CN101884782B - The application of bifidobacterium longum adhesion inhibition protein A ip in control diarrhoea - Google Patents
The application of bifidobacterium longum adhesion inhibition protein A ip in control diarrhoea Download PDFInfo
- Publication number
- CN101884782B CN101884782B CN201010212682.4A CN201010212682A CN101884782B CN 101884782 B CN101884782 B CN 101884782B CN 201010212682 A CN201010212682 A CN 201010212682A CN 101884782 B CN101884782 B CN 101884782B
- Authority
- CN
- China
- Prior art keywords
- adhesion
- diarrhoea
- adhesion inhibition
- protein
- aip
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The application of a kind of bifidobacterium longum adhesion inhibition protein A ip in control diarrhoea, it is characterized in that: adhesion inhibition protein A ip prevents pathogen adhesion to be colonizated in intestinal, and do not affect the adhesion of probiotic bacteria, thus the diarrhoea that control pathogenic bacterium cause, maintain intestinal microecology balance.Advantage of the present invention is: can overcome the large and drug resistance of side effect, adhesion inhibition protein A ip is prepared into the functional product of control diarrhoea, do not kill pathogenic bacterium itself, but prevent it to adhere to gastrointestinal tract, make it to lose the condition that field planting copies, be excreted, so safe and reliable, also impure in problems such as drug resistance transfers, be the new approaches for the treatment of diarrhoea.
Description
Technical field
The present invention relates to a kind of application of bifidobacterium longum, particularly relate to the application of a kind of bifidobacterium longum adhesion inhibition protein A ip in control diarrhoea.
Background technology
What human gi-tract was lived away from home more than 400 plants intestinal flora, and these microorganism species keep relative populations by quorum sensing, and vie each other nutrition and space, play its physiological function.In recent years, the illness outbreak that food-borne pathogens (listeria monocytogenes, Escherichia coli O 157 etc.) causes shows a rising trend.These pathogenic bacterium enter human gastrointestinal tract by food chain, after adhering to intestinal mucosa, amplification is bred, invasion enterocyte, by monokaryon macrophage phagocytic, and be diffused into regional nodes thereupon, finally arrive internal organs, thus cause the generation of disease, if listeria monocytogenes is the strong pathogenic bacterium of one that nature exists, 100 CFU just can cause death.
Adhesion is the prerequisite that pathogenic entero becteria causes diarrhoea, suppresses the adhesion of pathogenic bacterium, makes it to become the bacterium that passes by one's way and is excreted, and allows it lose condition in intestinal breeding, thus reaches the object of control diarrhoea.Bacillus bifidus is competed to stick in epithelial cell with pathogenic bacterium in vitro and is in certain advantage.Moroni etc. find to stick in process competing with bacillus bifidus, the aggressivity that the listeria monocytogenes of type is invaded in weak invasion type, medium invasion type and trunk offering not have dropped 38-90% not etc., and the preincubate of bacillus bifidus and cell monolayer can significantly suppress listeria monocytogenes to the adhesion of cell.Zhong Shishun etc. report that the 30min preincubate of bacillus bifidus secreting type adhesin (10-30 μ g/ml) can obviously suppress to produce malicious escherichia coli or enterorrhagia escherichia coli sticking Lovo cell.
Probiotic bacteria and pathogenic bacterium compete sticks site jointly, causes space occupation time process, is the important way that probiotic bacteria suppression pathogenic bacterium are sticked.Asialo-GM1 is the important glucide that pathogenic bacterium and non-pathogenic bacteria stick the mankind and mucous membrane of animal surface, and what to the inhibitory action of enteropathogenic E.Coli, enterohemorrhagic Escherichia coli, namely Lactobacillus johnsonii La1 came from that it occupies pathogenic bacterium sticks site.Mukai etc. find lactobacillus reuteri and helicobacter pylori bacterium competing phase with glycosyl site, occupy the sticking of lactobacillus reuteri enterocyte stick site after cause helicobacter pylori to lose sticking site and be excreted.Therefore, intestinal cell surface carbohydrates material plays an important role in antifungal mechanism as the common orientation binding site of probiotic bacteria and pathogenic bacterium.On the other hand, probiotic bacteria, by competing the different parts of glycosyl with pathogenic bacterium, plays the effect of size exclusion, reaches the object suppressing pathogenic bacterium.Escherichia coli I type preference sticks the mannose α 1-3 mannose site in epithelial cell, this site be not some Lactobacillus johnsonii bacterial strain stick site, Lactobacillus johnsonii may be because it occupies glycosyl site near above-mentioned site for the suppression of escherichia coli I type, cause the size exclusion effect of thalline, and affect the combination of pathogenic bacterium.
What current treatment diarrhoea generally adopted is antibiotherapy, and antibiosis have certain side effect, may cause the generation of persister simultaneously, thus increases treatment difficulty further.In recent years, people have done a large amount of work in research substitute antibiotics treatment diarrhoea, carry out prevention and therapy and to cause a disease microbial infection, the focus of research at present especially especially by probiotic bacteria.Probiotic bacteria by sticking, competing, repel, occupy-place and produce the mechanism such as antibiotic substance, suppress the pathogenic bacterium in gastrointestinal tract, keep the advantage of ancestral home flora, thus promote the health of human body and animal body.The present invention competes pathogenic bacterium at the binding site of intestinal cell by the adhesion inhibition protein A ip of bifidobacterium longum of originating, and prevents pathogen adhesion intestinal, reaches the object of control diarrhoea.
Summary of the invention
The object of the present invention is to provide the application of a kind of bifidobacterium longum adhesion inhibition protein A ip in control diarrhoea, Aip has the ability of stronger suppression pathogen adhesion enterocyte, and do not affect the adhesion function of probiotic bacteria, use safety, noresidue, not develop immunity to drugs.
The present invention is achieved like this, and it is characterized in that: adhesion inhibition protein A ip prevents pathogen adhesion to be colonizated in intestinal, and does not affect the adhesion of probiotic bacteria, thus the diarrhoea that control pathogenic bacterium cause, maintain intestinal microecology balance.
The preparation method of described adhesion inhibition protein A ip is:
(1) bifidobacterium longum of fresh cultured is accessed 300mL MRS fluid medium by 1%, 37 DEG C, the centrifugal 3min of Anaerobic culturel 16-18h, 8000rpm, collect fermented liquid supernatant;
(2) respectively according to 15% and 75% saturation ammonium sulfate precipitation supernatant, finally precipitation 20mLPBS is resuspended, desalination, vacuum lyophilization;
(3) the crude protein prepackage ion column Hitrap Q FF getting 1ml 0.5mg/ml carries out ion-exchange chromatography, first chromatographic column is balanced with start buffer, described start buffer is the mixture of 0.025mol/L kaliumphosphate buffer and 0.001mol/L EDTA and regulates pH to be 8.0, linear concentration gradient eluting is carried out with elution buffer, flow velocity is 1ml/min, collect each eluting peak respectively, electrophoresis detection, determine place, object peak, described elution buffer is 0.025mol/L kaliumphosphate buffer, the mixture of 1mol/L potassium chloride and 0.001mol/L EDTA also regulates pH to be 8.0,
(4) the object peak collected is separated with molecular sieve column HitrapSuperdex75 again, and mobile phase is Millipore ultra-pure water, and flow velocity is 0.5ml/min, collects each eluting peak, electrophoresis detection, determines place, object peak.
Advantage of the present invention is: can overcome the large and drug resistance of side effect, adhesion inhibition protein A ip is prepared into the functional product of control diarrhoea, do not kill pathogenic bacterium itself, but prevent it to adhere to gastrointestinal tract, make it to lose the condition that field planting copies, be excreted, so safe and reliable, also impure in problems such as drug resistance transfers, be the new approaches for the treatment of diarrhoea.
Accompanying drawing explanation
Fig. 1 is the electrophoresis detection collection of illustrative plates of the present invention separation and purification Aip from bifidobacterium longum fermentation liquid
Fig. 2 is nucleotide sequence and the aminoacid sequence of Aip of the present invention.
Fig. 3 is the digestion verification figure that the present invention builds Aip expression vector.
Fig. 4 is the electrophoresis detection collection of illustrative plates of gene engineering expression of the present invention and purification Aip.
Fig. 5 is that the present invention verifies that Aip adheres to the lab diagram of enterocyte.
Fig. 6 is that microscopic examination Aip of the present invention suppresses listeria monocytogenes to adhere to enterocyte figure.
Fig. 7 is that microscopic examination Aip of the present invention suppresses Escherichia coli O 157: H7 to adhere to enterocyte figure.
Fig. 8 is that count plate of the present invention measures Aip suppression listeria monocytogenes adhesion enterocyte figure.
Fig. 9 is that count plate of the present invention measures Aip suppression Escherichia coli O 157: H7 adhesion enterocyte figure.
Figure 10 is the effect diagram that count plate of the present invention measures that Aip adheres to enterocyte to bifidobacterium longum.
Figure 11 is the effect diagram that count plate of the present invention measures that Aip adheres to enterocyte to Lactobacillus plantarum.
Detailed description of the invention
Embodiment 1:
1. the bifidobacterium longum of fresh cultured is accessed 300mL MRS fluid medium by 1%, 37 DEG C, the centrifugal 3min of Anaerobic culturel 16-18h, 8000rpm, collect fermented liquid supernatant.
2., respectively according to 15% and 75% saturation ammonium sulfate precipitation supernatant, finally precipitation 20mLPBS is resuspended, desalination, vacuum lyophilization.
3. the crude protein prepackage ion column Hitrap Q FF getting 1ml 0.5mg/ml carries out ion-exchange chromatography.First start buffer (0.025mol/L kaliumphosphate buffer is used, 0.001mol/L EDTA, pH8.0) chromatographic column is balanced, with elution buffer (0.025mol/L kaliumphosphate buffer, 1mol/L potassium chloride, 0.001mol/L EDTA, pH8.0) carry out linear concentration gradient eluting, flow velocity is 1ml/min, collects each eluting peak respectively, electrophoresis detection, determines place, object peak.
4. the object peak collected is separated with molecular sieve column HitrapSuperdex75 again, and mobile phase is Millipore ultra-pure water, and flow velocity is 0.5ml/min, collects each eluting peak, electrophoresis detection, determines place, object peak.In each purification step, the SDS-PAGE collection of illustrative plates of Aip as shown in Figure 1, is the albumen of about 45kD, and 1 is albumen Marker (14-94kDa); 2 was the protein sample after complete molecular sieve column; 3 was the protein sample after complete ion column; 4 is the protein sample of ammonium sulfate precipitation.
Embodiment 2:
1. cultivate bifidobacterium longum by the method in embodiment 1, extract genomic DNA.According to the primers Aip-up (5`-GCGAATTCATGACAGTTAAGATTGGTATCAACGG-3`) in GenBank and Aip-down (5`-CCGCGGCCGCTCACTCGGAGATCTCAGCGA-3`), amplification Aip gene, gene order and protein sequence are as shown in Figure 2.
2. amplification gene with after restricted enzyme EcoRI and the process of NotI double digestion, connect with the expression vector pGEX-4T-1 of same double digestion, build recombinant expression carrier pAip-G4, transformation of E. coli DH5 α, picking positive colony, verify and check order, as shown in Figure 3,1 is pGEX-BIF (EcoR Iand Not I digested); 2 is DL2000DNA Marker.
3. get the positive colony bacterium that the order-checking of fresh cultured is correct, connect in bacterium amount access 300ml LB culture medium by 1%, be cultured to 0D
600=0.4-0.6, adds 0.5mM IPTG, 25 DEG C of abduction deliverings.After the centrifugal 5min of 4500rpm collects thalline, PBS washs thalline three times.30ml lysis buffer (PBS+2mM EDTA) resuspended thalline, after ultrasonic disruption, the centrifugal 10min of 13000rpm, gets supernatant.Simultaneously to be with the bacillus coli DH 5 alpha of pGEX-4T-1 to operate in contrast.
The A buffer (PBS+2mM EDTA) of 4.20ml carries out the balance of glutathione resin prepacked column GSTrapFF, flow velocity 3ml/min.After curve is steady, get the supernatant loading after fragmentation, flow velocity 0.5-1ml/min.
7., after curve smooth decreasing, with B buffer (PBS+2mM EDTA+10mM glutathion) by destination protein eluting, flow velocity 1ml/min, collects eluting peak.
8. super filter tube concentrate eluant, cross desalting column Hitrap desalting, pure water eluting, flow velocity 3ml/min, gets eluting peak, and after vacuum lyophilization, get to be partly dissolved and carry out SDS-PAGE electroresis appraisal, see Fig. 4,1 is pGEX-BIF expressing protein; 2 is pGEX-4T-1 expressing protein (contrast); 3, the Aip expressing protein of purification; 4 is Blue Plus albumen Marker (12kDa-94kDa)
Embodiment 3:
1. by the Aip that the method in embodiment 2 is purified to, adopt active ester method, get 2 μMs of quantum dot (CdSe/ZnS Core/Shell, Emission=620nm) with sodium dihydrogen phosphate-HCl buffer (0.2M, pH 5.0) resuspended, add 1.52mg carbodiimide (carbodiimide, EDAC) and 0.86mgN-hydroxysulfosuccinimide (Suflo-NHS), 25 DEG C of reaction 40min.
2. adjust pH to 7.8 with NaOH, add Aip fusion rotein 1mg, after 25 DEG C of reaction 3h, 4 DEG C of placements are spent the night.After the centrifugal 10min of 10000rpm gets supernatant, then 40000rpm (=100,000g) for30min, get precipitation, with 500 μ LPBS solubilize, 4 DEG C of preservations are stand-by.Same method labelling GST albumen in contrast.
3. get 95 μ L enterocyte HT-29 (10
4individual/mL) mix with 5 μ L and quantum dot-labeled Aip albumen after, 37 DEG C hatch 2h after, the centrifugal 5min of 3000rpm, gets precipitation, and after washing three times, 100 μ LPBS are resuspended.
4. get 5 μ L mixed liquor points on microscope slide, under fluorescence microscope, 450nm excites to observe and finds that Aip albumen can adhere to enterocyte, and as shown in Figure 5, A is the GST of labelling quantum dot; B is the Aip of labelling quantum dot.Quantum dot-labeled GST albumen in contrast.
Embodiment 4:
1., by the Aip that the method in embodiment 2 is purified to, get 50 μ L enterocyte HT-29 (10
4individual/mL) and 50 μ L30 μ g/mL Aip fusion rotein, after mixing, hatch 2h for 37 DEG C.
The centrifugal 5min of 2.3000rpm, gets precipitation, and after washing three times, 30 μ LPBS are resuspended, and coating slide surface, after drying in the shade, adds heat fixation, add 3%BSA solution and close 1h.
3., after washes clean, the listeria monocytogenes drop getting fresh cultured is added on fixing cell surface, 37 DEG C hatch 1h after, wash away unconjugated thalline, carry out Gram’s staining, then microexamination.GST albumen similarly processes in contrast.Find after the enterocyte of Aip process, the quantity that listeria monocytogenes combines is obviously few than contrast, and as shown in Figure 6, A is Aip; B is GST.
Embodiment 5:
1., by the Aip that the method in embodiment 2 is purified to, get 50 μ L enterocyte HT-29 (10
4individual/mL) and 50 μ L30 μ g/mL Aip fusion rotein, after mixing, hatch 2h for 37 DEG C.
The centrifugal 5min of 2.3000rpm, gets precipitation, and after washing three times, 30 μ LPBS are resuspended, and coating slide surface, after drying in the shade, adds heat fixation, add 3%BSA solution and close 1h.
3. after washes clean, get the Escherichia coli O 157 of fresh cultured: H7 bacterium drop is added on fixing cell surface, 37 DEG C hatch 1h after, wash away unconjugated thalline, carry out Gram’s staining, then microexamination.GST albumen similarly processes in contrast.Find after the enterocyte of Aip process, the quantity that Escherichia coli O 157: H7 combines is obviously few than contrast, and as shown in Figure 7, A is Aip; B is GST.
Embodiment 6:
1., by the Aip that the method in embodiment 2 is purified to, after the Aip fusion rotein (5,30,50 μ g/mL) getting 50 μ L enterocyte HT-29 (104/mL) and 50 μ L variable concentrations mixes, hatch 2h for 37 DEG C.
The centrifugal 5min of 2.3000rpm, gets precipitation, and after washing three times, 30 μ LPBS are resuspended, coat methanol activation pvdf membrane on (1 × 1.5cm
2), after drying in the shade, add closed 1h, PBST in 3%BSA solution and wash film three times.
3. the listeria monocytogenes liquid simultaneously getting fresh cultured is diluted to 10
4after individual/mL, get 500 μ L and hatch 30min with the film 37 DEG C processed, take out film, remaining bacterium liquid carries out count plate.GST albumen similarly processes in contrast.
4. calculate adhesion inhibition rate according to the following formula:
Adhesion inhibition rate (%)=total thalline in (total thalline-residue thalline) × 100/
Result makes Fig. 8, shows along with Aip protein concentration increases, and suppresses the effect of listeria monocytogenes to be strengthened.
Embodiment 7:
1., by the Aip that the method in embodiment 2 is purified to, after the Aip fusion rotein (5,30,50 μ g/mL) getting 50 μ L enterocyte HT-29 (104/mL) and 50 μ L variable concentrations mixes, hatch 2h for 37 DEG C.
The centrifugal 5min of 2.3000rpm, gets precipitation, and after washing three times, 30 μ LPBS are resuspended, coat methanol activation pvdf membrane on (1 × 1.5cm
2), after drying in the shade, add closed 1h, PBST in 3%BSA solution and wash film three times.
3. get the colon bacillus 0157 of fresh cultured: H7 bacterium liquid is diluted to 10 simultaneously
4after individual/mL, get 500 μ L and hatch 30min with the film 37 DEG C processed, take out film, remaining bacterium liquid carries out count plate.GST albumen similarly processes in contrast.
4. calculate adhesion inhibition rate according to the following formula:
Adhesion inhibition rate (%)=total thalline in (total thalline-residue thalline) × 100/
Result makes Fig. 9, shows along with Aip protein concentration increases, and suppresses the effect of colon bacillus 0157: H7 to be strengthened.
Embodiment 8:
1., by the Aip that the method in embodiment 2 is purified to, after the Aip fusion rotein (5,30,50 μ g/mL) getting 50 μ L enterocyte HT-29 (104/mL) and 50 μ L variable concentrations mixes, hatch 2h for 37 DEG C.
The centrifugal 5min of 2.3000rpm, gets precipitation, and after washing three times, 30 μ LPBS are resuspended, coat methanol activation pvdf membrane on (1 × 1.5cm
2), after drying in the shade, add closed 1h, PBST in 3%BSA solution and wash film three times.
3. the bifidobacterium longum liquid simultaneously getting fresh cultured is diluted to 10
4after individual/mL, get 500 μ L and hatch 30min with the film 37 DEG C processed, take out film, remaining bacterium liquid carries out count plate.GST albumen similarly processes in contrast.
4. calculate adhesion inhibition rate according to the following formula:
Adhesion inhibition rate (%)=total thalline in (total thalline-residue thalline) × 100/
Result makes Figure 10, and display Aip albumen does not affect the adhesion of bifidobacterium longum to enterocyte.
Embodiment 9:
1., by the Aip that the method in embodiment 2 is purified to, after the Aip fusion rotein (5,30,50 μ g/mL) getting 50 μ L enterocyte HT-29 (104/mL) and 50 μ L variable concentrations mixes, hatch 2h for 37 DEG C.
The centrifugal 5min of 2.3000rpm, gets precipitation, and after washing three times, 30 μ L PBS are resuspended, coat methanol activation pvdf membrane on (1 × 1.5cm
2), after drying in the shade, add closed 1h, PBST in 3%BSA solution and wash film three times.
3. the Lactobacillus plantarum liquid simultaneously getting fresh cultured is diluted to 10
4after individual/mL, get 500 μ L and hatch 30min with the film 37 DEG C processed, take out film, remaining bacterium liquid carries out count plate.GST albumen similarly processes in contrast.
4. calculate adhesion inhibition rate according to the following formula:
Adhesion inhibition rate (%)=total thalline in (total thalline-residue thalline) × 100/
Result makes Figure 11, and display Aip albumen does not affect the adhesion of Lactobacillus plantarum to enterocyte.
Claims (2)
1. the application of bifidobacterium longum adhesion inhibition albumen in the medicine of preparation control diarrhoea, it is characterized in that: adhesion inhibition protein A ip prevents pathogen adhesion to be colonizated in intestinal, and do not affect the adhesion of probiotic bacteria, thus the diarrhoea that control pathogenic bacterium cause, maintain intestinal microecology balance;
The aminoacid sequence of described adhesion inhibition protein A ip is:
MTVKIGINGFGRIGRLAFRRIFELQARGGQAGDIEVAAINDLTTPATLAYLLKYDSTHGTFRHDDGTPVDVKATEDSIIVDGKEYKVYAEKDANNIPWVKNDGVEYVLECTGFYTSAEKSQAHINAGAKKVLISAPAKDDTTPTVVFGVNHDILKASDVIVSAGSCTTNSMAAMVKLLDEKFGIKAGFMTTIHAYTGTQMLLDGPRGTKTGRNLRAAAINTIAHSTGAAKAIGKVVPSVNGKLQGHAQRVQVPDGSVTELTTVLNTETTADEINAAFKAAFSDTDYYGYNDEGIVSSDILGDTHGGVFDPTQTDVNTIDGVTLARTVSFYDNEYGFTSNMIRTLLYFAEISE；
Its nucleotide sequence is:
ATGACAGTTAAGATTGGTATCAACGGCTTCGGTCGCATTGGTCGTCTCGCCTTCCGTCGCATCTTCGAGCTGCAGGCTCGCGGCGGCCAGGCTGGTGACATTGAAGTTGCCGCCATCAACGATCTGACCACCCCGGCTACCCTGGCTTACCTGCTGAAGTACGACAGCACCCACGGCACCTTCCGTCATGACGATGGCACTCCGGTTGACGTCAAGGCCACCGAAGACTCCATCATCGTCGACGGCAAGGAATACAAGGTCTACGCCGAGAAGGACGCCAACAACATTCCGTGGGTCAAGAACGACGGTGTTGAGTACGTGCTCGAGTGCACCGGCTTCTACACCTCCGCCGAGAAGTCCCAGGCTCACATCAACGCTGGCGCCAAGAAGGTCCTGATCTCCGCCCCGGCCAAGGATGACACCACCCCGACCGTTGTGTTCGGCGTGAACCACGACATCCTCAAGGCTTCCGACGTGATCGTCTCCGCCGGTTCCTGCACCACCAACTCCATGGCCGCCATGGTCAAGCTGCTGGACGAGAAGTTCGGCATCAAGGCCGGCTTCATGACCACCATCCACGCCTACACCGGCACCCAGATGCTGCTCGATGGCCCGCGTGGCACCAAGACCGGCCGCAACCTGCGCGCCGCCGCCATCAACACCATCGCCCACTCCACCGGCGCTGCCAAGGCCATCGGCAAGGTCGTTCCGTCCGTGAACGGCAAGCTGCAGGGCCACGCCCAGCGCGTCCAGGTTCCGGACGGCTCCGTCACCGAGCTGACCACCGTTCTGAACACCGAGACCACCGCCGACGAGATCAACGCCGCCTTCAAGGCTGCCTTCTCCGACACCGATTACTACGGCTACAACGATGAGGGCATCGTCTCCTCCGACATCCTCGGCGACACCCACGGTGGCGTGTTCGACCCGACCCAGACCGACGTCAACACCATTGATGGCGTGACCCTGGCTCGCACCGTGTCCTTCTACGACAACGAGTACGGCTTCACCTCCAACATGATCCGTACCCTGCTGTACTTCGCTGAGATCTCCGAGTGA。
2. application according to claim 1, it is characterized in that the preparation method of described adhesion inhibition protein A ip is: the bifidobacterium longum of fresh cultured is accessed 300mLMRS fluid medium by 1% by (1), 37 DEG C, the centrifugal 3min of Anaerobic culturel 16-18h, 8000rpm, collect fermented liquid supernatant, (2) respectively according to 15% and 75% saturation ammonium sulfate precipitation supernatant, finally precipitation 20mLPBS is resuspended, desalination, vacuum lyophilization, (3) the crude protein prepackage ion column Hitrap Q FF getting 1mL 0.5mg/ml carries out example displacement chromatography, first chromatographic column is balanced with start buffer, described start buffer is the mixture of 0.025 mol/L kaliumphosphate buffer and 0.001mol/L EDTA and regulates pH to be 8.0, linear concentration gradient eluting is carried out with elution buffer, flow velocity is 1ml/min, collect each eluting peak respectively, electrophoresis detection, determine place, object peak, described elution buffer is 0.025mol/L kaliumphosphate buffer, the mixture of 1mol/L potassium chloride and 0.001mol/L EDTA also regulates pH to be 8.0, (4) the object peak collected is separated with molecular sieve column Hi trapSuperdex75 again, and mobile phase is Millipore ultra-pure water, and flow velocity is 0.5ml/min, collects each eluting peak, electrophoresis detection, determines place, object peak.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010212682.4A CN101884782B (en) | 2010-06-29 | 2010-06-29 | The application of bifidobacterium longum adhesion inhibition protein A ip in control diarrhoea |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010212682.4A CN101884782B (en) | 2010-06-29 | 2010-06-29 | The application of bifidobacterium longum adhesion inhibition protein A ip in control diarrhoea |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101884782A CN101884782A (en) | 2010-11-17 |
| CN101884782B true CN101884782B (en) | 2015-09-16 |
Family
ID=43070980
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010212682.4A Expired - Fee Related CN101884782B (en) | 2010-06-29 | 2010-06-29 | The application of bifidobacterium longum adhesion inhibition protein A ip in control diarrhoea |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101884782B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105669843B (en) * | 2016-02-26 | 2019-02-01 | 南昌大学 | A kind of bifidobacterium longum protein, preparation method and medical usage |
| CN108834900B (en) * | 2018-07-31 | 2022-03-11 | 安徽农业大学 | Culture method for inhibiting explant oxidation browning and endophyte pollution in tea tree tissue culture |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1227152A1 (en) * | 2001-01-30 | 2002-07-31 | Société des Produits Nestlé S.A. | Bacterial strain and genome of bifidobacterium |
| CN1420781A (en) * | 1999-08-05 | 2003-05-28 | 雀巢制品公司 | Bifidobacteria capable of preventing diarrhea |
| CN100413958C (en) * | 2004-12-29 | 2008-08-27 | 王敖喜 | Bifidobacterium possessing characteristic for anti pathogenesis bacterium in intestinal tract and antioxidation, and application |
| CN101649303A (en) * | 2009-05-08 | 2010-02-17 | 内蒙古蒙牛乳业（集团）股份有限公司 | Bifidobacterium, application thereof and food composition containing same |
-
2010
- 2010-06-29 CN CN201010212682.4A patent/CN101884782B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1420781A (en) * | 1999-08-05 | 2003-05-28 | 雀巢制品公司 | Bifidobacteria capable of preventing diarrhea |
| EP1227152A1 (en) * | 2001-01-30 | 2002-07-31 | Société des Produits Nestlé S.A. | Bacterial strain and genome of bifidobacterium |
| CN1500146A (en) * | 2001-01-30 | 2004-05-26 | �Ʒ� | Genome of bifidobacterium |
| CN100413958C (en) * | 2004-12-29 | 2008-08-27 | 王敖喜 | Bifidobacterium possessing characteristic for anti pathogenesis bacterium in intestinal tract and antioxidation, and application |
| CN101649303A (en) * | 2009-05-08 | 2010-02-17 | 内蒙古蒙牛乳业（集团）股份有限公司 | Bifidobacterium, application thereof and food composition containing same |
Non-Patent Citations (1)
| Title |
|---|
| Cell surface Lactobacillus plantarum LA318 glyceraldehyde-3-phosphate dehydrogenase(GAPDH) adheres to human colonic mucin;H.Kinoshita et.al;《Journal of Applied Microbiology》;20081231;第104卷;摘要及第1673页左栏第2段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101884782A (en) | 2010-11-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sorbara et al. | Microbiome-based therapeutics | |
| Tarrah et al. | Probiotic potential and biofilm inhibitory activity of Lactobacillus casei group strains isolated from infant feces | |
| Servin et al. | Adhesion of probiotic strains to the intestinal mucosa and interaction with pathogens | |
| Pavlović et al. | Probiotics—interactions with bile acids and impact on cholesterol metabolism | |
| Tiwari | Bacteriocin-producing probiotic lactic acid bacteria in controlling dysbiosis of the gut microbiota | |
| Liu et al. | Adhesion and immunomodulatory effects of Bifidobacterium lactis HN019 on intestinal epithelial cells INT-407 | |
| Strompfová et al. | Enterococcus faecium EK13—an enterocin A-producing strain with probiotic character and its effect in piglets | |
| Slížová et al. | Analysis of biofilm formation by intestinal lactobacilli | |
| Parveen Rani et al. | Purification of antilisterial peptide (Subtilosin A) from novel Bacillus tequilensis FR9 and demonstrate their pathogen invasion protection ability using human carcinoma cell line | |
| WO2012108830A1 (en) | Synbiotic compositions for restoration and reconstitution of gut microbiota | |
| Alshammari et al. | Potential evaluation and health fostering intrinsic traits of novel probiotic strain Enterococcus durans F3 isolated from the gut of fresh water fish Catla catla | |
| WO2002060931A2 (en) | A fimbria-like gene in bifidobacteria | |
| Collado et al. | Probiotics in adhesion of pathogens: mechanisms of action | |
| Denkova et al. | Antimicrobial activity of probiotic microorganisms: Mechanisms of interaction and methods of examination | |
| KR20070054670A (en) | Strain of lactobacillus acidophilus having analgesic properties in the gastrointestinal system | |
| CN104805040B (en) | A kind of bacillus subtilis formulation and preparation method and application | |
| Sun et al. | In vitro evaluation of Lactobacillus crispatus K313 and K243: high-adhesion activity and anti-inflammatory effect on Salmonella braenderup infected intestinal epithelial cell | |
| Darvishi et al. | Genomic and proteomic comparisons of bacteriocins in probiotic species Lactobacillus and Bifidobacterium and inhibitory ability of Escherichia coli MG 1655 | |
| Schiffrin et al. | Food processing: probiotic microorganisms for beneficial foods | |
| Nishant et al. | Bacteriocin producing probiotic lactic acid bacteria | |
| Li et al. | Adhesion and colonization of the probiotic Lactobacillus rhamnosus labeled by dsred2 in mouse gut | |
| Kim et al. | Probiotic properties and immune-stimulating effect of the Jeju lava seawater mineral-coated probiotics | |
| CA2469894A1 (en) | Use of micro-organisms for a directed delivery of substances to specific parts of the gut | |
| CN101884782B (en) | The application of bifidobacterium longum adhesion inhibition protein A ip in control diarrhoea | |
| Ohashi et al. | Transition of the probiotic bacteria, Lactobacillus casei strain Shirota, in the gastrointestinal tract of a pig |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150916 Termination date: 20190629 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |