CN101885769B - Fully human antibody capable of specifically bonding CD4 and use thereof - Google Patents

Fully human antibody capable of specifically bonding CD4 and use thereof Download PDF

Info

Publication number
CN101885769B
CN101885769B CN200910051046.5A CN200910051046A CN101885769B CN 101885769 B CN101885769 B CN 101885769B CN 200910051046 A CN200910051046 A CN 200910051046A CN 101885769 B CN101885769 B CN 101885769B
Authority
CN
China
Prior art keywords
seq
variable region
antibody
human antibody
antigen
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN200910051046.5A
Other languages
Chinese (zh)
Other versions
CN101885769A (en
Inventor
何明跃
王明蓉
高强
杜天飞
张勇侠
代云见
何勇智
丛聪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CHENGDU INSTITUTE OF BIOLOGICAL PRODUCTS CO LTD
Original Assignee
Chengdu Institute of Biological Products Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chengdu Institute of Biological Products Co Ltd filed Critical Chengdu Institute of Biological Products Co Ltd
Priority to CN200910051046.5A priority Critical patent/CN101885769B/en
Publication of CN101885769A publication Critical patent/CN101885769A/en
Application granted granted Critical
Publication of CN101885769B publication Critical patent/CN101885769B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Peptides Or Proteins (AREA)

Abstract

The invention provides a fully human anti-CD4 antibody. The heavy chain variable region of the antibody has an amino acid sequence shown by an amino acid sequence SEQ ID No.2, the light chain variable region of the antibody has an amino acid sequence shown by an amino acid sequence SEQ ID No.4, the molecule of the antibody can be bonded with a surface antigen cluster 4 (CD4 antigen) on an auxiliary T cell membrane specifically, and the affinity is more than 10<-7>M. The invention also discloses a DNA molecule for coding the antibody. The antibody has potential use in the treatment or diagnosis of diseases such as lymphocytoma, Aids, rheumatoid arthritis, allogenic organ transplant rejection and the like.

Description

The human antibody of a kind of specific binding CD4 and application
Technical field
The present invention relates to antibody technique field, relate in particular to antibody and the application of specific binding CD4.
Background technology
CD4 molecule is mainly present in T lymphocyte and most Surface of Thymocyte, and mononuclear macrophage, neutrophil leucocyte, B lymphoblast all have CD4 developed by molecule.The strand glycoprotein that CD4 molecule on mankind's t helper cell film is 55KD, comprises extracellular region, cross-film district and cytoplasmic domain 3 parts, its cytoplasmic domain afterbody and tyrosine protein kinase coupling.AntiCD4 mAb is combined and is caused enzyme activation with the CD4 of T surface of cell membrane molecule, and intracellular calcium concentration changes, and conducts negativity Inhibitory signal, causes stronger immunosuppressive effect.
Rheumatoid arthritis (rheumatoid arthritis RA) be a kind of take involve synovium of joint as main chronic disabling property inflammatory autoimmunization disease, think that RA is antigen presenting cell (APC) and the synergistic result of CD4+ cell more.So for multiple link and the Multiple components in immunologic process, intervene as T cell, cytokine, adhesion molecule and MHC molecule etc., regulate their immunocompetences in RA, and reach therapeutic purpose.
The anti-CD4 monoclonal antibody of full humanization (zanolimumab, HumMax-CD4) of being developed by Medarex/Genmab/Seono company enters III clinical trial (www.clinicaltrial.gov) as the T-cell lymphoma,cutaneous medicine Yi U.S..Americanism diseases caused by dampness academic year in 1991 can on reported by anti-CD4McAb treatment rheumatoid arthritis (RA).For example Clenoliximab and the Keliximab of the development of IDEC Pharma Inc. are exactly the chimeric CD4 monoclonal antibody of people-monkey (IgG 4-IgG 1), for rheumatoid arthritis treatment, entered the clinical phase (SharmaA, Davis CB, Tobia LA, et al.J Pharmacol Ex p Ther, 2000,293 (1): 33).The anti-CD4 chimeric antibody of Centocor company research, has also entered II phase clinical verification at treatment rheumatoid arthritis, multiple sclerosis.Separately there is the anti-CD4 McAb of report to be also used for the treatment of HIV and infect (Antimicrob Agents Chemother 2006; 50:2231-2233).The purposes that separately has anti-CD4McA to can be used as organ transplant rejection is also confirmed (Chinese microbiology and Journal of Immunology, Zhu Zhigang etc., the 22nd the 2nd phase of volume in 2002).
This area is in the urgent need to having the anti-CD 4 antibodies in the total man source of high-affinity, for the diagnosis and treatment of CD4 relative disease as lymphocytoma, acquired immune deficiency syndrome (AIDS), rheumatoid arthritis, allogeneic organ transplant rejection etc.
Summary of the invention
The antibody that the object of this invention is to provide a kind of specific binding T4 antigen, especially total man's resource monoclonal antibody, to meet the needs of diagnosing clinically and/or treating CD4 relative disease.
A first aspect of the present invention, provides a kind of human antibody of specific binding T4 antigen, and the variable region of heavy chain of this human antibody comprises following complementary determining region:
CDR1 shown in SEQ ID NO:5,
CDR2 shown in SEQ ID NO:6,
CDR3 shown in SEQ ID NO:7.
In preferred scheme, the variable region of heavy chain of this human antibody has the aminoacid sequence shown in SEQ ID NO:2.
A second aspect of the present invention, provides a kind of human antibody of specific binding T4 antigen, and the variable region of light chain of this human antibody comprises following complementary determining region:
CDR1 shown in SEQ ID NO:8,
CDR2 shown in SEQ ID NO:9,
CDR3 shown in SEQ ID NO:10.
In preferred scheme, the variable region of light chain of this human antibody has the aminoacid sequence shown in SEQ ID NO:4.
A third aspect of the present invention, provides a kind of human antibody of specific binding T4 antigen, and the variable region of heavy chain of this human antibody and variable region of light chain have respectively the aminoacid sequence shown in SEQ ID NO:2 and SEQ ID NO:4.
A fourth aspect of the present invention, provides a kind of human antibody fragment of specific binding T4 antigen, and this human antibody fragment comprises the aminoacid sequence shown in the aminoacid sequence shown in SEQ ID NO:2 and/or SEQ ID NO:4.This human antibody fragment comprises single-chain antibody (scFv), Fab, Fab ', F (ab ') 2etc. form.
A fifth aspect of the present invention, provides a kind of fusion rotein or polypeptide of specific binding T4 antigen, and this fusion rotein or polypeptide comprise the aminoacid sequence shown in the aminoacid sequence shown in SEQ ID NO:2 and/or SEQ ID NO:4.
A sixth aspect of the present invention, provides a kind of activated protein of small molecules mark, and this activated protein comprises the aminoacid sequence shown in the aminoacid sequence shown in SEQ ID NO:2 and/or SEQ ID NO:4.
A seventh aspect of the present invention, provides a kind of DNA sequence dna of variable region of heavy chain of human antibody of the specific binding T4 antigen of encoding, the polypeptide shown in this DNA sequence encoding SEQ ID NO:2.In a preferred scheme, this DNA sequence dna is as shown in SEQ ID NO:1.
A eighth aspect of the present invention, provides a kind of DNA sequence dna of variable region of light chain of human antibody of the specific binding T4 antigen of encoding, the polypeptide shown in this DNA sequence encoding SEQ ID NO:4.
In a preferred scheme, this DNA sequence dna is as shown in SEQ ID NO:3.
A ninth aspect of the present invention, provides human antibody, antibody fragment, fusion rotein, the small molecules mark activated protein of specific binding T4 antigen of the present invention treating or diagnosing the application in the diseases such as lymphocytoma, acquired immune deficiency syndrome (AIDS), rheumatoid arthritis, allogeneic organ transplant rejection.
A tenth aspect of the present invention, provides a kind of pharmaceutical composition, the human antibody of the specific binding T4 antigen of the present invention that comprises safe and effective amount, antibody fragment, fusion rotein, small molecules mark activated protein and pharmaceutically acceptable carrier.
Accompanying drawing explanation
The active detected result of ELISA of 11 strain anti-CD 4 antibodies positive colony bacterium of Fig. 1: embodiment 4 preparations.Envelope antigen is the solubility T4 antigen (1ug/ml) of 100ul, and open column shape body is for adding the test group of 100ul positive colony bacterium (anti-CD 4 antibodies), is the control group of the BSA (100ug/ml) that adds 100ul with the column of oblique line.Wherein the highest active positive colony bacterium is the 2nd strain, is numbered 4-91 #.
Fig. 2: 4-91 #the doubling dilution detected result of the anti-CD 4 antibodies that bacterium produces.
Embodiment
Term used herein " antibody " is to pass through at least one antigen recognition site, and the immunoglobulin (Ig) of target molecule (comprising sugar, Polynucleotide, lipid, polypeptide etc.) specific combination.Complete antibody is the approximately 150000 daltonian different four glycan albumen that have same structure feature, and it is comprised of two identical light chains (L) and two identical heavy chains (H).Every light chain is connected with heavy chain by a covalent disulfide bonds, and disulfide linkage number difference between the heavy chain of different Immunoglobulin Isotypes.Every heavy chain and light chain be the intrachain disulfide bond at regular interval also.There is variable region (VH) one end of every heavy chain, is thereafter a plurality of constant regions.There is variable region (VL) one end of every light chain, and the other end has constant region; First constant region of the constant region of light chain and heavy chain is relative, and the variable region of light chain is relative with the variable region of heavy chain.Special amino-acid residue forms interface between the variable region of the heavy chain of light chain.
Term used herein " monoclonal antibody " refers to and comprises the same antibody population that participates in a certain antigen amino acid structure of selective binding (nature or through reconstruction).Monoclonal antibody has high degree of specificity, for a certain single antigen site.
Term used herein " variable region " represents that some part of variable region in antibody is different in sequence, and it has formed various specific antibodies to the combination of its specific antigen and specificity.Yet mutability is not evenly distributed in whole variable region.It concentrates in light chain and variable region of heavy chain and is called in three fragments in complementary determining region (CDR) or hypervariable region.The more conservative part in variable region is called framework region (FR).In the variable region of natural heavy chain and light chain, comprise separately Si Ge FR district, they are beta sheet configuration haply, by the San Ge CDR district that forms shack, are connected, in some cases can forming section β-pleated sheet structure structure.CDR in every chain by FR district, be closely close together and with together with the CDR of another chain, form antibody antigen-binding site (referring to Kabat etc., NIH Publ.No.91-3242, volume I, 647-669 page (1991).Constant region is not participated in the combination of antibody and antigen directly, but they show different effector functions, for example, participate in the cytotoxicity that depends on antibody of antibody.
" light chain " of vertebrates antibody (immunoglobulin (Ig)) can be classified as the class in visibly different two classes (being called κ and λ) according to the aminoacid sequence of its constant region.According to the aminoacid sequence of its CH, immunoglobulin (Ig) can be divided into different kinds, mainly contains 5 immunoglobulin like protein: IgA, IgD, IgE, IgG and IgM, some of them also can be further divided into subclass (of the same type), as IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2.Corresponding to different immunoglobulin heavy chain constant regions, be called α, β, ε, μ, γ.
Subunit structure and the 3-d modelling of different immunoglobulin (Ig)s are well-known
" human antibody " used herein refers to the antibody gene source mankind's antibody.
Herein, so-called " antibody " not only comprises complete polyclone or monoclonal antibody, also comprise various antibody fragments (as Fab, Fab ', F (ab ') 2, Fv), single-chain antibody (ScFv), disome, the multi-specificity antibody being formed by antibody fragment, the fusion rotein that contains antibody fragment, and any immunoglobulin molecules through transforming but comprising required specific recognition site.The source of antibody or preparation method unrestricted, such as selecting by hybridoma, phage, recombinant expressed, transgenic animal etc.
Suitable " mark " comprises radionuclide, enzyme, substrate, cofactor, inhibitor, fluorescence part, chemiluminescent moiety, magnetic-particle etc.
Below in conjunction with embodiment, describe in further detail the present invention, should be appreciated that, enumerate these embodiment just for the present invention is described, rather than be used for limiting the present invention.The concentration not specializing in the following example is mass percent concentration; The experimental technique of unreceipted actual conditions, conventionally according to normal condition, such as people such as Sambrook, < < molecular cloning experiment guide > > (New York:Cold Spring Harbor LaboratoryPress, 1989) condition described in, or the condition of advising according to manufacturer.
The structure in embodiment 1. human antibody storehouses
The structure in full human single chain variable fragments antibody (scFv) storehouse is to adopt people [the He et al.Methods Mol Biol.2004 such as He; 248:177-189] method of report builds, the mRNA extracting from the mixing peripheral blood of 83 routine tumour patients, adopt following primer, with the method amplification in vitro heavy chain of RT-PCR and the variable region gene of light chain, by the method for overlapping extension PCR (Overlap-extension PCR), two fragment genes are dressed up to complete antibody library sequence by one section of Linker sequence set.
Heavy chain primer:
(1)HuVH/B：5’-CAGGT(c/g)CAGCTGG(t/a)G(c/g)AGTC(t/c)GG-3’
(2)HuJH/F：5’-TGAGGAGACGGTGACCA(t/g)GGTCCC-3’
Catenation sequence primer
(3)Linker/B：5’-GGGACC(a/c)TGGTCACCGTCTCCTCAGGCGGTGGCTCTGG-3’
(4)Linker/F：5’-TTGCCACCGCCAGAACC-3’
κ light chain primer
(5)HuVκ/B：5’-GGTTCTGGCGGTGGCAAAGA(a/c)AT(c/t)(g/a)TG(a/c)TGAC(c/g/t)CAGTCTCC-3’
(6)HuCκ/F：5’-TGAGGAGACGGTGACCA(t/g)GGTCCC-3’
Lambda light chain primer
(7)HuVλ/B：5’-GGTTCTGGCGGTGGCAAACAG(t/g)CTGTGCTGACTCAGCC(g/c)CC-3’
(8)HuCλ/F：5’-AGATTCTGTAGGGGCCACTGTC-3’
Utilize pair of primers 5 '-ACCACCATGGAGGTSCASCTCGAGSAGTCTGG-3 ' and 5 '-GCGAATTCTTAGCAGCCACCCAGGTGATGGTGATGGTGATGAGATGGTGCAGCCAC AG-3 ' in the both sides of antibody library, to introduce respectively Nco I and two restriction enzyme sites of EcoR I.The PCR library of scFv is cut with Nco I and EcoR I enzyme, pET22b cuts with Nco I and EcoR I enzyme, reclaim respectively the fragment after enzyme is cut, after being connected with carrier, scFv library after enzyme is cut transforms Rosetta competence, coating LB solid plate, picking 1500 strain list bacterium colonies, with filter paper, adhere to the aobvious blue reaction method (Colony filter method) of clone clone carried out to functional screening.
Embodiment 2. filter paper adhere to the aobvious blue reaction method of clone
The bacterium colony growing on the pvdf membrane photocopy flat board of processing with a methyl alcohol, bacterium colony one faces up and is laid on the agar plate that contains 1mM IPTG and 50ug/ml of ampicillin afterwards, 25-30 ℃ of standing cultivation 4 hours.With the PBS lavation buffer solution containing 0.05%Tween 20, wash plate hole 3 times, each 5 minutes, then with the PBS room temperature sealing that contains 0.05%Tween 20 and 1%BSA 1 hour.With the PBS lavation buffer solution containing 0.05%Tween20, wash plate hole 3 times, each 5 minutes, after being diluted to working fluid with the PBS containing 0.05%Tween 20 and 1%BSA by 1: 5000, Anti-His HRP (Sigma product) hatches two hours with pvdf membrane, with the PBS damping fluid washing containing 0.05%Tween 20 3 times, use again chemical illuminating reagent (Pierce company product) to expose to film, obtained the positive bacterium colony of 420 strains.
The detection (chemoluminescence method) of embodiment 3. antigen-antibody effects
With 80ul PBS by solubility T4 antigen (name of product: sCD4 antigen; R & D, product article No.: 514-CD-050) be diluted to the concentration of 10ug/ml, be coated on the pvdf membrane that methyl alcohol processed 4 ℃ of overnight incubation.With the PBS washing containing 0.05%Tween three times, each 5 minutes.With Superblock buffer in PBS (Thermo company), carry out room temperature sealing 1 hour.With the PBS washing containing 0.05%Tween three times, each 5 minutes.By the periplasm protein of the good positive bacterium colonies of 420 strains of extracting respectively point sample on pvdf membrane, carry out specific action with antigen, incubated at room 1 hour.The PBS of 0.05%Tween washing is three times again, each 5 minutes.By 8000 times of the PBS dilutions containing 0.05%Tween and 1%BSA for anti-HisHRP (Sigma aldrich), be layered on equably on film room temperature light shaking 2 hours.The PBS of 0.05%Tween washing is three times again, each 5 minutes.By chemical illuminating reagent Supersignal west Pico (Pierce company) incubated at room 5 minutes, in the darkroom of chemoluminescence imaging system Chemidoc (Bio-rad company), expose, filter out the darker positive colony bacterium of approximately 11 strains and CD4 specific combination and spot.
The Expression and purification of embodiment 4. albumen
The LB substratum of the glucose containing 0.5% for the 11 strain positive colony bacterium that upper step is screened, wherein adding final concentration is the penbritin of 100ug/ml and the paraxin of 64ug/ml, in 37 ℃ of overnight incubation.Adding final concentration morning next day is the IPTG of 1mM, continues 25-30 ℃ and cultivates after 4 hours 5000g centrifugal 5 minutes.Ratio according to the heavy corresponding 5ml of every gram of bacterium adds lavation buffer solution (300mM NaCl, 50mMNaH 2p0 4with 10mM imidazoles, PH8.0), ultrasonic disruption cell on ice bath (ultrasonic 4s interval 5s, 99 circulations), 12000g is centrifugal 40 minutes afterwards.Get supernatant and mix with the affine filler of 1mlNi-NTA by lavation buffer solution balance before, 4 ℃ of concussions are carried on purification column for 1 hour, the washing of the lavation buffer solution of 30 column volumes.Elution buffer (300mM NaCl, 50mM NaH with 1ml 2pO 4with 250mM imidazoles) wash-out, collect target elutriant.The sample of collecting is carried out to conventional ELISA experiment, the results are shown in Figure 1, select the bacterial strain of OD450 absorption value maximum: 4-91 #bacterium.
4-91 #the employing SDS-PAGE electrophoresis of the antibody that bacterium produces after Ni-affinitive layer purification, by QualityOne analysis software purity, be greater than 80%, reach the basic purity of ELISA avidity detection method, the concentration of sample adopts Bradford method to measure, and is about 160ug/ml.
The avidity of embodiment 5.ELISA detectable antigens antibody
With the solubility T4 antigen coated elisa plate of the 1ug/ml of 100ul, detect hole, 4 ℃ of overnight incubation.With the PBS lavation buffer solution containing 0.05%Tween 20, wash plate hole 3 times, each 5 minutes, afterwards with the PBS room temperature sealing that contains 0.05%Tween 20 and 1%BSA 1 hour.With the PBS lavation buffer solution containing 0.05%Tween 20, wash plate hole 3 times, each 5 minutes.Adopt doubling dilution after affinitive layer purification, to obtain 4-91 #the antibody dilution that bacterium produces is gradient, and gets successively 100ul and join in the above-mentioned hole that is coated with antigen, and negative control adopts and do not transform the albumen that the Rosetta bacterium of plasmid is extracted, and hatches 1 hour for 37 ℃.With the PBS lavation buffer solution containing 0.05%Tween 20, wash plate hole 3 times, each 5 minutes.Anti-HisHRP (Sigma product) is hatched two hours by being diluted at 1: 5000 in the hole of hatching sample before being added in after working fluid with the PBS containing 0.05%Tween 20 and 1%BSA, with the PBS damping fluid containing 0.05%Tween 20, wash 3 times.In hole, add TMB solution, hatch 10 minutes for 37 ℃, add the reaction of 50ul 1N HCl color development stopping, use ELISA microplate reader in 450nm wavelength readings.By dilution method, detect its combination dependency to CD4, the results are shown in Figure 2.
According to formula, the avidity of calculating antibody and antigen is 3.5 * 10 -7m.
The order-checking of embodiment 6.CD4 monoclonal antibody gene
To the 4-91 screening #the antibody gene that bacterium produces checks order, and result is in sequence table.Wherein SEQID NO:1 and SEQ ID NO:3 are the variable region of heavy chain of highly active monoclonal antibody and the DNA sequence dnas of variable region of light chain that the present invention obtains, and SEQ ID NO:2 and SEQ ID NO:4 infer according to above-mentioned DNA sequence dna the aminoacid sequence that.SEQ ID NO:5～7th, infers the complementary determining region CDR1～CDR3 of the variable region of heavy chain; SEQ ID NO:8～10th, infers the complementary determining region CDR1～CDR3 of the variable region of light chain.
Above-described embodiment, just for the present invention is described, not limits the invention to above-mentioned scope.Above-described embodiment may be done a lot of changes, and after having read content disclosed by the invention, those skilled in the art can make various changes and modification to the present invention, within these equivalent form of values fall into the protection domain of the claims in the present invention book equally.
Sequence table
<110> Sichuan Inst. of Antibiotic Industry, China Medicine Group Corp.
Human antibody and the application of a <120> specific binding CD4
<160>20
<170>PatentIn version 3.1
<210>1
<211>351
<212>DNA
<213> homo sapiens (Homo sapiens)
<220>
<221>misc_feature
<222>(1)..(351)
<223> variable region of heavy chain
<400>1
gaggtgcagc tcgaggagtc tgggggagac ttagttcgac ctgggggatc cctgagactc 60
tcctgtacag cctctggatc cgccttcaac aattatgtct tcaactgggt ccgccaggct 120
ccagggaagg ggctggagtg gattggccgt actaaaagta aagatgatgg tgagacaata 180
cagtacgctg cgcccgtgaa aggcagattc gtcatctcaa gagatgattc aaaaaagaca 240
gtgtatctgg aaatgaacac cctgaaaacc gaggacacag ccgtatacta ttgtaccaca 300
ggaagctaca attaccactg gggccacggg accctggtca ccgtctcctc a 351
<210>2
<211>117
<212>PRT
<213> homo sapiens (Homo sapiens)
<220>
<221>misc_feature
<222>(1)..(117)
<223> variable region of heavy chain
<400>2
Glu Val Gln Leu Glu Glu Ser Gly Gly Asp Leu Val Arg Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Ser Ala Phe Asn Asn Tyr
20 25 30
Val Phe Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Arg Thr Lys Ser Lys Asp Asp Gly Glu Thr Ile Gln Tyr Ala Ala
50 55 60
Pro Val Lys Gly Arg Phe Val Ile Ser Arg Asp Asp Ser Lys Lys Thr
65 70 75 80
Val Tyr Leu Glu Met Asn Thr Leu Lys Thr Glu Asp Thr Ala Val Tyr
85 90 95
Tyr Cys Thr Thr Gly Ser Tyr Asn Tyr His Trp Gly His Gly Thr Leu
100 105 110
Val Thr Val Ser Ser
115
<210>3
<211>327
<212>DNA
<213> homo sapiens (Homo sapiens)
<220>
<221>misc_feature
<222>(1)..(327)
<223> variable region of light chain
<400>3
gacattgtaa tgactcagtc tccaggcacc ctgtctctgt ctccagggga aagagccacc 60
ctctcctgca gggccagtca gagtgttagc agcagctact tagcctggta ccagcagaaa 120
cctggccagg ctcccaggct cctcatctat ggtgcatcca ccagggccac tggtacccca 180
gcccggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagcctgcag 240
tctgaagatt ttgcagttta ttactgtcag caatataata actggcctct cacttttggc 300
caggggacca agctggagat caaacga 327
<210>4
<211>109
<212>PRT
<213> homo sapiens (Homo sapiens)
<220>
<221>misc_feature
<222>(1)..(109)
<223> variable region of light chain
<400>4
Asp Ile Val Met Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly
1 5 10 15
Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser
20 25 30
Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu
35 40 45
Ile Tyr Gly Ala Ser Thr Arg Ala Thr Gly Thr Pro Ala Arg Phe Ser
50 55 60
Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln
65 70 75 80
Ser Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Asn Asn Trp Pro
85 90 95
Leu Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>5
<211>5
<212>PRT
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(5)
<223> variable region of heavy chain CDR1
<400>5
Asn Tyr Val Phe Asn
1 5
<210>6
<211>19
<212>PRT
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(19)
<223> variable region of heavy chain CDR2
<400>6
Arg Thr Lys Ser Lys Asp Asp Gly Glu Thr Ile Gln Tyr Ala Ala Pro
1 5 10 15
Val Lys Gly
<210>7
<211>6
<212>PRT
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(6)
<223> variable region of heavy chain CDR3
<400>7
Gly Ser Tyr Asn Tyr His
1 5
<210>8
<211>12
<212>PRT
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(12)
<223> variable region of light chain CDR1
<400>8
Arg Ala Ser Gln Ser Val Ser Ser Ser Tyr Leu Ala
1 5 10
<210>9
<211>7
<212>PRT
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(7)
<223> variable region of light chain CDR2
<400>9
Gly Ala Ser Thr Arg Ala Thr
1 5
<210>10
<211>9
<212>PRT
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(9)
<223> variable region of light chain CDR3
<400>10
Gln Gln Tyr Asn Asn Trp Pro Leu Thr
1 5
<210>11
<211>23
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(23)
<223> primer
<400>11
caggtscagc tggwgsagtc ygg 23
<210>12
<211>24
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(24)
<223> primer
<400>12
tgaggagacg gtgaccakgg tccc 24
<210>13
<211>38
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(38)
<223> primer
<400>13
gggaccmtgg tcaccgtctc ctcaggcggt ggctctgg 38
<210>14
<211>17
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(17)
<223> primer
<400>14
ttgccaccgc cagaacc 17
<210>15
<211>41
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(41)
<223> primer
<400>15
ggttctggcg gtggcaaaga matyrtgmtg acbcagtctc c 41
<210>16
<211>24
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(24)
<223> primer
<400>16
tgaggagacg gtgaccakgg tccc 24
<210>17
<211>41
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(41)
<223> primer
<400>17
ggttctggcg gtggcaaaca gkctgtgctg actcagccsc c 41
<210>18
<211>22
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(22)
<223> primer
<400>18
agattctgta ggggccactg tc 22
<210>19
<211>32
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(32)
<223> primer
<400>19
accaccatgg aggtscasct cgagsagtct gg 32
<210>20
<211>48
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(48)
<223> primer
<400>20
gcgaattctt agcagccacc caggtgatgg tgatggtgat gagatggtgc agccacag 48

Claims (8)

1. a human antibody for specific binding T4 antigen, is characterized in that, the variable region of heavy chain of described human antibody comprises following complementary determining region:
CDR1 shown in SEQ ID NO:5,
CDR2 shown in SEQ ID NO:6,
CDR3 shown in SEQ ID NO:7;
The variable region of light chain of described human antibody comprises following complementary determining region:
CDR1 shown in SEQ ID NO:8,
CDR2 shown in SEQ ID NO:9,
CDR3 shown in SEQ ID NO:10.
2. according to the human antibody of claim 1, it is characterized in that, the variable region of heavy chain of described human antibody has the aminoacid sequence shown in SEQ ID NO:2.
3. according to the human antibody of claim 1, it is characterized in that, the variable region of light chain of described human antibody has the aminoacid sequence shown in SEQ ID NO:4.
4. a human antibody for specific binding T4 antigen, is characterized in that, the variable region of heavy chain of described human antibody and variable region of light chain have respectively the aminoacid sequence shown in SEQ ID NO:2 and SEQ ID NO:4.
5. a human antibody fragment for specific binding T4 antigen, is characterized in that, the variable region of heavy chain of described human antibody fragment comprises following complementary determining region:
CDR1 shown in SEQ ID NO:5,
CDR2 shown in SEQ ID NO:6,
CDR3 shown in SEQ ID NO:7;
The variable region of light chain of described human antibody fragment comprises following complementary determining region:
CDR1 shown in SEQ ID NO:8,
CDR2 shown in SEQ ID NO:9,
CDR3 shown in SEQ ID NO:10;
Described antibody fragment is single-chain antibody (scFv), Fab, Fab' or F (ab') 2.
6. an activated protein for specific binding T4 antigen, is characterized in that, described activated protein is with antibody fragment described in antibody described in claim 1 ~ 4 any one of small molecules mark or claim 5.
7. a DNA molecular, is characterized in that, the variable region of heavy chain shown in described DNA molecule encode SEQ ID NO:2 and the variable region of light chain shown in SEQ ID NO:4.
8. according to the DNA molecular of claim 7, it is characterized in that, described DNA molecular has the nucleotide sequence shown in the nucleotide sequence shown in SEQ ID NO:1 and SEQ ID NO:3.
CN200910051046.5A 2009-05-12 2009-05-12 Fully human antibody capable of specifically bonding CD4 and use thereof Expired - Fee Related CN101885769B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN200910051046.5A CN101885769B (en) 2009-05-12 2009-05-12 Fully human antibody capable of specifically bonding CD4 and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN200910051046.5A CN101885769B (en) 2009-05-12 2009-05-12 Fully human antibody capable of specifically bonding CD4 and use thereof

Publications (2)

Publication Number Publication Date
CN101885769A CN101885769A (en) 2010-11-17
CN101885769B true CN101885769B (en) 2014-08-20

Family

ID=43071880

Family Applications (1)

Application Number Title Priority Date Filing Date
CN200910051046.5A Expired - Fee Related CN101885769B (en) 2009-05-12 2009-05-12 Fully human antibody capable of specifically bonding CD4 and use thereof

Country Status (1)

Country Link
CN (1) CN101885769B (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102854305B (en) * 2011-12-23 2013-08-07 中国人民解放军第三〇九医院 Prewarning kit for transplant kidney rejection and use method thereof
CN102854323B (en) * 2011-12-23 2013-08-07 中国人民解放军第三〇九医院 Transplant kidney rejection reaction early diagnosis kit and use method of kit
CN102854306B (en) * 2011-12-23 2013-08-07 中国人民解放军第三〇九医院 Kit for early warning rejection reaction after kidney transplant and use method of kit
CN110702916B (en) * 2019-04-15 2022-06-21 四川大学华西医院 Quantitative analysis method for integrating proteome and glycoprotein
CN116948032B (en) * 2023-09-19 2023-12-12 汇智生物技术(苏州)有限公司 Humanized CD4 monoclonal antibody and preparation method and application thereof
CN116990504B (en) * 2023-09-27 2023-12-01 苏州旭光科星抗体生物科技有限公司 Double antibody sandwich ELISA kit for detecting human soluble CD4

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7084260B1 (en) * 1996-10-10 2006-08-01 Genpharm International, Inc. High affinity human antibodies and human antibodies against human antigens

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080279848A1 (en) * 2006-03-16 2008-11-13 Genentech, Inc. Methods of treating lupus using CD4 antibodies

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7084260B1 (en) * 1996-10-10 2006-08-01 Genpharm International, Inc. High affinity human antibodies and human antibodies against human antigens

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CD4分子功能表位及拮抗剂研究进展;崔健 等;《军事医学科学院院刊》;20070430;第31卷(第2期);170-174 *
崔健 等.CD4分子功能表位及拮抗剂研究进展.《军事医学科学院院刊》.2007,第31卷(第2期),170-174.

Also Published As

Publication number Publication date
CN101885769A (en) 2010-11-17

Similar Documents

Publication Publication Date Title
JP7158403B2 (en) B7-H3 Antibodies, Antigen-Binding Fragments Thereof, and Their Medical Uses
US9683043B2 (en) PD-1 specific antibodies and uses thereof
EP2342228B1 (en) Pd-1 specific antibodies and uses thereof
CN101885769B (en) Fully human antibody capable of specifically bonding CD4 and use thereof
CN103328513B (en) Anti-CCR4 antibody and application thereof
JP6448554B2 (en) Methods for preventing and treating multiple sclerosis
CN107406505A (en) For treating the bispecific antibody for CD3 ε and BCMA of disease
US8877199B2 (en) B cell surface reactive antibodies
CN107108738A (en) Anti-cd 3 antibodies, it anti-cd 3 antibodies, polyspecific anti-cd 3 antibodies, polyspecific can be activated can activate anti-cd 3 antibodies and its application method
MX2008014978A (en) Human binding molecules having killing activity against enterococci and staphylococcus aureus and uses thereof.
CN104080805A (en) Neutralizing gp41 antibodies and their use
CN102482356A (en) Humanised antibodies to toll-like receptor 2 and uses thereof
CN113677359A (en) CD25 antibody
WO2020125653A1 (en) Monoclonal antibody which fights cd19 and application thereof
TW202019956A (en) Antibody directed against s. aureus clumping factor a (clfa)
Büyükköroğlu et al. Engineering monoclonal antibodies: Production and applications
Sotoudeh et al. Developing and characterizing a single-domain antibody (nanobody) against human cytotoxic T-lymphocyte-associated protein 4 (hCTLA-4)
CN101885770B (en) Fully human antibody capable of specifically bonding CD15 and use thereof
WO2023061421A1 (en) Single-domain 4-1bb antibodies
US20220064334A1 (en) Anti-idiotypic antibodies against anti-klk2 antibodies
US20230094867A1 (en) Anti-idiotypic antibodies against anti-cd79b antibodies
CN116744971A (en) anti-ERBB 3 receptor antibody or antigen binding fragment thereof and medical application thereof
JP2023535684A (en) Anti-idiotypic antibody against anti-GPRC5D antibody
Rönnmark Affibody ligands in immunotechnology applications

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
ASS Succession or assignment of patent right

Owner name: CHENGDU INSTITUTE OF BIOLOGICAL PRODUCTS CO., LTD.

Free format text: FORMER OWNER: SICHUAN INDUSTRIAL INSTITUTE OF ANTIBIOTICS, CHINA NATIONAL PHARMACEUTICAL GROUP CORPORATION

Effective date: 20120906

C41 Transfer of patent application or patent right or utility model
COR Change of bibliographic data

Free format text: CORRECT: ADDRESS; FROM: 610051 CHENGDU, SICHUAN PROVINCE TO: 610023 CHENGDU, SICHUAN PROVINCE

TA01 Transfer of patent application right

Effective date of registration: 20120906

Address after: Jinjiang District Jinhua Road Chengdu City, Sichuan province 610023 three No. 379

Applicant after: CHENGDU INSTITUTE OF BIOLOGICAL PRODUCTS Co.,Ltd.

Address before: 610051, No. 168, Zhonghe Road, Longtan Industrial Park, Chengdu, Sichuan

Applicant before: SICHUAN INDUSTRIAL INSTITUTE OF ANTIBIOTICS, CHINA NATIONAL PHARMACEUTICAL Group Corp.

C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20140820