase gene cDNA intermediate segment of cushion Selaginella tamariscina, through cloning and sequencing, obtains the intermediate segment sequence.

In this step, amplification system can be preferably:

TaqPlusPCR Master Mix 10 μL ，

CDNA template 1 μ L,

2 * primer (jx1/jf1), 0.5 μ L,

ddH ₂O 8 μL 。

Amplification program can be preferably:

94℃，5min；

94 ℃, 30 s, 55 ℃, 45 s, 72 ℃, 1 min, 30 s (30 circulations);

72 ℃, 8 min; 4 ℃ of insulations.

The clone of (3) 3 ' ends:

According to the intermediate segment sequence that above-mentioned steps (2) obtains, design and synthesize the specificity upstream primer S1 and the versatility downstream primer AP2 of the 3 ' end that is used to increase, be respectively:

S1: 5’-GCCATCAGAGAAAGCGGTTACT-3’，

AP2: 5’-TACGTACGGCATG ACAGTG-3’；

CDNA first chain to obtain among abovementioned steps (2) A is a template, utilizes upstream primer S1 and downstream primer AP2 to carry out pcr amplification; Amplification obtains 3 ' complete end, through cloning and sequencing, obtains 3 ' terminal sequence.

In this step, amplification system can be preferably:

TaqPlusPCR Master Mix 10 μL ，

CDNA template 2 μ L,

2 * primer (S1/AP2), 0.5 μ L,

ddH ₂O 7 μL 。

Amplification program can be preferably:

94℃，3 min；

94 ℃, 30 s; 55 ℃, 45 s; 72 ℃, 1 min, 30 s (33 circulations)

72 ℃, 8 min; 12 ℃ of insulations.

(4), the clone of 5 ' end:

CDNA first chain of C, synthetic 5 ' end

As template, is reverse transcription primer with following specificity downstream primer jx1 and 5 ' end connector upstream primer SMARTIIA Oligo with the total RNA of cushion Selaginella tamariscina blade of above-mentioned steps (1) purifying, carries out reverse transcription:

jx1: 5’- TGTTCGGGCATTGTTGTCAT-3’，

SMARTIIA Oligo: 5’-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3’；

Synthetic cDNA first chain that obtains reverse transcription product 5 ' end;

D, first section pcr amplification

According to the intermediate segment sequence that above-mentioned steps (2) obtains, design and synthesize specificity downstream primer A2 and homology upstream primer C1:

A2: 5’-TCTTTTCATTTTGACAGGCGAC-3’，

C1：5’-ATCGGATGGCCTGGTGTCTATG-3’；

CDNA first chain with abovementioned steps C gained reverse transcription product 5 ' end is the cDNA template, utilizes specificity downstream primer A2 and homology upstream primer C1, carries out first section pcr amplification of 5 ' end;

The product that amplification obtains is first section at cDNA a 5 ' end, through cloning and sequencing, obtains the sequence of first section at 5 ' end.

In this step, amplification system can be preferably:

TaqPlusPCR Master Mix 12 μL ，

CDNA template 2 μ L,

2 * primer (A2/C1), 0.5 μ L,

ddH ₂O 5 μL 。

Amplification program can be preferably:

94℃，3 min；

94 ℃, 30 s; 65 ℃, 45 s; 72 ℃, 1 min, 30 s (2 circulations);

Per two circulations are successively decreased 2 ℃;

94 ℃, 30 s; 55 ℃, 45 s; 72 ℃, 1 min, 30 s (25 circulations);

72 ℃, 8 min; 12 ℃ of insulations.

E, second section pcr amplification

According to the sequence of first section at abovementioned steps D gained cDNA 5 ' end, design and synthesize specificity downstream primer A5 and 5 ' end versatility upstream primer P3:

A5: 5’-GCGGTCTTCTTGACGCAATCCAATGTAG-3’，

P3: 5’-AAGCAGTGGTATCAACGCAGAGT-3’ ；

CDNA first chain with abovementioned steps C gained reverse transcription product 5 ' end is the cDNA template, utilizes specificity downstream primer A5 and 5 ' end versatility upstream primer P3, carries out second section pcr amplification of 5 ' end:

The product that amplification obtains is second section at cDNA a 5 ' end, through cloning and sequencing, obtains second section sequence of 5 ' end.

In this step, amplification system can be preferably:

TaqPlusPCR Master Mix 10 μL ，

CDNA template 1.5 μ L,

2 * primer (A5/P3), 0.5 μ L,

ddH ₂O 7.5 μL 。

Amplification program can be preferably:

94 ℃, 30 s; 72 ℃, 2 min (5 circulations);

94 ℃, 30 s; 70 ℃, 30 s; 72 ℃, 2 min (5 circulations);

94 ℃, 30 s; 68 ℃, 30 s; 72 ℃, 2 min (25 circulations);

12 ℃ of insulations.

(5) clone of ORF and splicing:

Above-mentioned steps (2) gained intermediate segment sequence, step (3) gained 3 ' terminal sequence and step (4) gained 5 ' first section sequence of end and second section sequence are spliced; The cDNA total length that obtains is as the cDNA template of ORF (Open Reading Frame, ORFs) amplification;

Carry out pcr amplification with following upstream primer ORF4 and downstream primer ORF5:

ORF 4：5’-CCCAAGCTT(Hind Ⅲ)CCTCGAG(XhoⅠ)ATGCCTACTCCGTATTCCAATAC -3’，

ORF5: 5’-CGC GGATCC (BamH Ⅰ)ATTAATTATCGACAGCGACAACC-3’；

The product that amplification obtains is complete ORFs, and promptly the trehalose-6-phosphate synthase gene of cushion Selaginella tamariscina through cloning and sequencing, promptly gets its gene order.

In this step, amplification system can be preferably:

2 * GC Buffer I (contains Mg ²⁺) 10 μ L,

2 * primer (ORF4/ORF5), 0.5 μ L,

CDNA template 1 μ L,

dNTP Mixture 3.2 μL ，

TaKaRa LA Taq 0.2 μL ，

ddH ₂O 4.6 μL 。

Amplification program can be preferably:

94℃，5 min；

94 ℃, 30 s; 57 ℃, 1 min, 30 s; 72 ℃, 2 min (10 circulations);

94 ℃, 30 s; 72 ℃, 2 min, 30 s (25 circulations);

72 ℃, 8 min; 12 ℃ of insulations.

Compared with prior art, the invention has the beneficial effects as follows:

The gene order that the present invention derives from the trehalose-6-phosphate synthase (TPS) of plant cushion Selaginella tamariscina is a kind of new TPS gene order, makes people further expand to various plants bodies such as cushion Selaginella tamariscina to the research object of TPS gene from mikrobes such as intestinal bacteria and fungi and the limited plant materials of minority.

And; Can expect according to performances such as the good drought resisting that catalysis synthetic trehalose is shown in cushion Selaginella tamariscina plant materials of this TPS gene, salt tolerants: if, can cultivate the new variety of plant of performances such as having accordingly good drought resisting, salt tolerant in its gene through other plants such as transgenic technology importing corns.

Description of drawings

Fig. 1 is SpTPS1 gene intermediate segment electrophoresis detection figure as a result,

Fig. 2 is SpTPS1 gene 3 ' end electrophoresis detection figure as a result,

Fig. 3 is first section electrophoresis detection of SpTPS1 gene 5 ' figure as a result,

Fig. 4 is second section electrophoresis detection of SpTPS1 gene 5 ' figure as a result,

Fig. 5 is SpTPS1 gene electrophoresis detection figure as a result,

Fig. 6 is an expression vector pTU+SpTPS1 synoptic diagram,

Fig. 7 is regeneration plant (changeing spTPS1 gene T1 is) PCR detected result figure for strain,

Fig. 8 is the Southern hybridization detected result figure of regeneration plant (changeing spTPS1 gene T1 is) for strain.

Embodiment

Below in conjunction with embodiment foregoing invention content of the present invention is done further to describe in detail.

But should this be interpreted as that the scope of the above-mentioned theme of the present invention only limits to following embodiment.Not breaking away under the above-mentioned technological thought situation of the present invention, according to ordinary skill knowledge and customary means, make various replacements and change, all should comprise within the scope of the invention.

In following each embodiment, the trehalose-6-phosphate synthase of cushion Selaginella tamariscina is abbreviated as SpTPS1Through each embodiment, finally obtain deriving from trehalose-6-phosphate synthase nucleotide sequence () and the pairing aminoacid sequence () thereof of cushion Selaginella tamariscina of SEQ ID NO.2 of SEQ ID NO.1.

Embodiment 1

Present embodiment is extraction and the purifying of the total RNA of cushion Selaginella tamariscina blade, comprises the steps:

(1) gets cushion Selaginella tamariscina young leaflet tablet and put into the mortar of liquid nitrogen precooling; Add liquid nitrogen immediately; Grind broken sample as much as possible, take advantage of liquid nitrogen and do not volatilize as yet sample is divided in the 1.5 mL centrifuge tubes of packing into the liquid nitrogen precooling by every pipe 0.1 g, add 1 mL Trizol (Invitrogen company) to every pipe immediately; Behind the thermal agitation, room temperature is placed 5 min.

(2) 4 ℃, centrifugal 2 min of 12000 r/min change supernatant in the centrifuge tube of new no RNase.

(3) add the NaCl of 0.1 mL, 5 mol/L to every pipe; Mix, add 0.3 mL chloroform to every pipe again, behind thermal agitation 15 s; Room temperature is placed 3 min; 4 ℃, centrifugal 15 min of 12000 r/min are not sucking under the situation in middle layer as far as possible, and the sucking-off supernatant changes in another 1.5 clean mL centrifuge tubes.

(4) to the Virahol of every pipe adding with gained supernatant equal volume, behind the mixing, room temperature is placed 10 min gently, and 4 ℃, centrifugal 10 min of 12000 r/min carefully outwell liquid in the pipe, keep deposition, add 1 mL, 75% washing with alcohol deposition.

(5) 4 ℃, centrifugal 5 min of 7500 r/min carefully outwell liquid in the pipe, keep deposition, add 1 mL, 75% washing with alcohol deposition again, 4 ℃, centrifugal 5 min of 7500 r/min, and the gained deposition is the total RNA of cushion Selaginella tamariscina blade ,-20 ℃ of preservations.

Embodiment 2

Present embodiment does SpTPS1The clone of gene intermediate segment, method is following:

With the total RNA of cushion Selaginella tamariscina blade of the foregoing description 1 gained purifying as template, with oligod (T) 18:5 '-GCTGTCAACGATACGCTACGTAACGGCATGACAGTG (T) ₁₈-3 ' is the reverse transcription primer, according to the PrimeScript of Takara company ^TMIt is synthetic that Reverse Transcriptase specification sheets carries out cDNA first chain, and the amplification system TV is 20 μ L; Obtain cDNA first chain of intermediate segment.

Earlier through 5 known trehalose-6-phosphate synthase aminoacid sequences of comparison: bring back to life Selaginella tamariscina TPS1( Selaginella lepidophylla TPS1U96736.1); Tomato TPS1( Solanum lycopersicum TPS1E.F151131.1); Arabidopis thaliana TPS1( Arabidopsis thalianaTPS1NM106505.4); Little upright pea moss TPS1( Physcomitrella patens subsp TPS1XM001778453); Sugarcane TPS1( Saccharum hybrid cultivar TPS1EU761244), determine the conservative region in mid-way, again to bring back to life Selaginella tamariscina TPS1For inquiry sequence carries out the Nucleotide comparison at NCBI, binding ratio obtains a pair of degenerate primer to situation:

jf1: 5’-TGGTCGTAAGGTTATGTTGGG -3’；

jx1: 5’-TGTTCGGGCATTGTTGTCAT-3’。

CDNA first chain with aforementioned intermediate segment is the cDNA template, carries out the amplification of cushion Selaginella tamariscina trehalose-6-phosphate synthase gene cDNA intermediate segment with designed primer jf1 and jx1.

Amplification system is: TaqPlusPCR Master Mix 10 μ L

CDNA template 1 μ L

2 * primer (jx1/jf1), 0.5 μ L

ddH ₂O 8 μL

Amplification program is: 94 ℃, and 5min;

94 ℃, 30 s, 55 ℃, 45 s, 72 ℃, 1 min, 30 s (30 circulations);

72 ℃, 8 min; 4 ℃ of insulations.

Get gained amplified production 10 μ L through 1% non-sex change sepharose 80 V electrophoresis 40 min, EB dyeing back UV detection amplified fragments, the result is as shown in Figure 1.

The product that amplification obtains does SpTPS1The gene cDNA intermediate segment, through the method cloning and sequencing that comprises the steps, the intermediate segment sequence such as the SEQ ID NO.3 that obtain are said:

1. segmental recovery of purpose and purifying:

The specific band that amplification is come out digs out from agarose under UV-light with clean blade soon and accurately, places 1.5 mL centrifuge tubes, reclaims test kit (sky, Beijing root company) with gel and reclaims the dna fragmentation in the glue;

2. ligation:

The dna fragmentation that reclaims is cloned in the pMD18-T of TaKaRa company carrier.Ligation is adopted and is connected test kit (Takara company), amplification system TV 10 μ L, and 16 ℃ of connections are spent the night;

3. the preparation of competent cell:

I, from the LB flat board the new activatory of picking E. coli DH5 αSingle bacterium colony is inoculated in the 3-5 mL LB liquid nutrient medium, about 37 ℃, 225 r/min shaking culture, 12 h, until the logarithmic growth later stage; The ratio of this bacteria suspension with 1:100-1:50 is inoculated in the 100 mL LB liquid nutrient mediums, about 37 ℃ of shaking culture 2-3 h to OD600=0.35-0.5;

II, nutrient solution is changed in the centrifuge tube, place 10 min on ice, then in 4 ℃ of centrifugal 10 min of 3000 r/min down;

III, supernatant discarded are with the CaCl of 0.05 mol/L of precooling ₂Solution 10 mL are suspension cell gently, place 15-30 min on ice after, 4 ℃ of following centrifugal 10 min of 3000 r/min;

IV, supernatant discarded add the CaCl that 4 mL precoolings contain 0.05 mol/L of 15% glycerine ₂Solution, suspension cell is placed several minutes on ice gently, the competent cell suspension;

V, competent cell is distributed into the aliquot of 200 μ L, being stored in-80 ℃ can preserve half a year;

4. the conversion of DNA:

I, from-80 ℃ of refrigerators, take out a pipe competent escherichia coli cell DH5 α, place on ice and melt;

II, under aseptic condition, add 10 μ L ligation liquid, behind the vortex mixing, place 30 min on ice gently;

III, 42 ℃ of water-bath thermal shock 90 s do not shake, and put into ice bath cooling 2-3 min afterwards rapidly;

IV, adding 700 μ L do not have the LB liquid nutrient medium of Amp, behind the mixing, and 37 ℃, 100 r/min shaking table joltings cultivation, incubation 45 min;

V, get the bacterium liquid that 100 μ L have transformed and be applied on the culture plate of a LB/Amp, face up and place 30 min, treat that bacterium liquid is absorbed by substratum fully after, seal with sealing film, reverse petridish then, 37 ℃ of lucifuges cultivation 16-24 h; Screen positive bacterium colony subsequently;

5. the recombinate evaluation and the preservation of bacterium colony:

From seeing in appearance, the bacterium colony of general white and circle is positive, accurately identifies the step below also needing:

I, on the flat board of incubated overnight with the sterilization the several white colonies of toothpick picking, respectively dibbling in the 1.5 mL centrifuge tubes that fill the LB liquid nutrient medium that contains 0.1 g/L Amp, 37 ℃, 100 r/min jolting overnight cultures;

II, get 10 μ L bacteria suspension in 1.5 mL centrifuge tubes, add 90 μ L ddH ₂O boils 10 min, and is centrifugal, gets supernatant 2 μ L as template, carries out pcr amplification with primer jf1/jx1, and pcr amplification system and amplification condition are all the same, and the non-sex change agarose gel electrophoresis with 1% detects amplified production; When if product is the purpose band, the positive clone of this reorganization bacterium colony, otherwise negative; Establish the negative control that does not add bacteria suspension simultaneously;

III, get the bacterium colony suspension-s 750 μ L of the positive colony of having identified, add the sterile glycerol of 250 μ L, behind the mixing, use liquid nitrogen flash freezer, it is subsequent use to place-80 ℃ of refrigerators to preserve;

IV, send Ying Jun biotech company order-checking at last, institute's calling sequence compares at the Blastn of NCBI, and whether the checking cloned sequence is correct.

Embodiment 3

Present embodiment is the clone of SpTPS1 gene 3 ' end, and method is following:

According to the sequencing result of above-mentioned intermediate segment, synthetic 1 the specificity upstream primer of design:

S1: 5’-GCCATCAGAGAAAGCGGTTACT-3’,

The versatility downstream primer is held in synthetic 13 ' of design in addition:

AP2: 5’-TACGTACGGCATGACAGTG-3’;

Intermediate segment cDNA first chain that obtains with previous embodiment 2 is a template, utilizes upstream primer S1 and downstream primer AP2 to carry out pcr amplification;

Amplification system is:

TaqPlusPCR Master Mix 10 μL ，

CDNA template 2 μ L,

2 * primer (S1/AP2), 0.5 μ L,

ddH ₂O 7 μL 。

Amplification program is:

94℃，3 min；

94 ℃, 30 s; 55 ℃, 45 s; 72 ℃, 1 min, 30 s (33 circulations)

72 ℃, 8 min; 12 ℃ of insulations.

Get the gained amplified production and detect through 1% agarose gel electrophoresis, the result is as shown in Figure 2.

The product that amplification obtains does SpTPS1Gene 3 ' end, through cloning and sequencing, the 3 ' terminal sequence such as the SEQ ID NO.4 that obtain are said.

Cloning and sequencing is with reference to the sequence measurement of aforementioned intermediate segment; Product after the electrophoresis detection is reclaimed test kit through glue reclaims, again with the product cloning that reclaims to the pMD18-T carrier, Transformed E. coli DH5 α competent cell; With S1/AP2 is primer; After bacterium liquid PCR checking, extract plasmid (sky, Beijing root biochemical technology ltd) with the little extraction reagent kit of plasmid, and send the order-checking of Ying Jun biotech company bacterium liquid.Institute's calling sequence compares at the Blastn of NCBI, and whether the checking cloned sequence is correct.

Embodiment 4

Present embodiment is the clone of SpTPS1 gene 5 ' end, comprises the steps:

(1), cDNA first chain of 5 ' end is synthetic:

With the total RNA of cushion Selaginella tamariscina blade of the foregoing description 1 gained purifying as template; With following specificity downstream primer jx1 and 5 ' end connector upstream primer SMARTIIA Oligo is the reverse transcription primer; Adopt MMLV Reverse Transcriptase (the precious biotech firm in Dalian) to carry out reverse transcription, post transcription cloning system TV is 10 μ L:

jx1: 5’-TGTTCGGGCATTGTTGTCAT-3’，

SMARTIIA Oligo: 5’-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3’；

Synthetic cDNA first chain that obtains reverse transcription product 5 ' end;

(2), first section pcr amplification:

According to the intermediate segment sequence that above-mentioned steps (2) obtains, design and synthesize specificity downstream primer A2:

A2: 5’-TCTTTTCATTTTGACAGGCGAC-3’，

According to the comparison (the same) of 5 known 6-phosphotrehalose UDP-transglucosylase synthetic enzyme sequences that design intermediate segment, seeking homology segment again, designing and synthesizing homology upstream primer C1 near 5 ' end place:

C1：5’-ATCGGATGGCCTGGTGTCTATG-3’；

CDNA first chain with abovementioned steps (1) gained reverse transcription product 5 ' end is the cDNA template, utilizes specificity downstream primer A2 and homology upstream primer C1, carries out first section pcr amplification of 5 ' end;

Amplification system is:

TaqPlusPCR Master Mix 12 μL ，

CDNA template 2 μ L,

2 * primer (A2/C1), 0.5 μ L,

ddH ₂O 5 μL 。

Amplification program is:

94℃，3 min；

94 ℃, 30 s; 65 ℃, 45 s; 72 ℃, 1 min, 30 s (2 circulations);

Per two circulations are successively decreased 2 ℃;

94 ℃, 30 s; 55 ℃, 45 s; 72 ℃, 1 min, 30 s (25 circulations);

72 ℃, 8 min; 12 ℃ of insulations.

Get the gained amplified production and detect through 1% agarose gel electrophoresis, the result is as shown in Figure 3.

The product that amplification obtains does SpTPS1First section at gene 5 ' end, through cloning and sequencing, the first section sequence of 5 ' end such as the SEQ ID NO.5 that obtain are said.

Cloning and sequencing is with reference to the sequence measurement of aforementioned intermediate segment; Product after the electrophoresis detection is reclaimed test kit through glue reclaims, again with the product cloning that reclaims to the pMD18-T carrier, Transformed E. coli DH5 α competent cell; With A2/C1 is primer; After bacterium liquid PCR checking, extract plasmid, and send the order-checking of Ying Jun biotech company bacterium liquid.Institute's calling sequence compares at the Blastn of NCBI, and whether the checking cloned sequence is correct.

(3), second section pcr amplification:

Sequence according to first section at abovementioned steps (2) gained cDNA 5 ' end designs and synthesizes specificity downstream primer A5:

A5: 5’-GCGGTCTTCTTGACGCAATCCAATGTAG-3’，

In addition according to synthetic 15 ' the end versatility upstream primer P3 of 5 ' end reverse transcription joint design of primers:

P3: 5’-AAGCAGTGGTATCAACGCAGAGT-3’ ；

CDNA first chain with abovementioned steps (1) gained reverse transcription product 5 ' end is the cDNA template, utilizes specificity downstream primer A5 and 5 ' end versatility upstream primer P3, carries out second section pcr amplification of 5 ' end:

Amplification system is:

TaqPlusPCR Master Mix 10 μL ，

CDNA template 1.5 μ L,

2 * primer (A5/P3), 0.5 μ L,

ddH ₂O 7.5 μL 。

Amplification program is:

94 ℃, 30 s; 72 ℃, 2 min (5 circulations);

94 ℃, 30 s; 70 ℃, 30 s; 72 ℃, 2 min (5 circulations);

94 ℃, 30 s; 68 ℃, 30 s; 72 ℃, 2 min (25 circulations);

12 ℃ of insulations.

Get the gained amplified production and detect through 1% agarose gel electrophoresis, the result is as shown in Figure 4.

The product that amplification obtains does SpTPS1Second section at gene 5 ' end, through cloning and sequencing, the second section sequence of 5 ' end such as the SEQ ID NO.6 that obtain are said.

Cloning and sequencing is with reference to the sequence measurement of aforementioned intermediate segment; Product after the electrophoresis detection is reclaimed test kit through glue reclaims, again with the product cloning that reclaims to the pMD18-T carrier, Transformed E. coli DH5 α competent cell; After bacterium colony PCR checking, send the order-checking of Ying Jun biotech company.Institute's calling sequence compares at the Blastn of NCBI, and whether the checking cloned sequence is correct.

Embodiment 5

Present embodiment is SpTPS1 gene ORFs ORF clone, and method is following:

The foregoing description 2 gained intermediate segment sequences, embodiment 3 gained, 3 ' terminal sequence and embodiment 4 gained, 5 ' first section sequence of end and second section sequence are spliced; Obtain cDNA total length (as the cDNA template of ORF amplification); Through ORF finder tool analysis ORFs in the NCBI, and following according to the needs design upstream primer ORF4 and the downstream primer ORF5 of the restriction enzyme site of expression vector:

ORF 4：5’-CCCAAGCTT(Hind Ⅲ)CCTCGAG(XhoⅠ)ATGCCTACTCCGTATTCCAATAC -3’，

ORF5: 5’-CGC GGATCC (BamH Ⅰ)ATTAATTATCGACAGCGACAACC-3’；

The cDNA total length that obtains with splicing is carried out pcr amplification as the cDNA template of ORF amplification with upstream primer ORF4 and downstream primer ORF5:

Amplification system is:

2 * GC Buffer I (contains Mg ²⁺) 10 μ L,

2 * primer (ORF4/ORF5), 0.5 μ L,

CDNA template 1 μ L,

dNTP Mixture 3.2 μL ，

TaKaRa LA Taq 0.2 μL ，

ddH ₂O 4.6 μL 。

Amplification program is:

94℃，5 min；

94 ℃, 30 s; 57 ℃, 1 min, 30 s; 72 ℃, 2 min (10 circulations);

94 ℃, 30 s; 72 ℃, 2 min, 30 s (25 circulations);

72 ℃, 8 min; 12 ℃ of insulations.

Get the gained amplified production and detect through 1% agarose gel electrophoresis, the result is as shown in Figure 5.

The product that amplification obtains is complete ORFs, and promptly the trehalose-6-phosphate synthase gene of cushion Selaginella tamariscina through cloning and sequencing, promptly gets its gene order, and is of SEQ ID NO.1; Its corresponding amino acid sequence such as SEQ ID NO.2 are said.

Cloning and sequencing is with reference to the sequence measurement of aforementioned intermediate segment; Product after the electrophoresis detection is reclaimed test kit through glue reclaims, again with the product cloning that reclaims to the pMD18-T carrier, Transformed E. coli DH5 α competent cell; After bacterium liquid PCR checking, send the order-checking of Ying Jun biotech company.Institute's calling sequence compares at the Blastn of NCBI.

Embodiment 6

Because gene has many uncertainties in clone, expression process, whether the gene that finally obtains has as expecting that function corresponding also is uncertain; Therefore, in the present embodiment, for whether the trehalose-6-phosphate synthase gene (SpTPS1) of institute clone's above-mentioned cushion Selaginella tamariscina has some particular functionality, the contriver furthers investigate, so that further verify its function, concrete operations are following:

(1), makes up plant expression vector, agrobacterium mediation converted corn acquisition transgenic regenerated plant

Starting cushion Selaginella tamariscina trehalose synthesize enzyme gene SpTPS1 by monocotyledons constitutive promoter Ubiquitin, is selective marker with anti-herbicide gene Bar, and construction of expression vector pTU+SpTPS1 is as shown in Figure 6.Among Fig. 6: LB, the plant expression vector left margin (length 25bp, L25); RB, and the plant expression vector right margin (length 25bp, R25); Bar, the antiweed selectable marker gene; TEV enhancer, enhanser, effect is to strengthen the bar expression of gene; 2 * PS, placed in-line two 35S promoters start the bar expression of gene; Ubiquitin, monocotyledons corn ubiquitin promoter; T-nos, the rouge alkali synthetase terminator; AadA, the spectinomycin mark, when being used for the expression vector transformed into escherichia coli as selection markers.

Embryo callus with corn inbred line 18-599 is an acceptor, agrobacterium mediation converted pTU+spTPS1, and through herbicide screening, differentiation obtains regeneration plant.

(2), the Molecular Identification of regeneration plant

Regeneration plant is carried out target gene PCR detect (process for extracting of goal gene and detection method are with the process for extracting and the detection method of SpTPS1 gene among the above embodiment); Obtain also adding generation seed of a strain positive plant, gather in the crops 38 offspring's strains systems to Yunnan.

38 T1 that change the spTPS1 gene for strain are, it is as shown in Figure 7 that the part strain is that PCR detects, and M is dna molecular amount mark DL2000, the negative contrast of CK-; The positive plasmid of CK+ (pTU+spTPS1) contrast, D6, C3, A6, E4, B5 are respectively changes spTPS1 gene T1 generation homophyletic system not, each transgenic T1 generation not homophyletic to bind fruit positive entirely.

Select two strain systems of enough E4 of genomic dna amount and A6, with the restriction enzyme that can evenly genomic dna be cut into size about several kb SpeI with ApaThe I enzyme is cut the genomic dna of two strains systems of E4 and A6, and enzyme electrophoretic separation enzyme is cut and carried out Southern hybridization behind the product and detect, and is as shown in Figure 8,1 be T1 for transgenic line E4 ( SpeThe I enzyme is cut), 2 are transgenic contrast, 3. positive contrast (pTU+SpTPS1), 4 be T1 for transgenic line E4 ( ApaThe I enzyme is cut), 5 be T1 for transgenic line A6 ( ApaThe I enzyme is cut); The result shows that the SpTPS1 gene has been incorporated in the corn gene group with single copy form.

(3), changeing spTPS1 gene T2 identifies for the drought tolerance of strain system

On Xinjiang and Sichuan and other places the evaluation point being set respectively in 2010 carries out.Examine according to each field accent of identifying point, average plant height 1.5 m of transfer-gen plant, comparison is according to reducing by 0.8 m, and plant type is compact.Expert evidence is carried out arid handle, the rotaring gene plant blade of highly reduce, plant type is compact still keeps unfolding, and non-transgenic contrast blade seriously curls, here withers.Transfer-gen plant tentatively shows stronger drought tolerance.

Sequence table

< 110>Sichuan Agricultural University

< 120>a kind of trehalose-6-phosphate synthase gene order and cloning process thereof that derives from the cushion Selaginella tamariscina

<160> 6

<210> 1

<211> 2790

<212> DNA

< 213>derive from the nucleotide sequence of the trehalose-6-phosphate synthase gene of cushion Selaginella tamariscina (Selaginella pulvinata Maxim)

<400> 1

atgcctactc cgtattccaa tacgaattcc tcaagcgctc ccttagtgcc tctcaatctc 60

aatctgccgc cttcgttagc gtcttccaga gtcgagcgcc ttgtccgaga gcggcaactg 120

aggaggaatg acgaccagcc tgaatcggtg caagaatcgc acgaacaggt acaagatcat 180

acgcaggagc agccggattc acccttgacg ccggatcgtc agcagcggct gctcgttgta 240

gcgaatcggt tgccggtttc cgccacgcgc aagggcgacg atcaatggag cttggaagtg 300

agcgctggcg gcctcgtctc tgcgcttctt ggtgtgaagc agttccaggt agtatggatc 360

ggccggcccg gtgtctatgt ccaggacgag ctcggcaagc aatcgcttgc caaggcgctt 420

gaggaaaagg gatttgtggg tgtgttgcta gacgaggaaa cagtggatca atattacaat 480

ggctactgca acaatgtctt gtggcctctc tttcactaca ttggattgcg tcaagaagac 540

cgcctggccg cgactcgaag tcttcaatca caattcggcg cctacaagcg tgcaaacagg 600

ctgtttgcag atgccgtcat taaacactac caagaaggcg atttcgtttg gacacatgat 660

tatcacctca tggtcctgcc tagctatctc aaggagcacg acccacgaat gaaagtcgga 720

tggttcctgc acactccatt tccttcatct gaaatatata gaacactgcc tctccgctca 780

gaattgcttc agggtgtcct tggtgcagat ttggttggtt tccacacgta cgactatgcc 840

aggcattttg ttagcgcctg tacaaggata ttgggtctgg aagggactcc cgagggagtg 900

gaagatcaag ggaaaataac gcgtgttgcc gcgtttcctg tcgggataga ttctgaaagg 960

tgcatccagg ctgttgaaac agatgcagtg aagaagcata tagaagaact cagtgccaga 1020

tttgctggcc gtaaggtgat gttgggagtg gataggcttg atccaattaa gggcatacca 1080

caaaagctac tcgcatttga gaagtttttg gaggaaaatc cacattggcg tgacaaggtg 1140

attctggtcc agattgcggt tcccacaaga caagatgtgc tggaatatca aaagctcgca 1200

agccaggtgc atgaaatcgt gggtcgcatc aacggtcgtt acggttctct tacgactgta 1260

cccatccacc atctcgaccg ttcgatgaaa tttcctgagc tctgtgcttt gtacaccatt 1320

actgatgtgt tgcttgtaac atccttacgg gatggtatga acctcgttag ctacgagttt 1380

gtcgcctgtc aaaatgaaaa gaagggagct ctcgtattaa gtgagttcgc aggtgctgca 1440

caatcactag gtgcaggctc aattttggta aacccatgga acattattga aaccgctaat 1500

gctattggag aagcacttaa catgcccgag gaagaacgtg aagagcgtca tagacttaac 1560

ttcatgcacg ttacacccca tagtgctcag gtctgggcgg agacattcac cagtgaattg 1620

aatgactcaa tactggaggc ggagctgcgt actttgcata ttcctccaca actgccatca 1680

gacaaagtgg ttactaagtt cgccgagtcg aagaatcggc taatgattct gggtttcaat 1740

tctgcactaa ctgcaccagt ggaagctcca cgtggaagag ctcctgacca gattagagaa 1800

atgaagattc gcctacatcc aaacttggaa gaagtgttca atgttctttg cagtgatcca 1860

agaaccacta tagtcattct tagtgggagt gaacgtgctg ttttggatga ggcatttgga 1920

gagtttgata tgtggttggc agcagagaat ggaatgtttc ttcgtcacac acaaggagag 1980

tggatgacaa ccatgcctga gcacctaaac atggattggg tagagagtgt acagttggta 2040

tttgattatt tctgtgagag aacgcctcgt tcgtttgtgg aagcccgtgg aacttcattg 2100

gtgtggaatt acaagtatgc agatgtggaa tttgggagag tacaagcacg ggatatgcta 2160

cagcatcttt ggacaggacc gatttccaat gcagctgtgg atgttgttca aggtgggagg 2220

tctgtagaag ttcgccctgt tggagtctca aagggctctg caattgatcg gattcttggg 2280

gagattgtac atagcaagca catggttact cctattgatt tcgttatgtg tattggtcat 2340

ttcttgagca aggatgaaga tatatacaca ttctttgagc cagagctccc atttttagag 2400

agcggaaatt caagtgcaaa ggttctagac aagagattag gttccaaggg atctggcaaa 2460

ttaggtggat caaggctcaa atcttatcct ccaatgtctc ctgacagggt ggtgcgcaag 2520

attgatgatg agcggctgat tgaagacgct ggtagatggg aaggctcgtc agtgcttgat 2580

ctcaagggtg aaaattattt ctcttgtgct gtggggacta tgaagcgttc attagcacga 2640

tactgtttga attcttctga cgaagtactt acattcttga gctcacttgc tgcggcttca 2700

gaatcttttc ctcaaaagag gagcgattcc tttaagagga atggtggatg gcatagccca 2760

actccaaggg ttgtcgctgt cgataattaa 2790

<210> 2

<211> 929

<212> PRT

< 213>derive from the aminoacid sequence of the trehalose-6-phosphate synthase gene of cushion Selaginella tamariscina (Selaginella pulvinata Maxim)

<400> 2

Met Pro Thr Pro Tyr Ser Asn Thr Asn Ser Ser Ser Ala Pro Leu Val

1 5 10 15

Pro Leu Asn Leu Asn Leu Pro Pro Ser Leu Ala Ser Ser Arg Val Glu

20 25 30

Arg Leu Val Arg Glu Arg Gln Leu Arg Arg Asn Asp Asp Gln Pro Glu

35 40 45

Ser Val Gln Glu Ser His Glu Gln Val Gln Asp His Thr Gln Glu Gln

50 55 60

Pro Asp Ser Pro Leu Thr Pro Asp Arg Gln Gln Arg Leu Leu Val Val

65 70 75 80

Ala Asn Arg Leu Pro Val Ser Ala Thr Arg Lys Gly Asp Asp Gln Trp

85 90 95

Ser Leu Glu Val Ser Ala Gly Gly Leu Val Ser Ala Leu Leu Gly Val

100 105 110

Lys Gln Phe Gln Val Val Trp Ile Gly Arg Pro Gly Val Tyr Val Gln

115 120 125

Asp Glu Leu Gly Lys Gln Ser Leu Ala Lys Ala Leu Glu Glu Lys Gly

130 135 140

Phe Val Gly Val Leu Leu Asp Glu Glu Thr Val Asp Gln Tyr Tyr Asn

145 150 155 160

Gly Tyr Cys Asn Asn Val Leu Trp Pro Leu Phe His Tyr Ile Gly Leu

165 170 175

Arg Gln Glu Asp Arg Leu Ala Ala Thr Arg Ser Leu Gln Ser Gln Phe

180 185 190

Gly Ala Tyr Lys Arg Ala Asn Arg Leu Phe Ala Asp Ala Val Ile Lys

195 200 205

His Tyr Gln Glu Gly Asp Phe Val Trp Thr His Asp Tyr His Leu Met

210 215 220

Val Leu Pro Ser Tyr Leu Lys Glu His Asp Pro Arg Met Lys Val Gly

225 230 235 240

Trp Phe Leu His Thr Pro Phe Pro Ser Ser Glu Ile Tyr Arg Thr Leu

245 250 255

Pro Leu Arg Ser Glu Leu Leu Gln Gly Val Leu Gly Ala Asp Leu Val

260 265 270

Gly Phe His Thr Tyr Asp Tyr Ala Arg His Phe Val Ser Ala Cys Thr

275 280 285

Arg Ile Leu Gly Leu Glu Gly Thr Pro Glu Gly Val Glu Asp Gln Gly

290 295 300

Lys Ile Thr Arg Val Ala Ala Phe Pro Val Gly Ile Asp Ser Glu Arg

305 310 315 320

Cys Ile Gln Ala Val Glu Thr Asp Ala Val Lys Lys His Ile Glu Glu

325 330 335

Leu Ser Ala Arg Phe Ala Gly Arg Lys Val Met Leu Gly Val Asp Arg

340 345 350

Leu Asp Pro Ile Lys Gly Ile Pro Gln Lys Leu Leu Ala Phe Glu Lys

355 360 365

Phe Leu Glu Glu Asn Pro His Trp Arg Asp Lys Val Ile Leu Val Gln

370 375 380

Ile Ala Val Pro Thr Arg Gln Asp Val Leu Glu Tyr Gln Lys Leu Ala

385 390 395 400

Ser Gln Val His Glu Ile Val Gly Arg Ile Asn Gly Arg Tyr Gly Ser

405 410 415

Leu Thr Thr Val Pro Ile His His Leu Asp Arg Ser Met Lys Phe Pro

420 425 430

Glu Leu Cys Ala Leu Tyr Thr Ile Thr Asp Val Leu Leu Val Thr Ser

435 440 445

Leu Arg Asp Gly Met Asn Leu Val Ser Tyr Glu Phe Val Ala Cys Gln

450 455 460

Asn Glu Lys Lys Gly Ala Leu Val Leu Ser Glu Phe Ala Gly Ala Ala

465 470 475 480

Gln Ser Leu Gly Ala Gly Ser Ile Leu Val Asn Pro Trp Asn Ile Ile

485 490 495

Glu Thr Ala Asn Ala Ile Gly Glu Ala Leu Asn Met Pro Glu Glu Glu

500 505 510

Arg Glu Glu Arg His Arg Leu Asn Phe Met His Val Thr Pro His Ser

515 520 525

Ala Gln Val Trp Ala Glu Thr Phe Thr Ser Glu Leu Asn Asp Ser Ile

530 535 540

Leu Glu Ala Glu Leu Arg Thr Leu His Ile Pro Pro Gln Leu Pro Ser

545 550 555 560

Asp Lys Val Val Thr Lys Phe Ala Glu Ser Lys Asn Arg Leu Met Ile

565 570 575

Leu Gly Phe Asn Ser Ala Leu Thr Ala Pro Val Glu Ala Pro Arg Gly

580 585 590

Arg Ala Pro Asp Gln Ile Arg Glu Met Lys Ile Arg Leu His Pro Asn

595 600 605

Leu Glu Glu Val Phe Asn Val Leu Cys Ser Asp Pro Arg Thr Thr Ile

610 615 620

Val Ile Leu Ser Gly Ser Glu Arg Ala Val Leu Asp Glu Ala Phe Gly

625 630 635 640

Glu Phe Asp Met Trp Leu Ala Ala Glu Asn Gly Met Phe Leu Arg His

645 650 655

Thr Gln Gly Glu Trp Met Thr Thr Met Pro Glu His Leu Asn Met Asp

660 665 670

Trp Val Glu Ser Val Gln Leu Val Phe Asp Tyr Phe Cys Glu Arg Thr

675 680 685

Pro Arg Ser Phe Val Glu Ala Arg Gly Thr Ser Leu Val Trp Asn Tyr

690 695 700

Lys Tyr Ala Asp Val Glu Phe Gly Arg Val Gln Ala Arg Asp Met Leu

705 710 715 720

Gln His Leu Trp Thr Gly Pro Ile Ser Asn Ala Ala Val Asp Val Val

725 730 735

Gln Gly Gly Arg Ser Val Glu Val Arg Pro Val Gly Val Ser Lys Gly

740 745 750

Ser Ala Ile Asp Arg Ile Leu Gly Glu Ile Val His Ser Lys His Met

755 760 765

Val Thr Pro Ile Asp Phe Val Met Cys Ile Gly His Phe Leu Ser Lys

770 775 780

Asp Glu Asp Ile Tyr Thr Phe Phe Glu Pro Glu Leu Pro Phe Leu Glu

785 790 795 800

Ser Gly Asn Ser Ser Ala Lys Val Leu Asp Lys Arg Leu Gly Ser Lys

805 810 815

Gly Ser Gly Lys Leu Gly Gly Ser Arg Leu Lys Ser Tyr Pro Pro Met

820 825 830

Ser Pro Asp Arg Val Val Arg Lys Ile Asp Asp Glu Arg Leu Ile Glu

835 840 845

Asp Ala Gly Arg Trp Glu Gly Ser Ser Val Leu Asp Leu Lys Gly Glu

850 855 860

Asn Tyr Phe Ser Cys Ala Val Gly Thr Met Lys Arg Ser Leu Ala Arg

865 870 875 880

Tyr Cys Leu Asn Ser Ser Asp Glu Val Leu Thr Phe Leu Ser Ser Leu

885 890 895

Ala Ala Ala Ser Glu Ser Phe Pro Gln Lys Arg Ser Asp Ser Phe Lys

900 905 910

Arg Asn Gly Gly Trp His Ser Pro Thr Pro Arg Val Val Ala Val Asp

915 920 925

Asn

<210> 3

<211> 979

<212> DNA

< 213>derive from the intermediate segment nucleotide sequence of the trehalose-6-phosphate synthase gene of cushion Selaginella tamariscina (Selaginella pulvinata Maxim)

<400> 3

ttggtcgtaa ggttatgttg ggagtggata ggcttgatcc aattaagggc ataccacaaa 60

agctactcgc atttgagaaa tttttggagg aaaatccaca ttggcgtgac aaggtgattc 120

ttgtccagat tgcggttccc acaagacaag atgtgctgga atatcaaaag ctcgcaagcc 180

aggtgcatga gatcgtgggt cgcatcaacg gtcgttacgg ttctcttacg actgtaccca 240

tccaccatct cgaccgttcg atgaaatttc ttgagctctg tgctttgtac gccattactg 300

atgtgttgct tgtaacatcc ttacgggatg gtatgaacct cgttagttac gaatttgtcg 360

cctgtcaaaa tgaaaagaag ggagctctcg tattaagtga gttcgcaggt gctgcacaat 420

cactaggtgc aggctcaatt ctggtaaacc catggaacat tattgaaacc gctaatgcta 480

ttggagaagc acttaacatg cccgaggaag aacgtgaaga acgtcataga cttaacttca 540

tgcacgttac aactcatagt gctcaggtct gggcggagac attcaccagt gaattgaatg 600

actcaatatt ggaggcggag ctgcgtactt tgcatattcc tccacaactg ccatcagaga 660

aagcggttac taagtttgcc gagtcgaaga atcggctaat gattctgggt ttcaattctg 720

cactaactgc accagtggaa gctccacgtg gaagagctcc tgaccagatt agagaaatga 780

agattcgcct acatccaaac ttgaaagaag tgttcaatgt tctttgcagt gatccaagaa 840

ccactatagt cattcttagt gggagtgaac gtgctgtatt ggatgaggca tttggagagt 900

ttgatatgtg gttggcagca gagaatggaa tgttccttcg tcacacacaa ggagagtgga 960

tgacaacaat gcccgaaca 979

<210> 4

<211> 1255

<212> DNA

< 213>derive from 3 ' terminal nucleotide sequence of the trehalose-6-phosphate synthase gene of cushion Selaginella tamariscina (Selaginella pulvinata Maxim)

<400> 4

tgccatcaga gaaagcggtt actaagttcg ccgagtcgaa gaatcggcta atgattctgg 60

gtttcaattc tgcactaact gcaccagtgg aagctccacg tggaagagct cctgaccaga 120

ttagagaaat gaagattcgc ctacatccaa acttggaaga agtgttcaat gttctttgca 180

gtgatccaag aaccactata gtcattctta gtgggagtga acgtgctgtt ttggatgagg 240

catttggaga gtttgatatg tggttggcag cagagaatgg aatgtttctt cgtcacacac 300

aaggagagtg gatgacaacc atgcctgagc acctaaacat ggattgggta gagagtgtac 360

agttggtatt tgattatttc tgtgagagaa cgcctcgttc gtttgtggaa gcccgtgaaa 420

cttcattggt gtggaattac aagtatgcag atgtggaatt tgggagagta caagcacggg 480

atatgctaca gcatctttgg acaggaccga tttccaatgc agctgtggat gttgttcaag 540

gtgggaggtc tgtagaagtt cgccctgttg gagtctcaaa gggctctgca attgatcgga 600

ttcttgggga gattgtacat agcaagcaca tggttactcc tattgatttc gttatgtgta 660

ttggtcattt cttgagcaag gatgaagata tatacacatt ctttgagcca gagctcccat 720

ttttagagag cggaaattca agtgcaaagg ttctagacaa gagattaggt tccaagggat 780

ctggcaaatt aggtggatca aggctcaaat cttatcctcc aatgtctcct gacagggtgg 840

tgcgcaagat tgatgatgag cggctgattg aagacgctgg tagatgggaa ggctcgtcag 900

tgcttgatct caagggtgaa aattatttct cttgtgctgt ggggactatg aagcgttcat 960

tagcacgata ctgtttgaat tcttctgacg aagtacttac atttttgagc tcacttgctg 1020

cggcttcaga atcttttcct caaaagagga gcgattcctt taagaggaat ggtggatggc 1080

atagcccaac tccaagggtt gtcgctgtcg ataattaaaa gaaaggaaag gcgtggtacg 1140

cttgtggctg aacaccaaga agacaaaggt acacctaaat gtgtaatgtg tgcttattta 1200

ttcttttatt cgaaaagaag tgtacattca gttgagctaa aaaaaaaaaa aaaaa 1255

<210> 5

<211> 1045

<212> DNA

< 213>derive from cushion Selaginella tamariscina (Selaginella pulvinata Maxim) the trehalose-6-phosphate synthase gene 5 ' end first section nucleotide sequence

<400> 5

atcggatggc ctggtgtcta tgtccaggac gagctcggca agcaatcgct tgccaaggcg 60

cttgaggaaa agggatttgt gggtgtgttg ctagacgagg aaacagtgga tcaatattac 120

aatggctact gcaacaatgt cttgtggcct ctctttcact acattggatt gcgtcaagaa 180

gaccgcctgg ccgcgactcg aagtcttcaa tcacaattcg gcgcctacaa gcgtgcaaac 240

aggctgtttg cagatgccgt cattaaacac taccaagaag gcgatttcgt ttggacacat 300

gattatcacc tcatggtcct gcctagctat ctcaaggagc acgacccacg aatgaaagtc 360

ggatggttcc tgcacactcc atttccttca tctgaaatat atagaacact gcctctccgc 420

tcagaattgc ttcagggtgt ccttggtgca gatttggttg gtttccacac gtacgactat 480

gccaggcatt ttgttagcgc ctgtacaagg atattgggtc tggaagggac tcccgaggga 540

gtggaagatc aagggaaaat aacgcgtgtt gccgcgtttc ctgtcgggat agattctgaa 600

aggtgcatcc aggctgttga aacagatgca gtgaagaagc atatagaaga actcagtgcc 660

agatttgctg gccgtaaggt gatgttggga gtggataggc ttgatccaat taagggcata 720

ccacaaaagc tactcgcatt tgagaagttt ttggaggaaa atccacattg gcgtgacaag 780

gtgattctgg tccagattgc ggttcccaca agacaagatg tgctggaata tcaaaagctc 840

gcaagccagg tgcatgaaat cgtgggtcgc atcaacggtc gttacggttc tcttacgact 900

gtacccatcc accatctcga ccgttcgatg aaatttcctg agctctgtgc tttgtacgcc 960

attactgatg tgttgcttgt aacatcctta cgggatggta tgaacctcgt tagctacgag 1020

tttgtcgcct gtcaaaatga aaaga 1045

<210> 6

<211> 575

<212> DNA

< 213>derive from cushion Selaginella tamariscina (Selaginella pulvinata Maxim) the trehalose-6-phosphate synthase gene 5 ' end second section nucleotide sequence

<400> 6

agcagtggta tcaacgcaga gtacgcgggg atatatgagt tttattttag caaactataa 60

aggtttgcct ctctccactt acctagtaag tggttggttt cccgtgtgtt cgtctgccgt 120

cttcacatgc ctactccgta ttccaatacg aattcctcaa gcgctccctt agtgcctctc 180

aatctcaatc tgccgccttc gttagcgtct tccagagtcg agcgccttgt ccgagagcgg 240

caactgagga ggaatgacga ccagcctgaa tcggtgcaag aatcgcacga acaggtacaa 300

gatcatacgc aggagcagcc ggattcatcc ttggcgccgg atcgtcagca gcggctgctc 360

gttgtagcga atcggttgcc ggtttccgcc acgcgcaagg gcgacgatca atggagcttg 420

gaagtgagcg ctggcggcct cgtctctgcg cttcttggtg tgaagcagtt ccaggtagta 480

tggatcggct ggcccggtgt ctatgtccag gacgagctcg gcaagcaatc gcttgccaag 540

gcgcttgagg aaaagggatt tgtgggtgtg ttgca 575

Claims (1)

1. a trehalose-6-phosphate synthase gene order that derives from the cushion Selaginella tamariscina, this sequence such as the described nucleotide sequence of SEQ ID NO.1.

2, sequence according to claim 1 is characterized in that: described nucleotide sequence corresponding amino acid sequence such as SEQ ID NO.2 are said.

3, the described cloning process that derives from the trehalose-6-phosphate synthase gene order of cushion Selaginella tamariscina of a kind of claim 1 comprises following key step:

(1) extraction and the purifying of total RNA:

Adopt various general RNA process for extracting and purification process, from plant cushion Selaginella tamariscina blade, extract the total RNA of cushion Selaginella tamariscina blade that obtains purifying;

(2) clone of intermediate segment:

Synthesizing of A, intermediate segment cDNA first chain

With the total RNA of cushion Selaginella tamariscina blade of above-mentioned steps (1) purifying as template; With oligod (T) 18:5 '-GCTGTCAACGATACGCTACGTAACGGCATGACAGTG (T) 18-3 ' is the reverse transcription primer; It is synthetic to carry out cDNA first chain; CDNA first chain that obtains is as the cDNA template of pcr amplification among the following step B;

B, pcr amplification

As the cDNA template, utilize following upstream primer jf1 and downstream primer jx1 with cDNA first chain of aforementioned steps A gained intermediate segment, carry out pcr amplification:

jf1: 5′-TGGTCGTAAGGTTATGTTGGG-3′，

jx1: 5′-TGTTCGGGCATTGTTGTCAT-3′；

Amplification obtains the trehalose-6-phosphate synthase gene cDNA intermediate segment of cushion Selaginella tamariscina, through cloning and sequencing, obtains the intermediate segment sequence;

The clone of (3) 3 ' end:

CDNA first chain to obtain among abovementioned steps (2) A is a template, utilizes following upstream primer S1 and downstream primer AP2 to carry out pcr amplification:

S1: 5′-GCCATCAGAGAAAGCGGTTACT-3′，

AP2: 5′-TACGTACGGCATG ACAGTG-3′；

Amplification obtains 3 complete ' end, through cloning and sequencing, obtains 3 ' terminal sequence;

The clone of (4) 5 ' end:

CDNA first chain of C, synthetic 5 ' end:

As template, is reverse transcription primer with following downstream primer jx1 and upstream primer SMARTIIA Oligo with the total RNA of cushion Selaginella tamariscina blade of above-mentioned steps (1) purifying, carries out reverse transcription:

jx1: 5′- TGTTCGGGCATTGTTGTCAT-3′，

SMARTIIA Oligo: 5′-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3′；

Synthetic cDNA first chain that obtains reverse transcription product 5 ' end;

D, first section pcr amplification:

CDNA first chain with abovementioned steps C gained reverse transcription product 5 ' end is the cDNA template, utilizes following downstream primer A2 and homology upstream primer C1, carries out first section pcr amplification of 5 ' end:

A2: 5′-TCTTTTCATTTTGACAGGCGAC-3′，

C1：5′-ATCGGATGGCCTGGTGTCTATG-3′；

The product that amplification obtains is first section at cDNA a 5 ' end, through cloning and sequencing, obtains the sequence of first section at 5 ' end;

E, second section pcr amplification:

CDNA first chain with abovementioned steps C gained reverse transcription product 5 ' end is the cDNA template, utilizes following downstream primer A5 and upstream primer P3, carries out second section pcr amplification of 5 ' end;

A5: 5′-GCGGTCTTCTTGACGCAATCCAATGTAG-3′，

P3: 5′-AAGCAGTGGTATCAACGCAGAGT-3′ ；

The product that amplification obtains is second section at cDNA a 5 ' end, through cloning and sequencing, obtains second section sequence of 5 ' end;

(5) clone of ORF and splicing:

Above-mentioned steps (2) gained intermediate segment sequence, step (3) gained 3 ' terminal sequence and step (4) gained 5 ' first section sequence of end and second section sequence are spliced, and the cDNA total length that obtains is as the cDNA template of ORF amplification;

Carry out pcr amplification with following upstream primer ORF4 and downstream primer ORF5:

ORF 4：5′-CCCAAGCTT(Hind

)CCTCGAG(Xho

)ATGCCTACTCCGTATTCCAATAC -3′，

ORF5: 5′-CGC GGATCC (BamH

)ATTAATTATCGACAGCGACAACC-3′；

The product that amplification obtains is complete ORFs, and promptly the trehalose-6-phosphate synthase gene of cushion Selaginella tamariscina through cloning and sequencing, promptly gets its gene order.

4, cloning process according to claim 3 is characterized in that: in the described step (1), the RNA process for extracting of employing is the Trizol method; Purification process is the dnase digestion method.

5, cloning process according to claim 3 is characterized in that: when carrying out pcr amplification in the described step (2),

Amplification system is:

TaqPlusPCR Master Mix 10 μL ，

CDNA template 1 μ L,

2 * primer: jx1/jf1,0.5 μ L,

ddH ₂O 8 μL ；

Amplification program is:

94℃，5min；

94 ℃, 30 s, 55 ℃, 45 s, 72 ℃, 1 min, 30 s; 30 circulations;

72 ℃, 8 min; 4 ℃ of insulations.

6, cloning process according to claim 3 is characterized in that: when carrying out pcr amplification in the described step (3),

Amplification system is:

TaqPlusPCR Master Mix 10 μL ，

CDNA template 2 μ L,

2 * primer: S1/AP2,0.5 μ L,

ddH ₂O 7 μL ；

Amplification program is:

94℃，3 min；

94 ℃, 30 s; 55 ℃, 45 s; 72 ℃, 1 min, 30 s; 33 circulations;

72 ℃, 8 min; 12 ℃ of insulations.

7, cloning process according to claim 3 is characterized in that: when carrying out first section pcr amplification in the described step (4),

Amplification system is:

TaqPlusPCR Master Mix 12 μL ，

CDNA template 2 μ L,

2 * primer: A2/C1,0.5 μ L,

ddH ₂O 5 μL ；

Amplification program is:

94℃，3 min；

94 ℃, 30 s; 65 ℃, 45 s; 72 ℃, 1 min, 30 s; 2 circulations;

Per two circulations are successively decreased 2 ℃;

94 ℃, 30 s; 55 ℃, 45 s; 72 ℃, 1 min, 30 s; 25 circulations;

72 ℃, 8 min; 12 ℃ of insulations.

8, cloning process according to claim 3 is characterized in that: when carrying out second section pcr amplification in the described step (4),

Amplification system is:

TaqPlusPCR Master Mix 10 μL ，

CDNA template 1.5 μ L,

2 * primer: A5/P3,0.5 μ L,

ddH ₂O 7.5 μL ；

Amplification program is:

94 ℃, 30 s; 72 ℃, 2 min; 5 circulations;

94 ℃, 30 s; 70 ℃, 30 s; 72 ℃, 2 min; 5 circulations;

94 ℃, 30 s; 68 ℃, 30 s; 72 ℃, 2 min; 25 circulations;

12 ℃ of insulations.

9, cloning process according to claim 3 is characterized in that: when carrying out pcr amplification in the described step (5),

Amplification system is:

2 * GC Buffer I, contain Mg ²⁺10 μ L,

2 * primer: ORF4/ORF5,0.5 μ L,

CDNA template 1 μ L,

dNTP Mixture 3.2 μL ，

TaKaRa LA Taq 0.2 μL ，

ddH ₂O 4.6 μL ；

Amplification program is:

94℃，5 min；

94 ℃, 30 s; 57 ℃, 1 min, 30 s; 72 ℃, 2 min; 10 circulations;

94 ℃, 30 s; 72 ℃, 2 min, 30 s; 25 circulations;

72 ℃, 8 min; 12 ℃ of insulations.

Images