CN101886061A - Method for breeding transgenic livestock rich in polyunsaturated fatty acid - Google Patents
Method for breeding transgenic livestock rich in polyunsaturated fatty acid Download PDFInfo
- Publication number
- CN101886061A CN101886061A CN2009100839449A CN200910083944A CN101886061A CN 101886061 A CN101886061 A CN 101886061A CN 2009100839449 A CN2009100839449 A CN 2009100839449A CN 200910083944 A CN200910083944 A CN 200910083944A CN 101886061 A CN101886061 A CN 101886061A
- Authority
- CN
- China
- Prior art keywords
- fatty acid
- transgenic
- sequence
- cell
- livestock
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for breeding transgenic livestock rich in polyunsaturated fatty acid. The method comprises the following steps of: guiding DNA molecules which have a sequence 1 and a sequence 2 in a sequence list into somatic cells of a mammal to obtain transgenic cells in which a delta-12 fatty acid dehydrogenase and an omega-3 fatty acid dehydrogenase are expressed; cloning embryos by using the transgenic cells as nuclear transfer donor cells and using isolated ovocytes as nuclear transfer acceptor cells by nuclear transfer technology; and transplanting the cloned embryos into a uterus of the livestock by a non-operation method for gestation to obtain the transgenic livestock. The method of the invention can ensure that the delta-12 fatty acid dehydrogenase and the omega-3 fatty acid dehydrogenase are stably expressed in the body of a transgenic pig and that the content of omega-3 polyunsaturated fatty acids (PUFAs) in meat of the livestock is improved obviously.
Description
Technical field
The present invention relates to prepare the method for the breeding transgenic livestock that is rich in polyunsaturated fatty acid.
Background technology
Polyunsaturated fatty acid (polyunsaturated fatty acids, PUFAs) extremely important to the nutrition and the health of human body, in the growth that promotes retina and brain, the control cardiovascular and cerebrovascular diseases, aspects such as inhibition tumor cell proliferation play an important role.
Polyunsaturated fatty acid mainly comprises and is divided into two big classes: a class is ω-3PUFAs, ω-3PUFAs is counted from fatty acid carbon chain methyl end, first pair key appears at the 3rd polyunsaturated fatty acid on the carbon atom, it belongs to flax acids, mainly comprise alpha-linolenic acid (α-linolenic acid, ALA), timnodonic acid (eicosapentaenoic acid, EPA) and docosahexenoic acid (docosahexaenoic acid, DHA).Another kind of is ω-6PUFAs, ω-6PUFAs is counted from fatty acid carbon chain methyl end, first pair key appears at the 6th polyunsaturated fatty acid on the carbon atom, it belongs to linoleic acid, mainly comprise linolic acid (linoleic acid), gamma-linolenic acid (γ-linolenic acid) and arachidonic acid (AA), be topmost PUFAs in the vegetables oil, linolic acid is the precursor substance of synthetic other ω-6PUFAs.Linolic acid, linolenic acid are essential but can not self synthetic polyunsaturated fatty acid in the mammalian body, thus be called as indispensable fatty acid (Essentialfatty acids, EFA).ω-3PUFAs is the EPA in the fish oil, the health that DHA helps human body especially, every day, edible a certain amount of PUFAs can make people away from disease, the expert recommends edible 4.44g linolic acid grownup's every day, 2.22g linolenic acid, 0.22g EPA and 0.22g DHA, and edible DHA must not be less than 0.3g for lactating women's every day.
PUFAs need and extend enzyme and synthesize under the katalysis successively at a series of desaturase (fatty acid dehydrogenase).At first stearic acid (C18:0) dehydrogenation under the effect of Δ-9 desaturase generates oleic acid (C18:1n-9), and oleic acid generates linolic acid (C18:2n-6) and alpha-linolenic acid (C18:3n-3) under the effect successively of Δ-12 and Δ-15 desaturase.Linolic acid and alpha-linolenic acid are the basic substances of synthetic ω-6 and ω-3PUFAs.Linolic acid and alpha-linolenic acid generate arachidonic acid (C20:4n-6 respectively under the effect successively of Δ-6 desaturase, Δ-6 extension enzyme and Δ-5 desaturase, AA) and timnodonic acid (C20:5n-3, EPA), AA and EPA further generate DPA (C22:5n-6) and DHA (C22:6n-3) under the effect of extending enzyme and desaturase.When EPA transformed to DHA, also can be by following approach: EPA extends to clupanodonic acid, extends to the acid of tetracosa carbon pentaene again, and then by the dehydrogenation of Δ-6 desaturase, two carbon are fallen in last oxidative degradation, generate DHA.Catalysis ω-6PUFAs is converted into the enzyme general designation omega-fatty acid desaturase (ω-3 desaturase) of ω-3PUFAs, and Δ-15 desaturase also belongs to this type of.
ω-3PUFAs mainly obtains from fish oil, is faced with the minimizing of fish stock and the pollution of ocean, the detected heavy metal that contains of some fish.In addition, fish oil is because its high calorie and special smell and uncomfortable all groups, and absorbing also can be different different because of individual's physiological situation.In animal-feed, add the polyunsaturated fatty acid composition and once be widely used for improving content of polyunsaturated fatty acid in the meat product (Wood and Enser, 1997), but this method can improve feeding cost greatly.In view of the reason of above several respects, if can in animal, change the enzyme gene of several keys over to, make it can self synthesis of long-chain polyunsaturated fatty acids, thereby improve meat and the milk preparation quality satisfies our daily nutritional need to polyunsaturated fatty acid.Mammals lacks Δ-12 and omega-fatty acid desaturase, precursor substance that can not synthesize polyunsaturated fatty acid: linolic acid and alpha-linolenic acid, thereby self can not synthesis of long-chain polyunsaturated fatty acids.And ω-6PUFAs and ω-3PUFAs can not transform mutually in the mammalian body, thus need in animal, change Δ-12 (FAT-2) and omega-fatty acid desaturase (FAT-1) over to thus rebuild the route of synthesis of a long chain polyunsaturated fatty acids.At present, existing many research and utilization transgenic methods successfully make the Mammals synthesize polyunsaturated fatty acid, 2004, K.Saeki etc. change spinach Δ 12 fatty acid dehydrogenase genes in the pig body over to, realized that first plant gene expresses in livestock animals, from transgenic pig isolating before adipocyte induce the contained linolic acid of differentiation than manying more than 10 times in the undifferentiated cell of transgenic pig; The linoleic acid content transgenic pig is higher more than 1.2 times than wild-type in the white fat.Kang, Jing X. etc. has expressed nematode omega-fatty acid desaturase (FAT-1 genes encoding) in mouse, ω-6PUFAs in the mouse is converted into ω-3PUFAs, improve the content of ω-3PUFAs, reduced ratio (Kang, the et al. of ω-6/ ω-3PUFAs, 2004), Lai etc. in clone pig successful expression this gene (Lai, et al., 2006).
Summary of the invention
The purpose of this invention is to provide a kind of preparation and be rich in the method for the breeding transgenic livestock of polyunsaturated fatty acid.
The method of the breeding transgenic livestock of polyunsaturated fatty acid is rich in preparation provided by the present invention, be in the dna molecular importing mammalian cell with sequence in the sequence table 1 and sequence 2, expression Δ-12 fatty acid dehydrogenase of acquisition and the transgenic cell of omega-fatty acid desaturase; With described transgenic cell is the nuclear transplantation donorcells, and ovocyte is the nuclear transplantation recipient cell, by the clone embryos of nuclear transfer technology acquisition; Described clone embryos is moved into the domestic animal intrauterine by non-modus operandi carry out gestation, obtain breeding transgenic livestock.
Wherein, described mammalian cell can make Chinese hamster ovary celI or fetal fibroblast.
Described transgenic cell, described clone embryos also belong to protection scope of the present invention.
Mammals is owing to lack Δ-12 fatty acid dehydrogenase (FAT-2) and omega-fatty acid desaturase and can not self synthesize omega-3 polyunsaturated fatty acids, thereby animal meat goods and milk preparation contain more saturated lipid, and too much absorption is unfavorable for HUMAN HEALTH.Δ-12 desaturase is present in fungi, plant and some lower animals, in order to realize self synthesizing of mammalian cell indispensable fatty acid, the present invention has cloned nematode Δ-12 fatty acid dehydrogenase gene FAT-2 coding region sequence and nematode omega-fatty acid desaturase FAT-1 coding region sequence, after being optimized according to mammiferous codon usage frequency, made up carrier for expression of eukaryon, and in the transgenic pig body stably express Δ-12 and omega-fatty acid desaturase, significantly improve the content of the ω-3PUFAs in the livestock meat.
Description of drawings
Fig. 1 is a pBudCE-FAT2 carrier structure synoptic diagram.
Fig. 2 is a pBudCE-FAT1 carrier structure synoptic diagram.
Fig. 3 is that FAT-2 and FAT-1 gene are integrated situation at the CHO transgenic cell.
Fig. 4 integrates situation at transgenic pig for FAT-2 and FAT-1 gene.
Embodiment
Among the following embodiment if no special instructions method therefor be ordinary method, agents useful for same all can obtain from commercial channels.
Chinese hamster ovary celI is provided by Shanghai wheat Sha bio tech ltd (article No. MS-C296);
Carrier for expression of eukaryon pBudCE4.1 is available from Invitrogen company (article No. V53220);
PMD19-T is available from Takara company (article No. D104A);
PCI-neo purchases in Promega company (article No. E1841);
The synthetic sequencing that reaches of primer is finished by the living worker in Shanghai;
The isotope labeling reagent box is purchased the company in Promega;
Radio isotope α-
32P-dCTP and Southern, Northern Hybond membrane are all available from U.S. Amersham biosciences company;
Taq enzyme, T4DNA ligase enzyme, restriction endonuclease are Biolabs company product;
Plasmid purification and recovery test kit are Omega company product;
Conventional molecular biology experiment operation stepss such as enzyme is cut, connected, recovery, conversion, pcr amplification see " molecular cloning (third edition) " for details.
1) the FAT-2 expression vector makes up
Go up the cDNA sequence (NM_070159) of Caenorhabditis elegans (C.elegans) FAT-2 according to GenBank, (comprise mouse, pig, ox, sheep totally 70882 encoding sequences according to the Mammals codon, 31346087 codon information, http://www.kazusa.or.jp/codon/) uses preference, carry out codon optimized to the FAT-2 gene coding region, design and suit to see sequence 1 in the FAT-2 of mammalian cell or expression in vivo gene order.By three dna fragmentation (F1 of sequence 1 design, F2 and F3, between F1 and the F2, and have the sequence of 20bp overlapping between F2 and the F3) or directly full gene synthetic, and design a pair of primer (upstream primer: 5 ' CCAGAAGCTTAAGATGACAATCGCTACAA 3 ' that adds HindIII and XbaI enzyme cutting site respectively in upstream and downstream, downstream primer: 5 ' CCA CTC TAG ATC ATT GAG CCT TCT TAG CCT 3 '), the lap over pcr amplification goes out complete new FAT-2.
After PCR product glue reclaims purifying,, be connected to carrier for expression of eukaryon pBudCE4.1 (4595bp) at last (Invitrogen), be built into pBudCE-FAT2 carrier (5692bp) (Fig. 1) through HindIII and XbaI enzyme cutting.
2) the FAT-1 expression vector makes up
Go up the cDNA sequence (NM_001028389) of Caenorhabditis elegans (C.elegans) FAT-1 according to GenBank, (comprise mouse, pig, ox, sheep totally 70882 encoding sequences according to the Mammals codon, 31346087 codon information, http://www.kazusa.or.jp/codon/) uses preference, carry out codon optimized to the FAT-1 gene coding region, design and suit to see sequence 2 in the FAT-1 of mammalian cell or expression in vivo gene order.By three dna fragmentation (F1 of sequence 2 designs, F2 and F3, between F1 and the F2, and have the sequence of 20bp overlapping between F2 and the F3) or directly full gene synthetic, and design a pair of primer (upstream primer PF2:5 ' CCAGAAGCTTAAGATGGTCGCTCATTCC 3 ' that adds Hind III and XbaI enzyme cutting site respectively in upstream and downstream, downstream primer PR2:5 ' CCA CTC TA TCACTTGGCCTTTGCCTTC 3 '), go out complete new FAT-1 by overlapping pcr amplification.
After PCR product glue reclaims purifying,, be connected to carrier for expression of eukaryon pBudCE4.1 (4595bp) at last (Invitrogen), be built into pBudCE-FAT1 carrier (5804bp) (Fig. 2) through HindIII and XbaI enzyme cutting.
3) polygene cotransfection Chinese hamster ovary celI
Frozen Chinese hamster ovary cell (CHO) cell is taken out, put into 37 ℃ of water-baths rapidly it is melted at 1min.Under aseptic condition, 4ml DMEM (containing 10% serum) nutrient solution is splashed in the Chinese hamster ovary celI after the thawing, gently mixing.The centrifugal 5min of 1100rpm abandons supernatant, and is with cell precipitation with the PBS washing once centrifugal, and cell precipitation is resuspended in the 4ml DMEM perfect medium, changes in the T-25 Tissue Culture Flask, puts to CO
2In the incubator, 37 ℃ of cultivations.With 3 * 10
5Individual/ml is inoculated in six orifice plates, after cell degree of converging reaches 80-90%, cell culture fluid is changed into the DMEM substratum of antibiotic-free.
Cut carrier for expression of eukaryon pBudCE-FAT1, pBudCE-FAT2 and the pCI-neo of 2 μ g with restriction enzyme Nhe I enzyme, above-mentioned linearized vector DNA was diluted in the 100ulDMEM substratum in 3: 3: 1 in molar ratio, add 6ul Roche FuGENE HD Transfection Reagent then, the concuss mixing, room temperature is induced 15min, obtains transfection composite; Transfection composite is added in the culture dish for the treatment of transfectional cell, gently mixing.Behind the transfection 6h, change the perfect medium that contains 10% foetal calf serum.After the transfection 3 days, use the G418 of 500ug/ml to screen cell 9 days, screening back proliferative cell obtains the positive cell clone group.With pBudCE4.1 empty carrier cells transfected is contrast.
With FAT-2 gene specific primer PF1 and PR1, FAT-1 gene specific primer PF2 and PR2, carry out pcr analysis.
Pcr analysis result such as Fig. 3 show that the genome of pBudCE-FAT1 and pBudCE-FAT2 transfectional cell has been integrated FAT-1 and FAT-2 gene simultaneously, show the transgenic cell that has obtained stable integration FAT-1 and FAT-2 gene.Among Fig. 3, M:DNA marker; C1-2:pBudCE4.1pBudCE-FAT2 and pBudCE-FAT2 cotransfection cellular genome; The PC:PCR positive control; NC: negative control.
Extract total RNA of the transgenic cell of stable integration FAT-1 and FAT-2 gene, carry out the Northern hybridization analysis, make confidential reference items with β-actin.
Northern blot result shows that transcribe (the about 1.4kb) of FAT-1 and FAT-2mRNA arranged in the transgenic cell, and does not detect signal (repetition of twice independent transfection and screening cell) in pBudCE4.1 empty carrier transfectional cell.The above results shows that in the Chinese hamster ovary celI of pBudCE-FAT2 transfection, the FAT-2 stable gene is integrated on the cellular genome, and expresses.
4) impact analysis of transgenic cell fatty acid content
Collect pBudCE-FAT1, pBudCE-FAT2 and pCI-neo respectively and integrate altogether, and the transgenic cell of pCI-neo integration, centrifugal behind the PBS washed cell, absorb redundant moisture, add 1ml 2.5%H in the cell
2SO
4Methanol solution, hatch 1h for 80 ℃, to be cooled to room temperature, add 0.2ml normal hexane and 1ml water, concussion mixing low-speed centrifugal is got upper strata normal hexane nitrogen and is dried up laggard promoting the circulation of qi analysis of hplc.
Gas chromatographic analysis positive cell form (twice different transfection repeats, four gentle analysis of hplc of cellular fat acid extraction) with Normocellular lipid acid.
Gas chromatographic analysis is the result show: the serial unsaturated fatty acid content of ω-3 is significantly higher than pCI-neo transfectional cell (table 1) in pBudCE-FAT1 and the pBudCE-FAT2 cotransfection cell, show that FAT-1 and FAT-2 gene express ω-3 and the fatty desaturase of Δ-12 in transgenic cell, and the serial unsaturated fatty acids of catalysis ω-6 transforms to the serial unsaturated fatty acids of ω-3.
Table 1.FAT-2+FAT-1 transfectional cell fatty acid analysis
In the table 1, letter (a, b) identical expression does not have significant difference, and alphabetical different table is shown with significant difference (P＜0.01).
1) is rich in the preparation of polyunsaturated fatty acid breeding transgenic livestock
The breeding transgenic livestock preparation method can adopt methods such as microinjection, somatic cell clone method, sperm vector method, and breeding transgenic livestock comprises transgenic pig, transgenic sheep, transgenic cattle etc.Preferred body cell clone legal system of the present invention is equipped with transgenic pig, but is not limited to the somatic cell clone method, also is not limited to the preparation of transgenic pig.
Get pig ear tissue inoculation culture and go out inoblast (referring to " test cell line guide "), with NheI respectively enzyme cut pBudCE-FAT1, pBudCE-FAT2 and pCI-neo, 3: 3: 1 in molar ratio transfection pig inoblasts (transfection method is with implementing 1), identify (authentication method is with embodiment 1) through G418 screening and PCR, be defined as the transgenic positive cell.
With above-mentioned transgenic positive cell is the nuclear transplantation donorcells, puberty father's former wife's porcine oocytes with maturation in vitro is the nuclear transplantation recipient cell, the nuclear transplantation donorcells is moved into non-nucleus egg mother cell, merge and activation through electricity, be built into clone embryos, select the good clone embryos of form and carry out gestation with the multiparity sow intrauterine that non-modus operandi moves into spontaneous estrus, non-modus operandi embryo transfer step is for after anaesthetizing slightly with no veronal, insert the thick conduit of 10 millimeters of external diameters to cervical canal from acceptor sow vagina, fine duct with 5 millimeters of diameters inserts thick conduit inboard then, extend into a body of uterus or a side horn of uterus.Clone embryos being preserved liquid together with 2 milliliters transplant into by fine duct, specifically is through conduit the embryo to be blown into intrauterine 1-3 minute with the carbonic acid gas that dry ice generates.Whether 30 days B ultrasounds detect gestation after the embryo transfer.
Clone pig to birth after the full-term carries out the PCR detection, obtain to integrate altogether the transgenic pig of pBudCE-FAT1, pBudCE-FAT2 and pCI-neo, with in 200 pieces of transgene clone embryo transfers to 3 sow body, obtain 4 transgenic pigs altogether, detected result is seen Fig. 4.Among Fig. 4, right figure is a FAT-2 gene PCR detected result, and left side figure is a FAT-1 gene PCR detected result; M:DNA marker; P1-4: transgenic pig genome; The PC:PCR positive control; NC: negative control.
2) mutation analysis is formed in the acid of transgenic pig muscle fat
To above-mentioned former generation transgenic pig breed and go down to posterity, can obtain the first filial generation transgenic pig.Muscle tissue to two first filial generation transgenic pigs is carried out gas chromatographic analysis.
Gas chromatographic analysis is the result show: the serial unsaturated fatty acids of ω-3 is significantly higher than the non-transgenic pig in the common integration transgenosis pig muscle tissue of pBudCE-FAT1 and pBudCE-FAT2, and the serial unsaturated fatty acids of ω-6 significantly is lower than non-transgenic pig (table 2), show that FAT-1 and FAT-2 gene express ω-3 and the fatty desaturase of Δ-12 in transgenic pig muscle, and the serial unsaturated fatty acids of catalysis ω-6 transforms to the serial unsaturated fatty acids of ω-3.
Table 2.FAT-2 and FAT-1 transgenic pig muscle tissue fatty acid analysis
In the table 2, letter (a, b) identical expression does not have significant difference, and alphabetical different table is shown with significant difference (P＜0.01)
Sequence table
＜110〉Beijing Ji-Pu-Lin Biotechnology Co
＜120〉method of the breeding transgenic livestock of polyunsaturated fatty acid is rich in preparation
<160>2
<210>1
<211>1134
<212>DNA
＜213〉artificial sequence
<220>
<230>
<400>1
aagatgacaa?tcgctacaaa?agtgaacaca?aataaaaagg?acctggatac?aatcaaggtg 60
cccgagctgc?caagcgtggc?agctgtcaaa?gcagcaatcc?ctgagcactg?ctttgtcaag 120
gatccactga?ctagcattag?ctatctcatc?aaggattacg?tgctgctcgc?tggcctctat 180
tttgcagtgc?catacattga?gcattatctc?ggatggatcg?ggctgctggg?atggtattgg 240
gcaatgggaa?ttgtgggatc?cgcattgttc?tgtgtgggcc?atgactgtgg?acatggatcc 300
ttctccgatt?atgaatggct?caatgatctg?tgtggacatc?tggctcatgc?tccaattctt 360
gctccattct?ggccatggca?gaagtctcat?agacagcatc?atcagtacac?atcccacgtg 420
gaaaaggata?agggacatcc?atgggttact?gaggaagact?acaataatag?aactgctatt 480
gagaagtatt?tcgctgtgat?tccaatttcc?ggatggcttc?gatggaatcc?aatctacacc 540
atcgtcggcc?tgccagatgg?atctcatttc?tggccatggt?cccggctctt?cgagactact 600
gaggatcgcg?tcaagtgtgc?agtgtctgga?gttgcatgcg?ctatctgtgc?ttacattgcc 660
tttgtcctct?gcgactattc?tgtctacaca?tttgtcaagt?actactacat?tccactgctc 720
ttccagggac?tcattctcgt?cattatcaca?tatctgcagc?atcagaatga?ggatattgag 780
gtctacgaag?ctgatgagtg?gggatttgtg?cgcggacaga?cccagactat?cgacagacac 840
tggggattcg?gactcgacaa?catcatgcac?aacattacca?acggccacgt?cgcccatcac 900
ttcttcttca?ccaaaatccc?acattatcat?ctgctggagg?caactccagc?aatcaagaaa 960
gctcttgaac?cactgaaaga?cactcagtac?ggatacaaac?gagaagtcaa?ctataactgg 1020
ttcttcaagt?atcttcacta?caacgttacc?ctcgactatt?tgactcataa?agcaaagggt 1080
gtcctgcagt?acagaagtgg?agttgaggct?gcaaaggcta?agaaggctca?atga 1134
<210>2
<211>1209
<212>DNA
＜213〉artificial sequence
<220>
<230>
<400>2
atggtcgctc?attccagcga?agggctgtcc?gccaccgctc?ctgtcaccgg?cggagatgtg 60
ctggtcgatg?ctagggcatc?tctggaagaa?aaggaggctc?caagagatgt?gaatgcaaac 120
actaaacagg?ccaccactga?agagccacgc?atccaactgc?caactgtgga?tgctttcagg 180
cgggcaattc?cagcacactg?tttcgaaaga?gatctcgtga?aaagcatcag?atatctggtg 240
caagactttg?ccgcactcac?aattctctac?tttgctcttc?cagcttttga?gtactttgga 300
ctgtttggct?acctggtgtg?gaacattttt?atgggagtgt?ttggattcgc?tttgttcgtc 360
gttggacacg?attgtctgca?tggatccttc?tctgataatc?agaatctcaa?tgatttcatt 420
ggacatatcg?ccttcagccc?actcttctct?ccatacttcc?catggcagaa?aagccacaag 480
ctgcaccatg?ctttcaccaa?ccacattgac?aaagatcatg?gacacgtgtg?gattcaggat 540
aaggattggg?aagcaatgcc?atcatggaaa?agatggttca?atccaattcc?attctctgga 600
tggcttaaat?ggttcccagt?gtacactctc?ttcggtttct?gtgatggatc?tcacttctgg 660
ccatactcta?gcctgtttgt?gaggaactct?gaacgggtcc?aatgtgtgat?ctctggaatc 720
tgttgctgtg?tgtgtgcata?tattgctctg?acaattgctg?gatcatattc?caattggttc 780
tggtactatt?gggtgccact?gtctttcttc?ggactgatgc?tcgtcattgt?tacctatttg 840
caacatgtcg?atgatgtcgc?tgaggtgtac?gaggctgatg?aatggagctt?cgtccgcgga 900
caaacccaaa?ccatcgatcg?gtactatgga?ctcggactgg?acacaaccat?gcaccatatc 960
acagacggac?acgttgccca?tcacttcttc?aacaaaatcc?cacattacca?tctcatcgaa 1020
gcaaccgaag?gcgtcaaaaa?ggtcctggag?cccttgtccg?acacccaata?cgggtacaaa 1080
tctcaagtga?actacgattt?ctttgccaga?ttcctgtggt?tcaactacaa?gctcgactat 1140
ctcgttcaca?agaccgccgg?aatcatgcaa?ttccgaacaa?ctctcgagga?gaaggcaaag 1200
gccaagtga 1209
Claims (7)
1. a transgenic cell is in the dna molecular importing mammalian somatic cell with sequence in the sequence table 1 and sequence 2, expression Δ-12 fatty acid dehydrogenase of acquisition and the transgenic cell of omega-fatty acid desaturase.
2. transgenic cell according to claim 1 is characterized in that: described mammalian cell is Chinese hamster ovary celI or fetal fibroblast.
3. method for preparing clone embryos is to be the nuclear transplantation donorcells with claim 1 or 2 described transgenic cells, and stripped ovocyte is the nuclear transplantation recipient cell, obtains clone embryos by nuclear transfer technology.
4. a method for preparing breeding transgenic livestock is the clone embryos that the described method of claim 3 prepares to be moved into the domestic animal intrauterine by non-modus operandi carry out gestation, obtains breeding transgenic livestock.
5. method according to claim 4 is characterized in that: described domestic animal is a pig.
6. dna molecular, its nucleotide sequence is shown in sequence in the sequence table 1.
7. dna molecular, its nucleotide sequence is shown in sequence in the sequence table 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100839449A CN101886061A (en) | 2009-05-11 | 2009-05-11 | Method for breeding transgenic livestock rich in polyunsaturated fatty acid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100839449A CN101886061A (en) | 2009-05-11 | 2009-05-11 | Method for breeding transgenic livestock rich in polyunsaturated fatty acid |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101886061A true CN101886061A (en) | 2010-11-17 |
Family
ID=43072154
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100839449A Pending CN101886061A (en) | 2009-05-11 | 2009-05-11 | Method for breeding transgenic livestock rich in polyunsaturated fatty acid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101886061A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102206675A (en) * | 2011-03-23 | 2011-10-05 | 中国农业科学院北京畜牧兽医研究所 | Novel vector for raising content of polyunsaturated fatty acids in animal body |
| CN102864122A (en) * | 2012-09-07 | 2013-01-09 | 青岛德瑞骏发生物科技有限公司 | Equine embryo-flushing solution as well as preparation method and applications of solution |
| CN103320389A (en) * | 2012-03-23 | 2013-09-25 | 南开大学 | Production method for virus infection resistance transgene pig with high pig HDAC6 expression |
| CN104059881A (en) * | 2013-03-21 | 2014-09-24 | 中国农业大学 | Method for producing polyunsaturated fatty acid-containing transgenic animal |
| WO2015143284A1 (en) * | 2014-03-21 | 2015-09-24 | The General Hospital Corporation | Essential fatty acid-producing nonhuman transgenic animals and uses thereof |
| CN105200086A (en) * | 2015-10-22 | 2015-12-30 | 中国农业科学院北京畜牧兽医研究所 | Preparation method of selectable marker-free polygenes complex character genetic engineering pig |
-
2009
- 2009-05-11 CN CN2009100839449A patent/CN101886061A/en active Pending
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102206675A (en) * | 2011-03-23 | 2011-10-05 | 中国农业科学院北京畜牧兽医研究所 | Novel vector for raising content of polyunsaturated fatty acids in animal body |
| CN102206675B (en) * | 2011-03-23 | 2013-09-11 | 中国农业科学院北京畜牧兽医研究所 | Novel vector for raising content of polyunsaturated fatty acids in animal body |
| CN103320389A (en) * | 2012-03-23 | 2013-09-25 | 南开大学 | Production method for virus infection resistance transgene pig with high pig HDAC6 expression |
| CN102864122A (en) * | 2012-09-07 | 2013-01-09 | 青岛德瑞骏发生物科技有限公司 | Equine embryo-flushing solution as well as preparation method and applications of solution |
| CN104059881A (en) * | 2013-03-21 | 2014-09-24 | 中国农业大学 | Method for producing polyunsaturated fatty acid-containing transgenic animal |
| WO2015143284A1 (en) * | 2014-03-21 | 2015-09-24 | The General Hospital Corporation | Essential fatty acid-producing nonhuman transgenic animals and uses thereof |
| CN106413393A (en) * | 2014-03-21 | 2017-02-15 | 通用医疗公司 | Essential fatty acid-producing nonhuman transgenic animals and uses thereof |
| US10182560B2 (en) * | 2014-03-21 | 2019-01-22 | The General Hospital Corporation | Transgene construct encoding delta 12 fatty acid |
| CN105200086A (en) * | 2015-10-22 | 2015-12-30 | 中国农业科学院北京畜牧兽医研究所 | Preparation method of selectable marker-free polygenes complex character genetic engineering pig |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wu et al. | Production of cloned transgenic cow expressing omega-3 fatty acids | |
| CN101886061A (en) | Method for breeding transgenic livestock rich in polyunsaturated fatty acid | |
| Pan et al. | Efficient production of omega-3 fatty acid desaturase (s Fat-1)-transgenic pigs by somatic cell nuclear transfer | |
| Li et al. | Site-specific Fat-1 knock-in enables significant decrease of n-6PUFAs/n-3PUFAs ratio in pigs | |
| Wu et al. | Application of new biotechnologies for improvements in swine nutrition and pork production | |
| Kabeya et al. | Modification of the n-3 HUFA biosynthetic pathway by transgenesis in a marine teleost, nibe croaker | |
| BRPI0413786B1 (en) | recombinant vector with desaturase activity and methods of producing omega-3 fatty acid seed oil, producing omega-3 fatty acid and producing plant comprising seed oil with altered levels of omega-3 fatty acids | |
| Pang et al. | Double transgenesis of humanized fat1 and fat2 genes promotes omega-3 polyunsaturated fatty acids synthesis in a zebrafish model | |
| US6018096A (en) | Animal model for engraftment, proliferation and differentiation of human hematopoietic stem cells | |
| Zhou et al. | The high-level accumulation of n-3 polyunsaturated fatty acids in transgenic pigs harboring the n-3 fatty acid desaturase gene from Caenorhabditis briggsae | |
| US20080320610A1 (en) | Transgenic fish with increased unsaturated fatty acid content | |
| Ivarson et al. | Significant increase of oleic acid level in the wild species Lepidium campestre through direct gene silencing | |
| CN104059881A (en) | Method for producing polyunsaturated fatty acid-containing transgenic animal | |
| CN104059877B (en) | Method for preparing 'imitated Belgian blue cattle' myostatin (MSTN) genetype gene editing pig | |
| Yamashita et al. | Suppression of mosaic mutation by co-delivery of CRISPR associated protein 9 and three-prime repair exonuclease 2 into porcine zygotes via electroporation | |
| Xing et al. | CRISPR/Cas9-mediated knock-in method can improve the expression and effect of transgene in P1 generation of channel catfish (Ictalurus punctatus) | |
| Cheng et al. | Production of transgenic beef cattle rich in n-3 PUFAs by somatic cell nuclear transfer | |
| CN102206675B (en) | Novel vector for raising content of polyunsaturated fatty acids in animal body | |
| Buchtová et al. | Fatty acid composition in diploid and triploid populations of tench (Tinca tinca L.) | |
| CN105331621B (en) | Eriocheir sinensis Elovl6 gene and its cloning process | |
| WO2002072028A2 (en) | Compositions and methods for modifying the content of polyunsaturated fatty acids in mammalian cells | |
| Oboh | Investigating the long-chain polyunsaturated fatty acid biosynthesis of the African catfish Clarias gariepinus (Burchell, 1822) | |
| Soler et al. | Preparation of recombinant proteins in milk to improve human and animal health | |
| Świątkiewicz et al. | The use of genetic engineering techniques to improve the lipid composition in meat, milk and fish products: a review | |
| CN100460506C (en) | Omega-3-aliphatic acid desaturase, and its encoding gene and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: BEIJING JIFULIN BIOTECHNOLOGY CO., LTD. Free format text: FORMER OWNER: JIPULIN BOLOGICAL TECH. CO., LTD., BEIJING Effective date: 20101130 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20101130 Address after: Zhongding No. 158 building, 100193 Beijing Road, room 306, Haidian District city malianwa Applicant after: Beijing Jifulin Biotechnology Co., Ltd. Address before: Zhongding No. 158 building, 100193 Beijing Road, room 306, Haidian District city malianwa Applicant before: Beijing jipulin Biotechnology Co., Ltd. |
|
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Open date: 20101117 |