CN101878193A - Bicyclic gamma-amino acid derivative - Google Patents

Bicyclic gamma-amino acid derivative Download PDF

Info

Publication number
CN101878193A
CN101878193A CN2008801188928A CN200880118892A CN101878193A CN 101878193 A CN101878193 A CN 101878193A CN 2008801188928 A CN2008801188928 A CN 2008801188928A CN 200880118892 A CN200880118892 A CN 200880118892A CN 101878193 A CN101878193 A CN 101878193A
Authority
CN
China
Prior art keywords
heptan
alkyl
alkene
methyl
pain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN2008801188928A
Other languages
Chinese (zh)
Other versions
CN101878193B (en
Inventor
岛田神生
河村明日香
荒川尚久
土门友纪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sankyo Co Ltd
Daiichi Sankyo Co Ltd
Original Assignee
Sankyo Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sankyo Co Ltd filed Critical Sankyo Co Ltd
Publication of CN101878193A publication Critical patent/CN101878193A/en
Application granted granted Critical
Publication of CN101878193B publication Critical patent/CN101878193B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C229/00—Compounds containing amino and carboxyl groups bound to the same carbon skeleton
    • C07C229/02—Compounds containing amino and carboxyl groups bound to the same carbon skeleton having amino and carboxyl groups bound to acyclic carbon atoms of the same carbon skeleton
    • C07C229/32—Compounds containing amino and carboxyl groups bound to the same carbon skeleton having amino and carboxyl groups bound to acyclic carbon atoms of the same carbon skeleton the carbon skeleton being unsaturated and containing rings other than six-membered aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C49/00—Ketones; Ketenes; Dimeric ketenes; Ketonic chelates
    • C07C49/587—Unsaturated compounds containing a keto groups being part of a ring
    • C07C49/613—Unsaturated compounds containing a keto groups being part of a ring polycyclic
    • C07C49/617—Unsaturated compounds containing a keto groups being part of a ring polycyclic a keto group being part of a condensed ring system
    • C07C49/623—Unsaturated compounds containing a keto groups being part of a ring polycyclic a keto group being part of a condensed ring system having two rings
    • C07C49/627—Unsaturated compounds containing a keto groups being part of a ring polycyclic a keto group being part of a condensed ring system having two rings the condensed ring system containing seven carbon atoms
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A61K31/22—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin
    • A61K31/221—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin with compounds having an amino group, e.g. acetylcholine, acetylcarnitine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A61P21/02—Muscle relaxants, e.g. for tetanus or cramps
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/02—Drugs for disorders of the nervous system for peripheral neuropathies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/04—Centrally acting analgesics, e.g. opioids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/08—Antiepileptics; Anticonvulsants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/22—Anxiolytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C323/00—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups
    • C07C323/50—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and carboxyl groups bound to the same carbon skeleton
    • C07C323/51—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and carboxyl groups bound to the same carbon skeleton having the sulfur atoms of the thio groups bound to acyclic carbon atoms of the carbon skeleton
    • C07C323/57—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and carboxyl groups bound to the same carbon skeleton having the sulfur atoms of the thio groups bound to acyclic carbon atoms of the carbon skeleton the carbon skeleton being further substituted by nitrogen atoms, not being part of nitro or nitroso groups
    • C07C323/58—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and carboxyl groups bound to the same carbon skeleton having the sulfur atoms of the thio groups bound to acyclic carbon atoms of the carbon skeleton the carbon skeleton being further substituted by nitrogen atoms, not being part of nitro or nitroso groups with amino groups bound to the carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07B—GENERAL METHODS OF ORGANIC CHEMISTRY; APPARATUS THEREFOR
    • C07B2200/00—Indexing scheme relating to specific properties of organic compounds
    • C07B2200/07—Optical isomers
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C2601/00—Systems containing only non-condensed rings
    • C07C2601/04—Systems containing only non-condensed rings with a four-membered ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C2601/00—Systems containing only non-condensed rings
    • C07C2601/06—Systems containing only non-condensed rings with a five-membered ring
    • C07C2601/08—Systems containing only non-condensed rings with a five-membered ring the ring being saturated
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C2602/00—Systems containing two condensed rings
    • C07C2602/02—Systems containing two condensed rings the rings having only two atoms in common
    • C07C2602/14—All rings being cycloaliphatic
    • C07C2602/20—All rings being cycloaliphatic the ring system containing seven carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C2603/00—Systems containing at least three condensed rings
    • C07C2603/93—Spiro compounds
    • C07C2603/94—Spiro compounds containing "free" spiro atoms

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Pain & Pain Management (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Nutrition Science (AREA)
  • Hematology (AREA)
  • Psychology (AREA)
  • Emergency Medicine (AREA)
  • Rheumatology (AREA)
  • Physiology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Nitrogen And Oxygen Or Sulfur-Condensed Heterocyclic Ring Systems (AREA)
  • Indole Compounds (AREA)

Abstract

Disclosed is a bicyclic gamma-amino acid derivative having an excellent activity as an a2d ligand. Specifically disclosed is a compound represented by the following general formula (I). [chemical formula 1] (I) (In the formula, R1, R2, R2', R4, R5, R6, R7, R8 and R8' each represents a hydrogen atom or the like; and R3 represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group or the like.

Description

Bicyclic gamma-amino acid derivative
Technical field
The present invention relates to bicyclic gamma-amino acid derivative or its pharmacy acceptable salt.Specifically, the present invention relates to have α 22-delta ligand is active and to voltage-dependent ca channel subunit α 2δ has compound or its pharmacy acceptable salt of avidity.The invention still further relates to and comprise described compound or its pharmacy acceptable salt pharmaceutical composition as activeconstituents.
Background field
Verified, to voltage-dependent ca channel subunit α 2δ shows high affinity bonded compound can effectively treat for example neuropathic pain (neuropathic pain) (referring to for example Non-Patent Document 1 and 2).In the application's context, neuropathic pain is meant the chronic pain that is caused by nervous tissue injury etc., is a kind of disease of remarkable infringement quality of life, reaches because serious pain invasion and attack and the patient suffers from depressed degree.
The α of present known several types 22-delta ligand is to be used for so neuralgic curative drug.α 2The example of 2-delta ligand comprises gabapentin and lyrica.α such as these compounds 22-delta ligand can be used for treating (for example Patent Document 1) such as epilepsy and neurodynias.
Yet, it is reported, for example, for gabapentin, the effectiveness of its treatment postherpetic neuralgia is according to about 60% (referring to for example Non-Patent Document 3) of being evaluated as of patient self, for lyrica, the effectiveness of its treatment painful diabetic neuropathy is according to about 50% (referring to for example Non-Patent Document 4) of being evaluated as of patient self.
Other compound for example is disclosed in Patent Document 2,3 and 4.Yet disclosed compound mainly is the dicyclo saturated hydrocarbon compound in these Patent Documents, and they are obviously different with compound of the present invention.
Patent Document 1:WO 04/006836 paper
Patent Document 2:WO 99/21824 paper
Patent Document 3:WO 01/28978 paper
Patent Document 4:WO 02/085839 paper
Non-Patent Document 1:J Biol.Chem.271 (10): 5768-5776,1996
Non-Patent Document 2:J Med.Chem.41:1838-18445,1998
Non-Patent Document 3:Acta Neurol.Scand.101:359-371,2000
Non-Patent Document 4:Drugs 64 (24): 2813-2820,2004
Disclosure of the present invention
The problem to be solved in the present invention
The treatment meaning of particularly important of the present invention is that the curative effect of the compound that provided is better than the α that conventional treatment uses 2The 2-delta ligand active compound.
Therefore, target of the present invention provides and has splendid α 2The active bicyclic gamma-amino acid derivative of 2-delta ligand or its pharmacy acceptable salt, to pain or the pharmaceutical composition that has splendid therapeutic and/or prophylactic action such as the obstacle that relates to central nervous system, and the intermediate that is used to produce described derivative.
Solve the method for problem of the present invention
The invention provides:
(1) a kind of compound or its pharmacy acceptable salt by following general formula (I) representative:
Figure GPA00001143598100021
Wherein
R 1, R 2, R 2 ', R 4, R 5, R 6, R 7, R 8And R 8 'Independent separately is hydrogen atom, halogen atom or C1-C6 alkyl, perhaps R 2And R 2 'Form the C3-C7 cycloalkyl with their bonded carbon atoms; With
R 3Be hydrogen atom, halogen atom, C1-C6 alkyl, C1-C6 alkylogen group, hydroxyl-C1-C6 alkyl, sulfane base-C1-C6 alkyl, C1-C6 alkoxy-C 1-C6 alkyl, C2-C6 thiazolinyl, C2-C6 alkynyl, C1-C6 alkoxyl group, C1-C6 alkyl alkylthio base, C1-C6 alkyl alkylthio base-C1-C6 alkyl, C2-C7 acyl group sulfo--C1-C6 alkyl, C2-C7 acyloxy-C1-C6 alkyl or C3-C7 cycloalkyl.
According to preferred aspect, the invention provides:
(2) according to compound or its pharmacy acceptable salt, the wherein R of (1) 1Be hydrogen atom;
(3) according to compound or its pharmacy acceptable salt, the wherein R of (1) or (2) 2And R 2 'Be hydrogen atom;
(4) according to each compound or its pharmacy acceptable salt, wherein R in (1)-(3) 3Be hydrogen atom or C1-C6 alkyl;
(5) according to compound or its pharmacy acceptable salt, the wherein R of (4) 3Be hydrogen atom, methyl, ethyl, propyl group or butyl;
(6) according to compound or its pharmacy acceptable salt, the wherein R of (5) 3Be hydrogen atom or ethyl;
(7) according to each compound or its pharmacy acceptable salt, wherein R in (1)-(6) 4Be hydrogen atom;
(8) according to each compound or its pharmacy acceptable salt, wherein R in (1)-(7) 5Be hydrogen atom;
(9) according to each compound or its pharmacy acceptable salt, wherein R in (1)-(8) 6Be hydrogen atom;
(10) according to each compound or its pharmacy acceptable salt, wherein R in (1)-(9) 7Be hydrogen atom;
(11) according to each compound or its pharmacy acceptable salt, wherein R in (1)-(10) 8And R 8 'Be hydrogen atom;
(12) according to the pharmacy acceptable salt of each compound in (1)-(11), wherein said pharmacy acceptable salt is hydrochloride, benzene sulfonate or tosilate;
(13) compound or its pharmacy acceptable salt of representing by following general formula (Ia):
Figure GPA00001143598100041
Wherein
R 1, R 2, R 2 ', R 4, R 5, R 6, R 7, R 8And R 8 'Independent separately is hydrogen atom, halogen atom or C1-C6 alkyl, perhaps R 2And R 2 'Form the C3-C7 cycloalkyl with their bonded carbon atoms; With
R 3Be hydrogen atom, halogen atom, C1-C6 alkyl, C1-C6 alkylogen group, hydroxyl-C1-C6 alkyl, sulfane base-C1-C6 alkyl, C1-C6 alkoxy-C 1-C6 alkyl, C2-C6 thiazolinyl, C2-C6 alkynyl, C1-C6 alkoxyl group, C1-C6 alkyl alkylthio base, C1-C6 alkyl alkylthio base-C1-C6 alkyl, C2-C7 acyl group sulfo--C1-C6 alkyl, C2-C7 acyloxy-C1-C6 alkyl or C3-C7 cycloalkyl;
(14) compound or its pharmacy acceptable salt of representing by following general formula (Ib):
Figure GPA00001143598100042
Wherein
R 1, R 2, R 2 ', R 4, R 5, R 6, R 7, R 8And R 8 'Independent separately is hydrogen atom, halogen atom or C1-C6 alkyl, perhaps R 2And R 2 'Form the C3-C7 cycloalkyl with their bonded carbon atoms; With
R 3Be hydrogen atom, halogen atom, C1-C6 alkyl, C1-C6 alkylogen group, hydroxyl-C1-C6 alkyl, sulfane base-C1-C6 alkyl, C1-C6 alkoxy-C 1-C6 alkyl, C2-C6 thiazolinyl, C2-C6 alkynyl, C1-C6 alkoxyl group, C1-C6 alkyl alkylthio base, C1-C6 alkyl alkylthio base-C1-C6 alkyl, C2-C7 acyl group sulfo--C1-C6 alkyl, C2-C7 acyloxy-C1-C6 alkyl or C3-C7 cycloalkyl;
(15) compound or its pharmacy acceptable salt of representing by following general formula (II):
Figure GPA00001143598100051
Wherein
R 3Be hydrogen atom, halogen atom, C1-C6 alkyl, C1-C6 alkylogen group, hydroxyl-C1-C6 alkyl, sulfane base-C1-C6 alkyl, C1-C6 alkoxy-C 1-C6 alkyl, C2-C6 thiazolinyl, C2-C6 alkynyl, C1-C6 alkoxyl group, C1-C6 alkyl alkylthio base, C1-C6 alkyl alkylthio base-C1-C6 alkyl, C2-C7 acyl group sulfo--C1-C6 alkyl, C2-C7 acyloxy-C1-C6 alkyl or C3-C7 cycloalkyl;
(16) a kind ofly be selected from following compound:
(±)-[(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
(±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate;
(±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
(±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-propyl group dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
(±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-butyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
[(1R, 5S, 6S)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
[(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
[(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetic acid hydrochloride;
[(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] the acetate benzene sulfonate;
[(1R, 5S, 6S)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
[(1R, 5S, 6S)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] the acetate tosilate;
[(1R, 5S, 6S)-6-(amino methyl)-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] the acetate benzene sulfonate; With
[(1S, 5R, 6R)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate.
(17) comprise (1)-(16) in each compound or its pharmacy acceptable salt as the pharmaceutical composition of activeconstituents;
(18) according to the pharmaceutical composition of (17), it is used for the treatment of and/or prevent irritation;
(19) according to the pharmaceutical composition of (17), it is used for the treatment of and/or prevents to be selected from following disease: acute pain, chronic pain, the pain that causes by soft tissue injury or peripheral damage, postherpetic neuralgia, occipital neuralgia, trigeminal neuralgia, myelomere neurodynia or intercostal neuralgia, central pain, neuropathic pain, migraine, the pain relevant with osteoarthritis or rheumatic arthritis, with contusion, sprain or pain that wound is relevant, spondylalgia, injure the pain that causes by spinal cord or brain stem, back pain, sciatica, toothache, myofasical pain syndrome, episiotomy pain, gouty pain, the pain that causes by burn, heart pain, myalgia, ocular pain, inflammatory pain, actinal surface pain, abdominal pain, the pain relevant with dysmenorrhoea, labor pains or endometriosis, somatalgia, with nerve or the relevant pain of nerve root injury, the pain relevant with amputation, trigeminal neuralgia, neuroma or vasculitis, the pain (or diabetic peripheral neuralgia) that causes by diabetic neuropathy, the pain that causes by chemotherapy inductive DPN, the atypia prosoponeuralgia, lower back neurodynia, trigeminal neuralgia, occipital neuralgia, myelomere neurodynia or intercostal neuralgia, the neurodynia relevant with HIV, the neurodynia relevant with AIDS, hyperpathia, burn pain, sudden pain, the pain that causes by chemotherapy, occipital neuralgia, psychogenic pain, the pain relevant with cholelith, neurodynia relevant or non-neurodynia with cancer, phantom limb pain, functional abdominal pain, headache, acute or chronic tension headache, sinus headache, cluster headache, temporomandibular arthralgia, maxillary sinus pain, the pain that causes by stiff property arthritis vertebralis, postoperative pain, scar pain, chronic non-neurodynia, fibromyalgia, amyotrophic lateral sclerosis, epilepsy (part epilepsy especially, adult's partial seizure and epileptic's partial seizure), generalized anxiety disorder and restless leg syndrome;
(20) pharmaceutical composition of basis (17), the pain that it is used for the treatment of and/or prevents to be caused by diabetic neuropathy;
(21) purposes that each compound or its pharmacy acceptable salt are used to produce pharmaceutical composition in (1)-(16);
(22) according to the purposes of (21), wherein said pharmaceutical composition is to be used for the treatment of and/or the composition of prevent irritation;
(23) according to the purposes of (21), wherein said pharmaceutical composition is to be used for the treatment of and/or the composition of the pain preventing to be caused by diabetic neuropathy;
(24) a kind of method that treats and/or prevents pain, described method comprise in (1)-(16) that give significant quantity on the Mammals pharmacology each compound or its pharmacy acceptable salt;
(25) according to the method for (24), wherein said pain is the pain that is caused by diabetic neuropathy;
(26) according to the method for (24) or (25), wherein said Mammals is behaved; With
(27) a kind of compound by following general formula (III) representative:
Figure GPA00001143598100071
Wherein
R 1a, R 2a, R 2a ', R 4a, R 5a, R 8aAnd R 8a 'Independent separately is hydrogen atom, halogen atom or C1-C6 alkyl, perhaps R 2aAnd R 2a 'Form the C3-C7 cycloalkyl with their bonded carbon atoms; With
R 3aBe hydrogen atom, halogen atom, C1-C6 alkyl, C1-C6 alkylogen group, hydroxyl-C1-C6 alkyl, sulfane base-C1-C6 alkyl, C1-C6 alkoxy-C 1-C6 alkyl, C2-C6 thiazolinyl, C2-C6 alkynyl, C1-C6 alkoxyl group, C1-C6 alkyl alkylthio base, C1-C6 alkyl alkylthio base-C1-C6 alkyl, C2-C7 acyl group sulfo--C1-C6 alkyl, C2-C7 acyloxy-C1-C6 alkyl or C3-C7 cycloalkyl.
Advantage of the present invention
The present invention can provide has splendid α 2The active bicyclic gamma-amino acid derivative of 2-delta ligand or its pharmacy acceptable salt, to pain or the pharmaceutical composition that has splendid therapeutic and/or prophylactic action such as the obstacle that relates to central nervous system, and the intermediate that is used to produce them.
Implement best mode of the present invention
In this manual, " halogen atom " is meant fluorine atom, chlorine atom, bromine atoms or iodine atom.
In this manual, " C1-C6 alkyl " is meant the straight or branched alkyl with 1-6 carbon atom, and comprise methyl, ethyl, propyl group, sec.-propyl, butyl, isobutyl-, sec-butyl, the tertiary butyl, amyl group, isopentyl, 2-methyl butyl, neo-pentyl, 1-ethyl propyl, hexyl, isohexyl, 4-methyl amyl, 3-methyl amyl, 2-methyl amyl, 1-methyl amyl, 3,3-dimethylbutyl, 2,2-dimethylbutyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl and 2-ethyl-butyl.
In this manual, " C1-C6 alkylogen group " is meant " the C1-C6 alkyl " that is replaced by " halogen atom ", and comprise trifluoromethyl, trichloromethyl, difluoromethyl, dichloromethyl, two brooethyls, methyl fluoride, 2,2,2-trifluoroethyl, 2,2,2-three chloroethyls, 2-bromotrifluoromethane, 2-chloroethyl, 2-fluoro ethyl, 2-iodine ethyl, 3-chloropropyl, 4-fluorine butyl and 6-iodine hexyl.
In this manual, " hydroxyl-C1-C6 alkyl " is meant " the C1-C6 alkyl " that is replaced by hydroxyl, and comprises hydroxymethyl, 2-hydroxyethyl, 3-hydroxypropyl, 4-hydroxybutyl, 5-hydroxyl amyl group, 6-hydroxyl hexyl, 1-hydroxyethyl and 1-hydroxypropyl.
In this manual, " sulfane base-C1-C6 alkyl " is meant " the C1-C6 alkyl " that is replaced by the sulfane base, and comprises mercapto methyl, mercaptoethyl, 2-mercaptoethyl, sulfydryl propyl group, 2-sulfydryl propyl group and 3-sulfydryl propyl group.
In this manual, " C2-C6 thiazolinyl " is meant the straight or branched thiazolinyl with 2-6 carbon atom, and comprise vinyl, allyl group, the 1-propenyl, pseudoallyl, the 1-butylene base, crotyl, the 3-butenyl, 2-methyl isophthalic acid-propenyl, the 2-methacrylic, 1-methyl isophthalic acid-propenyl, the 1-methacrylic, the 1-pentenyl, pentenyl, the 3-pentenyl, the 4-pentenyl, the 3-methyl-1-butene base, 3-methyl-2-butene base, 3-methyl-3-butenyl, the 2-methyl-1-butene thiazolinyl, 2-methyl-2-butene base, 2-methyl-3-butenyl, 1-methyl isophthalic acid-butenyl, 1-methyl-2-butene base, 1-methyl-3-butenyl, 1, the 1-dimethyl-allyl, 1,2-dimethyl-1-propenyl, 1,2-dimethyl-2-propenyl, 1-ethyl-1-propenyl, 1-ethyl-2-propenyl, the 1-hexenyl, the 2-hexenyl, the 3-hexenyl, the 4-hexenyl, the 5-hexenyl, 1,1-dimethyl-1-butylene base, 1,1-dimethyl-crotyl, 1,1-dimethyl-3-butenyl, 3,3-dimethyl-1-butylene base, 1-methyl-1-pentene thiazolinyl, 1-methyl-pentenyl, 1-methyl-3-pentenyl, 1-methyl-4-pentenyl, the 4-methyl-1-pentene base, 4-methyl-pentenyl and 4-methyl-3-pentenyl.
In this manual, " C2-C6 alkynyl " is meant the straight or branched alkynyl with 2-6 carbon atom, and comprise ethynyl, 1-proyl, 2-propynyl, ethyl acetylene base, 2-butyne base, 3-butynyl, 1-methyl-2-propynyl, 1-pentynyl, valerylene base, 3-pentynyl, 4-pentynyl, 3-methyl isophthalic acid-butynyl, 2-methyl-3-butynyl, 1-methyl-2-butyne base, 1-methyl-3-butynyl, 1,1-dimethyl-2-propynyl, 1-hexin base, 2-hexin base, 3-hexin base, 4-hexin base and 5-hexin base.
In this manual, " C1-C6 alkoxyl group " is meant " the C1-C6 alkyl " in conjunction with Sauerstoffatom, and comprises methoxyl group, oxyethyl group, propoxy-, isopropoxy, butoxy, isobutoxy, sec-butoxy, tert.-butoxy, pentyloxy, isopentyloxy, 2-methyl butoxy, neopentyl oxygen, hexyloxy, 4-methyl pentyloxy, 3-methyl pentyloxy and 2-methyl pentyloxy.
In this manual, " C1-C6 alkyl alkylthio base " is meant combined sulfur atom " C1-C6 alkyl ", and comprise methyl sulfane base, ethyl sulfane base, the propylthio alkyl, sec.-propyl sulfane base, butyl sulfane base, isobutyl-sulfane base, sec-butyl sulfane base, tertiary butyl sulfane base, amyl group sulfane base, isopentyl sulfane base, 2-methyl butyl sulfane base, neo-pentyl sulfane base, 1-ethyl propyl sulfane base, hexyl sulfane base, isohexyl sulfane base, 4-methyl amyl sulfane base, 3-methyl amyl sulfane base, 2-methyl amyl sulfane base, 1-methyl amyl sulfane base, 3,3-dimethylbutyl sulfane base, 2,2-dimethylbutyl sulfane base, 1,1-dimethylbutyl sulfane base, 1,2-dimethylbutyl sulfane base, 1,3-dimethylbutyl sulfane base, 2,3-dimethylbutyl sulfane base and 2-ethyl-butyl sulfane base.
In this manual, " C1-C6 alkoxy-C 1-C6 alkyl " is meant " the C1-C6 alkyl " that is replaced by " C1-C6 alkoxyl group ", and comprises methoxymethyl, ethoxyl methyl, propoxy-methyl, butoxymethyl, 3-methoxy-propyl, 3-ethoxycarbonyl propyl, 4-methoxyl group butyl, 5-methoxyl group amyl group and 6-methoxyl group hexyl.
In this manual, " C1-C6 alkyl alkylthio base-C1-C6 alkyl " is meant " the C1-C6 alkyl " that is replaced by " C1-C6 alkyl alkylthio base ", and comprise methyl sulfane ylmethyl, ethyl sulfane ylmethyl, the propylthio alkyl methyl, sec.-propyl sulfane ylmethyl, butyl sulfane ylmethyl, isobutyl-sulfane ylmethyl, sec-butyl sulfane ylmethyl, tertiary butyl sulfane ylmethyl, amyl group sulfane ylmethyl, isopentyl sulfane base ethyl, 2-methyl butyl sulfane base ethyl, neo-pentyl sulfane base ethyl, 1-ethyl propyl sulfane base ethyl, hexyl sulfane base ethyl, isohexyl sulfane base ethyl, 4-methyl amyl sulfane base ethyl, 3-methyl amyl sulfane base ethyl, 2-methyl amyl sulfane base propyl group, 1-methyl amyl sulfane base propyl group, 3,3-dimethylbutyl sulfane base propyl group, 2,2-dimethylbutyl sulfane base propyl group, 1,1-dimethylbutyl sulfane base propyl group, 1,2-dimethylbutyl sulfane base propyl group, 1,3-dimethylbutyl sulfane base propyl group, 2,3-dimethylbutyl sulfane base propyl group and 2-ethyl-butyl sulfane base propyl group.
In this manual, " C2-C7 acyl group sulfo--C1-C6 alkyl " is meant " the C1-C6 alkyl " that is replaced by " C2-C7 acyl mercapto "." C2-C7 acyl mercapto " is meant combined sulfur atom " C2-C7 acyl group "." C2-C7 acyl group " is meant " the C1-C6 alkyl " in conjunction with carbonyl.
" C2-C7 acyl group " comprises ethanoyl, propionyl, butyryl radicals, isobutyryl, secondary butyryl radicals, uncle's butyryl radicals, pentanoyl, isovaleryl, 2-methylbutyryl base, valeryl, 1-ethyl propionyl, caproyl, 4-methylpent acyl group, 3-methylpent acyl group, 2-methylpent acyl group and 1-methylpent acyl group.
" C2-C7 acyl mercapto " comprises ethanoyl sulfenyl, propionyl sulfenyl, butyryl radicals sulfenyl, isobutyryl sulfenyl, secondary butyryl radicals sulfenyl, uncle's butyryl radicals sulfenyl, pentanoyl sulfenyl, isovaleryl sulfenyl, 2-methylbutyryl base sulfenyl, valeryl sulfenyl, 1-ethyl propionyl sulfenyl, caproyl sulfenyl, 4-methylpent acyl mercapto, 3-methylpent acyl mercapto, 2-methylpent acyl mercapto and 1-methylpent acyl mercapto.
" C2-C7 acyl group sulfo--C1-C6 alkyl " comprises ethanoyl sulphomethyl, 2-ethanoyl thio-ethyl, 3-ethanoyl sulfo-propyl group, 4-ethanoyl sulfo-butyl, propionyl sulphomethyl, 2-propionyl thio-ethyl and butyryl radicals sulphomethyl.
In this manual, " C2-C7 acyloxy-C1-C6 alkyl " is meant " the C1-C6 alkyl " that is replaced by " C2-C7 acyloxy "." C2-C7 acyloxy " is meant " the C2-C7 acyl group " in conjunction with Sauerstoffatom.
" C2-C7 acyloxy " comprises acetoxyl group, propionyloxy, butyryl acyloxy, isobutyl acyloxy, secondary butyryl acyloxy, uncle's butyryl acyloxy, penta acyloxy, isoamyl acyloxy, 2-methylbutyryl oxygen base, new pentane acyloxy, 1-ethyl propionyloxy, hexylyloxy, 4-methylpent acyloxy, 3-methylpent acyloxy, 2-methylpent acyloxy and 1-methylpent acyloxy.
" C2-C7 acyloxy-C1-C6 alkyl " comprises acetoxy-methyl, 2-acetoxyl group ethyl, 3-acetoxyl group propyl group, 4-acetoxyl group butyl, propionyloxy methyl, 2-propionyloxy ethyl and butyryl acyloxy methyl.
In this manual, " C3-C7 cycloalkyl " is meant the saturated annular hydrocarbyl group with 3-7 carbon atom, and comprises cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and suberyl.
Because when having amino and/or carboxyl in the compound structure by general formula (I) representative, itself and acid or alkali reaction formation salt are so " pharmacy acceptable salt " is meant such salt.
Salt based on amino comprises: halogen acid salt, for example hydrofluoride, hydrochloride, hydrobromate and hydriodate; Inorganic acid salt, for example hydrochloride, nitrate, perchlorate, vitriol and phosphoric acid salt; Lower paraffin hydrocarbons sulfonate, for example mesylate, fluoroform sulphonate and esilate; Arylsulphonate, for example benzene sulfonate and tosilate; Organic acid salt, for example acetate, malate, fumarate, succinate, Citrate trianion, ascorbate salt, tartrate, oxalate and maleate; And amino acid salts, for example glycinate, lysine salt, arginic acid salt, ornithine salt, glutaminate and aspartate.Preferred inorganic acid salt or arylsulphonate, more preferably hydrochloride, benzene sulfonate or tosilate.
Salt based on carboxyl comprises: an alkali metal salt, for example sodium salt, sylvite and lithium salts; Alkaline earth salt, for example calcium salt and magnesium salts; Metal-salt, for example aluminium salt and molysite; Inorganic salt, for example ammonium salt; Amine salt, organic salt for example, as uncle's octyl group amine salt, dibenzyl amine salt, alkylbenzyldimethylasaltsum saltsum, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucosamine salt, guanidinesalt, diethyl amine salt, triethyl amine salt, dicyclohexyl amine salt, N, N '-dibenzyl ethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl-1-phenylethylamine salt, piperazine salt, tetramethyl ammonium and three (methylol) aminomethane salt; And amino acid salts, for example glycinate, lysine salt, arginic acid salt, ornithine salt, glutaminate and aspartate.
By general formula (I), (Ia), (Ib) or (II) compound of representative when placing air or recrystallization, may absorb with the water that absorbs by water and combine, with the formation hydrate.Such hydrate is also included within the salt of the present invention.
By general formula (I) or (II) compound of representative in its molecule, have asymmetric carbon atoms, therefore and comprise optical isomer.All these isomer and these mixture of isomers are represented by single general formula, i.e. general formula (I) or (II).Therefore, by general formula (I) or (II) compound of representative also comprise the mixture of the adequate rate of all such optical isomers and these optical isomers.
Be preferably by the general formula (Ia) or (Ib) compound of representative by the compound of general formula (I) representative, more preferably by the compound of general formula (Ib) representative.
At general formula (I), (Ia) or (Ib), R 1Be preferably hydrogen atom.
At general formula (I), (Ia) or (Ib), R 2Be preferably hydrogen atom.
At general formula (I), (Ia) or (Ib), R 2 'Be preferably hydrogen atom.
At general formula (I), (Ia), (Ib) or (II), R 3Be preferably hydrogen atom or C1-C6 alkyl, more preferably hydrogen atom, methyl, ethyl, propyl group or butyl, even more preferably hydrogen atom or ethyl.
At general formula (I), (Ia) or (Ib), R 4Be preferably hydrogen atom.
At general formula (I), (Ia) or (Ib), R 5Be preferably hydrogen atom.
At general formula (I), (Ia) or (Ib), R 6Be preferably hydrogen atom.
At general formula (I), (Ia) or (Ib), R 7Be preferably hydrogen atom.
At general formula (I), (Ia) or (Ib), R 8Be preferably hydrogen atom.
At general formula (I), (Ia) or (Ib), R 8 'Be preferably hydrogen atom.
In general formula (III), R 1aBe preferably hydrogen atom.
In general formula (III), R 2aBe preferably hydrogen atom.
In general formula (III), R 2a 'Be preferably hydrogen atom.
In general formula (III), R 3aBe preferably hydrogen atom or C1-C6 alkyl, more preferably hydrogen atom, methyl, ethyl, propyl group or butyl, even more preferably hydrogen atom or ethyl.
In general formula (III), R 4aBe preferably hydrogen atom.
In general formula (III), R 5aBe preferably hydrogen atom.
In general formula (III), R 8aBe preferably hydrogen atom.
In general formula (III), R 8a 'Be preferably hydrogen atom.
By the compound of general formula (I) representative by the concrete example of describing in the following table 1 for example of compound.Yet, the invention is not restricted to these compounds.
In following example, n-Pr represents n-propyl, and i-Pr represents sec.-propyl.
[table 1]
Figure GPA00001143598100131
Numbering ??R 1 ??R 2 ??R 2’ ??R 3 ??R 4
??1 ??-H ??-H ??-H ??-H ??-H
??2 ??-CH 3 ??-H ??-H ??-H ??-H
??3 ??-H ??-CH 3 ??-H ??-H ??-H
??4 ??-H ??-H ??-H ??-CH 3 ??-H
??5 ??-H ??-H ??-H ??-H ??-CH 3
??6 ??-H ??-H ??-H ??-H ??-H
??7 ??-H ??-H ??-H ??-H ??-H
??8 ??-H ??-H ??-H ??-CH 2CH 3 ??-H
??9 ??-H ??-H ??-H ??-CH 2CH 2CH 3 ??-H
??10 ??-H ??-H ??-H ??-CH 2CH 2CH 2CH 3 ??-H
Figure GPA00001143598100141
??14 ??-H ??-H ??-H ??-H ??-H
??15 ??-H ??-H ??-H ??-H ??-H
??16 ??-H ??-H ??-H ??-H ??-H
??17 ??-H ??-H ??-H ??-H ??-H
??18 ??-H ??-H ??-H ??-H ??-H
??19 ??-H ??-H ??-H ??-H ??-H
??20 ??-H ??-H ??-C(CH 3) 3 ??-H ??-H
??21 ??-H ??-CH 3 ??-H ??-H ??-H
??22 ??-H ??-CH 2CH 3 ??-H ??-H ??-H
??23 ??-H ??-n-Pr ??-H ??-H ??-H
??24 ??-H ??-i-Pr ??-H ??-H ??-H
??25 ??-H ??-H ??-CH 3 ??-H ??-H
??26 ??-H ??-H ??-CH 2CH 3 ??-H ??-H
??27 ??-H ??-H ??-n-Pr ??-H ??-H
??28 ??-H ??-H ??-i-Pr ??-H ??-H
??29 ??-H ??-H ??-H ??-CH 3 ??-CH 3
??30 ??-H ??-H ??-H ??-H ??-H
??31 ??-H ??-H ??-H ??-H ??-H
??32 ??-H ??-H ??-H ??-H ??-H
??33 ??-H ??-H ??-H ??-H ??-H
??34 ??-H ??-H ??-H ??-H ??-H
??14 ??-H ??-H ??-H ??-H ??-H
??35 ??-H ??-H ??-H ??-H ??-H
??36 ??-H ??-H ??-H ??-H ??-H
??37 ??-H ??-H ??-H ??-H ??-H
??38 ??-H ??-H ??-H ??-H ??-H
??39 ??-H ??-H ??-H ??-H ??-H
??40 ??-H ??-H ??-H ??-H ??-H
??41 ??-H ??-H ??-H ??-H ??-H
??42 ??-H ??-H ??-H ??-H ??-H
??43 ??-F ??-H ??-H ??-H ??-H
??44 ??-H ??-CH 3 ??-H ??-H ??-H
??45 ??-H ??-CH 2CH 3 ??-H ??-H ??-H
??46 ??-H ??-n-Pr ??-H ??-H ??-H
??47 ??-H ??-i-Pr ??-H ??-H ??-H
??48 ??-H ??-H ??-CH 3 ??-H ??-H
??49 ??-H ??-H ??-CH 2CH 3 ??-H ??-H
??50 ??-H ??-H ??-n-Pr ??-H ??-H
??51 ??-H ??-H ??-i-Pr ??-H ??-H
??52 ??-H ??-H ??-H ??-F ??-H
In exemplary compounds, preferred compound 1,4,8,9 and 10.
In the compound of general formula (I) representative, R wherein 6And R 7The compound that is hydrogen atom for example produces by A method (steps A-1, steps A-2, steps A-3, optional step A-4, and steps A-5) or D method (steps A-1, step D-1, step D-2, optional step A-4, and steps A-5).
On the other hand, in compound by general formula (I) representative, R wherein 6And R 7The compound that is the part of non-hydrogen atom for example produces by steps A-6, steps A-7, optional step A-8 and steps A-9 after steps A-5.
[A method and D method]
Figure GPA00001143598100181
R wherein 1, R 2, R 2 ', R 3, R 4, R 5, R 6, R 7, R 8And R 8 'As above definition; P 1The protecting group of representation carboxy; And P 2And P 3Represent amino protecting group.
P 1Be not particularly limited, as long as it is used as the protecting group of carboxyl usually.The example comprises methyl, ethyl, propyl group, sec.-propyl, butyl, isobutyl-, sec-butyl, the tertiary butyl, hexyl, the bromo-tertiary butyl, three chloroethyls, benzyl, to nitrobenzyl, adjacent nitrobenzyl, to methoxy-benzyl, to tertiary butyl benzyl, acetoxy-methyl, the propionyloxy methyl, the butyryl acyloxy methyl, isobutyl acyl-oxygen ylmethyl, valeryl oxygen ylmethyl, oxy acid methyl neopentyl, the acetoxyl group ethyl, the acetoxyl group propyl group, the acetoxyl group butyl, the propionyloxy ethyl, the propionyloxy propyl group, the butyryl acyloxy ethyl, isobutyl acyloxy ethyl, the new pentane acyloxy ethyl, the hexylyloxy ethyl, isobutyl acyl-oxygen ylmethyl, ethyl butyryl acyloxy methyl, dimethyl butyrate acyloxy methyl, penta acyloxy ethyl, the methoxyl group carbonyl oxy-methyl, ethoxy carbonyl oxy-methyl, the propoxy-carbonyl oxy-methyl, the tert.-butoxy carbonyl oxy-methyl, methoxyl group carbonyl oxygen base ethyl, oxyethyl group carbonyl oxygen base ethyl, the isopropoxy carbonyl oxy ethyl, t-butyldimethylsilyl, trimethyl silyl, methoxymethyl, ethoxyl methyl, the propoxy-methyl, the isopropoxy methyl, (2-methyl sulfo-)-ethyl, 3-methyl-2-butene base, 5-indanyl and 3-2-benzo [C] furanone subunit.
P 2And P 3Be not particularly limited, as long as they are usually as amino protecting group.The example comprises formyl radical, phenylcarbonyl group, methoxycarbonyl, ethoxy carbonyl, phenyloxycarbonyl, 9-fluorenyl methyl oxygen base carbonyl, adamantyl oxygen base carbonyl, benzyl oxygen base carbonyl, benzyloxycarbonyl group, benzyl, diphenyl-methyl, trityl and phthaloyl.
In the multiple condition that is used for by the production method of the compound of general formula (I) representative, the reaction times difference of each step, depend on the type of the initial compounds that uses in the step, secondary material, catalyzer, reagent, solvent etc., be generally 1-48 hour, be preferably 1-24 hour.Other condition of each step below has been described in detail in detail on the other hand.
[steps A-1]
Steps A-the 1st is by the step of olefination by compound (1) production compound (2).
Used solvent is not particularly limited, as long as they are inhibited reactions and can dissolve initial substance to a certain degree solvent not.Described solvent comprises aromatic solvent, ether solvents, ester solvent, halon solvent, nitrile solvent, amide solvent and sulfoxide solvent.Preferred ether solvents, more preferably tetrahydrofuran (THF).
The secondary material that uses comprises: Horner-Emmons reagent; Dialkyl group phosphonoacetic acid alkyl ester is as diethyl phosphonoacetic acid ethyl ester; Phosphorus ylide reagent; And phosphonium ylide (phosphonium ylides), for example ethoxy carbonyl methylene tri phenyl phosphorane.
The reagent that uses is mineral alkali, pure basic metal, organic bases, organo-metallic alkali etc.Preferred mineral alkali, more preferably sodium hydride.
The temperature of reaction difference depends on the type of initial compounds, solvent, secondary material, reagent etc. to be generally 0-100 ℃, preferred 0 ℃ to room temperature.
After finishing reaction, collect the target compound of this reaction by reaction mixture according to standard method.For example, as required, the excessive reagent of degrading, and termination reaction.Neutralization reaction mixture aptly.And, if there is any insoluble substance, by removing by filter.Add entry and the immiscible organic solvent of water to resistates then, ethyl acetate is for example separated the organic layer that contains target compound, and washing such as water then is then through dryings such as anhydrous magnesium sulfate, anhydrous sodium sulphate, anhydrous sodium bicarbonates.Then, distill solvent, to obtain target compound.As required, by combination standard method aptly, for example be generally used for separating the common method with purified organic compound, for example recrystallization and redeposition then by using chromatography with suitable eluent wash-out, separate and the target compound of purifying acquisition.
And, in step subsequently, usually after the reaction of finishing each step, with steps A-1 handle identical mode again, collect the target compound of each reaction by reaction mixture.
[steps A-2]
Steps A-the 2nd is by the step of compound (2) production compound (3).
Used solvent and those solvent phase in steps A-1 are together.Preferred ether solvents or nitrile solvent, more preferably tetrahydrofuran (THF) or acetonitrile.
Used secondary material comprises Nitromethane 99Min..
Used reagent comprise with steps A-1 in those identical reagent.Preferred organic bases or organo-metallic alkali, more preferably diazabicyclo undecylene or quaternary alkylammonium halides.
The temperature of reaction difference depends on the type of initial compounds, solvent, secondary material, reagent etc. to be generally 0-100 ℃, is preferably 0-60 ℃.
[steps A-3]
Steps A-3 is that reducing compound (3) is to produce the step of compound (5).
Used solvent is not particularly limited, as long as they are inhibited reactions and can dissolve initial substance to a certain degree solvent not.Described solvent comprises alcoholic solvent, ester solvent, ether solvents and aqueous solvent.Preferred alcohols solvent and aqueous solvent, more preferably ethanol or water.
Used reagent comprises radium-carbon, palladium hydroxide-carbon, nickelous chloride, tin chloride, sodium borohydride, iron powder, tin, zinc and hydrogen.Preferred iron powder or tin.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally 0-100 ℃, is preferably 60-80 ℃.
[step D-1]
Step D-1 is the step by compound (2) production compound (4).
Used solvent comprise with steps A-1 in identical those solvents, alcoholic solvent and aqueous solvent.The preferred amide solvent, more preferably N, dinethylformamide.
Used reagent comprises: cyanidization agent; With metallocyanide reagent, cyaniding aluminium for example.Preferred cyanidization agent, more preferably sodium cyanide or potassium cyanide.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally 0-100 ℃, is preferably 60-80 ℃.
[step D-2]
Step D-2 is that reducing compound (4) is to produce the step of compound (5).
Used solvent comprise with step D-1 in identical solvent.Preferred alcohols solvent or ether solvents, more preferably methyl alcohol or tetrahydrofuran (THF).
Used catalyzer comprises transition-metal catalyst.Preferred nickelous chloride or cobalt chloride.
Used reagent comprises borane reagent.Preferred sodium borohydride.
The temperature of reaction difference depends on the type of initial compounds, solvent, catalyzer, reagent etc. to be generally 0-100 ℃, is preferably 0 ℃ to room temperature.
[steps A-4]
Can choose the step (steps A-4) of the amino of implementing protection compound (5) wantonly, with preparation compound (6).
Used solvent comprise with steps A-3 in identical solvent.Preferred alcohols solvent or aqueous solvent, more preferably ethanol or water.
Used reagent comprises two dimethyl dicarbonate butyl esters, chloro-formic ester, acyl halide, acid anhydrides, SULPHURYL CHLORIDE, mineral alkali, pure basic metal, organic bases and organo-metallic alkali.Preferred two dimethyl dicarbonate butyl esters, mineral alkali or organic bases, more preferably two dimethyl dicarbonate butyl esters, sodium hydroxide or triethylamine.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally 0-100 ℃, is preferably 0 ℃ to room temperature.
[steps A-5]
Steps A-5 is by going to protect the step of protecting group by compound (5) or (6) production compound (7).
Used solvent comprise with steps A-3 in those identical solvents.Preferred ether solvents or ester solvent, more preferably diox or ethyl acetate.
Used reagent is mineral acid, mineral alkali or organic acid.More preferably hydrochloric acid, acetate or trifluoroacetic acid.
The temperature of reaction difference depends on the type of initial compounds, solvent, secondary material, reagent etc. to be generally 0-100 ℃, is preferably 0 ℃ to room temperature.
[steps A-6]
Steps A-6 is the step of the amino of protection compound (7) with generation compound (8).
Used solvent comprise with steps A-3 in those identical solvents.Preferred alcohols solvent or aqueous solvent, more preferably ethanol or water.
Used reagent comprise with steps A-4 in those identical reagent.Preferred two dimethyl dicarbonate butyl esters, mineral alkali or organic bases, more preferably two dimethyl dicarbonate butyl esters, sodium hydroxide or triethylamine.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally 0-100 ℃, is preferably 0 ℃ to room temperature.
[steps A-7]
Steps A-7 is that alkylated compound (8) is to produce the step of compound (9).
Used solvent comprise with steps A-1 in those identical reagent.Preferred ether solvents.
Used secondary material comprises alkylogen.
Used reagent comprise with steps A-1 in those identical reagent.Preferred sodium hydride.
The temperature of reaction difference depends on the type of initial compounds, solvent, secondary material, reagent etc. to be generally-78 ℃ to room temperature, is preferably 0 ℃ to room temperature.
[steps A-8]
After steps A-7, can choose wantonly and carry out steps A-8.Steps A-8 is that alkylated compound (9) is to produce the step of compound (10).
Used solvent comprise with steps A-1 in those identical solvents.Preferred ether solvents or amide solvent.
Used secondary material comprises alkylogen.
Used reagent comprise with steps A-1 in those identical reagent.Preferred yellow soda ash or salt of wormwood.
The temperature of reaction difference depends on the type of initial compounds, solvent, secondary material, reagent etc. to be generally-78 ℃ to room temperature, is preferably 0 ℃ to room temperature.
[steps A-9]
Steps A-9 is by going to protect protecting group to be produced the step of the compound of being represented by general formula (I) by compound (9).
Used solvent comprise with steps A-3 in those identical solvents.Preferred ether solvents or ester solvent, more preferably diox or ethyl acetate.
Used reagent comprise with steps A-4 in those identical reagent.Preferred hydrochloric acid, acetate or trifluoroacetic acid.
The temperature of reaction difference depends on the type of initial compounds, solvent, secondary material, reagent etc. to be generally 0-100 ℃, is preferably 0 ℃ to room temperature.
The compound (1) that obtains by described production method can also produce by B, C or the E method of for example showing down.The B method is made up of step B-1, B-2, B-3 and B-4.The C method is made up of step C-1, B-3 and B-4.
[B and C method]
Figure GPA00001143598100241
R wherein 1, R 2, R 2 ', R 3, R 4, R 5, R 6, R 7, R 8, R 8 'And P 1As above definition.
[step B-1]
Step B-1 is the step that is produced compound (12) by substitution reaction by compound (11).
Used solvent comprise with steps A-1 in those identical solvents.Preferred ether solvents.
Used secondary material comprises allyl halide and crotyl halide.Preferred allyl bromide 98 or crotyl chloride.
Used reagent comprise with steps A-1 in those identical reagent.Preferred sodium hydride or butyllithium.
The temperature of reaction difference depends on the type of initial compounds, solvent, secondary material, reagent etc. to be generally-78 ℃ to room temperature, is preferably 0 ℃ to room temperature.
[step B-2]
Step B-2 is the step that is produced compound (13) by reduction reaction by compound (12).
Used solvent comprise with steps A-1 in identical those solvents, alcoholic solvent and aqueous solvent.Preferred ether solvents, alcoholic solvent or its mixed solvent, more preferably tetrahydrofuran (THF)-methyl alcohol.
Used reagent comprises hydroborate reagent.Preferred sodium borohydride.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally 0-100 ℃, is preferably 0 ℃ to room temperature.
[step C-1]
Step C-1 is the step that is produced compound (13) by linked reaction by compound (15).
Used solvent comprise with steps A-1 in identical those solvents and boric acid derivatives.Preferred ether solvents or boric acid derivatives, more preferably tetrahydrofuran (THF), dme or trimethyl-boron acid esters.
Used secondary material comprises the alpha-halogen alkyl acetate.Preferred monobromo-acetic acid alkyl ester, more preferably monobromo-acetic acid methyl esters, bromoethyl acetate or tert-butylbromo acetate.
Used reagent comprises zinc.
The temperature of reaction difference depends on the type of initial compounds, solvent, secondary material, reagent etc. to be generally 0-100 ℃, is preferably 60-80 ℃.
[step B-3]
Step B-3 is that hydrolysis compound (13) is to produce the step of compound (14).
Used solvent is not particularly limited, as long as they are that inhibited reaction also can not dissolve initial substance solvent extremely to a certain degree.Described solvent comprises aromatic solvent, ether solvents, halogenated hydrocarbon solvent, nitrile solvent, amide solvent, sulfoxide solvent, alcoholic solvent and aqueous solvent.Preferred alcohols solvent, aqueous solvent or its mixed solvent, more preferably methanol-water.
Used reagent comprises mineral alkali.Preferred potassium hydroxide, sodium hydroxide or lithium hydroxide.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally 0-100 ℃, is preferably 0 ℃ to room temperature.
[step B-4]
Step B-4 is to produce the step of compound (1) by alkaline purification catalytic cpd (14).
Used solvent is not particularly limited, as long as they are that inhibited reaction also can not dissolve initial substance solvent extremely to a certain degree.Described solvent comprises aromatic solvent, ether solvents, halogenated hydrocarbon solvent, nitrile solvent, acid and acid anhydrides.Preferred acid or acid anhydrides, more preferably acetate or diacetyl oxide.
Used reagent comprises an alkali metal salt.Preferred potassium acetate.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally 0-150 ℃, is preferably room temperature to 140 ℃.
[E method]
R wherein 1, R 2, R 2 ', R 3, R 4, R 5, R 6, R 7, R 8And R 8 'As above definition.
[step e-1]
Step e-1 is the step that is produced compound (17) by compound (16).
Used solvent comprise with steps A-1 in identical those solvents and hydrocarbon solvent.Optimization aromatic solvent, halogenated hydrocarbon solvent or hydrocarbon solvent, more preferably toluene.
Used reagent comprises oxalyl chloride and thionyl chloride.Preferred oxalyl chloride.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally 0-150 ℃, is preferably room temperature to 120 ℃.
[step e-2]
Step e-2 is the step that is produced compound (1) by compound (17).
Used solvent comprise with steps A-1 in those identical solvents.Optimization aromatic solvent, halogenated hydrocarbon solvent or hydrocarbon solvent, more preferably toluene.
Used reagent comprises organic bases.Preferred triethylamine.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally 0-150 ℃, is preferably room temperature to 120 ℃.
Compound by general formula (II) representative can produce with the identical mode of compound of general formula (I) representative.
By general formula (Ia) or (Ib) compound of representative be optical isomer by the compound of general formula (I) representative, and add F, G or the generation of for example showing down of H method by the A method.
[F method]
The F method is to carry out optical resolution to produce the optical isomer (3a) and the step (3b) of compound (3) after the steps A of A method-2.By steps A-3 to A-5 or steps A-3 to A-9, by optical isomer (3a) or (3b) produce by the general formula (Ia) or (Ib) compound of representative.
[F method]
R wherein 1, R 2, R 2 ', R 3, R 4, R 5, R 6, R 7, R 8, R 8 'And P 1As above definition.
Used solvent comprise with steps A-1 in identical those solvents, hydrocarbon solvent, alcoholic solvent and hydrocarbon solvent and the mixed solvent of alcoholic solvent.Preferred hexane-Virahol or hexane-ethanol.
The pillar that uses in optical resolution is not particularly limited, as long as it is the chiral column that allows optical resolution.Described post is preferably the Industries by Daicel Chemical, CHIRALPAK (registered trademark) AD-H or CHIRALPAK (registered trademark) IC that Ltd. produces.
Used temperature is generally 0-40 ℃, is preferably 20-40 ℃.
After finishing reaction, distill eluent (solvent), to obtain the target compound of this reaction.
By general formula (Ia) or (Ib) the following generation of compound of representative: compound (1) is carried out optical resolution as follows, implement those steps identical then with the A method.
The G method is to carry out optical resolution to produce the optical isomer (1a) and the method (1b) of compound (1) before the steps A of A method-1.By steps A-1 to A-5 or steps A-1 to A-9, by optical isomer (1a) or (1b) produce by the general formula (Ia) or (Ib) compound of representative.
[G method]
Figure GPA00001143598100291
R wherein 1, R 2, R 2 ', R 3, R 4, R 5, R 6, R 7, R 8And R 8 'As above definition; And P 4The protecting group of representation hydroxy.
P 4Be not particularly limited, as long as it generally is used as the protecting group of hydroxyl.The example comprises trimethyl silyl; t-butyldimethylsilyl; methoxymethyl; 2-methoxy ethoxy methyl; THP trtrahydropyranyl; benzyl; to methoxy-benzyl; 2; the 4-dimethoxy-benzyl; neighbour-nitrobenzyl; right-nitrobenzyl; trityl; formyl radical; ethanoyl; tert-butoxycarbonyl; 2-iodo ethoxy carbonyl; 2; 2; 2-trichlorine ethoxy carbonyl; 2-propenyl oxygen base carbonyl; 2-chloro-2-propenyl oxygen base carbonyl; 3-methoxycarbonyl-2-propenyl oxygen base carbonyl; 2-methyl-2-propenyl oxygen base carbonyl; crotyl oxygen base carbonyl; cinnamyl oxygen base carbonyl; benzyl oxygen base carbonyl; right-methoxy-benzyl oxygen base carbonyl, neighbour-nitrobenzyl oxygen base carbonyl and right-nitrobenzyl oxygen base carbonyl.
[step G-1]
Step G-1 is that reducing compound (1) is to produce the step of compound (18).
Used solvent is not particularly limited, as long as they are inhibited reactions and can dissolve initial substance to a certain degree solvent not.Described solvent comprises aromatic solvent, ether solvents, ester solvent, halogenated hydrocarbon solvent, nitrile solvent, amide solvent, sulfoxide solvent and hydrocarbon solvent.Optimization aromatic solvent, halogenated hydrocarbon solvent or hydrocarbon solvent, more preferably tetrahydrofuran (THF).
Used reagent comprises borane reagent and aurin tricarboxylic acid.Preferred trimethoxy aluminum hydride.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally-78 ℃ to room temperature, is preferably-78 ℃ to 0 ℃.
[step G-2]
Step G-2 carries out the optical resolution of compound (1) to obtain compound (19a) or method (19b) for using the enzyme such as lipase.
Used solvent is not particularly limited, as long as they are inhibited reactions and can dissolve initial substance to a certain degree solvent not.Described solvent comprises aromatic solvent, ether solvents, ester solvent, halogenated hydrocarbon solvent, nitrile solvent, amide solvent, sulfoxide solvent and hydrocarbon solvent.Optimization aromatic solvent, halogenated hydrocarbon solvent or hydrocarbon solvent, more preferably hexane.
Used reagent comprises ester reagent.Optimal ethylene ester, more preferably vinyl-acetic ester.
Used enzyme comprises: antarctic candida (Candida antarctica) lipase, Pseudomonas fluorescens (Pseudomonas fluorescens) lipase, pseudomonas cepacia (Pseudomonas cepacia) lipase, pig pancreas lipase, pig liver esterase and fold candida (Candida rugosa) lipase.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent, enzyme etc. to be generally 0-150 ℃, is preferably room temperature to 40 ℃.
And, in step G-2, can also use suitable chiral auxiliary(reagent) to change compound (18) into diastereomer, by suitable method (recrystallization, distillation and column chromatography) it is split then.Can be by for example Experimental Chemistry 18, Reaction ofOrganic Compound-(II)-, (on November 25 nineteen fifty-seven, Maruzen Co.Ltd. publishes the first roll, Chemical Society of Japan edits), the method that the 503-556 page or leaf is described splits.More particularly, compound (18) and carboxylic acid reagent such as phthalic anhydride, and can use phenylethylamine, quinine, cinchonidine, methylbenzylamine, naphthalene ethylamine etc., by recrystallization etc. by produced carboxylic acid derivative (19a) and mixture (19b) split.
[step G-3]
Step G-3 is a hydrolysis compound (19a) or (19b) with synthetic compound (20a) or method (20b).
Used solvent is not particularly limited, as long as they are inhibited reactions and can dissolve initial substance to a certain degree solvent not.Described solvent comprises aromatic solvent, ether solvents, ester solvent, halogenated hydrocarbon solvent, nitrile solvent, amide solvent, sulfoxide solvent, hydrocarbon solvent, alcoholic solvent, aqueous solvent and mixed solvent thereof.Preferred ether solvents, alcoholic solvent, aqueous solvent or its mixed solvent, more preferably methyl alcohol, ethanol or water.
Used reagent comprises mineral alkali.Preferred salt of wormwood, sodium hydroxide or potassium hydroxide.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally 0-60 ℃, is preferably 0 ℃ to room temperature.
[step G-4]
Step G-4 is an oxygenated compound (20a) or (20b) with synthetic compound (1a) or method (1b).
Used solvent is not particularly limited, as long as they are inhibited reactions and can dissolve initial substance to a certain degree solvent not.Described solvent comprises aromatic solvent, ether solvents, ester solvent, halogenated hydrocarbon solvent, nitrile solvent, amide solvent, sulfoxide solvent and hydrocarbon solvent.Preferred halogenated hydrocarbon solvent, more preferably methylene dichloride.
Used reagent comprises chloride of acid.Preferred oxalyl chloride.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally-78 ℃ to room temperature, is preferably-78 ℃ to 0 ℃.
[H method]
The H method is to carry out compound (1a) or (1b) the method for optical resolution with the optical isomer that is produced as compound (1) before the steps A of A method-1.By steps A-1 to A-5 or steps A-1 to A-9, by compound (1a) or (1b) produce by the general formula (Ia) or (Ib) compound of representative.
[H method]
Figure GPA00001143598100321
[step H-1]
Step H-1 is the step that is produced compound (21) by compound (1).
Used solvent is not particularly limited, as long as they are inhibited reactions and can dissolve initial substance to a certain degree solvent not.Described solvent comprises aromatic solvent, ether solvents, ester solvent, halogenated hydrocarbon solvent, nitrile solvent, amide solvent, sulfoxide solvent and hydrocarbon solvent.Optimization aromatic solvent, halogenated hydrocarbon solvent or hydrocarbon solvent, more preferably benzene or toluene.
Used reagent comprises ethylene glycol and propylene glycol.Preferred benzyleneglycol.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally-78 ℃ to reflux conditions, preferred 60 ℃ to reflux conditions.
[step H-2]
Step H-2 carries out optical resolution to produce compound (21a) or step (21b) to compound (21).
Used solvent comprise with steps A-1 in identical those solvents, hydrocarbon solvent, alcoholic solvent and hydrocarbon solvent and the mixed solvent of alcoholic solvent.Preferred hexane-Virahol or hexane-ethanol.
The pillar that in optical resolution, uses comprise with the F method in those identical pillars.
Used temperature is generally 0-40 ℃, is preferably 20-40 ℃.
After finishing reaction, distill eluent (solvent), to obtain the target compound of this reaction.
[step H-3]
Step H-3 is by compound (21a) or (21b) synthetic compound (1a) or step (1b).
Used solvent is not particularly limited, as long as they are inhibited reactions and can dissolve initial substance to a certain degree solvent not.Described solvent comprises aromatic solvent, ether solvents, ester solvent, halogenated hydrocarbon solvent, nitrile solvent, amide solvent, sulfoxide solvent, hydrocarbon solvent, ketone solvent and aqueous solvent.Preferred ketone solvent or aqueous solvent, more preferably acetone or water.
Used reagent comprises an acidic catalyst, for example mineral acid or organic acid, for example hydrochloric acid, acetate, sulfuric acid, toluenesulphonic acids and camphorsulfonic acid.
The temperature of reaction difference depends on the type of initial compounds, solvent, reagent etc. to be generally 0-100 ℃, is preferably 60-100 ℃.
By described method obtain compound or its pharmacy acceptable salt of representative show α by general formula (I), (Ia), (Ib) or (II) 22-delta ligand is active and to voltage-dependent ca channel subunit α 2The avidity of δ, and the activeconstituents of useful as drug composition are used for the treatment of and/or prevent irritation, the disease that relates to central nervous system and other disease.
The example of pain comprises: acute pain, chronic pain, the pain that causes by soft tissue injury or peripheral damage, postherpetic neuralgia, occipital neuralgia, trigeminal neuralgia, myelomere neurodynia or intercostal neuralgia, central pain, neuropathic pain, migraine, the pain relevant with osteoarthritis or rheumatic arthritis, with contusion, sprain or pain that wound is relevant, spondylalgia, injure the pain that causes by spinal cord or brain stem, back pain, sciatica, toothache, myofasical pain syndrome, episiotomy pain, gouty pain, the pain that causes by burn, heart pain, myalgia, ocular pain, inflammatory pain, actinal surface pain, abdominal pain, the pain relevant with dysmenorrhoea, labor pains or endometriosis, somatalgia, with nerve or the relevant pain of nerve root injury, the pain relevant with amputation, trigeminal neuralgia, neuroma or vasculitis, the pain (or diabetic peripheral neuralgia) that causes by diabetic neuropathy, the pain that causes by chemotherapy inductive DPN, the atypia prosoponeuralgia, lower back neurodynia, trigeminal neuralgia, occipital neuralgia, myelomere neurodynia or intercostal neuralgia, the neurodynia relevant with HIV, the neurodynia relevant with AIDS, hyperpathia, burn pain, sudden pain, the pain that causes by chemotherapy, occipital neuralgia, psychogenic pain, the pain relevant with cholelith, neurodynia relevant or non-neurodynia with cancer, phantom limb pain, functional abdominal pain, headache, acute or chronic tension headache, sinus headache, cluster headache, temporomandibular arthralgia, maxillary sinus pain, the pain that causes by stiff property arthritis vertebralis, postoperative pain, scar pain, chronic non-neurodynia, pain owing to hyperlipemia, fiber flesh pain and fibromyalgia.
The disease that relates to central nervous system comprises the outbreak of fainting, epilepsy (part epilepsy specifically, adult's partial seizure and epileptic's partial seizure), suffocate, the whole body anoxic, anoxia, the spinal cord injury, traumatic brain injury, head injury, cerebral ischemia, epileptic seizures, cerebro-vascular diseases, VS, nervosa is fainted, the supersensitivity carotid sinus, neural blood vessel syndrome, arrhythmia, mental state disorder (for example depressed), intractable depression, seasonal emotion disorder, child depression, premenstrual syndrome, through preceding emotionally disturbed, hectic fever, bipolar disorder, manic depressive illness, behavior disorder, the fissility behavior disorder, the health obstacle that stress be correlated with, anxiety disorder, borderline personality disorder, schizophrenia, dissociation of sensibility disease, paranoea, temporary psychosis, total type psychosis, the psychosis that material brings out, the anxiety relevant with psychosis, the disorder of psychotic disease mental state, the mood disorder relevant with schizophrenia, the behavior disorder relevant with backwardness, insomnia (primary insomnia for example, Secondary cases insomnia and of short duration insomnia), noctambulism, sleep deprivation, the REM somnopathy, sleep apnea, hypersomnia, parasomnia, Sleep-Wake cycle obstacle, time difference disease, narcolepsy and generalized anxiety disorder.
The example of other disease comprises: the chronic obstructive tracheopathy, bronchopneumonia, chronic bronchitis, cystic fibrosis, adult respiratory distress syndrome, bronchospasm, cough, Whooping cough, transformation reactions, contact dermatitis, allergic dermatitis, rubella, pruritus, the pruritus relevant with hemodialysis, inflammatory bowel, psoriatic, osteoarthritis, cartilage injury, rheumatic arthritis, psoriasis arthropathica, asthma, sunburn, hypersensitivity, Parkinson's disease, Huntington's disease, Alzheimer, delirium, dull-witted, amnesia, autism, hyperkinetic syndrome, the Reiter Cotard, the Down Cotard, the Sjogren Cotard, hypertension, hemoposieis (hematopoiesis), operation back neuroma, benign prostatauxe, periodontopathy, hemorrhoid, anal fissure, infertile, sympathetic dystrophy, hepatitis, vasorelaxation, fibrotic disease, collagenosis, stenocardia, migraine, the RaynaudShi disease, dry eye syndrome, conjunctivitis, vernal conjunctivitis, proliferative vitreoretinopathy, multiple sclerosis, amyotrophic lateral sclerosis, the ubiquity dysplasia, the human immunodeficiency virus infection, the HIV encephalopathic, dissociative disorder, the feed imbalance, ulcerative colitis, gram labor engler disease, irritable bowel syndrome, chronic pancreatitis, chronic fatigue syndrome, sudden infant death syndrome, overactive bladder, chronic cystitis, the urocystitis of chemotherapy induction, main dyskinesia, motion can not, dyskinesia, knot, the Tourette Cotard, Scott syndrome, paralysis, the outer motion obstacle of pyramidal tract, restless leg syndrome, mazalgia syndrome, motion sickness, lupus erythematosus, immune deficiency, the inflammatory gastrointestinal disorders, gastritis, rectitis, gastroduodenal ulcer, stomach ulcer, maldigestion, vomiting, breast cancer, cancer of the stomach, gastric lymphoma, Ganglioneuroblastoma and small cell carcinoma.
Comprise by general formula (I), (Ia), (Ib) or (II) pharmaceutical composition of the compound of representative or its pharmacy acceptable salt giving Mammals (for example people, horse, ox or pig; preferred people) time, gives by oral or parenteral approach systematicness or locality.
Pharmaceutical composition of the present invention can be with suitable form according to the preparation method preparation of medication by several formulations commonly used.
The form that is used for pharmaceutical composition for oral administration comprises tablet, pill, powder agent, granula, capsule, solution, suspensoid, emulsion, syrup and elixir.The pharmaceutical composition of this class form is selected following additive preparation commonly used as required aptly according to standard method: vehicle, wedding agent, disintegrating agent, lubricant, swelling agent, help swelling agent, Drug coating, softening agent, stablizer, antiseptic-germicide, antioxidant, tinting material, solubilizing agent, suspension agent, emulsifying agent, sweeting agent, sanitas, buffer reagent, thinner, wetting agent etc.
The form that is used for the pharmaceutical composition of parenteral admin comprises injection, salve, gelifying agent, emulsion, plaster, paster agent, aerosol, inhalation, sprays, eye drops, nasal drop, suppository and inhalation.The pharmaceutical composition of this class form is selected following additive preparation commonly used as required aptly according to standard method: stablizer, antiseptic-germicide, solubilizing agent, wetting agent, sanitas, antioxidant, seasonings, gelifying agent, neutralizing agent, solubilizing agent, buffer reagent, osmotic pressure agent, tensio-active agent, tinting material, buffer reagent, thickening material, wetting agent, weighting agent, absorption enhancer, suspension agent, wedding agent etc.
By general formula (I), (Ia) or the compound of (Ib) representing or the dosage difference of its pharmacy acceptable salt, depend on symptom, age, body weight etc., oral administration is every dose of 1-2000mg, preferred every dose of 10-600mg (being described compound amount), (the body weight: of being grown up in one day about 60Kg) once to several times, for parenteral admin is every dose of 0.1-1000mg, and preferred every dose of 1-300mg (being described compound amount) was grown up once to several times in one day.
Embodiment
(embodiment 1) (±)-[(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 1)
(1-a) (2E)-heptan-2, the 6-diolefinic acid
With the 4-pentenals (4.45g, 51.4mmol) and propanedioic acid (6.41g 61.6mmol) is dissolved in the pyridine (9.9mL).Add piperidines (1.9mL) to described solution, stirred the mixture 5 hours in 90 ℃ then.Make the mixture cooling, make mixture become acidity by adding 2N hydrochloric acid then, extract with diethyl ether afterwards.Organic layer washs with saturated brine, and through anhydrous magnesium sulfate drying, then the concentrating under reduced pressure permeate.The underpressure distillation resistates is the target compound (3mmHg, 110-116 ℃, 3.27g, 50%) of colorless oil with the acquisition.
(1-b) (±)-(1S, 5R) dicyclo [3.2.0] heptan-3-alkene-6-pitches tert.-butyl acetate
Oxalyl chloride (10mL) is dropped to (2E)-heptan-2,6-diolefinic acid (3.27g, toluene solution 25.9mmol) (60mL) down ice-cooled.Stirred the mixture 20 minutes, and, and be heated to room temperature gradually then by taking out in the ice-water bath.After stirring 50 minutes, be heated under the backflow stirring reaction solution 1 hour.Make the solution cooling, solvent is fallen in underpressure distillation then.Add toluene again to resistates, under reduced pressure solvent is fallen in redistillation then.Resistates is dissolved in the toluene (20mL), in 1 hour, this drips of solution is added to triethylamine (9.19g, toluene solution 91mmol) (20mL) that is heated to 90 ℃ in advance.After finishing dropping, under agitation the reheat mixture is 2 hours.Cooled reaction solution filters then with saturated brine and water dilution, and by celite (Celite).Filtered solution is separated into organic layer and water layer.Use 1N salt acid elution organic layer then,, and filter then through dried over mgso.This filtered solution is added in advance by dimethoxy phosphoryl tert.-butyl acetate (5.98g; 25.9mmol) and sodium hydride (＞65% oiliness; 986.7mg, the reaction soln of glycol dimethyl ether solution (20mL) preparation 25.9mmol), and stirred the mixture 1.5 hours.Add saturated aqueous solution, saturated brine and the water of ammonium chloride to reaction soln according to order, and reaction soln is extracted with ethyl acetate.Organic layer filters then through anhydrous magnesium sulfate drying.Under reduced pressure distilling solvent, by the silica gel chromatography resistates, is the target compound (1.73g, 32%, E/Z mixture) of light yellow oil with the acquisition.
(1-c) (±)-[(1S, 5R, 6R)-and 6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-(1S, 5R) dicyclo [3.2.0] heptan-3-alkene-(1.73g 8.39mmol) is dissolved in the Nitromethane 99Min. (10mL) 6-fork tert.-butyl acetate.Add 1 to this solution, and 8-diazabicyclo [5.4.0] 11-7-alkene (1.3mL, 8.4mmol), in stirring at room mixture 1 hour, then under agitation in 50-60 ℃ of heating 5 hours.Make the mixture cooling, with 1N hydrochloric acid and saturated brine dilution, use ethyl acetate extraction afterwards then.Then, organic layer is through anhydrous magnesium sulfate drying, and solvent is fallen in underpressure distillation.Resistates is the target compound (1.98g, 89%) of colorless oil by silica gel chromatography with the acquisition.
(1-d) (±)-[(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-[(1S, 5R, 6R)-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-guanidine-acetic acid tert-butyl ester] (1.98g 7.41mmol) is dissolved in ethanol (20mL) and the water (10mL).To this solution add iron powder (2.07g, 37.0mmol) and ammonium chloride (392.7mg 7.41mmol), stirred the mixture under the backflow 4.5 hours being heated to.Make the mixture cooling, dilute with the saturated aqueous solution and the ethyl acetate of saturated brine, sodium bicarbonate then, and filter, to remove insoluble substance by Yin Shi salt.Filtered solution is separated into organic layer and water layer.Wash organic layer with saturated brine, then through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (1.99g, this compound need not purifying and is directly used in next reaction) of light yellow solid shape with the acquisition.
(1-e) (±)-[(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With 4N hydrochloric acid-ethyl acetate solution (10mL) add to (±)-[(1S, 5R, 6R)-6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (0.99g, 4.17mmol), and in stirring at room mixture 1 hour.Then, solvent is fallen in underpressure distillation.By adding methylene dichloride suspension resistates.In suspension, drip triethylamine then, and by filter to collect produced powder.The institute's powder that obtains washed with dichloromethane, drying under reduced pressure is the target compound (211.6mg, 35%) of white powder with the acquisition then.
(embodiment 2) [(1R, 5S, 6S)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 1, optical activity form)
Figure GPA00001143598100381
(2-a) (±)-[(1S, 5R, 6R)-and 6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] fractionation of tert.-butyl acetate
Use is by Daicel Chemical Industries, Ltd. the Chiralpak AD-H (normal hexane: EtOH=95: 5 of Sheng Chaning, 1.0mL/ minute, 40 ℃) fractionation (±)-[(1S, 5R, 6R)-and 6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (154g 576mmol), obtains 65.5g peak 1 (retention time: 5.1 minutes) and 64.8g peak 2 (retention time: 6.5 minutes) respectively to tert.-butyl acetate.
(2-b) [(1R, 5S, 6S)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Will [(1R, 5S, 6S)-and 6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (peak 2,20.7g 77.4mmol) are dissolved in ethanol (200mL) and the water (100mL) tert.-butyl acetate.To solution add iron powder (34.69g, 619.5mmol) and ammonium chloride (2.09g 38.72mmol), stirred the mixture under the backflow 6.5 hours being heated to.Make the mixture cooling, filter then with saturated brine, saturated sodium bicarbonate aqueous solution and ethyl acetate dilution, and by Yin Shi salt, to remove insoluble substance.Filtered solution is separated into organic layer and water layer.Organic layer washs with saturated brine, then through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, with the ratio that obtains target compound and initial substance almost 1: 1 mixture (20.18g, by 1H-NMR estimates).This mixture is dissolved in ethanol (200mL) and the water (100mL) again.To this solution add iron powder (40.36g, 720.7mmol) and ammonium chloride (4.18g 78.1mmol), stirred the mixture under the backflow 9 hours being heated to, with the time-division add again for three times iron powder (32.73g, 584.5mmol).Make the mixture cooling, filter then with saturated brine, saturated sodium bicarbonate aqueous solution and ethyl acetate dilution, and by Yin Shi salt, to remove insoluble substance.Filtered solution is separated into organic layer and water layer.Organic layer washs with saturated brine, then through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (17.53g, 95%) of light yellow oil with the acquisition.
(2-c) (-)-[(1R, 5S, 6S)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
4N hydrochloric acid-ethyl acetate solution (200mL) is added to [(1R, 5S, 6S)-6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (17.53g, 7.4mmol), in stirring at room mixture 1.5 hours.Then, solvent is fallen in underpressure distillation.Resistates is suspended in the methylene dichloride.Drip triethylamine to suspension, the powder that is produced is collected by filtering, and uses washed with dichloromethane then, and is dry then, to obtain white powder A (6.85g).Fall solvent by the filtered solution underpressure distillation.Add 4N hydrochloric acid-ethyl acetate solution (200mL) again to resistates then, in stirring at room mixture 2 hours.Solvent is fallen in underpressure distillation, and resistates is suspended in the methylene dichloride.Drip triethylamine to resistates, the powder that is produced is collected by filtering, and uses washed with dichloromethane then, and is dry then, to obtain white powder B (2.48g).This white powder B is mixed with the white powder A of above acquisition, and, be the target compound (7.39g, 55%) of white powder with the acquisition with ethanol and ethyl acetate washing.
(embodiment 3) [(1R, 5S, 6S)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 1, optical activity form are production method with the difference of the compound of embodiment 2)
Figure GPA00001143598100401
(3-a) [(1R, 5S, 6S)-and 6-(tert-butoxycarbonyl amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Will [(1R, 5S, 6S)-and 6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (peak 2,30g 0.11mol) are dissolved in ethanol (300mL) and the water (100mL) tert.-butyl acetate.To this solution add iron powder (18.8g, 0.34mol) and ammonium chloride (3.6g 67.3mmol), stirred the mixture 4 hours in 80 ℃ of oil baths.Because kept the nitro form of initial substance, (18.8g 0.34mmol), stirs the mixture in 80 ℃ of oil baths so add iron powder to it.After 3 hours, (18.8g, 0.34mmmol), the restir mixture is 4 hours in 80 ℃ of oil baths, the placement of spending the night then to add iron powder to it.(18.8g 0.34mmol), stirred the mixture 2 hours in 80 ℃ of oil baths to add iron powder to it.Although (18.8g, 0.34mmol), mixture becomes and is difficult to stir to add iron powder to it again.Therefore, termination reaction.Make the mixture cooling, filter then, to remove insoluble substance.Add (Boc) to filtered solution 2O (36.7g, 0.17mol) and triethylamine (46.9mL, 0.34mol), in stirring at room mixture 2 hours.Organic solvent is fallen in underpressure distillation, afterwards with extracting in the water layer of ethyl acetate by remainder.Organic layer washs with aqueous citric acid solution, water, saturated sodium bicarbonate aqueous solution and saturated brine, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation.By the silica gel chromatography resistates, be the target compound (30.8g) of colorless oil with the acquisition.
(3-b) (-)-[(1R, 5S, 6S)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
(500mL) adds to [(1R with 4N hydrochloric acid-ethyl acetate solution, 5S, 6S)-and 6-(tert-butoxycarbonyl amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (76.9g, ethyl acetate 0.23mol) (150mL) solution was in stirring at room mixture 5 hours for tert.-butyl acetate.Then, collect sedimentary powder by filtering, and dry.Because the part tert-butyl ester is not eliminated, so the powder that obtains is resuspended in 4N hydrochloric acid-ethyl acetate solution (300mL), suspension is in stirring at room 4 hours, the placement of spending the night then.Collect sedimentary powder by filtering, and dry, be the hydrochloride (43.2g) of the target compound of white powder with the acquisition.(27.7mL 0.198mol), stirred the mixture 2 hours, spent the night then and left standstill to methylene dichloride (800mL) the suspension dropping triethylamine of obtaining hydrochloride in room temperature.Collect the powder that is produced by filtering again, and, be the target compound (25.6g) of white powder with the acquisition with methyl alcohol-ethyl acetate mixed solvent washing.
(embodiment 4) [(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 1, optical activity form are configuration with the difference of the compound of embodiment 2)
Figure GPA00001143598100411
(4-a) [(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Will [(1S, 5R, 6R)-and 6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (peak 1,21.6g 80.8mmol) are dissolved in ethanol (200mL) and the water (100mL) tert.-butyl acetate.To this solution add iron powder (45.1g, 80.8mmol) and ammonium chloride (2.59g 48.5mmol), is heated under the backflow and stirred the mixture 5.5 hours.And then (9.0g 161mmol), had been heated under the backflow this mixture of restir 2 hours to add iron powder to this reaction soln.Make the mixture cooling, then with saturated sodium bicarbonate aqueous solution and ethyl acetate dilution, and filter, to remove insoluble substance.Fall organic solvent by underpressure distillation in the filtered solution, afterwards with ethyl acetate by extracting in the water layer.Wash organic layer with saturated brine, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (5.5g) of light yellow oil by the nh 2 column chromatogram purification with the acquisition.
(4-b) [(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
4N hydrochloric acid-ethyl acetate solution (200mL) is added to [(1S, 5R, 6R)-6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (17.4g, 73.3mmol), in stirring at room mixture 4 hours.Then, collecting sedimentary powder by filtering, is the hydrochloride (15.6g) of the target compound of white powder with the acquisition.(10.2mL 72.8mol), stirred the mixture 2 hours to methylene dichloride (300mL) the suspension dropping triethylamine of obtaining hydrochloride in room temperature.Then, collect the powder that is produced by filtering again.With ethanol-ethyl acetate mixed solvent washing powder that obtains, be the target compound (8.43g) of white powder with the acquisition.
(embodiment 5) [(1R, 5S, 6S)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetic acid hydrochloride (exemplary compounds 1, the hydrochloride of the compound of embodiment 2)
Figure GPA00001143598100421
(5-a) [(1R, 5S, 6S)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetic acid hydrochloride
With water (5mL) and 4N hydrochloric acid-1,4-dioxane solution (22mL) add to (1R, 5S, 6S)-6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (320.2mg, 1.77mmol), with mixture in stirring at room 5 minutes.Solvent is fallen in underpressure distillation.Add 1 to resistates, the 4-diox, heated mixt makes mixture be cooled to room temperature then.The powder that is produced is collected by filtering.Institute's powder that obtains is with 1, and the 4-diox washs, and is dry then, is the target compound (350.0mg, 92%) of white powder with the acquisition.
(embodiment 6) [(1R, 5S, 6S)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate benzene sulfonate (exemplary compounds 1, the benzene sulfonate of the compound of embodiment 2)
Figure GPA00001143598100431
Will (1R, 5S, 6S)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (152.2g 391mmol) is dissolved in 2-propyl alcohol (7.5mL) and the water (2.6mL) acetate.Then to this solution add Phenylsulfonic acid monohydrate (305.2mg, 1.73mmol), in this mixture of stirring at room 5 minutes.Solvent is fallen in underpressure distillation, afterwards again with 2-propyl alcohol azeotropic dehydration.Then, with 2-propyl alcohol debris, be the target compound (260.4mg, 55%) of white powder with the acquisition.
(embodiment 7) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 4)
(7-a) 4-methyl-3-hydroxyl heptan-6-olefin(e) acid methyl esters
((5.10g, tetrahydrofuran solution 39.2mmol) (50mL) stirred the mixture under this state 10 minutes 43.1mmol) to add to 3-oxopentanoic acid methyl esters for＞63% oiliness, 1.64g with sodium hydride under ice-cooled.To reaction soln drip n-Butyl Lithium (the 1.66M hexane solution, 25.9mL, 43.1mmol), in ice-cooled restir mixture down 10 minutes.Then, (5.18g 43.1mmol), stirred the mixture under this state 30 minutes, then in room temperature stirred overnight again to add allyl bromide 98 to it.Add 1N hydrochloric acid and saturated brine to reaction soln, extract with diethyl ether afterwards.Organic layer washs with saturated brine, and through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation.Obtaining resistates is dissolved in the methyl alcohol (100mL).(1.89g 50mmol), stirred the mixture under this state 1.5 hours to this solution adding sodium borohydride under ice-cold.Add 2N hydrochloric acid (50mL) to it, stirred the mixture 30 minutes.Then, add saturated brine, use ethyl acetate extraction afterwards to it.Organic layer washs with saturated brine, and then through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation.Resistates is the target compound (5.72g, 85%, the mixture of diastereomer) of light yellow oil by silica gel chromatography with the acquisition.
(7-b) 4-methyl-3-hydroxyl heptan-6-olefin(e) acid
With 4-methyl-3-hydroxyl heptan-(5.72g 33.2mmol) is dissolved in 2N potassium hydroxide-methanol solution (50mL), in the ambient temperature overnight stirred solution 6-olefin(e) acid methyl esters.The solvent in the reaction soln is fallen in underpressure distillation.Add the 1N aqueous sodium hydroxide solution to resistates then, extract with diethyl ether afterwards.Make water layer become acidity by adding concentrated hydrochloric acid down ice-cooled, extract with diethyl ether more afterwards.Wash organic layer with saturated brine, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (2.21g, 42%, the mixture of diastereomer) of yellow oil with the acquisition.
(7-c) (±)-(1S, 5R)-3-methyl bicycle [3.2.0] heptan-3-alkene-6-pitches tert.-butyl acetate
With 4-methyl-3-hydroxyl heptan-(2.21g 13.9mmol) is dissolved in the diacetyl oxide (14mL) the 6-olefin(e) acid.To this solution add potassium acetate (3.29g, 33.4mmol), in stirring at room mixture 2 hours.Reaction soln is heated to 110-120 ℃, and stirred 3.5 hours.Add frozen water and toluene to reaction soln then, and in this mixture of stirring at room 1 hour.Is water layer and organic layer by adding saturated brine and toluene with mixture separation.Then, wash organic layer in proper order by this with 1N aqueous sodium hydroxide solution and saturated brine, then through anhydrous magnesium sulfate drying, subsequent filtration.This filtered solution added under ice-cooled by with sodium hydride (＞63% oiliness; 533.3mg; 14.0mmol) add to dimethoxy phosphoryl tert.-butyl acetate (3.24g, the reaction soln of tetrahydrofuran solution 14.5mmol) (20mL) preparation, restir mixture 1.5 hours.By saturated aqueous solution and the saturated brine that adds ammonium chloride reaction soln is separated into water layer and organic layer.With ethyl acetate water layer is extracted.Mix these organic layers, then with saturated brine washing, with after anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (1.21g, 40%, E/Z mixture) of light yellow oil by silica gel chromatography with the acquisition.
(7-d) (±)-[(1S, 5R, 6R)-and 3-methyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-(1S, 5R)-3-methyl bicycle [3.2.0] heptan-3-alkene-(1.21g 5.50mmol) is dissolved in the Nitromethane 99Min. (7mL) 6-fork tert.-butyl acetate.Add 1 to this solution, and 8-diazabicyclo [5.4.0] 11 carbon-7-alkene (0.91mL, 6.0mmol), under agitation in 50-60 ℃ of heated mixt 6 hours.Make the mixture cooling, to its saturated aqueous solution that adds potassium primary phosphate, use ethyl acetate extraction afterwards then.Then, organic layer is through anhydrous magnesium sulfate drying, and solvent is fallen in underpressure distillation.Resistates is the target compound (1.14g, 74%) of colorless oil by silica gel chromatography with the acquisition.
(7-e) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-[(1S, 5R, 6R)-3-methyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (1.12g 3.99mmol) is dissolved in ethanol (20mL) and the water (10mL) tert.-butyl acetate.To this solution add iron powder (892.8mg, 15.9mmol) and ammonium chloride (211.5mg 3.99mmol), stirred the mixture under the backflow 4 hours being heated to.Make the mixture cooling, filter then with saturated brine, saturated sodium bicarbonate aqueous solution and ethyl acetate dilution, and by Yin Shi salt, to remove insoluble substance.Filtered solution is separated into organic layer and water layer.Organic layer washs with saturated brine, and then through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation then.Add 4N hydrochloric acid-ethyl acetate solution (5mL) to resistates, in stirring at room mixture 1 hour.Then, solvent is fallen in underpressure distillation.Resistates is suspended in the methylene dichloride.Drip triethylamine to suspension, collect the powder that is produced, use washed with dichloromethane then by filtering, dry then, be the target compound (105.8mg, 28%) of white powder with the acquisition.
(embodiment 8) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 8)
(8-a) 4-ethyl-3-hydroxyl heptan-6-olefin(e) acid ethyl ester
Down (＞63% oiliness, 2.09g 55mmol) add to 3-oxo ethyl hexanoate (7.91g, tetrahydrofuran solution 50mmol) (50mL), and stirring the mixture 10 minutes under this state with sodium hydride ice-cooled.To reaction soln drip n-Butyl Lithium (the 1.58M hexane solution, 34.8mL, 55mmol), in ice-cooled restir mixture down 10 minutes.Then, (4.7mL 55mmol), stirred the mixture under this state 1 hour, then in room temperature restir 4 hours to add allyl bromide 98 to it.Add 1N hydrochloric acid and ammonium chloride saturated aqueous solution to reaction soln, extract with Skellysolve A afterwards.Organic layer washs with saturated brine, and through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation.Obtaining resistates is dissolved in the ethanol (80mL).(1.51g 40mmol), stirred the mixture under this state 2 hours to this solution adding sodium borohydride under ice-cooled.Add 1N hydrochloric acid (50mL) to it, stirred the mixture 30 minutes.Then, add saturated brine, use ethyl acetate extraction afterwards to it.Organic layer washs with saturated brine, and then through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation.Resistates is the target compound (3.64g, 37%, the mixture of diastereomer) of light yellow oil by silica gel chromatography with the acquisition.
(8-b) 4-ethyl-3-hydroxyl heptan-6-olefin(e) acid
With 4-ethyl-3-hydroxyl heptan-(3.64g 18.2mmol) is dissolved in 2N potassium hydroxide-methanol solution (120mL), in the ambient temperature overnight stirred solution 6-olefin(e) acid ethyl ester.Fall solvent by underpressure distillation in the reaction soln.Add 1N aqueous sodium hydroxide solution (200mL) to resistates then, extract with diethyl ether afterwards.Make water layer become acidity by adding concentrated hydrochloric acid down ice-cooled, extract with diethyl ether more afterwards.Organic layer washs with saturated brine, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (3.14g,＜100%, the mixture of diastereomer) of light yellow oil with the acquisition.
(8-c) (±)-(1S, 5R)-3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-pitches tert.-butyl acetate
With 4-ethyl-3-hydroxyl heptan-(3.13g 18.2mmol) is dissolved in the diacetyl oxide (15mL) the 6-olefin(e) acid.To this solution add potassium acetate (4.27g, 43.6mmol), and in stirring at room mixture 100 minutes.Reaction soln is heated to backflow, and stirred 3.5 hours.Add frozen water and toluene to reaction soln then, stir this mixture in ambient temperature overnight.Is water layer and organic layer by adding saturated brine (50mL) and toluene (20mL) with mixture separation.Then, wash organic layer in proper order by this,, filter then then through anhydrous magnesium sulfate drying with 1N aqueous sodium hydroxide solution and saturated brine.Under ice-cooled, this filtered solution is added to reaction soln; described reaction soln is by (＞65% oiliness, 761.9mg 20mmol) add to dimethoxy phosphoryl tert.-butyl acetate (4.48g with sodium hydride; tetrahydrofuran solution 20mmol) (50mL) preparation, restir mixture 1 hour.By adding ammonium chloride saturated aqueous solution and saturated brine reaction soln is separated into water layer and organic layer.With ethyl acetate water layer is extracted.Merge these organic layers, then with the saturated brine washing, then through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (1.32g, 31%, E/Z mixture) of light yellow oil by silica gel chromatography with the acquisition.
(8-d) ((±)-[(1S, 5R, 6R)-and 3-ethyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-[(1S, 5R)-3-ethyl dicyclo [3.2.0] heptan-3-alkene-(1.32g 5.63mmol) is dissolved in the Nitromethane 99Min. (7mL) 6-fork tert.-butyl acetate.Add 1 to this solution, (1.2mL 7.3mmol), under agitation heats mixture 7 hours in 50-60 ℃ 8-diazabicyclo [5.4.0] 11 carbon-7-alkene.Make the mixture cooling, to its saturated aqueous solution that adds potassium primary phosphate, use ethyl acetate extraction afterwards then.Then, organic layer is through anhydrous magnesium sulfate drying, and solvent is fallen in underpressure distillation.Resistates is the target compound (1.39g, 84%) of colorless oil by silica gel chromatography with the acquisition.
(8-e) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With (±)-[(1S, 5R, 6R)-3-ethyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (1.09g 4.71mmol) is dissolved in ethanol (10mL) and the water (5mL) tert.-butyl acetate.To this solution add iron powder (1.32g, 23.5mmol) and ammonium chloride (249.6mg 4.71mmol), stirred the mixture under the backflow 2 hours being heated to.Make the mixture cooling, filter then with saturated brine, saturated sodium bicarbonate aqueous solution and ethyl acetate dilution, and by Yin Shi salt, to remove insoluble substance.Filtered solution is separated into organic layer and water layer.Organic layer washs with saturated brine, and then through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation then.Add 4N hydrochloric acid-ethyl acetate solution (20mL) to resistates, in stirring at room mixture 1 hour.Then, solvent is fallen in underpressure distillation.Resistates is suspended in the methylene dichloride.Drip triethylamine to suspension, collect the powder that is produced, use washed with dichloromethane then by filtering, dry then, be the target compound (425.1mg, 43%) of white powder with the acquisition.
(embodiment 9) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-propyl group dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 9)
(9-a) 4-propyl group-3-hydroxyl heptan-6-olefin(e) acid methyl esters
((7.91g, tetrahydrofuran solution 50mmol) (50mL) stirred the mixture under this state 25 minutes 55mmol) to add to 3-oxo Methylheptanoate for＞63% oil, 2.09g with sodium hydride under ice-cooled.To reaction soln drip n-Butyl Lithium (the 1.58M hexane solution, 34.8mL, 55mmol), in ice-cooled restir mixture down 1 hour.Then, (4.7mL 55mmol), stirred the mixture under this state 1 hour, and then stirs in ambient temperature overnight to add allyl bromide 98 to it.Add 1N hydrochloric acid and ammonium chloride saturated aqueous solution to reaction soln, use ethyl acetate extraction afterwards.Organic layer washs with saturated brine, and through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation.Obtaining resistates is dissolved in the methyl alcohol (35mL).(0.61g 16.1mmol), stirred the mixture under this state 1 hour to this solution adding sodium borohydride under ice-cooled.Add 1N hydrochloric acid (50mL) to it, stirred the mixture 30 minutes.Then, add saturated brine, use ethyl acetate extraction afterwards to it.Wash organic layer with saturated brine, then through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation.Resistates is the target compound (3.24g, 33%, the mixture of diastereomer) of light yellow oil by silica gel chromatography with the acquisition.
(9-b) 4-propyl group-3-hydroxyl heptan-6-olefin(e) acid
With 4-propyl group-3-hydroxyl heptan-(3.24g 16.2mmol) is dissolved in 2N potassium hydroxide-methanol solution (16mL), in the ambient temperature overnight stirred solution 6-olefin(e) acid methyl esters.Fall solvent by underpressure distillation in the reaction soln.Add 1N aqueous sodium hydroxide solution (150mL) to resistates then, extract with diethyl ether afterwards.Make water layer become acidity by adding concentrated hydrochloric acid down ice-cooled, extract with diethyl ether more afterwards.Organic layer washs with saturated brine, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (2.79g, 92%, the mixture of diastereomer) of light yellow oil with the acquisition.
(9-c) (±)-(1S, 5R)-3-propyl group-dicyclo [3.2.0] heptan-3-alkene-6-pitches tert.-butyl acetate
With 4-propyl group-3-hydroxyl heptan-(2.79g 15.0mmol) is dissolved in the diacetyl oxide (13mL) the 6-olefin(e) acid.To this solution add potassium acetate (3.52g, 36.0mmol), in stirring at room mixture 2 hours.Reaction soln is heated to 120 ℃, and stirred 3 hours.Add frozen water and Skellysolve A to reaction soln then, stir this mixture in ambient temperature overnight.Adding saturated brine to it, is water layer and organic layer by adding Skellysolve A with mixture separation.Then, organic layer washs by this in proper order with 1N aqueous sodium hydroxide solution and saturated brine, and through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation then.Resistates is dissolved in the tetrahydrofuran (THF) (50mL).Under ice-cooled, this solution is added to previously prepared reaction soln; described reaction soln passes through sodium hydride (＞65% oiliness; 761.9mg; 20mmol) add dimethoxy phosphoryl tert.-butyl acetate (4.48g; tetrahydrofuran solution 20mmol) (50mL) preparation, restir mixture 1 hour.By adding ammonium chloride saturated aqueous solution and saturated brine reaction soln is separated into water layer and organic layer.With ethyl acetate water layer is extracted.Merge these organic layers, then with the saturated brine washing, then through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (1.81g, 49%, E/Z mixture) of light yellow oil by silica gel chromatography with the acquisition.
(9-d) (±)-[(1S, 5R, 6R)-and 3-propyl group-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-(1S, 5R)-3-propyl group-dicyclo [3.2.0] heptan-3-alkene-(1.81g 7.29mmol) is dissolved in the Nitromethane 99Min. (7mL) 6-fork tert.-butyl acetate.Add 1 to this solution, and 8-diazabicyclo [5.4.0] 11 carbon-7-alkene (1.5mL, 10.2mmol), under agitation in 50-60 ℃ of heated mixt 8 hours.Make the mixture cooling, to its saturated aqueous solution that adds potassium primary phosphate, use ethyl acetate extraction afterwards then.Then, organic layer is through anhydrous magnesium sulfate drying, and solvent is fallen in underpressure distillation.Resistates is the target compound (2.22g, 95%) of colorless oil by silica gel chromatography with the acquisition.
(9-e) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-propyl group dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With (±)-[(1S, 5R, 6R)-3-propyl group-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (1.09g 4.71mmol) is dissolved in ethanol (10mL) and the water (5mL) tert.-butyl acetate.To this solution add iron powder (1.32g, 23.5mmol) and ammonium chloride (249.6mg 4.71mmol), stirred the mixture under the backflow 2 hours being heated to.Make the mixture cooling, filter then with saturated brine, saturated sodium bicarbonate aqueous solution and ethyl acetate dilution, and by Yin Shi salt, to remove insoluble substance.Filtered solution is separated into organic layer and water layer.Organic layer washs with saturated brine, and then through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation then.Add 4N hydrochloric acid-ethyl acetate solution (20mL) to resistates, in stirring at room mixture 1 hour.Then, solvent is fallen in underpressure distillation.Resistates is suspended in the methylene dichloride.Drip triethylamine to suspension, collect the powder that is produced, use washed with dichloromethane then by filtering, dry then, be the target compound (425.1mg, 43%) of white powder with the acquisition.
(embodiment 10) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-butyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 10)
(10-a) 4-allyl group-3-Hydroxyoctanoic acid methyl esters
With 2-allyl group hexanal (J.Org.Chem.46,1980,5250) (5g, 33.7mmol), methyl bromoacetate (3.7mL, 40mmol) and zinc (2.6g 40mmol) adds to tetrahydrofuran (THF) (30mL) and trimethyl borate (15mL), vigorous stirring mixture.Then, reaction vessel is placed oil bath, and be heated to 70 ℃, stirred the mixture 2 hours.Make the mixture cooling, add glycerine (20mL) and ammonium chloride saturated aqueous solution (100mL) to it then, use ethyl acetate extraction afterwards.Organic layer water and saturated brine washing, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (non-enantiomer mixture) (6.8g, 94%) of colorless oil by silica gel chromatography with the acquisition.
(10-b) 4-allyl group-3-Hydroxyoctanoic acid
(6.8g 31.7mmol) is dissolved in 2N potassium hydroxide-methanol solution (20mL), and spends the night in stirring at room solution with 4-allyl group-3-Hydroxyoctanoic acid methyl esters.Concentrated reaction solution, dilute with water then, and wash with ether.Use hydrochloric acid to make the aqueous solution become acidity, use ethyl acetate extraction afterwards.Organic layer water and saturated brine washing, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, with the acquisition be oily matter target compound (6.0g, 30mmol).This compound need not purifying and promptly is used for next reaction.
(10-c) (±)-[(1S, 5R)-3-butyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
4-allyl group-3-Hydroxyoctanoic acid (6.0g, 30mmol), potassium acetate (9.4g, 96mmol) and the mixing solutions of diacetyl oxide (30mL) in stirring at room 2 hours, under refluxing, stirred 4 hours then.Reaction soln is placed on ice, and stir and spend the night.With ether this reaction soln is extracted.Ether layer washs with saturated sodium bicarbonate aqueous solution and saturated brine, and through anhydrous magnesium sulfate drying.This ethereal solution is added in advance by the tertiary butyl-p; p-solutions of dimethyl phosphoryl guanidine-acetic acid methyl esters (7.8g, 35mmol) and sodium hydride (＞63% oiliness, 1500mg;＞35mmol) the reaction soln of glycol dimethyl ether solution (30mL) preparation stirred the mixture 1.5 hours.Be sequentially added into ammonium chloride saturated aqueous solution, saturated brine and water to this reaction soln, and reaction soln extracted with ethyl acetate.Organic layer filters then through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (4.3g, 51%, E/Z mixture) of light yellow oil by silica gel chromatography with the acquisition.
(10-d) (±)-[(1S, 5R, 6R)-the 3-butyl-and 6-nitro methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Use (±)-[(1S, 5R)-3-butyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (4.3g, 16.4mmol) with the identical mode of paragraph (1-c) obtain into oily matter title compound (4.8g, 14.8mmol).
(10-e) (±)-[(1S, 5R, 6R)-6-(tert-butoxycarbonyl amino) methyl-and 3-butyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Use (±)-[(1S, 5R, 6R)-the 3-butyl-and 6-nitro methyl bicycle [3.2.0] heptan-3-alkene-6-yl] (4.8g is 14.8mmol) to obtain title compound (3.63g, 63%) into oily matter with the identical mode of paragraph (3-a) for tert.-butyl acetate.
(10-f) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-butyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
Use (±)-[(1S, 5R, 6R)-and 6-(tert-butoxycarbonyl amino) methyl-3-butyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (3.63g is 9.1mmol) to obtain title compound (1.5g, 70%) into white powder with the identical mode of paragraph (3-b) for tert.-butyl acetate.
(embodiment 11) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-sec.-propyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 11)
(11-a) 2-sec.-propyl penta-4-olefine aldehydr
(17.30g, methylene dichloride 136.3mmol) (290mL) solution drip dimethyl sulfoxide (DMSO), and (18.70mL 263.3mmol), stirred the mixture 15 minutes in-78 ℃ then to the oxalyl chloride that is cooled to-78 ℃ in 15 minutes.Subsequently, alkene-(11.30g, methylene dichloride 88.1mmol) (75mL) solution stirred the mixture 1 hour in-78 ℃ 1-alcohol to drip 2-sec.-propyl penta-4-to it in 30 minutes.In 5 minutes to its drip triethylamine (62.40g, 616.7mmol), then in stirring at room mixture 2 hours.With 2N hydrochloric acid (320mL) neutralise mixt.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, to obtain to containing the yellow oily mixture of target compound.This compound uses in next reaction, need not to be further purified.
(11-b) 3-hydroxyl-4-sec.-propyl heptan-6-olefin(e) acid methyl esters
(16.18g 105.8mmol) is prepared into tetrahydrofuran (THF) (25mL) solution for 2-sec.-propyl penta-4-olefine aldehydr that will obtain in paragraph (11-a) and methyl bromoacetate.The sample aliquot of about 1/5 amount is added to zinc powder (6.92g, trimethyl borate 105.8mmol) (25mL) suspension.With mixture heating up to 80 ℃.Then, in 30 minutes, add remaining solution, stirred the mixture 2.5 hours in 80 ℃ then to it.Make the mixture cooling, add glycerine (25mL), ammonium chloride saturated aqueous solution (25mL) and diethyl ether to it then.Institute's organic layer that obtains is through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (12.30g, 70%) of yellow oil by silica gel chromatography with the acquisition.
(11-c) 3-hydroxyl-4-sec.-propyl heptan-6-olefin(e) acid
2N potassium hydroxide-methanol solution (200mL) is added to 3-hydroxyl-4-sec.-propyl heptan-6-olefin(e) acid methyl esters, and (12.30g, methyl alcohol 61.5mmol) (132mL) solution was in stirring at room mixture 13 hours.Solvent is fallen in underpressure distillation.Add entry and diethyl ether to resistates then, use in the 2N hydrochloric acid and water layer.Add diethyl ether to it, organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (11.10g, 97%) of brown oil with the acquisition.
(11-d) (±)-(1S, 5R)-3-sec.-propyl dicyclo [3.2.0] heptan-3-alkene-6-ketone
(14.00g, (11.10g, diacetyl oxide 59.6mmol) (67mL) solution in stirring at room mixture 1 hour, stirred 3.5 hours in 120 ℃ then 142.7mmol) to add to 3-hydroxyl-4-sec.-propyl heptan-6-olefin(e) acid with potassium acetate.Use the frozen water treating mixture, extract with diethyl ether afterwards.Organic layer washs with saturated sodium bicarbonate aqueous solution.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (6.6g, 74%) of yellow oil by silica gel chromatography with the acquisition.
(11-e) (±)-[(1S, 5R)-3-sec.-propyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (E/Z mixture)
In 0 ℃ in 20 minutes to sodium hydride (0.68g, 63%, tetrahydrofuran (THF) 18.0mmol) (15mL) suspension drips the solutions of dimethyl phosphoryl guanidine-acetic acid tert-butyl ester, and (3.70g, tetrahydrofuran (THF) 16.5mmol) (15mL) solution stirred the mixture 20 minutes in 0 ℃.In 0 ℃ in 15 minutes to this solution drip (±)-(1S, 5R)-(2.25g, tetrahydrofuran (THF) 15.0mmol) (15mL) solution was in stirring at room mixture 2 hours for 3-sec.-propyl dicyclo [3.2.0] heptan-3-alkene-6-ketone.Use water treatment, extract with diethyl ether afterwards.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (3.00g, 81%) of yellow oil by silica gel chromatography with the acquisition.
(11-f) (±)-[(1S, 5R, 6R)-6-(nitro methyl)-and 3-sec.-propyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-[(1S, 5R)-3-sec.-propyl dicyclo [3.2.0] heptan-3-alkene-6-fork] (3.00g 12.1mmol) is dissolved in the Nitromethane 99Min. (30mL) tert.-butyl acetate.Add 1 to this solution, (2.20g's 8-diazabicyclo [5.4.0] 11 carbon-7-alkene 14.5mmol), stirred the mixture 5 hours in 60 ℃.Make the mixture cooling, to its saturated aqueous solution that adds potassium primary phosphate, use dichloromethane extraction afterwards then.Organic layer is through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (3.00g, 80%) of yellow oil by the silica gel chromatography purifying with the acquisition.
(11-g) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-sec.-propyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-[(1S, 5R, 6R)-6-(nitro methyl)-3-sec.-propyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (3.00g 9.70mmol) is dissolved in the ethanol (60mL) tert.-butyl acetate.(4.47g, 80.05mmol), (0.54g, the 10.00mmol) aqueous solution (20mL) stirred the mixture under the backflow 4.5 hours being heated to add ammonium chloride then to add iron powder to this solution.Make the mixture cooling, filter by Yin Shi salt then, to remove insoluble substance.Concentrated solution dilutes resistates with ethyl acetate.Diluent washs with saturated sodium bicarbonate aqueous solution, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (2.50g, 92%) of colorless oil by silica gel chromatography with the acquisition.
(11-h) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-sec.-propyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With (±)-[(1S, 5R, 6R)-the 6-amino methyl-3-sec.-propyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (2.50g 9.0mmol) was dissolved in 4N hydrochloric acid-ethyl acetate solution (25mL) tert.-butyl acetate, in this solution of stirring at room 2 hours.Then, solvent is fallen in underpressure distillation.By adding methylene dichloride suspension resistates.Drip triethylamine to suspension then, collect the powder that is produced by filtering.The powder that obtains is used washed with dichloromethane, is the target compound (1.01g, 51%) of white powder with the acquisition.
(embodiment 12) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-isobutyl-dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 13)
(12-a) 2-isobutyl-penta-4-alkene-1-alcohol
(13g 83mmol) is dissolved in the tetrahydrofuran (THF) (80mL), under ice-cooled this drips of solution is added to lithium aluminum hydride (3.4g, tetrahydrofuran (THF) 90mmol) (80mL) mixing solutions with 2-isobutyl--4-pentenoic acid (J.Am.Chem.Soc.115,1993,8669).Stirred the mixture 1 hour in this temperature.Then, add entry (3.4mL), 15% aqueous sodium hydroxide solution (3.4mL) and water (10.2mL), stirred overnight mixture to it in order.After removing insoluble substance, concentrate filtered solution, be the target compound (4.9g, 42%) of oily matter with the acquisition.
(12-b) 2-isobutyl--4-pentenals
(5.45g 43mmol) is dissolved in the methylene dichloride (50mL), and this solution is cooled to-78 ℃ with oxalyl chloride.Then, drip dimethyl sulfoxide (DMSO) (6.1mL) to it.Alkene-(4.9g, methylene dichloride 34mmol) (40mL) solution stirred the mixture 1 hour in this temperature 1-alcohol to drip 2-isobutyl-penta-4-to this mixture subsequently.Add triethylamine (24mL) to it, make mixture return to room temperature.Add ammonium chloride saturated aqueous solution to it.Separate organic layer, water and saturated brine washing, dry then, concentrate then, be the target compound of oily matter with the acquisition.This compound need not purifying and promptly can be used for next reaction.
(12-c) 3-hydroxyl-2-isobutyl--6-heptenoic acid methyl esters
Use 2-isobutyl--4-pentenals to obtain target compound (4.5g, 61%) as oily matter (non-enantiomer mixture) with the identical mode of paragraph (10-a).
(12-d) 3-hydroxyl-2-isobutyl--6-heptenoic acid
(4.5g is 21mmol) to obtain target compound (4.3g) into oily matter with the identical mode of paragraph (10-b) to use 3-hydroxyl-2-isobutyl--6-heptenoic acid methyl esters.This compound need not purifying and promptly can be used for next reaction.
(12-e) (±)-(1S, 5R)-[3-isobutyl-dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
Use 3-hydroxyl-2-isobutyl--6-heptenoic acid (4.3g) to obtain target compound (3.7g, 67%) as oily matter (E/Z mixture) with the identical mode of paragraph (10-c).
(12-f) (±)-[(1S, 5R, 6R)-the 3-isobutyl--and 6-nitro methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Use (±)-(1S, 5R)-[3-isobutyl-dicyclo [3.2.0] heptan-3-alkene-6-fork] (3.7g is 14mmol) to obtain target compound (3.8g, 84%) into oily matter with the identical mode of paragraph (10-c) for tert.-butyl acetate.
(12-g) (±)-[(1S, 5R, 6R)-6-(tert-butoxycarbonyl amino) methyl-and 3-isobutyl-dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Use (±)-[(1S, 5R, 6R)-the 3-isobutyl--and 6-nitro methyl bicycle [3.2.0] heptan-3-alkene-6-yl] (3.8g is 12mmol) to obtain target compound (2.7g, 54%) into oily matter with the identical mode of paragraph (3-a) for tert.-butyl acetate.
(12-h) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-isobutyl-dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
Use (±)-[(1S, 5R, 6R)-and 6-(tert-butoxycarbonyl amino) methyl-3-isobutyl-dicyclo [3.2.0] heptan-3-alkene-6-yl] (2.7g is 6.8mmol) to obtain title compound (1.0g, 62%) into white powder with the identical mode of paragraph (3-b) for tert.-butyl acetate.
(embodiment 13) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-sec-butyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 12)
(13-a) 2-sec-butyl penta-obtusilic acid ethyl ester
With lithium chloride (9.67g, 228.1mmol) and water (2.05mL, (30.90g, dimethyl sulfoxide (DMSO) 120.5mmol) (60mL) solution stirred the mixture 6 hours in 185 ℃ 113.9mmol) to add to allyl group (sec-butyl) diethyl malonate.Use water treatment, extract with diethyl ether afterwards.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound of brown oil with the acquisition.This compound need not purifying and promptly can be used for next reaction.
(13-b) 2-sec-butyl penta-4-alkene-1-alcohol
Tetrahydrofuran (THF) (50mL) drips of solution with 2-sec-butyl penta-obtusilic acid ethyl ester in 30 minutes adds to the lithium aluminum hydride (4.79g that is cooled to 0 ℃, 126.3mmol) tetrahydrofuran (THF) (120mL) solution, stirred the mixture 1 hour in 0 ℃ then, then in stirring at room 2 hours.Mixture is cooled to 0 ℃ again.Add ethyl acetate (55.4mL), water (44.7mL), tetrahydrofuran (THF) (83.1mL) and Sodium Fluoride (53.0g) to it, stirred the mixture 1.5 hours.Mixture filters by Yin Shi salt, to remove insoluble substance.Then, concentrate this solution, resistates is the target compound (12.20g, 69%) of colorless oil by silica gel chromatography with the acquisition.
(13-c) 2-sec-butyl penta-4-olefine aldehydr
(16.90g, methylene dichloride 133.1mmol) (280mL) solution drip dimethyl sulfoxide (DMSO), and (18.20mL 256.4mmol), stirred the mixture 25 minutes in-78 ℃ then to the oxalyl chloride that is cooled to-78 ℃ in 15 minutes.Subsequently, alkene-(12.20g, methylene dichloride 85.8mmol) (75mL) solution stirred the mixture 1 hour in-78 ℃ 1-alcohol to drip 2-sec-butyl penta-4-to it in 30 minutes.In 5 minutes to its drip triethylamine (60.80g, 600.8mmol), then in stirring at room mixture 2 hours.With 2N hydrochloric acid (310mL) neutralise mixt.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, to obtain to containing the yellow oily mixture of target compound.This compound need not to be further purified and promptly can be used for next reaction.(13-d) 3-hydroxyl-4-sec-butyl heptan-6-olefin(e) acid methyl esters
(15.74g 102.9mmol) is prepared as tetrahydrofuran (THF) (25mL) solution with 2-sec-butyl penta-4-olefine aldehydr and methyl bromoacetate.About 1/5 sample aliquot of measuring is added to zinc powder, and (6.73g is in trimethyl borate 102.9mmol) (25mL) suspension.With mixture heating up to 80 ℃.Then, in 30 minutes, add remaining solution, stirred the mixture 2.5 hours in 80 ℃ then to it.Make the mixture cooling, add the saturated aqueous solution (25mL) and the diethyl ether of glycerine (25mL), ammonium chloride then to it.Institute's organic layer that obtains is through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (14.40g, 78%) of yellow oil by silica gel chromatography with the acquisition.
(13-e) 3-hydroxyl-4-sec-butyl heptan-6-olefin(e) acid
(14.40g 67.2mmol) was dissolved in 2N potassium hydroxide-methanol solution (200mL), in this solution of stirring at room 13.5 hours with 3-hydroxyl-4-sec-butyl heptan-6-olefin(e) acid methyl esters.Solvent is fallen in underpressure distillation.Add entry and diethyl ether to resistates then, use in the 2N hydrochloric acid and water layer.Add diethyl ether to it, organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (12.70g, 94%) of yellow oil with the acquisition.
(13-f) (±)-(1S, 5R)-3-sec-butyl dicyclo [3.2.0] heptan-3-alkene-6-ketone
(14.90g, (12.70g, diacetyl oxide 63.5mmol) (71mL) solution in stirring at room mixture 1 hour, stirred 3.5 hours in 120 ℃ then 151.8mmol) to add to 3-hydroxyl-4-sec-butyl heptan-6-olefin(e) acid with potassium acetate.Mixture is handled with frozen water, extracts with diethyl ether afterwards.Organic layer washs with saturated sodium bicarbonate aqueous solution.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (6.70g, 64%) of yellow oil by silica gel chromatography with the acquisition.
(13-g) (±)-[(1S, 5R)-3-sec-butyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (E/Z mixture)
In 20 minutes in 0 ℃ to sodium hydride (0.68g, 63%, tetrahydrofuran (THF) 18.0mmol) (15mL) suspension drips the solutions of dimethyl phosphoryl guanidine-acetic acid tert-butyl ester, and (3.70g, tetrahydrofuran (THF) 16.5mmol) (15mL) solution stirred the mixture 20 minutes in 0 ℃.In 15 minutes in 0 ℃ to this solution drip (±)-(1S, 5R)-(2.48g, tetrahydrofuran (THF) 15.1mmol) (15mL) solution was in stirring at room mixture 2 hours for 3-sec-butyl dicyclo [3.2.0] heptan-3-alkene-6-ketone.Use water treatment, extract with diethyl ether afterwards.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (3.10g, 78%) of yellow oil by silica gel chromatography with the acquisition.
(13-h) (±)-[(1S, 5R, 6R)-6-(nitro methyl)-and 3-sec-butyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-[(1S, 5R)-3-sec-butyl dicyclo [3.2.0] heptan-3-alkene-6-fork] (3.10g 11.8mmol) is dissolved in the Nitromethane 99Min. (30mL) tert.-butyl acetate.Add 1 to this solution, (2.20g's 8-diazabicyclo [5.4.0] 11 carbon-7-alkene 14.5mmol), stirred the mixture 5 hours in 60 ℃.Make the mixture cooling, to its saturated aqueous solution that adds potassium primary phosphate, use dichloromethane extraction afterwards then.Organic layer is through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (3.28g, 86%) of yellow oil by the silica gel chromatography purifying with the acquisition.
(13-i) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-sec-butyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-[(1S, 5R, 6R)-6-(nitro methyl)-3-sec-butyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (3.28g 10.2mmol) is dissolved in the ethanol (60mL) tert.-butyl acetate.(4.47g, 80.0mmol), (0.54g, the 10.0mmol) aqueous solution (20mL) stirred the mixture under the backflow 4.5 hours being heated to add ammonium chloride then to add iron powder to this solution.Make the mixture cooling, filter by Yin Shi salt then, to remove insoluble substance.Concentrated solution dilutes resistates with ethyl acetate.Diluent washs with saturated sodium bicarbonate aqueous solution, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (2.26g, 75%) of colorless oil by silica gel chromatography with the acquisition.
(13-j) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-sec-butyl butyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With (±)-[(1S, 5R, 6R)-the 6-amino methyl-3-sec-butyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (2.26g 7.7mmol) was dissolved in 4N hydrochloric acid-ethyl acetate solution (30mL) tert.-butyl acetate, in stirring at room solution 2 hours.Then, solvent is fallen in underpressure distillation.By adding methylene dichloride suspension resistates.Drip triethylamine to suspension then, collect the powder that is produced by filtering.The powder that obtains is used washed with dichloromethane, is the target compound (0.98g, 54%) of white powder with the acquisition.
(embodiment 14) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-cyclopentyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 15)
(14-a) 2-cyclopentyl penta-obtusilic acid ethyl ester
With lithium chloride (3.60g, 84.9mmol) and water (0.76mL, (10.10g, dimethyl sulfoxide (DMSO) 37.7mmol) (20mL) solution stirred the mixture 6 hours in 185 ℃ 41.9mmol) to add to allyl group (cyclopentyl) diethyl malonate.Use water treatment, extract with diethyl ether afterwards.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (6.10g, 84%) of brown oil with the acquisition.
(14-b) 2-cyclopentyl penta-4-alkene-1-alcohol
In 20 minutes to the lithium aluminium hydride (1.21g that is cooled to 0 ℃, 31.9mmol) tetrahydrofuran (THF) (40mL) solution drip 2-cyclopentyl penta-obtusilic acid ethyl ester (6.10g, 31.6mmol) tetrahydrofuran (THF) (15mL) solution, stirred the mixture 1 hour in 0 ℃ then, then in stirring at room 2 hours.Mixture is cooled to 0 ℃ again.Add ethyl acetate (14.0mL), water (11.3mL), tetrahydrofuran (THF) (21.0mL) and Sodium Fluoride (13.4g) to it, stirred the mixture 1 hour.Mixture filters by Yin Shi salt, to remove insoluble substance.Then, concentrated solution, resistates is the target compound (3.50g, 56%) of colorless oil by silica gel chromatography with the acquisition.
(14-c) 2-cyclopentyl penta-4-olefine aldehydr
(4.47g, methylene dichloride 35.2mmol) (75mL) solution drip dimethyl sulfoxide (DMSO), and (4.82mL 67.9mmol), stirred the mixture 30 minutes in-78 ℃ then to the oxalyl chloride that is cooled to-78 ℃ in 15 minutes.Subsequently, in 15 minutes, drip 2-cyclopentyl penta-4-alkene-1-alcohol (3.50g, methylene dichloride 22.7mmol) (20mL) solution, and stirred the mixture 45 minutes in-78 ℃ to it.In 5 minutes to its drip triethylamine (16.11g, 159.3mmol), then in stirring at room mixture 2 hours.With 1N hydrochloric acid (160mL) neutralise mixt.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, to obtain to contain the yellow oily mixture of target compound.This compound need not to be further purified and promptly can be used for next reaction.
(14-d) 3-hydroxyl-4-cyclopentyl heptan-6-olefin(e) acid methyl esters
(4.22g 27.6mmol) is prepared into tetrahydrofuran (THF) (12mL) solution for 2-cyclopentyl penta-4-olefine aldehydr that will obtain in aforementioned paragraphs and methyl bromoacetate.The sample aliquot of about 1/5 amount is added to zinc powder (1.81g, trimethyl borate 27.6mmol) (12mL) suspension.With mixture heating up to 80 ℃.Then, in 30 minutes, add remaining solution, stirred the mixture 2.5 hours in 80 ℃ then to it.Make the mixture cooling, add glycerine (6mL), ammonium chloride saturated aqueous solution (6mL) and diethyl ether to it then.Institute's organic layer that obtains is through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (4.00g, 77%) of yellow oil by silica gel chromatography with the acquisition.
(14-e) 3-hydroxyl-4-cyclopentyl heptan-6-olefin(e) acid
(4.00g 17.7mmol) was dissolved in 2N potassium hydroxide-methanol solution (53mL), in stirring at room solution 1.5 hours with 3-hydroxyl-4-cyclopentyl heptan-6-olefin(e) acid methyl esters.Solvent is fallen in underpressure distillation.Add entry and diethyl ether to resistates then, and with in the 2N hydrochloric acid and water layer.Add diethyl ether to it.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (4.00g (comprising residual solvent)) of yellow oil with the acquisition.
(14-f) 3-cyclopentyl dicyclo [3.2.0] heptan-3-alkene-6-ketone
(4.16g 42.4mmol) adds to diacetyl oxide (20mL) solution of 3-hydroxyl-4-cyclopentyl heptan-6-olefin(e) acid (4.00g, maximum 17.7mmol), and mixture stirred 3.5 hours in 120 ℃ then in stirring at room 1 hour with potassium acetate.Use the frozen water treating mixture, extract with diethyl ether afterwards.Organic layer washs with saturated sodium bicarbonate aqueous solution.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (2.30g, 74%) of yellow oil by silica gel chromatography with the acquisition.
(14-g) (±)-[(1S, 5R)-3-cyclopentyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (E/Z mixture)
In 0 ℃ in 15 minutes to sodium hydride (0.59g, 63%, tetrahydrofuran (THF) 15.7mmol) (15mL) suspension drips the solutions of dimethyl phosphoryl guanidine-acetic acid tert-butyl ester, and (3.21g, tetrahydrofuran (THF) 14.4mmol) (15mL) solution stirred the mixture 25 minutes in 0 ℃.(2.30g, tetrahydrofuran (THF) 13.1mmol) (15mL) solution was in stirring at room mixture 16 hours to drip 3-cyclopentyl dicyclo [3.2.0] heptan-3-alkene-6-ketone in 0 ℃ to this solution in 10 minutes.Use water treatment, extract with diethyl ether afterwards.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (3.30g, 92%) of yellow oil by silica gel chromatography with the acquisition.
(14-h) (±)-[(1S, 5R, 6R)-6-(nitro methyl)-and 3-cyclopentyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-[(1S, 5R)-3-cyclopentyl dicyclo [3.2.0] heptan-3-alkene-6-fork] (3.30g 12.0mmol) is dissolved in the Nitromethane 99Min. (30mL) tert.-butyl acetate.Add 1 to this solution, (2.20g's 8-diazabicyclo [5.4.0] 11 carbon-7-alkene 14.5mmol), stirred the mixture 5 hours in 60 ℃.Make the mixture cooling, add the potassium primary phosphate saturated aqueous solution to it then, use dichloromethane extraction afterwards.Organic layer is through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (3.50g, 87%) of yellow oil by the silica gel chromatography purifying with the acquisition.
(14-i) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-cyclopentyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-[(1S, 5R, 6R)-6-(nitro methyl)-3-cyclopentyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (3.30g 9.8mmol) is dissolved in the ethanol (60mL) tert.-butyl acetate.(4.47g, 80.0mmol), (0.54g, the 10.0mmol) aqueous solution (20mL) stirred the mixture under the backflow 4.5 hours being heated to add ammonium chloride then to add iron powder to this solution.Make the mixture cooling, filter by Yin Shi salt then, to remove insoluble substance.Concentrate this solution, resistates dilutes with ethyl acetate.Diluent washs with saturated sodium bicarbonate aqueous solution, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (2.00g, 67%) of colorless oil by silica gel chromatography with the acquisition.
(14-j) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-cyclopentyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With (±)-[(1S, 5R, 6R)-the 6-amino methyl-3-cyclopentyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (2.00g 6.5mmol) is dissolved in 4N hydrochloric acid-ethyl acetate solution (30mL) tert.-butyl acetate, and solution was in stirring at room 2 hours.Then, solvent is fallen in underpressure distillation.By adding methylene dichloride suspension resistates.Drip triethylamine to suspension then, the powder that is produced is collected by filtering.The powder that obtains is used washed with dichloromethane, is the target compound (0.70g, 43%) of white powder with the acquisition.
(embodiment 15) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-allyl group dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 14)
(15-a) 4-allyl group heptan-2, the 6-diolefinic acid
(0.74g, (2.20g, tetrahydrofuran solution 13.1mmol) (30mL) stirred the mixture under this state 1 hour 20mmol) to add to 2-allyl group penta-4-alkene-ethyl acetate with lithium aluminium hydride under ice-cooled.Add 1N aqueous sodium hydroxide solution (10mL) to reaction soln,, filter by Yin Shi salt then in stirring at room mixture 1 hour.Filtered solution dilutes with saturated brine and ethyl acetate, and is separated into water layer and organic layer.Organic layer washs with saturated brine, and through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation.Be cooled under-78 ℃ to dimethyl sulfoxide (DMSO) (2.7mL, dichloromethane solution 19.5mmol) (10mL) dropping oxalyl chloride (1.6mL, dichloromethane solution 13.1mmol) (20mL).Methylene dichloride (10mL) solution of the resistates that obtains more than reaction soln adds stirred this mixture 1 hour in-78 ℃.To reaction soln add triethylamine (7.1mL, 52.4mmol), in stirring at room mixture 1 hour.Add 1N hydrochloric acid and saturated brine to it, use ethyl acetate extraction afterwards.Organic layer washs with saturated brine, and then through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation.Obtaining resistates is dissolved in the pyridine (2.3mL).(1.55g, 14.95mmol) and tetramethyleneimine (0.43mL), mixture stirs in ambient temperature overnight, and is being heated under the backflow restir 6 hours to add propanedioic acid to this solution.Make the mixture cooling, with the dilution of 2N aqueous sodium hydroxide solution, wash with dme then then.Make water layer become acidity at the ice-cooled concentrated hydrochloric acid that uses down, extract with diethyl ether afterwards.Organic layer washs with saturated brine, and through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, is the target compound (1.49g, 78%) of light yellow oil with the acquisition.
(15-b) (±)-(1S, 5R)-3-allyl group dicyclo [3.2.0] heptan-3-alkene-6-pitches tert.-butyl acetate
With 4-allyl group heptan-2, (2.00g 12.0mmol) is dissolved in the benzene (5mL) the 6-diolefinic acid.(7.01g 55.2mmol), stirred the mixture under this state 1 hour to this solution adding oxalyl chloride under ice-cooled.In room temperature restir mixture 30 minutes, be heated to 80 ℃ then, and stirred 1 hour.Then, solvent is fallen in underpressure distillation.Add toluene to resistates, and solvent is fallen in underpressure distillation.Resistates is dissolved in the toluene (20mL).This drips of solution is added to triethylamine (4.41g, toluene solution 43.68mmol) (30mL), the restir mixture 2.5 hours that is heated to backflow in advance.Make the reaction soln cooling, filter then with saturated brine and ethyl acetate dilution, and by Yin Shi salt (Xelite).Filtered solution is separated into water layer and organic layer.Then, organic layer washs by this in proper order with 1N hydrochloric acid and saturated brine, then through anhydrous magnesium sulfate drying, filters then.Under ice-cooled, this filtered solution is added to previously prepared reaction soln; described reaction soln passes through sodium hydride (＞65% oiliness; 457.1mg; 12mmol) add to dimethoxy phosphoryl tert.-butyl acetate (3.03g; tetrahydrofuran solution 12mmol) (20mL) preparation stirred the mixture 1 hour.Solvent is fallen in underpressure distillation, is the target compound (0.63g, 16%, E/Z mixture) of light yellow oil with the acquisition.
(15-c) (±)-[(1S, 5R, 6R)-and 3-allyl group-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-(1S, 5R)-3-allyl group dicyclo [3.2.0] heptan-3-alkene-(0.63g 2mmol) is dissolved in the Nitromethane 99Min. (5mL) 6-fork tert.-butyl acetate.Add 1 to this solution, and 8-diazabicyclo [5.4.0] 11 carbon-7-alkene (0.45mL, 3mmol), under agitation in 50-60 ℃ of heated mixt 7 hours.Make the mixture cooling, add the potassium primary phosphate saturated aqueous solution to it then, use ethyl acetate extraction afterwards.Then, organic layer is through anhydrous magnesium sulfate drying, and solvent is fallen in underpressure distillation.Resistates is the target compound (367.0mg, 60%) of colorless oil by silica gel chromatography with the acquisition.
(15-d) (±)-[(1S, 5R, 6R)-and 3-allyl group-6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With (±)-[(1S, 5R, 6R)-3-allyl group-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (335.2mg 1.09mmol) is dissolved in ethanol (10mL) and the water (5mL) tert.-butyl acetate.To this solution add iron powder (611.0mg, 10.9mmol) and ammonium chloride (57.8mg 1.09mmol), stirred the mixture under the backflow 2 hours being heated to.Make the mixture cooling, filter then with saturated brine, saturated sodium bicarbonate aqueous solution and ethyl acetate dilution, and by Yin Shi salt, to remove insoluble substance.Filtered solution is separated into organic layer and water layer.Organic layer washs with saturated brine, and then through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation then.Add 4N hydrochloric acid-ethyl acetate solution (10mL) to this resistates, in stirring at room mixture 1 hour.Then, solvent is fallen in underpressure distillation.Resistates is suspended in the methylene dichloride.Drip triethylamine to this suspension, the powder that is produced is collected by filtering, and uses washed with dichloromethane then, and is dry then, is the target compound (68.5mg, 28%) of white powder with the acquisition.
(embodiment 16) (±)-[(1S, 5R, 6S)-the 6-amino methyl-and 5-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 6)
(16-a) 2-methyl-3-oxo heptan-6-olefin(e) acid ethyl ester
(10mL 70.7mmol) drops to sodium hydride (2.83g, anhydrous tetrahydro furan suspension 74.2mmol) with 2-methyl-ethyl 3-oxobutanoate under ice-cooled and stirring.In this bath, stirred the mixture 15 minutes.Then, to its drip n-Butyl Lithium (the 1.59M hexane solution, 45.3mL, 72.1mmol), restir mixture 30 minutes.Then, to its drip allyl bromide 98 (6.73mL, 77.7mmol).After removing ice bath, stirred the mixture 2 hours, then to reaction soln impouring dilute hydrochloric acid termination reaction.With ethyl acetate reaction soln is extracted.Organic layer water, saturated sodium bicarbonate aqueous solution and saturated brine washing, and through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation then.Institute's resistates that obtains is the target compound (7.67g) of light yellow oil by silica gel chromatography with the acquisition.
(16-b) 3-hydroxy-2-methyl heptan-6-olefin(e) acid ethyl ester
Ice-cooled and stir under (2.48g 65.7mmol) adds to 2-methyl-3-oxo heptan-6-olefin(e) acid ethyl ester (12.1g, methyl alcohol 65.7mmol) (200mL) solution with sodium borohydride.Stirred the mixture in this bath 30 minutes, again in stirring at room 2 hours, concentrating under reduced pressure desolvates to remove then.Resistates dilutes with dilute hydrochloric acid, uses ethyl acetate extraction afterwards.Organic layer water, saturated sodium bicarbonate aqueous solution and saturated brine washing, then through anhydrous magnesium sulfate drying, concentrating under reduced pressure then.Institute's resistates that obtains is the target compound (6.11g) of colorless oil by silica gel chromatography with the acquisition.
(16-c) 3-hydroxy-2-methyl heptan-6-olefin(e) acid
(6.11g 32.8mmol) is dissolved in 2N potassium hydroxide-methanol solution (100mL), in stirring at room mixture 2 hours, places then and spends the night with 3-hydroxy-2-methyl heptan-6-olefin(e) acid ethyl ester.Methyl alcohol is fallen in underpressure distillation, and residue diluted with water is used washed with dichloromethane then, neutralizes with dilute hydrochloric acid then.With ethyl acetate water layer is extracted, extract water and saturated brine washing, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (5.46g) of light yellow oil with the acquisition.
(16-d) (±)-(1S, 5R)-5-methyl bicycle [3.2.0] heptan-3-alkene-6-ketone
With 3-hydroxy-2-methyl heptan-6-olefin(e) acid (5.45g, 34.5mmol), potassium acetate (7.0g, 71.3mmol) and the mixing solutions of diacetyl oxide (30mL) in stirring at room 1.5 hours, stirred 3 hours being heated under the condition of backflow then.Placing response solution spends the night, and then with the ethyl acetate dilution, the saturated aqueous solution of water, sodium bicarbonate and saturated brine washing are then through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and institute's resistates that obtains is the target compound (810mg) of light yellow oil by silica gel chromatography with the acquisition.
(16-e) (±)-[(1S, 5R)-5-methyl-dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
Ice-cooled and stir under with (±)-(1S; 5R)-5-methyl bicycle [3.2.0] heptan-3-alkene-6-ketone (800mg; 6.55mmol) anhydrous tetrahydrofuran solution (2mL) drop in advance by the solutions of dimethyl phosphoryl guanidine-acetic acid tert-butyl ester (1.28g; 6.55mmol) and sodium hydride (＞63% oiliness; 245mg; 6.55mmol) the reaction soln of anhydrous tetrahydrofuran solution (10mL) preparation, in this bath, stirred the mixture 1 hour then, and in room temperature restir 2 hours.Reaction soln dilutes with aqueous citric acid solution, uses ethyl acetate extraction afterwards.Organic layer water, saturated sodium bicarbonate aqueous solution and saturated brine washing, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and institute's resistates that obtains is the target compound (389mg) of colorless oil by silica gel chromatography with the acquisition.
(16-f) (±)-[(1S, 5R, 6S)-6-cyano group-and 5-methyl-dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-[(1S, 5R)-5-methyl-dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (300mg, 1.36mmol) and potassium cyanide (89mg, 1.36mmol) in mixed at room temperature in anhydrous dimethyl sulphoxide (2mL), stirred the mixture 2 hours, and placed then and spend the night.Mixture in 100 ℃ of restir 10 hours, is placed then and is spent the night in oil bath.Reaction soln dilutes with ethyl acetate, water and saturated brine washing then, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and institute's resistates that obtains is the target compound (128mg) of colorless oil by silica gel chromatography with the acquisition.In the method, obtain into colorless oil by product (±)-[(1S, 5R, 6R)-6-cyano group-5-methyl-dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (45mg).
(16-g) (±)-[(1S, 5R, 6S)-6-(tert-butoxycarbonyl amino methyl)-and 5-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
In room temperature under agitation with aliquot with sodium borohydride (134mg, 3.54mmol) add to (±)-[(1S, 5R, 6S)-and 6-cyano group-5-methyl-dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (125mg, 0.51mmol), nickelous chloride (II) hexahydrate (12mg, 0.05mmol) and (Boc) 2(221mg, methyl alcohol 1.01mmol) (5mL) solution is then in stirring at room mixture 2 hours for O.With ethyl acetate and saturated sodium bicarbonate aqueous solution diluting reaction solution, and filter, to remove insoluble substance.Then, organic layer washs with saturated brine, and through anhydrous sodium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (123mg) of colorless oil by silica gel chromatography with the acquisition.
(16-h) (±)-[(1S, 5R, 6S)-the 6-amino methyl-and 5-methyl-dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With (±)-[(1S, 5R, 6S)-6-(tert-butoxycarbonyl amino methyl)-5-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] (120mg 0.34mmol) is dissolved in 4N hydrochloric acid-ethyl acetate solution (2mL) tert.-butyl acetate, solution is in stirring at room 3 hours, concentrating under reduced pressure then.Resistates is dissolved in the methylene dichloride (2mL).(0.048mL 0.34mmol), stirred the mixture 2 hours to drip triethylamine in room temperature to this solution.The powder that is produced is collected by filtering, and dry, is the target compound (22mg) of white solid with the acquisition.
(embodiment 17) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 2-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 3)
(17-a) 5-methyl-3-hydroxyl-6-heptenoic acid methyl esters
(5g is 59mmol) to obtain title compound (3.4g, 33%) into oily matter with the identical mode of paragraph (10-a) to use 3-methyl-4-pentenals.
(17-b) 5-methyl-3-hydroxyl-6-heptenoic acid
(3.4g is 19mmol) to obtain title compound (2.23g, 74%) into oily matter with the identical mode of paragraph (10-b) to use 5-methyl-3-hydroxyl-6-heptenoic acid methyl esters.This compound need not purifying and promptly can be used for next step.
(17-c) (±)-(1S, 5R)-[2-methyl bicycle [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
(2.23g is 14mmol) to obtain title compound (1.9g, 61%) (main: inferior=3: 1, E/Z mixture) into oily matter with the identical mode of paragraph (10-c) to use 5-methyl-3-hydroxyl-6-heptenoic acid.
(17-d) (±)-[(1S, 5R, 6R)-the 2-methyl-and 6-nitro methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Use (±)-(1S, 5R)-[2-methyl bicycle [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (1.9g, 14mmol) with the identical mode of paragraph (1-c) obtain into oily matter title compound (1.9g, 80mmol).
(17-e) (±)-[(1S, 5R, 6R)-6-(tert-butoxycarbonyl amino) methyl-and 2-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Use (±)-[(1S, 5R, 6R)-the 2-methyl-and 6-nitro methyl bicycle [3.2.0] heptan-3-alkene-6-yl] (1.9g is 6.75mmol) to obtain title compound (2.3g, 99%) into oily matter with the identical mode of paragraph (3-a) for tert.-butyl acetate.
(17-f) (±)-[(1S, 5R, 6R)-the 6-amino methyl-and 2-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate
Use (±)-[(1S, 5R, 6R)-and 6-(tert-butoxycarbonyl amino) methyl-2-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (2.3g, 6.7mmol) (to lead: inferior=3: 1 with the title compound that the identical mode of paragraph (3-b) obtains to white powder, 0.68g, 52%).
(embodiment 18) (±)-[(1R, 5R, 6R)-3-(acetoxy-methyl)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 16)
(18-a) 3-hydroxyl-4-{[(4-methoxy-benzyl) oxygen base] methyl } heptan-6-olefin(e) acid ethyl ester
Under agitation in-78 ℃ with titanium tetrachloride (0.97mL, 8.88mmol) and [(1-vinyl ethyl ether base) oxygen base] (trimethylammonium) silicomethane (J.Am.Chem.Soc.2003,125,5644) dichloromethane solution (10mL) adds to the 2-{[(4-methoxy-benzyl) the oxygen base] methyl } (Tetrahedron:Asymmetry 2001 for penta-4-olefine aldehydr, 12,3223) (1.98g, dichloromethane solution 8.46mmol) (80mL) stirred the mixture 1.5 hours in this temperature.By adding saturated sodium bicarbonate aqueous solution (100mL) and water (100mL) termination reaction, use dichloromethane extraction afterwards.Organic layer washs with saturated sodium bicarbonate aqueous solution, water and saturated brine, and through anhydrous sodium sulfate drying.Filtration residue and concentrating under reduced pressure.Then, by crude product that silica gel chromatography obtains, be the target compound (1.31g, 48%) of oily matter with the acquisition.
(18-b) 3-hydroxyl-4-{[(4-methoxy-benzyl) oxygen base] methyl } heptan-the 6-olefin(e) acid
In the mode identical with paragraph (7-b) by 3-hydroxyl-4-{[(4-methoxy-benzyl) the oxygen base] methyl heptan-(1.31g 4.06mmol) obtains to be the target compound of oily matter (1.20g,＞99%) to 6-olefin(e) acid ethyl ester.
(18-c) (±)-[(1R, 5R)-3-{[(4-methoxy-benzyl) oxygen base] methyl } dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
In the mode identical with paragraph (7-c) by 3-hydroxyl-4-{[(4-methoxy-benzyl) the oxygen base] methyl heptan-(1.20g 4.06mmol) obtains to be the target compound of oily matter (1.00g, 69%) to the 6-olefin(e) acid.
(18-d) (±)-[(1R, 5R, 6R)-and the 3-{[(4-methoxy-benzyl) the oxygen base] methyl }-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
In the mode identical with paragraph (1-c) by (±)-[(1R, 5R)-and the 3-{[(4-methoxy-benzyl) the oxygen base] methyl } dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (1.00g, 2.80mmol) obtain to be the target compound of oily matter (1.02g, 87%).
(18-e) (±)-[(1R, 5R, 6R)-and the 6-{[(tert-butoxycarbonyl) amino] methyl }-the 3-{[(4-methoxy-benzyl) the oxygen base] methyl } dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
In the mode identical with paragraph (3-a) by (±)-[(1R, 5R, 6R)-and the 3-{[(4-methoxy-benzyl) the oxygen base] methyl }-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (1.02g, 2.44mmol) obtain to be the target compound of oily matter (1.19g,＞99%).
(18-f) (±)-[(1R, 5R, 6R)-and the 6-{[(tert-butoxycarbonyl) amino] methyl }-3-(hydroxymethyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
In 0 ℃ under agitation with water (1.4mL) and 2,3-two chloro-5,6-dicyano-1,4-benzoquinones (831mg, 3.66mmol) add to (±)-[(1R, 5R, 6R)-the 6-{[(tert-butoxycarbonyl) amino] methyl }-the 3-{[(4-methoxy-benzyl) the oxygen base] methyl } dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (1.19g, dichloromethane solution 2.44mmol) (25mL).Mixture stirred 1 hour in 0 ℃ of this temperature, and in room temperature restir 1 hour.Then, by adding the saturated sodium bicarbonate aqueous solution termination reaction, use dichloromethane extraction afterwards.Organic layer water, saturated sodium bicarbonate aqueous solution and saturated brine washing, and through anhydrous sodium sulfate drying.Filtration residue and concentrating under reduced pressure.Then, institute's crude product that obtains is the target compound (571mg, 64%) of oily matter by silica gel chromatography with the acquisition.
(18-g) (±)-[(1R, 5R, 6R)-3-(acetoxy-methyl)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
In the mode identical with paragraph (3-b) by (±)-[(1R, 5R, 6R)-and the 6-{[(tert-butoxycarbonyl) amino] methyl }-3-(hydroxymethyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (275mg, 0.75mmol) obtain to be the target compound of white solid (85.2mg, 45%).
(embodiment 19) (±)-[(1R, 5R, 6R)-and 6-amino methyl-3-(methoxymethyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 17)
(19-a) (2E)-4-({ [tertiary butyl (dimethyl) silyl] oxygen base } methyl) heptan-2,6-diolefinic acid methyl esters
Under agitation (4.71mL, (2.84mL, dichloromethane solution 33.2mmol) (70mL) stirred the mixture 5 minutes in this temperature 66.3mmol) to add to oxalyl chloride with dimethyl sulfoxide (DMSO) in-78 ℃.Then, add 2-({ [tertiary butyl (dimethyl) silyl] oxygen base } methyl) penta-4-alkene-1-alcohol (J.Chem.Soc., Perkin Trans.1 1991,2073) (5.10g, dichloromethane solution 22.1mmol) (30mL) to it.Stirred the mixture 15 minutes in this temperature.Then, (12.3mL 88.4mmol), to room temperature, and stirs mixture heating up to add triethylamine to it.Is water layer and organic layer by adding 0.1M hydrochloric acid with mixture separation.Organic layer is with 0.1M hydrochloric acid, water and saturated brine washing, then through anhydrous magnesium sulfate drying.Filtration residue and concentrating under reduced pressure are dissolved in obtaining resistates in the toluene (50mL).(11.1g, 33.2mmol), mixture is in stirring at room 4 hours, and in 60 ℃ of restir 2 hours to add (methoxycarbonyl methylene radical) triphenyl phosphorane to this solution.The concentrating under reduced pressure reaction soln filters by Yin Shi salt then, and concentrating under reduced pressure again.Then, institute's crude product that obtains is the target compound (5.69g, 91%) of oily matter by silica gel chromatography with the acquisition.
(19-b) (2E)-4-({ [tertiary butyl (dimethyl) silyl] oxygen base } methyl) heptan-2, the 6-diolefinic acid
With lithium hydroxide monohydrate (2.52g, 60.0mmol) add to (2E)-4-({ [tertiary butyl (dimethyl) silyl] oxygen base } methyl) heptan-2,6-diolefinic acid methyl esters (5.69g, 20.0mmol) tetrahydrofuran (THF): methyl alcohol: water (3: 1: 1,100mL) mixing solutions, mixture was in stirring at room 6 hours.Reaction soln is through concentrating under reduced pressure.Add entry to resistates then, use dichloromethane extraction afterwards.Make water layer become acidity by adding 10% hydrochloric acid, use dichloromethane extraction afterwards again.Then, the organic layer of merging is through anhydrous sodium sulfate drying.Resistates after filtration and concentrating under reduced pressure.Then, institute's crude product that obtains is the target compound (3.11g, 57%) of oily matter by silica gel chromatography with the acquisition.
(19-c) (±)-[(1R, 5R)-3-({ [tertiary butyl (dimethyl) silyl] oxygen base } methyl) dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
By (2E)-4-({ [tertiary butyl (dimethyl) silyl] oxygen base } methyl) heptan-2, (3.11g 11.5mmol) obtains to be the target compound of oily matter (2.03g, 50%) to the 6-diolefinic acid in the mode identical with paragraph (1-b).
(19-d) (±)-[(1R, 5R)-3-(hydroxymethyl) dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
With tetrabutyl ammonium fluoride (1.0M tetrahydrofuran solution, 8.69mL, 8.69mmol) add to (±)-[(1R, 5R)-and 3-({ [tertiary butyl (dimethyl) silyl] oxygen base } methyl) dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (2.03g, 5.79mmol) tetrahydrofuran solution (15mL), mixture was in stirring at room 2 hours.Add entry to this reaction soln, use ethyl acetate extraction afterwards.Then, organic layer water and saturated brine washing, and through anhydrous sodium sulfate drying.Resistates after filtration and concentrating under reduced pressure.Then, institute's crude product that obtains is the target compound (1.29g, 94%) of oily matter by silica gel chromatography with the acquisition.
(19-e) (±)-[(1R, 5R, 6R)-and 3-(methoxymethyl)-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With methyl-iodide (2.03mL, 32.6mmol) and silver suboxide (I) (1.62g, 6.99mmol) add to (±)-[(1R, 5R)-and 3-(hydroxymethyl) dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (550mg, 2.33mmol) dichloromethane solution (6.0mL), mixture was in stirring at room 40 hours.Mixture filters by Yin Shi salt, and concentrating under reduced pressure.Then, resistates is dissolved in the Nitromethane 99Min. (4.5mL).Add 1 to this solution, (0.70mL, 4.66mmol), mixture stirred 7 hours in 60 ℃ 8-diazabicyclo [5.4.0] 11 carbon-7-alkene.Add the potassium primary phosphate saturated aqueous solution to reaction soln, use ethyl acetate extraction afterwards.Organic layer washs with potassium primary phosphate saturated aqueous solution and saturated brine, and through anhydrous sodium sulfate drying.Resistates after filtration and concentrating under reduced pressure.Then, resistates is the target compound (368mg, 51%) of oily matter by silica gel chromatography with the acquisition.
(19-f) (±)-[(1R, 5R, 6R)-and the 6-{[(tert-butoxycarbonyl) amino] methyl }-3-(methoxymethyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
In the mode identical with paragraph (3-a) by (±)-[(1R, 5R, 6R)-and 3-(methoxymethyl)-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (368mg 1.18mmol) obtains to be the target compound of oily matter (450mg,＞99%) to tert.-butyl acetate.
(19-g) (±)-[(1R, 5R, 6R)-and 6-amino methyl-3-(methoxymethyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With the mode identical with paragraph (1-e) by (±)-[(1R, 5R, 6R)-6-amino methyl-3-(methoxymethyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (450mg 1.18mmol) obtains to be the target compound of white solid (143mg, 53%) to acetate.
(embodiment 20) (±)-[(1S, 5R, 6R)-6-amino methyl-3,4-dimethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate tosilate (tosilate of exemplary compounds 19) is 3-hydroxyl-3 (20-a), 4-dimethyl-6-heptenoic acid methyl esters
(17g is 106mmol) to obtain target compound (11.7g, 60%) into oily matter (non-enantiomer mixture) with the identical mode of paragraph (10-a) to use 3-methyl-5-hexene-2-ketone.
(20-b) 3-hydroxyl-3,4-dimethyl-6-heptenoic acid
Use 3-hydroxyl-3, (11.7g is 63mmol) to obtain target compound (10.1g) into oily matter with the identical mode of paragraph (10-b) for 4-dimethyl-6-heptenoic acid methyl esters.This compound need not purified, and promptly is used for next reaction.
(20-c) (±)-(1S, 5R)-[3,4-dimethyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
Use 3-hydroxyl-3,4-dimethyl-6-heptenoic acid (10.1g) is to obtain target compound (4.2g, 33%) into oily matter (E/Z mixture) with the identical mode of paragraph (10-c).
(20-d) (±)-[(1S, 5R, 6R)-3, and 4-dimethyl-6-nitro methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Use (±)-(1S, 5R)-[3,4-dimethyl dicyclo [3.2.0] heptan-3-alkene-6-fork] (4.2g is 18mmol) to obtain target compound (4.5g, 85%) into oily matter with the identical mode of paragraph (1-c) for tert.-butyl acetate.
(20-e) (±)-[(1S, 5R, 6R)-6-(tert-butoxycarbonyl amino) methyl-3, and 4-dimethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Use (±)-[(1S, 5R, 6R)-3,4-dimethyl-6-nitro methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate that (4.5g is 15mmol) to obtain target compound (5.6g, 99%) into oily matter with the identical mode of paragraph (3-a).
(20-f) (±)-[(1S, 5R, 6R)-6-amino methyl-3,4-dimethyl dicyclo [3.2.0] heptan-3-alkene-6-yl]
The acetate tosilate
With (±)-[(1S, 5R, 6R)-6-(tert-butoxycarbonyl amino) methyl-3,4-dimethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (4.0g, 11mmol) with tosic acid monohydrate (2.5g, 13mmol) be suspended in toluene (30mL) and the thioanisole (3.8mL), in 80 ℃ of stirred suspensions 2 hours.Concentrated reaction solution, institute's oily matter that obtains is handled with ethyl acetate and hexane, is the title compound (2.3g, 55%) of white powder with the acquisition.
(embodiment 21) [(1S, 5S, 6S)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 8, the optical activity form of the compound of embodiment 8)
Figure GPA00001143598100741
(21-a) (±)-[(1R, 5S, 6S)-and 3-ethyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] fractionation of tert.-butyl acetate
Use is by Daicel Chemical Industries, Ltd. the Chiralpak IC (normal hexane: EtOH=98: 2 of Sheng Chaning, 1.0mL/ minute, 40 ℃) fractionation (±)-[(1R, 5S, 6S)-3-ethyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (230g, 778mmol), to obtain 115g peak 1 (retention time: 5.2 minutes) and 93.7g peak 2 (retention time: 6.3 minutes) respectively.
(21-b) ([(1R, 5S, 6S)-6-(tert-butoxycarbonyl amino) methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Will [(1R, 5S, 6S)-and 3-ethyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (peak 1,7.0g 23.7mmol) are dissolved in ethanol (60mL) and the water (21mL) tert.-butyl acetate.To this solution add iron powder (13.27g, 237mmol) and ammonium chloride (628.1mg 11.9mmol), and stirred the mixture under the backflow 5.5 hours being heated to.Make the mixture cooling, filter then with saturated brine, saturated sodium bicarbonate aqueous solution and ethyl acetate dilution, and by Yin Shi salt, to remove insoluble substance.Filtered solution is separated into organic layer and water layer.Organic layer washs with saturated brine, then through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, to obtain light yellow oil (7.02g).With this substance dissolves in methylene dichloride (200mL).Add (Boc) to this solution 2O (5.25g, 25mmol) and triethylamine (5.01g 50mmol), and stirs the mixture in ambient temperature overnight.Solvent is fallen in underpressure distillation, by silica gel chromatography purifying resistates, is the title target compound (8.82g,＜100%) of light yellow oil with the acquisition then.
(21-c) [(1R, 5S, 6S)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
4N hydrochloric acid-ethyl acetate solution (100mL) is added to (6S)-[6-(tert-butoxycarbonyl amino methyl)-3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (9.82g, 23.7mmol), mixture was in stirring at room 1 hour for tert.-butyl acetate for 1R, 5S.Then, solvent is fallen in underpressure distillation.Resistates is dissolved in the methylene dichloride.Drip triethylamine to this solution, the powder that is produced is collected by filtering, and uses washed with dichloromethane then, and is dry then, to obtain the 4.02g white powder.This powder is the title target compound (2.14g, 43%) of white powder with ethanol and ethyl acetate washing with the acquisition.
(embodiment 22) [(1R, 5S, 6S)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate tosilate (exemplary compounds 8, the tosilate of the compound of embodiment 21)
Figure GPA00001143598100751
Will [(1R, 5S, 6S)-6-(tert-butoxycarbonyl amino) methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (1152.23g 391.6mmol) is dissolved in the benzene (1.2L) tert.-butyl acetate.(145.57g 1173mmol) with tosic acid monohydrate (89.39g), stirred the mixture 2 hours under refluxing to add thioanisole to this solution then.Mixture is in the room temperature standing over night, and the powder that is produced is collected by filtering.The powder that obtains washs with ethyl acetate, and is dry then, is the target compound (88.29g, 59%) of white powder with the acquisition.
(embodiment 23) [(1S, 5R, 6R)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 8, the optical isomer of the compound of embodiment 21)
Figure GPA00001143598100761
(23-a) [(1S, 5R, 6R)-6-(tert-butoxycarbonyl amino) methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Will [(1S, 5R, 6R)-6-(nitro methyl)-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (peak 2,6.90g 23.36mmol) are dissolved in ethanol (80mL) and the water (20mL) tert.-butyl acetate.To this solution add iron powder (6.52g, 116.8mmol) and ammonium chloride (1.25g 23.36mmol), stirred the mixture under the backflow 4.5 hours being heated to.Make the mixture cooling, filter by Yin Shi salt then, to remove insoluble substance.Add (Boc) to filtered solution 2O (15.30g 70.08mmol), uses the 2N sodium hydroxide solution to make filtered solution become alkalescence (pH＞9) then, and in stirring at room 2 hours.Concentrated solution, resistates dilutes with ethyl acetate.Diluent water and saturated brine washing, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (8.51g, 99%) of colorless oil by silica gel chromatography with the acquisition.
(23-b) [(1S, 5R, 6R)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
Will [(1S, 5R, 6R)-and 6-[(tert-butoxycarbonyl amino) methyl-3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (8.54g 23.36mmol) is dissolved in 4N hydrochloric acid-ethyl acetate solution (100mL) tert.-butyl acetate, and solution was in stirring at room 2 hours.Then, solvent is fallen in underpressure distillation.By adding methylene dichloride suspension resistates.Drip triethylamine to suspension then, the powder that is produced is collected by filtering.The institute's powder that obtains washed with dichloromethane with Virahol-ethyl acetate washing, is the target compound (2.7g, 55%) of white powder with the acquisition then.
(embodiment 24) (±)-(1R, 5R, 6R)-and 6-amino methyl-3-[(methyl sulfo-) methyl] dicyclo [3.2.0] heptan-3-alkene-6-yl } acetate (exemplary compounds 18)
(24-a) (±)-[(1R, 5R, 6R)-and 3-(hydroxymethyl)-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With the mode identical with paragraph (1-c) by (±) that in paragraph (19-d), produce-[(1R, 5R)-3-(hydroxymethyl) dicyclo [3.2.0] heptan-3-alkene-6-fork] (726mg 3.07mmol) obtains to be the target compound of oily matter to tert.-butyl acetate.
(24-b) (±)-[(1R, 5R, 6R)-and 3-[(methyl sulfo-) methyl]-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With triphenylphosphine (1.85g, 7.05mmol) and tetracol phenixin (0.78mL, 8.14mmol) add to (±)-[(1R, 5R, 6R)-and 3-(hydroxymethyl)-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (807mg, 2.71mmol) dimethyl formamide solution (8.0mL), mixture was in stirring at room 1 hour.Add entry to this reaction soln, extract with diethyl ether afterwards.Organic layer washs with saturated brine, then through anhydrous sodium sulfate drying.Resistates after filtration and concentrating under reduced pressure.Then, with (±) that obtained-[(1R, 5R, 6R)-3-(chloromethyl)-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] crude product of tert.-butyl acetate is dissolved in the dimethyl formamide (10mL).(570mg 8.14mmol), stirred the mixture 4 hours in this temperature under agitation to add sodium methyl mercaptide in 0 ℃ to this solution.Reaction soln dilutes with ethyl acetate, and is separated into water layer and organic layer.Organic layer is with 1M aqueous sodium hydroxide solution, water and saturated brine washing, then through anhydrous sodium sulfate drying.Resistates after filtration and concentrating under reduced pressure.Then, institute's crude product that obtains is the target compound (632mg, 71%) of oily matter by silica gel chromatography with the acquisition.
(24-c) (±)-(1R, 5R, 6R)-and the 6-{[(tert-butoxycarbonyl) amino] methyl }-3-[(methyl sulfo-) methyl] dicyclo [3.2.0] heptan-3-alkene-6-yl } tert.-butyl acetate
In the mode identical with paragraph (3-a) by (±)-[(1R, 5R, 6R)-and 3-[(methyl sulfo-) methyl]-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (632mg 1.93mmol) obtains to be the target compound of oily matter (755mg, 98%) to tert.-butyl acetate.
(24-d) (±)-(1R, 5R, 6R)-and 6-amino methyl-3-[(methyl sulfo-) methyl] dicyclo [3.2.0] heptan-3-alkene-6-yl } acetate
In the mode identical with paragraph (1-e) by (±)-{ (1R, 5R, 6R)-and the 6-{[(tert-butoxycarbonyl) amino] methyl }-3-[(methyl sulfo-) methyl] dicyclo [3.2.0] heptan-3-alkene-6-yl } tert.-butyl acetate (755mg, 1.90mmol) obtain to be the target compound of white solid (342mg, 75%).
(embodiment 25) [(1R, 5S, 6S)-the 6-amino methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 4, the optical activity form of the compound of embodiment 7)
Figure GPA00001143598100781
(25-a) (±)-[(1R, 5S, 6S)-and 3-methyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] fractionation of tert.-butyl acetate
Use is by Daicel Chemical Industries, Ltd. the Chiralpak IC (normal hexane: EtOH=98: 2 of Sheng Chaning, 1.0mL/ minute, 40 ℃) fractionation (±)-[(1R, 5S, 6S)-and 3-methyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (15g), to obtain 5.5g peak 1 (retention time: 6.1 minutes) and 5.2g peak 2 (retention time: 7.7 minutes) respectively.
(25-b) [(1R, 5S, 6S)-6-(tert-butoxycarbonyl amino) methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Will [(1R, 5S, 6S)-and 3-methyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (peak 1,5.5g 19.5mmol) are dissolved in the ethanol (40mL) tert.-butyl acetate.Add Raney's nickel (1.2g) to this solution.(3.9g, 78.2mmol), mixture stirs in ambient temperature overnight under agitation to add a hydrazine hydrate to mixture.Filtration catalizer concentrates filtered solution then.Resistates dilutes with ethyl acetate, and water and saturated brine washing are dry then, concentrate then.Resistates is dissolved in the ethanol (50mL).(8.53g, 39.1mmol), mixture was in stirring at room 2 hours to add tert-Butyl dicarbonate to this solution.Concentrated reaction solution, resistates water and saturated brine washing, dry then, concentrate then.Resistates is the target compound (6.8g, 99%) of oily matter by silica gel column chromatography (100g) purifying with the acquisition.
(25-c) [(1R, 5S, 6S)-the 6-amino methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] the acetate Phenylsulfonic acid
With [(1R, 5S, 6S)-6-(tert-butoxycarbonyl amino) methyl-3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (6.8g, 13.9mmol) and Phenylsulfonic acid monohydrate (3.79g, 21mmol) add in the benzene (40mL), under agitation heated mixt is 2 hours.The solid by filtration that is produced is collected, and is the target compound (5.6g, 81%) of white solid with the acquisition.
(25-d) [(1R, 5S, 6S)-the 6-amino methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate
Will [(1R, 5S, 6S)-6-tert-butoxycarbonyl amino methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] (5.6g 15.8mmol) is suspended in the methylene dichloride (50mL) the acetate Phenylsulfonic acid.(4.4ml, 31.7mmol), mixture was in stirring at room 1 hour to add triethylamine to suspension.The solid by filtration that is produced is collected, and uses washed with isopropyl alcohol, is the target compound (2.4g, 77%) of white solid with the acquisition.
(embodiment 26) [(1R, 5S, 6S)-the 6-amino methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 4, the optical activity form of the compound of embodiment 7 are production method with the difference of the compound of embodiment 25)
(26-a) [(1S, 5R, 6R)-6-(tert-butoxycarbonyl amino) methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Will [(1S, 5R, 6R)-and 3-methyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (peak 2,5.2g 18.5mmol) are dissolved in the ethanol (40mL) tert.-butyl acetate.Add Raney's nickel (1.2g) to this solution.(3.7g, 74.1mmol), mixture stirs in ambient temperature overnight under agitation to add a hydrazine hydrate to mixture.Filtration catalizer concentrates filtered solution then.Resistates dilutes with ethyl acetate, and water and saturated brine washing are dry then, concentrate then.Resistates is dissolved in the ethanol (50mL).(7.99g, 36.6mmol), mixture was in stirring at room 2 hours to add tert-Butyl dicarbonate to this solution.Concentrated reaction solution, resistates water and saturated brine washing, dry then, concentrate then.Resistates is the target compound (6.4g, 99%) of oily matter by silica gel column chromatography (100g) purifying with the acquisition.
(26-b) [(1S, 5R, 6R)-the 6-amino methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] the acetate Phenylsulfonic acid
With [(1S, 5R, 6R)-6-(tert-butoxycarbonyl amino) methyl-3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (6.4g, 18.2mmol) and Phenylsulfonic acid monohydrate (3.53g, 20mmol) add in the benzene (40mL), under agitation heated mixt is 2 hours.The solid by filtration that is produced is collected, and is the target compound (5.8g, 90%) of white solid with the acquisition.
(26-c) [(1S, 5R, 6R)-the 6-amino methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate
Will [(1S, 5R, 6R)-6-tert-butoxycarbonyl amino methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] (5.8g 16.4mmol) is suspended in the methylene dichloride (50mL) the acetate Phenylsulfonic acid.To suspension add triethylamine (4.6ml, 32.7mmol), in stirring at room mixture 1 hour.The solid by filtration that is produced is collected, and uses washed with isopropyl alcohol, is the target compound (2.0g, 63%) of white solid with the acquisition.
(embodiment 27) (±)-[(1R, 5S, 6S)-6-amino methyl-3, and 4-dimethyl-dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 19, the no salt form of the compound of embodiment 20)
(27-a) 3,4-dimethyl-3-hydroxyl-6-heptenoic acid methyl esters
With 3-methyl-methyl heptenone (J.Chem.Soc., Chem.Comm.19,1991,1399) (17g, 106mmol) and methyl bromoacetate (24.4g, 159mmol) be dissolved in the tetrahydrofuran (THF) (100mL), under refluxing, drip tetrahydrofuran (THF) (50mL) (zinc (10.4g, 159mmol) and trimethyl borate (30mL)) solution to this solution.After refluxing 3 hours, mixture is cooled to room temperature, to its saturated aqueous solution (100mL) that adds glycerine (30mL) and ammonium chloride, carry out twice extraction with ethyl acetate afterwards.Wash ethyl acetate layer with saturated brine, dry then, concentrate then.Resistates is the target compound (11.7g, 60%) of oily matter by silica gel column chromatography (200g) purifying with the acquisition.
(27-b) 3,4-dimethyl-3-hydroxyl-6-heptenoic acid
With 3, (11.7g 62.8mmol) is dissolved in 2N potassium hydroxide-methanol solution (44mL) 4-dimethyl-3-hydroxyl-6-heptenoic acid methyl esters, and solution stirs in ambient temperature overnight.Concentrated reaction solution is dissolved in the water (30mL) then, and washs with ether.Use aqueous hydrochloric acid make water layer become acidity (＜pH=2), carry out twice extraction with ethyl acetate afterwards.Ethyl acetate layer washs with saturated brine, and is dry then, concentrate then, and be the target compound (10.1g, 93%) of oily matter with the acquisition.This compound need not purifying and promptly can be used for next step.
(27-c) (±)-(1R, 5S)-3,4-dimethyl-[3.2.0] heptan-3-alkene-6-pitches tert.-butyl acetate
With 3,4-dimethyl-3-hydroxyl-6-heptenoic acid (10.1g, 54.2mmol) and potassium acetate (12.8g 130mmol) is dissolved in the diacetyl oxide (100mL), and solution is in stirring at room 30 minutes, stirs 3 hours being heated under the backflow then.Reaction soln is placed ice bath, carry out 3 extractions with ether-pentane afterwards.Organic layer concentrates then with aqueous sodium hydroxide solution and saturated brine solution washing, to obtain oily matter.This oily matter is dissolved in the tetrahydrofuran (THF) (70mL), and this drips of solution added under ice-cooled tetrahydrofuran (THF) (50mL) (sodium hydride (and 2.17g, 54.3mmol) and dimethoxy phosphoryl tert.-butyl acetate (12.2g, 54.3mmol) solution.This reaction soln is inclined to ammonium chloride saturated aqueous solution, use ethyl acetate extraction afterwards.Ethyl acetate layer washs with saturated brine, and is dry then, concentrates then.Resistates is the target compound (4.2g, 33%) of oily matter by silica gel column chromatography (200g) purifying with the acquisition.
(27-d) (±)-[(1R, 5S, 6S)-3, and 4-dimethyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-(1R, 5S)-3,4-dimethyl-[3.2.0] heptan-3-alkene-(4.2g 17.9mmol) is dissolved in the Nitromethane 99Min. (20mL) 6-fork tert.-butyl acetate.Add 1 to this solution, (4.9g, 27mmol), mixture is in stirred overnight at room temperature for 8-diazabicyclo [5.4.0] 11 carbon-7-alkene.Add the potassium primary phosphate saturated aqueous solution to it, use ethyl acetate extraction afterwards.Then, organic layer is through anhydrous magnesium sulfate drying, and solvent is fallen in underpressure distillation.Resistates is the target compound (4.5g, 85%) of colorless oil by silica gel chromatography with the acquisition.
(27-e) [(1R, 5S, 6S)-6-(tert-butoxycarbonyl amino) methyl-3, and 4-dimethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Use (±)-[(1R, 5S, 6S)-3,4-dimethyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate that (4.5g is 15.2mmol) to obtain target compound (5.5g, 99%) into oily matter with the identical mode of paragraph (3-a).
(27-f) (±)-[(1R, 5S, 6S)-6-amino methyl-3, and 4-dimethyl-dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
Use [(1R, 5S, 6S)-6-(tert-butoxycarbonyl amino) methyl-3,4-dimethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (1.7g, 4.65mmol) to obtain target compound (440mg, 45%) into white solid with the identical mode of paragraph (3-b).
(embodiment 28) (±)-[(1R, 5S, 6S)-6-amino methyl-3-(2-fluoro ethyl)-and dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 30)
(28-a) (E)-4-(2-hydroxyethyl)-heptan-2,6-diolefinic acid ethyl ester
(18g is 140mmol) with ethoxy carbonyl triphenyl phosphorane (35g, 104mmol) stirred overnight in toluene (200mL) with 3-allyl group-tetrahydrofuran (THF)-2-alcohol.Concentrated reaction solution, resistates is the target compound (15.8g, 61.1%) of oily matter by silica gel chromatography with the acquisition.
(28-b) (E)-4-(2-fluoro ethyl)-heptan-2,6-diolefinic acid ethyl ester
With (E)-4-(2-hydroxyethyl)-heptan-2, (5g 27.1mmol) is dissolved in the tetrahydrofuran (THF) (40mL) 6-diolefinic acid ethyl ester.(4.8g 29.8mmol), stirred the mixture 1 hour to this solution adding DAST under ice-cooled.With reaction soln impouring saturated sodium bicarbonate aqueous solution, use ethyl acetate extraction afterwards.Ethyl acetate layer washs with saturated brine, and is dry then, concentrates then.Resistates is the target compound (2.2g, 44%) of oily matter by silica gel column chromatography (200g) purifying with the acquisition.
(28-c) (±)-[(1R, 5S, 6S)-3-(2-fluoro ethyl)-and 6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Use (E)-4-(2-fluoro ethyl)-heptan-2,6-diolefinic acid ethyl ester (2.2g, 11.9mmol) with paragraph (4342-b ,-c-obtains target compound (870mg, 23%) with-d) identical mode.
(28-d) [(1R, 5S, 6S)-and 6-(tert-butoxycarbonyl amino) methyl-3-(2-fluoro ethyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Use (±)-[(1R, 5S, 6S)-and 3-(2-fluoro ethyl)-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (870mg is 2.77mmol) to obtain target compound (700mg, 65.8%) into oily matter with the identical mode of paragraph (3-a) for tert.-butyl acetate.
(28-e) (±)-[(1R, 5S, 6S)-6-amino methyl-3-(2-fluoro ethyl)-and dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
Use [(1R, 5S, 6S)-and 6-(tert-butoxycarbonyl amino) methyl-3-(2-fluoro ethyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (700mg is 1.83mmol) to obtain target compound (330mg, 79%) into white solid with the identical mode of paragraph (3-b) for tert.-butyl acetate.
(embodiment 29) (±)-[(1S, 5R, 6R)-6-(amino methyl)-and 4-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 5)
(29-a) 3-hydroxy-3-methyl heptan-6-olefin(e) acid
Trimethyl borate (15mL), zinc powder (are washed and dried for standby with dilute hydrochloric acid in advance, 4.24g) and bromo-acetic acid tert-butyl (9.91mL, 48.6mmol) add in order oneself-5-alkene-2-ketone (5.29g, 53.9mmol) tetrahydrofuran solution (15mL), use oil bath that mixture heating up to 30 ℃ is reached 30 minutes, return to room temperature then, and stirred 3 hours.Is organic layer and water layer by adding glycerine, saturated aqueous ammonium chloride and saturated brine with mixture separation, with diethyl ether water layer is extracted then.Merge these organic layers, with the saturated brine washing, then through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation then then.Add 2N potassium hydroxide-methanol solution (50mL) to resistates, in stirring at room mixture 6 hours.Solvent is fallen in underpressure distillation.Add the 1N aqueous sodium hydroxide solution to resistates then, wash with diethyl ether afterwards.Make water layer become acidity at the ice-cooled concentrated hydrochloric acid that uses down, extract with diethyl ether afterwards.Organic layer washs with saturated brine, then through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, is the target compound (5.24g, 75%) of light yellow oil with the acquisition.
(29-b) (±)-(1S, 5R)-4-methyl bicycle [3.2.0] heptan-3-alkene-6-ketone
With 3-hydroxy-3-methyl heptan-(5.24g 36.4mmol) is dissolved in the diacetyl oxide (40mL) the 6-olefin(e) acid.(12.52g, 127mmol), mixture was in stirring at room 2 hours to add potassium acetate to this solution.Reaction soln is heated to backflow, and stirred 4 hours.Add frozen water and toluene to this reaction soln then, this mixture stirs in ambient temperature overnight.Is water layer and organic layer by adding diethyl ether and saturated brine with mixture separation.Then, wash organic layer, and through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation with saturated brine.Resistates is the target compound (1.10g, 17%, non-enantiomer mixture) of light yellow oil by the silica gel chromatography purifying with the acquisition.
(29-c) (±)-(1S, 5R)-4-methyl bicycle [3.2.0] heptan-3-alkene-6-pitches tert.-butyl acetate
Ice-cooled following with (±)-(1S; 5R)-4-methyl bicycle [3.2.0] heptan-3-alkene-6-ketone (1.10g; 9.0mmol) add to previously prepared reaction soln; this reaction soln passes through sodium hydride (＞65% oiliness; 342.8mg; 9.0mmol) (2.08g, tetrahydrofuran solution 9.3mmol) (10mL) prepares, restir mixture 2 hours to add to dimethoxy phosphoryl tert.-butyl acetate.By adding ammonium chloride saturated aqueous solution and saturated brine reaction soln is separated into water layer and organic layer.With ethyl acetate water layer is extracted.Merge these organic layers, then with the saturated brine washing, then through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (1.59g, 80%, E/Z mixture) of light yellow oil by silica gel chromatography with the acquisition.
(29-d) (±)-[(1S, 5R, 6R)-6-(nitro methyl)-and 4-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
Use (±)-[(1S, 5R)-(1.59g is 7.22mmol) to obtain target compound (2.02g,＜100%) into colorless oil with the identical mode of embodiment (8-d) for 4-methyl bicycle [3.2.0] heptan-3-alkene-6-fork tert.-butyl acetate.
(29-e) (±)-[(1S, 5R, 6R)-6-(amino methyl)-and 4-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate
Use (±)-[(1S, 5R, 6R)-and 6-(nitro methyl)-4-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] (1.00g is 3.2mmol) to obtain target compound (125.1mg, 20%) into white powder with the identical mode of embodiment (8-e) for tert.-butyl acetate.
(embodiment 30) [(1R, 5S, 6S)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (exemplary compounds 20)
Figure GPA00001143598100851
Will [(1R, 5S, 6S)-and 3-ethyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (7.0g 23.7mmol) is dissolved in ethanol (60mL) and the water (21mL) tert.-butyl acetate.To this solution add iron powder (13.27g, 237mmol) and ammonium chloride (628.1mg 11.9mmol), stirred the mixture under the backflow 5.5 hours being heated to.Make the mixture cooling, filter then with saturated brine, saturated sodium bicarbonate aqueous solution and ethyl acetate dilution, and by Yin Shi salt, to remove insoluble substance.Filtered solution is separated into organic layer and water layer.Organic layer washs with saturated brine.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (7.02g,＜100%) of light yellow oil with the acquisition.
(embodiment 31) [(1R, 5S, 6S)-6-(amino methyl)-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate benzene sulfonate (exemplary compounds 8, optically active benzene sulfonate)
Figure GPA00001143598100852
By heating will (1R, 5S, 6S)-6-(amino methyl)-3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (4.50g 20.6mmol) is dissolved in the 1M aqueous solution (22.7mL) of Phenylsulfonic acid monohydrate acetate, makes solution be cooled to room temperature then.The solid by filtration that is produced is collected.The vacuum pump drying is used in described solid water (15mL) washing then, is the target compound (6.45g, 77%) of colorless solid shape with the acquisition.
(embodiment 32) (±)-(1S, 5R, 6R)-6-(amino methyl)-spiral shell [dicyclo [3.2.0] heptan-2,1 '-the ring fourth]-3-alkene-6-yl } acetate (exemplary compounds 39)
(32-a) ring fourth fork methyl acetate
Down (＞65% oiliness, 3.62g 95mmol) add to phosphonoacetic acid trimethyl (18.21g, tetrahydrofuran solution 100mmol) (200mL), and stirring the mixture 1 hour with sodium hydride ice-cooled.(5.00g, tetrahydrofuran solution 71.4mmol) (50mL) make mixture return to room temperature then, and stir 1.5 hours to drip cyclobutanone to reaction soln.Add ammonium chloride saturated aqueous solution to reaction soln, use hexane extraction afterwards.Organic layer washs with saturated brine, and through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, is the target compound (18.94g,＜100%) of light yellow oil with the acquisition.
(32-b) ring fourth fork ethanol
Down (1.89g, (18.92g,＜71.4mmol) tetrahydrofuran solution (200mL) stirred the mixture under this state 2.5 hours 50mmol) to add to ring fourth fork methyl acetate with lithium aluminium hydride ice-cooled.Add methyl alcohol (10mL) and 1N aqueous sodium hydroxide solution (5mL) to it, in room temperature restir mixture 1 hour, then by the filtration of Yin Shi salt.Resistates washs with ethyl acetate and saturated brine.Merge these filtered solutions, and be separated into water layer and organic layer.Organic layer washs with saturated brine, then through anhydrous sodium sulfate drying.Solvent is fallen in underpressure distillation, is the target compound (22.14g,＜84%) of light yellow oil with the acquisition.
(32-c) (1-vinyl cyclobutyl) ethanol
To encircle fourth fork ethanol (22.14g,＜60mmol) be dissolved in the triethly orthoacetate (25mL).(1.02g 11.6mmol), stirred the mixture under the backflow 1 day being heated to add phenol to this solution.Make the mixture cooling, add saturated brine to it then, use ethyl acetate extraction afterwards.Organic layer washs with saturated brine, and then through anhydrous sodium sulfate drying, solvent is fallen in underpressure distillation.Add 2N potassium hydroxide-methanol solution (80mL) to resistates, stir the mixture in ambient temperature overnight.Solvent is fallen in underpressure distillation, then resistates is dissolved in the 2N aqueous sodium hydroxide solution, and washs with diethyl ether.Make water layer become acidity at the ice-cooled concentrated hydrochloric acid that uses down, use ethyl acetate extraction afterwards.Organic layer washs with saturated brine, and then through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation.Resistates is dissolved in the tetrahydrofuran (THF) (70mL).Then ice-cooled down to this solution add lithium aluminium hydride (948.8mg, 25mmol).Make mixture return to room temperature, stirred 7 hours being heated under the backflow then.Down add methyl alcohol (1.5mL) and 1N aqueous sodium hydroxide solution (1.5mL) ice-cooled, in room temperature restir mixture 1 hour, then by the filtration of Yin Shi salt to it.Resistates washs with methylene dichloride and saturated brine.Merge these filtered solutions, and be separated into water layer and organic layer.Organic layer is with 1N aqueous sodium hydroxide solution and saturated brine washing, then through anhydrous sodium sulfate drying.Solvent is fallen in underpressure distillation, is the target compound (1.94g, 25%) of colorless oil with the acquisition.
(32-d) 3-hydroxyl-4-(1-vinyl cyclobutyl) methyl-butyrate
(1.88mL, dichloromethane solution 22.5mmol) (80mL) are cooled to-78 ℃, drip dimethyl sulfoxide (DMSO) (3.0mL, dichloromethane solution 43.0mmol) (20mL) to it with oxalyl chloride.Stirred the mixture 10 minutes in-78 ℃.Then, (1.94g, dichloromethane solution 15mmol) (20mL) was in-78 ℃ of restir mixtures 3 hours to its dropping (1-vinyl cyclobutyl) ethanol.(8mL 60mmol), makes mixture return to room temperature gradually, stirs then 1 hour to add triethylamine to it.Add 1N hydrochloric acid and saturated brine to it, use dichloromethane extraction afterwards.Organic layer washs with saturated brine, and then through anhydrous sodium sulfate drying, solvent is fallen in underpressure distillation.Resistates is dissolved in the tetrahydrofuran (THF) (40mL).Add trimethyl borate (6.2mL) and zinc powder (4.46g) to this solution, then to its dripping bromine methyl acetate (4.2mL, 44.1mmol).Be that stirring at room after 30 minutes, is heated to 40 ℃ with reaction soln, and stirred 20 minutes.Make mixture return to room temperature again, and stirred 1 hour, add glycerine, water and saturated brine to it then, use ethyl acetate extraction afterwards.Organic layer washs with saturated brine, and then through anhydrous sodium sulfate drying, solvent is fallen in underpressure distillation.Resistates is the target compound (1.22g, 40%) of colorless oil by the column chromatography purifying with the acquisition.
(32-e) 3-hydroxyl-4-(1-vinyl cyclobutyl) butyric acid
(1.22g is 6.16mmol) to obtain target compound (1.16g,＜100%) into colorless oil with the identical mode of embodiment (8-b) to use 3-hydroxyl-4-(1-vinyl cyclobutyl) methyl-butyrate.
(32-f) (±)-(1S, 5R)-spiral shell [dicyclo [3.2.0] heptan-2,1 '-the ring fourth]-3-alkene-6-pitches tert.-butyl acetate
(1.16g 6.16mmol) is dissolved in N,N-dimethylacetamide (12mL) and the diacetyl oxide (1.5mL) with 3-hydroxyl-4-(1-vinyl cyclobutyl) butyric acid.(664.9mg 6.77mmol), stirred the mixture 4 hours in 140 ℃ to add potassium acetate to this solution.Add frozen water and saturated brine to this reaction soln, and stirred the mixture 2 hours, use ethyl acetate extraction afterwards.Organic layer washs by this in proper order with saturated sodium bicarbonate aqueous solution and saturated brine, and through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation then.Resistates is dissolved in the tetrahydrofuran (THF) (30mL); and this solution added in advance by dimethoxy phosphoryl tert.-butyl acetate (1.82g; 10mmol) and sodium hydride (63% oiliness, 342.9mg is in the reaction soln of tetrahydrofuran solution 9mmol) (30mL) preparation.In stirring at room mixture 1 hour, by adding ammonium chloride saturated aqueous solution and saturated brine reaction soln is separated into water layer and organic layer then.With ethyl acetate water layer is extracted.Merge these organic layers, then with the saturated brine washing, then through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (1.07g, 70%, E/Z mixture) of light yellow oil by silica gel chromatography with the acquisition.
(32-g) (±)-(1S, 5R, 6R)-6-(nitro methyl) spiral shell [dicyclo [3.2.0] heptan-2,1 '-the ring fourth]-3-alkene-6-yl } tert.-butyl acetate
With (±)-(1S, 5R)-spiral shell [dicyclo [3.2.0] heptan-2,1 '-the ring fourth]-3-alkene-6-fork tert.-butyl acetate is dissolved in the Nitromethane 99Min. (8mL).Add 1 to this solution, and 8-diazabicyclo [5.4.0] 11 carbon-7-alkene (0.97mL, 6.51mmol), under agitation in 50-60 ℃ of heated mixt 5.5 hours.Make the mixture cooling, add the potassium primary phosphate saturated aqueous solution to it then, use ethyl acetate extraction afterwards.Then, organic layer is through anhydrous magnesium sulfate drying, and solvent is fallen in underpressure distillation.Resistates is the target compound (1.08g, 81%) of light yellow oil by silica gel chromatography with the acquisition.
(32-h) (±)-(1S, 5R, 6R)-6-(amino methyl)-spiral shell [dicyclo [3.2.0] heptan-2,1 '-the ring fourth]-3-alkene-6-yl } acetate
With (±)-(1S, 5R, 6R)-6-(nitro methyl) spiral shell [dicyclo [3.2.0] heptan-2,1 '-ring fourth]-3-alkene-6-yl (1.08g 3.52mmol) is dissolved in ethanol (15mL) and the water (6mL) tert.-butyl acetate.To this solution add iron powder (0.99g, 17.6mmol) and ammonium chloride (93.3mg, 1.76mmol) in, stirred the mixture under the backflow 4 hours being heated to.Make the mixture cooling, filter then with saturated brine, saturated sodium bicarbonate aqueous solution and ethyl acetate dilution, and by Yin Shi salt, to remove insoluble substance.Filtered solution is separated into organic layer and water layer.Wash organic layer with saturated brine, then through anhydrous magnesium sulfate drying, solvent is fallen in underpressure distillation then.Add 4N hydrochloric acid-ethyl acetate solution (10mL) to resistates, in stirring at room mixture 1 hour.Then, solvent is fallen in underpressure distillation.Resistates is suspended in the methylene dichloride.Drip triethylamine to suspension, the powder that is produced is collected by filtering, and uses washed with dichloromethane then, and is dry then, is the target compound (439.2mg, 57%) of white powder with the acquisition.
(embodiment 33) (±)-(1S, 5R, 6R)-6-(amino methyl)-spiral shell [dicyclo [3.2.0] heptan-2,1 '-ring penta]-3-alkene-6-yl } acetate
(33-a) cyclopentylidene methyl acetate
(8.42g is 100mmol) to obtain target compound (14.31g,＜100%) into light yellow oil with the identical mode of embodiment (32-a) to use cyclopentanone.
(33-b) cyclopentylidene ethanol
(7.16g is 50mmol) to obtain target compound (8.90g comprises ethyl acetate) into light yellow oil with the identical mode of embodiment (32-b) to use the cyclopentylidene methyl acetate.
(33-c) (1-vinyl cyclopentyl) ethanol
Use cyclopentylidene ethanol (8.90g,＜50mmol) to obtain target compound (0.47g, 7%) into colorless oil with the identical mode of embodiment (32-c).
(33-d) 3-hydroxyl-4-(1-vinyl cyclopentyl) methyl-butyrate
(0.47g is 3.36mmol) to obtain target compound (417.3mg, 48%) into colorless oil with the identical mode of embodiment (32-d) to use (1-vinyl cyclopentyl) ethanol.
(33-e) 3-hydroxyl-4-(1-vinyl cyclopentyl) butyric acid
(417.3mg is 1.97mmol) to obtain target compound (lingering section solvent into light brown oily thing with the identical mode of embodiment (32-e) to use 3-hydroxyl-4-(1-vinyl cyclopentyl) methyl-butyrate; 504.1mg,＜100%).
(33-f) (±)-(1S, 5R)-spiral shell [dicyclo [3.2.0] heptan-2,1 '-ring penta]-3-alkene-6-pitches tert.-butyl acetate
Use 3-hydroxyl-4-(1-vinyl cyclopentyl) butyric acid (504.1mg,＜1.9mmol) to obtain target compound (232.3mg, 47%, E/Z mixture) into light yellow oil with the identical mode of embodiment (32-f).
(33-g) (±)-(1S, 5R, 6R)-6-(nitro methyl) spiral shell [dicyclo [3.2.0] heptan-2,1 '-ring penta]-3-alkene-6-yl } tert.-butyl acetate
Use (±)-(1S, 5R)-spiral shell [dicyclo [3.2.0] heptan-2,1 '-ring penta]-(232.3mg is 0.89mmol) to obtain target compound (250.2mg, 88%) into colorless oil with the identical mode of embodiment (32-g) for 3-alkene-6-fork tert.-butyl acetate.
(33-h) (±)-(1S, 5R, 6R)-6-(amino methyl)-spiral shell [dicyclo [3.2.0] heptan-2,1 '-ring penta]-3-alkene-6-yl } acetate
Use (±)-{ (1S, 5R, 6R)-6-(nitro methyl) spiral shell [dicyclo [3.2.0] heptan-2,1 '-ring penta]-3-alkene-6-yl } tert.-butyl acetate (249.0mg, 0.77mmol) to obtain target compound (124.4mg, 72%) into white powder with the identical mode of embodiment (32-h).
(embodiment 34) (±)-[(1S, 5R, 6R)-6-(amino methyl)-and 3-cyclobutyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
(34-a) (±)-2-cyclobutyl penta-obtusilic acid ethyl ester
In 10 minutes to the 2-cyclobutyl ethyl acetate (2.32g that is cooled to-78 ℃, 16.3mmol) tetrahydrofuran (THF) (40mL) solution drip 1.9M tetramethyl-disilazane sodium-tetrahydrofuran solution (9.44mL, 18.0mmol), stirred the mixture 10 minutes in-78 ℃ then.Subsequently, (7.90g, tetrahydrofuran (THF) 65.3mmol) (10mL) solution was in stirring at room mixture 17 hours to drip allyl bromide 98 to it in 10 minutes.Use water treatment, the volatility part is removed in decompression then.Add ethyl acetate and water to obtaining liquid, institute's organic layer that obtains is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (1.80g, 61%) of yellow oil with the acquisition.
(34-b) (±)-4-cyclobutyl penta-2,6-diolefinic acid ethyl ester
In 40 minutes to (±)-2-cyclobutyl penta-obtusilic acid ethyl ester (1.80g that is cooled to-78 ℃, 9.9mmol) toluene (20mL) solution drip 1M diisobutyl aluminium hydride/toluene solution (9.88mL, 9.9mmol), stirred the mixture 2 hours in-78 ℃ then.In 5 minutes, drip 30% acetic acid aqueous solution (9.4mL) to it.Then, organic layer is through dried over mgso.After removing by filter insoluble substance, (3.78g 10.9mmol) added to liquid, in stirring at room mixture 18 hours with (triphenyl phosphorus fork) ethyl acetate.Solvent is fallen in underpressure distillation, and resistates is by the column chromatography purifying, to obtain to containing the colorless oil mixture of target compound.This compound need not to be further purified and promptly can be used for next reaction.
(34-c) (±)-4-cyclobutyl penta-2, the 6-diolefinic acid
5N aqueous sodium hydroxide solution (15mL) is added to (±)-4-cyclobutyl penta-2 that obtains in aforementioned paragraphs, ethanol (20mL) solution of 6-diolefinic acid ethyl ester, mixture stirred 2 hours in 60 ℃ subsequently in stirring at room 1.5 hours.Make the mixture cooling, solvent is fallen in underpressure distillation then.Resistates is water-soluble.The water layer washed with dichloromethane is used 2N aqueous hydrochloric acid (100mL) neutralization then, uses dichloromethane extraction afterwards.Organic layer is through dried over mgso.Solvent is fallen in underpressure distillation, to obtain to containing the yellow oily mixture of target compound.This compound need not to be further purified and promptly can be used for next reaction.
(34-d) (±)-[(1S, 5R)-3-cyclobutyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (E/Z mixture)
With potassium acetate (1.05g, 10.7mmol) add to (±)-4-cyclobutyl penta-2 that in aforementioned paragraphs, obtains, and the N,N-DIMETHYLACETAMIDE of 6-diolefinic acid (20mL) solution and diacetyl oxide (1.09g, 10.7mmol), in stirring at room mixture 1 hour, stirred 2 hours in 120 ℃ then.With frozen water and 2N aqueous sodium hydroxide solution treating mixture, afterwards with hexane and diethyl ether extraction.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, to obtain light yellow oil.The material that herein obtains is added to the dimethyl phosphine ethyl acetoacetic acid tert-butyl ester (0.84g that stirs 1 hour in advance, 3.7mmol), lithium chloride (0.16g, 3.7mmol) and 1,8-diazabicyclo [5.4.0] 11 carbon-7-alkene (0.59g, 3.7mmol) acetonitrile (20mL) solution, restir mixture 12 hours.Use water treatment, the volatile matter part is fallen in underpressure distillation then, uses ethyl acetate extraction afterwards.Organic layer is through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (0.36g, 24%) (with respect to (00-b) 4-cyclobutyl penta-2, the yield of 6-diolefinic acid ethyl ester) of yellow oil by silica gel chromatography with the acquisition.
(34-e) (±)-[(1S, 5R, 6R)-6-(nitro methyl)-and 3-cyclobutyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
With (±)-[(1S, 5R)-3-cyclobutyl dicyclo [3.2.0] heptan-3-alkene-6-fork] (0.36g 1.4mmol) is dissolved in the Nitromethane 99Min. (20mL) tert.-butyl acetate.Add 1 to this solution, (0.26g's 8-diazabicyclo [5.4.0] 11 carbon-7-alkene 1.7mmol), stirred the mixture 3 hours in 60 ℃.Add 1 to it again, (0.26g's 8-diazabicyclo [5.4.0] 11 carbon-7-alkene 1.7mmol), stirred the mixture 4.5 hours in 60 ℃.Make the mixture cooling, add the potassium primary phosphate saturated aqueous solution to it then, use dichloromethane extraction afterwards.Organic layer is through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (0.40g, 90%) of light yellow oil by the silica gel chromatography purifying with the acquisition.
(34-f) (±)-[(1S, 5R, 6R)-6-(amino methyl)-and 3-cyclobutyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
With (±)-[(1S, 5R, 6R)-6-(nitro methyl)-3-cyclobutyl dicyclo [3.2.0] heptan-3-alkene-6-fork] (0.40g 1.2mmol) is dissolved in the ethanol (20mL) tert.-butyl acetate.(0.56g, 10.0mmol), (0.07g, the 1.2mmol) aqueous solution (7mL) stirred the mixture under the backflow 4.5 hours being heated to add ammonium chloride then to add iron powder to this solution.Make the mixture cooling, filter by Yin Shi salt then, to remove insoluble substance.Concentrated solution, resistates dilutes with ethyl acetate.Diluent washs with saturated sodium bicarbonate aqueous solution, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (0.30g, 83%) of colorless oil by silica gel chromatography with the acquisition.
(34-g) (±)-[(1S, 5R, 6R)-6-(amino methyl)-and 3-cyclobutyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With (±)-[(1S, 5R, 6R)-6-(amino methyl)-3-cyclobutyl dicyclo [3.2.0] heptan-3-alkene-6-fork] (0.30g 1.0mmol) was dissolved in 4N hydrochloric acid-ethyl acetate solution (10mL) tert.-butyl acetate, in stirring at room solution 1.5 hours.Then, solvent is fallen in underpressure distillation.By adding methylene dichloride suspension resistates.Drip triethylamine to this suspension then, the powder that is produced is collected by filtering.The powder drying under reduced pressure that obtains is the target compound (0.17g, 67%) of white powder with the acquisition.
(embodiment 35) (±)-[(1S, 5R, 6R)-6-(amino methyl)-and 4-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 34)
(35-a) 3-ethyl heptan-2,6-diolefinic acid methyl esters (E/Z mixture)
In 1 hour in 0 ℃ to sodium hydride (1.04g, 63%, tetrahydrofuran (THF) 27.4mmol) (25mL) suspension drips phosphonoacetic acid trimethyl (4.67g, tetrahydrofuran (THF) 25.1mmol) (25mL) solution.Add tetrahydrofuran (THF) (25mL) to this mixture again, stirred the mixture 1 hour in 0 ℃ then.(2.56g, tetrahydrofuran (THF) 22.8mmol) (25mL) solution in stirring at room mixture 2.5 hours, stirred 3 hours in 65 ℃ subsequently to drip 6-teracrylic acid-ketone in 0 ℃ to this solution in 20 minutes.The mixture water treatment, the volatile matter part is fallen in underpressure distillation then, uses hexane extraction afterwards.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, is the target compound (3.04g, 79%) of light yellow oil with the acquisition.
(35-b) 3-ethyl heptan-2,6-diolefinic acid (E/Z mixture)
5N aqueous sodium hydroxide solution (14.5mL) is added to 3-ethyl heptan-2, and (3.04g, ethanol 18.1mmol) (40mL) solution was in stirring at room mixture 17 hours for 6-diolefinic acid methyl esters.With 5N aqueous hydrochloric acid (15mL) neutralise mixt, use dichloromethane extraction afterwards.Organic layer is through dried over mgso.Solvent is fallen in underpressure distillation, is the target compound (2.01g, 71%) of light yellow oil with the acquisition.
(35-c) (±)-[(1S, 5R)-4-ethyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (E/Z mixture)
(2.56g 26.1mmol) adds to 3-ethyl heptan-2,6-diolefinic acid (2.01g with potassium acetate, 13.0mmol) and diacetyl oxide (2.66g, 26.1mmol) N,N-DIMETHYLACETAMIDE (25mL) solution, mixture stirred 3 hours in 120 ℃ then in stirring at room 1 hour.Mixture frozen water solution-treated extracts with diethyl ether afterwards.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, with sample on the resistates to column chromatography, to obtain light yellow oil.The material that herein obtains is added to the dimethyl phosphine ethyl acetoacetic acid tert-butyl ester (2.60g that stirs 1 hour in advance, 16.6mmol), lithium chloride (0.70g, 16.6mmol) and 1,8-diazabicyclo [5.4.0] 11 carbon-7-alkene (2.60g, 16.6mmol) acetonitrile (40mL) solution, restir mixture 3.5 hours.Use water treatment, the volatile matter part is fallen in underpressure distillation then, uses ethyl acetate extraction afterwards.Organic layer is through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (2.20g, 68%) of yellow oil by silica gel chromatography with the acquisition.
(35-d) (±)-[(1S, 5R, 6R)-6-(nitro methyl)-and 4-ethyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
With (±)-[(1S, 5R)-4-ethyl dicyclo [3.2.0] heptan-3-alkene-6-fork] (2.20g 9.4mmol) is dissolved in the Nitromethane 99Min. (30mL) tert.-butyl acetate.Add 1 to this solution, and 8-diazabicyclo [5.4.0] 11 carbon-7-alkene (1.77g, 11.3mmol), in stirring at room mixture 63 hours.To its saturated aqueous solution that adds potassium primary phosphate, use dichloromethane extraction afterwards.Organic layer is through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is by the silica gel chromatography purifying, to obtain the target compound (2.38g) for the mixture that contains initial substance.
(35-e) (±)-[(1S, 5R, 6R)-6-(amino methyl)-and 4-ethyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
With (±)-[(1S, 5R, 6R)-and 6-(nitro methyl)-4-ethyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate and (±)-[(1S, 5R)-4-ethyl dicyclo [3.2.0] heptan-3-alkene-6-fork] mixture (2.38g) of tert.-butyl acetate is dissolved in the ethanol (30mL).(2.25g, 40.1mmol), (0.43g, the 8.1mmol) aqueous solution (10mL) stirred the mixture under the backflow 4.5 hours being heated to add ammonium chloride then to add iron powder to this solution.Make the mixture cooling, filter by Yin Shi salt then, to remove insoluble substance.Concentrated solution dilutes resistates with ethyl acetate.Diluent washs with saturated sodium bicarbonate aqueous solution, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (1.00g, the yield in 40%: two step) of colorless oil by silica gel chromatography with the acquisition.
(35-f) (±)-[(1S, 5R, 6R)-6-(amino methyl)-and 4-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With (±)-[(1S, 5R, 6R)-6-(amino methyl)-4-ethyl dicyclo [3.2.0] heptan-3-alkene-6-fork] (1.00g 3.8mmol) is dissolved in 4N hydrochloric acid-ethyl acetate solution (20mL) tert.-butyl acetate, and mixture was in stirring at room 1 hour.Then, the solid by filtration that is produced is collected.By adding the methylene dichloride described solid that suspends.Drip triethylamine to suspension then.Collect the powder that is produced by filtering again, and drying under reduced pressure, be the target compound (0.51g, 65%) of white powder with the acquisition.
(embodiment 36) (±)-[(1S, 5R, 6R)-and 3-ethyl-6-(hydroxyl amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetic acid hydrochloride
With ammonium formiate (1.10g, 16.9mmol) add to (±)-[(1S, 5R, 6R)-and 3-ethyl-6-[(hydroxyl amino) methyl] dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (0.50g, 1.7mmol) and ethanol (10mL) suspension of the palladium (0.05g) of barium sulfate-support, mixture was in stirring at room 19 hours.Add entry (20mL) to it, mixture filters by Yin Shi salt then, to remove insoluble substance.Concentrated solution, resistates dilutes with ethyl acetate.Diluent washs with saturated sodium bicarbonate aqueous solution, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is by silica gel chromatography, to obtain colourless liquid (0.34g).Described liquid is dissolved in 4N hydrochloric acid-ethyl acetate solution (15mL), and solution was in stirring at room 1 hour.Then, solvent is fallen in underpressure distillation.By adding methylene dichloride suspension resistates, collect the powder that is produced by filtering then.Institute's powder that obtains is the target compound (0.10g, 23%) of white powder with methylene dichloride and hexane wash with the acquisition.
(embodiment 37) [(1R, 5S, 6R)-6-(amino methyl)-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With tosic acid (13.14g, 69.1mmol) add to [(1R, 5S)-and the 6-{[(tert-butoxycarbonyl) amino] methyl }-3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (10.20g, 34.5mmol) and iron powder (9.64g, 172.7mmol) ethanol (150mL)/water (50mL) suspension, mixture stirred 2.5 hours in 80 ℃.Make the mixture cooling, filter by Yin Shi salt then, to remove insoluble substance.Concentrated solution, resistates dilutes with ethyl acetate.Diluent washes with water, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and the institute's solid that obtains hexane wash is to obtain white solid (14.62g).With this compound dissolution in benzene (100mL).(1.27g, 6.7mmol), mixture stirred 2.5 hours in 80 ℃ to add tosic acid to this solution.Make the mixture cooling, filter then, to remove insoluble substance.Concentrated solution, and obtaining solid (2.32g) is dissolved in the chloroform (50mL).Add triethylamine (1.4mL) to this solution, the solid by filtration that is produced is collected, and is suspended in the ethyl acetate (25mL).Add tosic acid (0.44g) to suspension.Ultrasonic radiation mixture 1 hour, the solid that obtains is used methanol wash, is the target compound (0.06g, 1%) of white solid with the acquisition.
(embodiment 38) (±)-[(1S, 5R, 6R)-6-(amino methyl)-and 1-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate (exemplary compounds 2)
(38-a) (±)-[(1S, 5R)-1-methyl bicycle [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (E/Z mixture)
In 5 minutes in 0 ℃ to sodium hydride (0.59g, 63%, tetrahydrofuran (THF) 15.5mmol) (15mL) suspension drips the dimethyl phosphine ethyl acetoacetic acid tert-butyl ester, and (mixture stirred 15 minutes in 0 ℃ for 3.29g, tetrahydrofuran (THF) 14.7mmol) (15mL) solution.(mixture was in stirring at room 4 hours for 1.60g, tetrahydrofuran (THF) 13.1mmol) (15mL) solution to drip 1-methyl bicycle [3.2.0] heptan-3-alkene-6-ketone in 0 ℃ to this solution in 10 minutes.Use water treatment, extract with diethyl ether afterwards.Organic layer is through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (1.80g, 62%) of yellow oil by silica gel chromatography with the acquisition.
(38-b) (±)-[(1S, 5R, 6R)-6-(nitro methyl)-and 1-methyl bicycle [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
With (±)-[(1S, 5R)-1-methyl bicycle [3.2.0] heptan-3-alkene-6-fork] (1.80g 8.2mmol) is dissolved in the Nitromethane 99Min. (30mL) tert.-butyl acetate.Add 1 to this solution, (1.52g's 8-diazabicyclo [5.4.0] 11 carbon-7-alkene 10.0mmol), stirred the mixture 11 hours in 60 ℃.Make the mixture cooling, add the potassium primary phosphate saturated aqueous solution to it then, use ethyl acetate extraction afterwards.Organic layer is through anhydrous magnesium sulfate drying.Solvent is fallen in underpressure distillation, and resistates is the target compound (1.80,78%) of yellow oil by the silica gel chromatography purifying with the acquisition.
(38-c) (±)-[(1S, 5S, 6R)-6-(amino methyl)-and 1-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With (±)-[(1S, 5R, 6R)-6-(nitro methyl)-1-methyl bicycle [3.2.0] heptan-3-alkene-6-fork] (1.80g 6.4mmol) is dissolved in the ethanol (45mL) tert.-butyl acetate.(6.52g, 51.1mmol), (0.34g, the 6.4mmol) aqueous solution (15mL) stirred the mixture under the backflow 4.5 hours being heated to add ammonium chloride then to add iron powder to this solution.Make the mixture cooling, filter by Yin Shi salt then, to remove insoluble substance.Concentrated solution dilutes resistates with ethyl acetate.Diluent washs with saturated sodium bicarbonate aqueous solution, and through anhydrous magnesium sulfate drying.Then, solvent is fallen in underpressure distillation, and resistates is the target compound (0.90g, 56%) of colorless oil by silica gel chromatography with the acquisition.
(38-d) (±)-[(1S, 5R, 6R)-6-(amino methyl)-and 1-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate
With (±)-[(1S, 5S, 6R)-6-(amino methyl)-1-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] (0.90g 3.6mmol) is dissolved in 4N hydrochloric acid-ethyl acetate solution (20mL) tert.-butyl acetate, and in stirring at room solution 2 hours.Then, solvent is fallen in underpressure distillation.By adding methylene dichloride suspension resistates.Drip triethylamine to suspension then, the powder that is produced is collected by filtering.The powder that obtains is used washed with dichloromethane, is the target compound (0.33g, 47%) of white powder with the acquisition.
(embodiment 39) (±) { (1R, 5R)-6-(amino methyl)-7-methyl bicycle [3.2.0] heptan-3-alkene-6-yl } acetate (exemplary compounds 7)
(39-a) (±) { (1R, 5R)-7-methyl bicycle [3.2.0] heptan-3-alkene-6-fork } tert.-butyl acetate
With the mode identical with embodiment (11-e) by (±) (1R, 5R)-(6.16g 50.4mmol) obtains to be the target compound of oily matter (5.88g, 53%) to 7-methyl bicycle [3.2.0] heptan-3-alkene-6-ketone (J.Org.Chem., 1988,53,5320).Target compound is the non-enantiomer mixture of mainly being made up of two kinds of diastereomers.
(39-b) (±) { (1R, 5R)-7-methyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl } tert.-butyl acetate
With the mode identical with embodiment (1-c) by (±) (1R, 5R)-7-methyl bicycle [3.2.0] heptan-3-alkene-6-fork (5.74g 26.1mmol) obtains to be the target compound of oily matter (4.07g, 56%) to tert.-butyl acetate.Target compound is the non-enantiomer mixture of mainly being made up of three kinds of diastereomers.
(39-c) (±) { (1R, 5R)-6-{[(tert-butoxycarbonyl) amino] methyl }-7-methyl bicycle [3.2.0] heptan-3-alkene-6-yl } tert.-butyl acetate
With the mode identical with embodiment (3-a) by (±) (1R, 5R)-7-methyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl (1.00g 3.55mmol) obtains to be the target compound of oily matter (1.11g, 89%) to tert.-butyl acetate.Target compound is the non-enantiomer mixture of mainly being made up of two kinds of diastereomers.
(39-d) (±) { (1R, 5R)-6-(amino methyl)-7-methyl bicycle [3.2.0] heptan-3-alkene-6-yl } acetate
In the mode identical with embodiment (1-e) by (±) { (1R, 5R)-and the 6-{[(tert-butoxycarbonyl) amino] methyl }-7-methyl bicycle [3.2.0] heptan-3-alkene-6-yl } tert.-butyl acetate (1.11g, 3.16mmol) obtain to be the target compound of white solid (281mg, 46%).Target compound is the non-enantiomer mixture of mainly being made up of two kinds of diastereomers.
(embodiment 40) { (1S, 5R, 6R)-and 3-ethyl-6-[(methylamino) methyl] dicyclo [3.2.0] heptan-3-alkene-6-yl } acetic acid hydrochloride (exemplary compounds 44)
Figure GPA00001143598100991
(40-a) [(1S, 5R, 6R)-and the 6-{[(tert-butoxycarbonyl) amino] methyl }-3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With [(1S, 5R, 6R)-and 6-(amino methyl)-3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (2.48g 6.50mmol) is dissolved in water (6.5mL), 1M aqueous sodium hydroxide solution (10mL) and 1, in the mixing solutions of 4-diox (13mL) to the acetate tosilate.Under agitation in room temperature to this solution add tert-Butyl dicarbonate (2.84g, 13.0mmol).Stir the mixture in this temperature overnight, make reaction soln become acidity by adding the 1M citric acid then, use dichloromethane extraction afterwards.Organic layer washs with saturated brine, and through anhydrous sodium sulfate drying.Filtration residue, and concentrating under reduced pressure are the target compound (2.01g,＞99%) of oily matter with the acquisition.
(40-b) [(1S, 5R, 6R)-and the 6-{[(tert-butoxycarbonyl) (methyl) amino] methyl }-3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
Under agitation in room temperature with sodium hydride (63%, 2.48g, 65.0mmol) add to [(1S with aliquot, 5R, 6R)-and the 6-{[(tert-butoxycarbonyl) amino] methyl }-3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate (2.01g, 6.50mmol) and methyl-iodide (4.05mL, tetrahydrofuran solution 65.0mmol) (25mL).Stirred the mixture 6 hours in this temperature, add entry (50mL) to it then,, wash with diethyl ether afterwards simultaneously at the cooled on ice reaction soln.Use the 1M citric acid to make water layer become acidity, use ethyl acetate extraction afterwards.Organic layer is through anhydrous sodium sulfate drying.Resistates after filtration and concentrating under reduced pressure.Then, institute's crude product that obtains is the target compound (2.00g, 95%) of oily matter by silica gel chromatography with the acquisition.
(40-c) (1S, 5R, 6R)-and 3-ethyl-6-[(methylamino) methyl] dicyclo [3.2.0] heptan-3-alkene-6-yl } acetic acid hydrochloride
4N hydrochloric acid-ethyl acetate (13mL) is added to [(1S, 5R, 6R)-and the 6-{[(tert-butoxycarbonyl) (methyl) amino] methyl }-3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] and acetate (0.90g, 2.78mmol), in stirring at room mixture 1 hour.The concentrating under reduced pressure mixture, institute's resistates that obtains is the target compound (0.34g, 47%) of white solid by hexane-Virahol recrystallization with the acquisition.
(embodiment 41) (±) [(1S, 5R, 6S)-6-(amino methyl)-and 2-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
(41-a) tertiary butyl [(2-ethyl fourth-3-alkene-1-yl) oxygen base] dimethylsilane
With ((59.1g 165mmol) is suspended in the tetrahydrofuran (THF) (330mL) methyltriphenylphospbromide bromide phosphorus.Under agitation in 0 ℃ to suspension add gradually n-Butyl Lithium (the 1.57M hexane solution, 97.3mL, 153mmol).Stirred the mixture 1 hour in this temperature, add 2-({ [tertiary butyl (dimethyl) silyl] oxygen base } methyl) butyraldehyde-n (Tetrahedron 2004,60,9307) (27.6g, tetrahydrofuran solution 127mmol) (110mL) gradually to it then.Mixture by adding the saturated aqueous solution and the water termination reaction of ammonium chloride, is used ethyl acetate extraction then afterwards in 0 ℃ of stirring 2 hours.Organic layer is with saturated aqueous solution, water and the saturated brine washing of ammonium chloride, then through anhydrous sodium sulfate drying.Filtration residue, and concentrating under reduced pressure.Then, institute's crude product that obtains is the target compound (19.9g, 73%) of oily matter by silica gel chromatography with the acquisition.
(41-b) (2E)-5-ethyl heptan-2,6-diolefinic acid ethyl ester
Under agitation (1M tetrahydrofuran solution, 99.3mL 99.3mmol) add to the tertiary butyl [(2-ethyl fourth-3-alkene-1-yl) oxygen base] dimethylsilane (19.9g, diethyl ether solution 93mmol) (80mL) with tetrabutyl ammonium fluoride in room temperature.The stirred overnight mixture is separated into water layer and organic layer by adding entry with reaction soln then, extracts with diethyl ether afterwards.Organic layer water and saturated brine washing are then through anhydrous sodium sulfate drying.Filtration residue, and concentrating under reduced pressure are dissolved in resistates in the methylene dichloride (180mL) then.Under agitation in 0 ℃ to this solution add triethylamine (25.7mL, 186mmol) and methylsulfonyl chloride (10.8mL, 139mmol).Mixture is separated into water layer and organic layer by adding 1M hydrochloric acid (200mL) with reaction soln then in 0 ℃ of stirred overnight, uses dichloromethane extraction afterwards.Organic layer washs with saturated brine, and through anhydrous sodium sulfate drying.Filtration residue, and concentrating under reduced pressure are dissolved in resistates in dimethyl sulfoxide (DMSO) (240mL) and the water (12mL) then.To this solution add potassium cyanide (15.1g, 232mmol).Mixture adds entry (400mL) to it then gradually in 60 ℃ of stirred overnight, simultaneously at the cooled on ice reaction soln, extracts with diethyl ether afterwards.Organic layer water and saturated brine washing are washed with anhydrous sodium sulphate then.Filtration residue, and concentrating under reduced pressure are dissolved in resistates in the toluene (150mL) then.Under agitation in-78 ℃ to this solution drip diisobutyl aluminium hydride (the 0.99M toluene solution, 169mL, 167mmol).Stirred the mixture 1 hour in this temperature, add 30% acetic acid aqueous solution (167mL) gradually to it then, the while is reacting by heating solution gradually.Under agitation adding saturated sodium bicarbonate aqueous solution (130mL) in 0 ℃ to this reaction soln, is water layer and organic layer with mixture separation then, extracts with toluene afterwards.Organic layer water, saturated sodium bicarbonate aqueous solution and saturated brine washing, and through dried over mgso.After filtration, (33.9g 97.4mmol) adds to filtered solution, stirs the mixture in ambient temperature overnight with (triphenyl phosphorus fork) ethyl acetate.Concentrated reaction solution then by crude product that silica gel chromatography obtains, is the target compound (9.52g, 56%) of oily matter with the acquisition.
(41-c) (2E)-5-ethyl heptan-2, the 6-diolefinic acid
With lithium hydroxide monohydrate (4.39g 104mmol) adds to (2E)-5-ethyl heptan-2,6-diolefinic acid ethyl ester (9.52g, tetrahydrofuran (THF) 52.2mmol): methyl alcohol: water (3: 3: 1,100mL) in the mixing solutions, stir the mixture in ambient temperature overnight.The concentrating under reduced pressure reaction soln.Add entry to resistates then, wash with diethyl ether afterwards.Make water layer become acidity by adding 5M hydrochloric acid, use ethyl acetate extraction afterwards.Then, organic layer washs with saturated brine, and through anhydrous sodium sulfate drying.Filtration residue, and concentrating under reduced pressure are the target compound (8.00g,＞99%) of oily matter with the acquisition.
(41-d) (±) [(1S, 5R)-2-ethyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
In the mode identical with embodiment (7-c) by (2E)-5-ethyl heptan-2, the 6-diolefinic acid (4.50g, 29.4mmol) obtain for the target compound of oily matter (3.00g, 44%, lead/time=3/1).
(41-e) (±) [(1S, 5R, 6S)-and 2-ethyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With the mode identical with embodiment (1-c) by (±) [(1S, 5R)-2-ethyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate (3.00g, 12.8mmol) obtain for the target compound of oily matter (3.52g, 93%, lead/time=3/1).
(41-f) (±) [(1S, 5R, 6S)-6-(amino methyl)-and 2-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
In the mode identical with embodiment (4-a) by (±) [(1S, 5R, 6S)-2-ethyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (3.52g 11.9mmol) obtains to be the target compound of oily matter (2.75g to tert.-butyl acetate, 87%, main/time=3/1).
(41-g) (±) [(1S, 5R, 6S)-6-(amino methyl)-and 2-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] the acetate tosilate
With tosic acid monohydrate (2.17g, 11.4mmol) add to (±) [(1S, 5R, 6S)-6-(amino methyl)-2-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate (2.75g, 10.4mmol) benzole soln (20mL), backflow mixture 1 hour.Make mixture cooling, use the sedimentary solid of washed with dichloromethane then, to acquisition be gray solid target compound (3.17g, 80%, lead/time=3/1).
(41-h) (±) [(1S, 5R, 6S)-6-(amino methyl)-and 2-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
With (±) [(1S, 5R, 6S)-6-(amino methyl)-2-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (3.17g 8.31mmol) is suspended in the methylene dichloride (35mL) the acetate tosilate.Under agitation in room temperature to suspension add triethylamine (1.27mL, 9.14mmol).Stirred the mixture 3 hours in this temperature,, and use washed with dichloromethane then by filter collecting sedimentary solid, with the acquisition be white solid target compound (1.58g, 91%, lead/time=3/1).
(embodiment 42) (±) [(1R, 5S, 6S)-6-(amino methyl)-and 3-vinyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
(42-a) (±)-(1R, 5R)-spiral shell [dicyclo [3.2.0] heptane-6,2 '-[1,3] dioxolane]-3-ketone
Under agitation in 0 ℃ with (±)-(1 ' R, 2 ' R, 4 ' S, 6 ' R)-spiral shell [1,3-dioxolane-2,7 '-[3] oxatricyclo [4.2.0.0 2,4] octane] (J.Chem.Soc.Perkin Trans.1,1980,852) (20.0g, tetrahydrofuran solution 119mmol) (120mL) drop to lithium aluminium hydride gradually, and (6.77g is in the tetrahydrofuran (THF) suspension (480mL) 178mmol).Stir the mixture in ambient temperature overnight, add tetrahydrofuran (THF) (200mL), water (6.8mL), 15% aqueous sodium hydroxide solution (6.8mL) and water (20.4mL) to it then, simultaneously at the cooled on ice reaction soln.Mixture was in stirring at room 3 hours.Mixture filters by Yin Shi salt, and concentrating under reduced pressure.Then, institute's crude product that obtains is by silica gel column chromatography (separating with positional isomers with regard to hydroxyl) purifying, with the acquisition be oily matter (±)-(1R, 3R, 5R)-spiral shell [dicyclo [3.2.0] heptane-6,2 '-[1,3] dioxolane]-3-alcohol (7.78g, 38%).Under agitation (9.11mL, (5.50mL, dichloromethane solution 64.2mmol) (110mL) stirred the mixture 5 minutes in this temperature 128mmol) to add to oxalyl chloride with dimethyl sulfoxide (DMSO) in-78 ℃.Then, alcohol (7.28g, dichloromethane solution 42.8mmol) (30mL) that more than it adds, obtains.Stirred the mixture 15 minutes in this temperature.Then, (23.7mL 171mmol), also stirs mixture heating up to room temperature to add triethylamine to it.Is water layer and organic layer by adding 0.1M hydrochloric acid with mixture separation.Organic layer is with 0.1M hydrochloric acid, water and saturated brine washing, then through anhydrous sodium sulfate drying.Filtration residue and concentrating under reduced pressure.Then, institute's crude product that obtains is the target compound (6.61g, 92%) of oily matter by silica gel chromatography with the acquisition.
(42-b) (±)-(1R, 5S)-spiral shell [dicyclo [3.2.0] heptan-3-alkene-6,2 '-[1,3] dioxolane]-3-base triflate
With two (trimethyl silyl) acid amides potassium (0.5M tetrahydrofuran solutions, 96.8mL, 48.4mmol) add to tetrahydrofuran (THF) (180mL), and under agitation drip (±)-(1R gradually to it in-78 ℃, 5R)-spiral shell [dicyclo [3.2.0] heptane-6,2 '-[1,3] dioxolane]-3-ketone (6.11g, tetrahydrofuran solution 36.3mmol) (85mL).Stirred the mixture 2 hours in this temperature, drip two (fluoroform sulfimide) (17.3g, tetrahydrofuran solutions 48.4mmol) (95mL) of N-phenyl to it gradually then.Mixture heating up to room temperature and stirring spent the night.Then, by adding saturated aqueous ammonium chloride and water termination reaction, and be water layer and organic layer with mixture separation, extract with diethyl ether afterwards.Organic layer washs with saturated brine, and through anhydrous sodium sulfate drying.Filtration residue and concentrating under reduced pressure.Then, institute's crude product that obtains is the target compound (4.74g, 43%) of oily matter by silica gel column chromatography (separating with positional isomers with regard to alkene) purifying with the acquisition.
(42-c) (±)-(1R, 5S)-3-vinyl spiral shell [dicyclo [3.2.0] heptan-3-alkene-6,2 '-[1,3] dioxolane]
With lithium chloride (1.97g, 46.4mmol), four (triphenyl phosphine) palladium (0) (0.36g, 0.31mmol) and tributyl (vinyl) tin (2.47mL, 8.50mmol) add to (±)-(1R, 5S)-spiral shell [dicyclo [3.2.0] heptan-3-alkene-6,2 '-[1,3] dioxolane]-3-base triflate (2.32g, tetrahydrofuran solution 7.73mmol) (60mL).Mixture heating up to refluxing 2 hours, is added to reaction soln with water then, extract with diethyl ether afterwards.Organic layer washs with saturated brine, and through anhydrous sodium sulfate drying.Filtration residue and concentrating under reduced pressure.Then, institute's crude product that obtains is the target compound (990mg, 72%) of oily matter by silica gel chromatography with the acquisition.
(42-d) (±) [(1R, 5S)-3-vinyl dicyclo [3.2.0] heptan-3-alkene-6-fork] tert.-butyl acetate
With (±)-(1R, 5S)-(990mg 5.55mmol) is dissolved in the mixed solvent of acetonitrile (16mL) and water (7mL) 3-vinyl spiral shell [dicyclo [3.2.0] heptan-3-alkene-6,2 '-[1,3] dioxolane].Under agitation add 2M sulfuric acid (2.60mL) to this solution in room temperature.In stirring at room mixture 7 hours, by adding saturated sodium bicarbonate aqueous solution neutralization reaction solution, use ethyl acetate extraction afterwards then.Organic layer washs with saturated brine, and through anhydrous sodium sulfate drying.Filtration residue and concentrating under reduced pressure.Then, with the mode identical with embodiment (11-e) by obtained (1R, 5S)-3-vinyl dicyclo [3.2.0] heptan-3-alkene-6-ketone obtain for the target compound of oily matter (710mg, 55%, lead/time=2/1).
(42-e) (±) [(1R, 5S, 6S)-6-(nitro methyl)-and 3-vinyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With the mode identical with embodiment (1-c) by (±) [(1R, 5S)-3-vinyl dicyclo [3.2.0] heptan-3-alkene-6-fork] (710mg 3.06mmol) obtains to be the target compound of oily matter (670mg, 75%) to tert.-butyl acetate.
(42-f) (±) [(1R, 5S, 6S)-6-(amino methyl)-and 3-vinyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With the mode identical with embodiment (4-a) by (±) [(1R, 5S, 6S)-6-(nitro methyl)-3-vinyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (670mg 2.28mmol) obtains to be the target compound of oily matter (527mg, 88%) to tert.-butyl acetate.
(42-g) (±) [(1R, 5S, 6S)-6-(amino methyl)-and 3-vinyl dicyclo [3.2.0] heptan-3-alkene-6-yl] the acetate tosilate
In the mode identical with embodiment (41-g) by (±) [(1R, 5S, 6S)-and 6-(amino methyl)-3-vinyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (527mg 2.00mmol) obtains to be the target compound of light gray solid (590mg, 78%) to tert.-butyl acetate.
(42-h) (±) [(1R, 5S, 6S)-6-(amino methyl)-and 3-vinyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
In the mode identical with embodiment (41-h) by (±) [(1R, 5S, 6S)-and 6-(amino methyl)-3-vinyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (590mg 1.55mmol) obtains to be light brown solid target compound (286mg, 89%) to the acetate tosilate.
(embodiment 43) (±) [(1R, 5S, 6S)-6-(amino methyl)-and 3-ethynyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
(43-a) (±)-trimethylammonium [(1R, 5S)-spiral shell [dicyclo [3.2.0] heptan-3-alkene-6,2 '-[1,3] dioxolane]-3-ethyl-acetylene base] silicomethane
With two (triphenyl phosphine) Palladous chlorides (II) (98%, 0.29g, 0.40mmol), 2, the 6-lutidine (1.41mL, 12.1mmol), trimethyl silyl acetylene (1.45mL, 10.5mmol) and cupric iodide (I) (0.15g, 0.81mmol) add in embodiment (42-b) (±) that obtain-(1R, 5S)-spiral shell [dicyclo [3.2.0] heptan-3-alkene-6,2 '-[1,3] dioxolane]-3-base triflate (2.42g, dimethyl formamide solution 8.06mmol) (5mL).Under agitation in 50 ℃ of heated mixt 2 hours, the saturated aqueous solution with ammonium chloride added to reaction soln then, extracts with diethyl ether afterwards.Organic layer washs with saturated brine, and through anhydrous sodium sulfate drying.Filtration residue and concentrating under reduced pressure.Then, institute's crude product that obtains is the target compound (1.78g, 89%) of oily matter by silica gel chromatography with the acquisition.
(43-b) (±)-and (1S, 5S)-3-[(trimethyl silyl) ethynyl] dicyclo [3.2.0] heptan-3-alkene-6-fork } tert.-butyl acetate
With the mode identical with embodiment (42-d) by (±)-trimethylammonium [(1R, 5S)-spiral shell [dicyclo [3.2.0] heptan-3-alkene-6,2 '-[1,3] dioxolane]-3-ethyl-acetylene base] silicomethane (1.78g, 7.17mmol) obtain for the target compound of oily matter (1.50g, 69%, lead/time=2/1).
(43-c) (±)-[(1R, 5S, 6S)-and 3-ethynyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
In the mode identical with embodiment (1-c) by (±)-{ (1S, 5S)-and the 3-[(trimethyl silyl) ethynyl] dicyclo [3.2.0] heptan-3-alkene-6-fork } tert.-butyl acetate (1.50g, 4.98mmol) obtain to be the target compound of oily matter (870mg, 60%).
(43-d) (±)-[(1R, 5S, 6S)-6-(amino methyl)-and 3-ethynyl dicyclo [3.2.0] heptan-3-alkene-6-yl] tert.-butyl acetate
With the mode identical with embodiment (4-a) by (±)-[(1R, 5S, 6S)-3-ethynyl-6-(nitro methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] (870mg 2.99mmol) obtains to be the target compound of oily matter (630mg, 81%) to tert.-butyl acetate.
(43-e) (±) [(1R, 5S, 6S)-6-(amino methyl)-and 3-ethynyl dicyclo [3.2.0] heptan-3-alkene-6-yl] the acetate tosilate
In the mode identical with embodiment (41-g) by (±)-[(1R, 5S, 6S)-and 6-(amino methyl)-3-ethynyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (630mg 2.41mmol) obtains to be the target compound of light yellow solid (821mg, 90%) to tert.-butyl acetate.
(43-f) (±) [(1R, 5S, 6S)-6-(amino methyl)-and 3-ethynyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate
In the mode identical with embodiment (41-h) by (±) [(1R, 5S, 6S)-and 6-(amino methyl)-3-ethynyl dicyclo [3.2.0] heptan-3-alkene-6-yl] (821mg 2.17mmol) obtains to be light brown solid target compound (371mg, 83%) to the acetate tosilate.
The physical analysis data that below shown compound described in the embodiment.
[table 2]
Embodiment Analytical data
??1(1-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：2.21-2.26(2H，m)，2.32-2.37(2H，m)，??5.01-5.08(2H，m)，5.75-6.87(2H，m)，7.03-7.11(1H，m).
??1(1-b) 1H-NMR (400MHz, CDCl3): d ppm: main isomer 1.45 (9H, S), 2.29-2.35 (1H, m), and 2.62-2.71 (2H, m), 2.89-2.98 (1H, m), 3.27-3.35 (1H, m), 3.92 (1H, broad peaks), 5.47-5.49 (1H, m), 5.80-5.87 (2H, m). and less important isomer 1.49 (9H, s), 2.42-2.48 (1H, m), and 2.62-2.71 (2H, m), 2.89-2.98 (2H, m), 4.34-4.36 (1H, m), and 5.37-5.38 (1H, m), 5.61-5.64 (2H, m).
??1(1-c) MS (FAB): m/z:268 (M+H)+, 290 (M+Na)+1H-NMR (400MHz, CDCl3): d ppm:1.45 (9H, s), 1.53 (1H, dd, J=7.5,12.9Hz), 2.17 (1H, d, J=15.2Hz), 2.31 (1H, ddd, J=2.4,8.6,12.1Hz), 2.47 (2H, s), and 2.52-2.58 (1H, m), 2.87 (1H, five peaks, J=7.5Hz), 3.25-2.66 (1H, m), 4.78 (1H, d, J=11.4Hz), 4.87 (1H, d, J=11.4Hz), 5.65-5.67 (1H, m), 5.95 (1H, dd, J=1.6,5.9Hz).
??1(1-d) 1H-NMR (400MHz, CDCl3): d ppm:1.39-1.49 (1H, m), 1.44 (9H, s), 1.97 (1H, ddd, J=2.8,9.0,11.7Hz), 2.14 (1H, dd, J=2.3,16.8Hz), 2.25 (1H, d, J=13.7Hz), 2.32 (1H, d, J=13.7Hz), 2.47-2.55 (1H, m), 2.75 (1H, five peaks, J=7.4Hz), 2.88 (2H, s), 2.98-2.99 (1H, m), 5.77-5.79 (1H, m), 5.87-5.89 (1H, m).
Embodiment Analytical data
??1(1-e) Mp:176-178 ℃. 1H-NMR (400MHz, CDCl3): d ppm:1.49 (1H, dd, J=7.6,12.5Hz), 2.06 (1H, ddd, J=2.6,7.6,12.5Hz), 2.17 (1H, dd, J=2.6,16.8Hz), 2.49 (2H, s), 2.48-2.56 (1H, m), 2.86 (1H, five peaks, J=7.6Hz), 3.15-3.16 (1H, m), 3.18 (1H, d, J=12.7Hz), 3.22 (1H, d, J=12.7Hz), 5.75-5.78 (1H, m), and 5.91-5.93 (1H, m). IR (KBr): cm-1:2953,2896,2840,1635,1573,1504,1395,1174,724. MS (EI): m/z:181 (M)+. the theoretical analysis value of C10H15NO2: C, 66.27; H, 8.34; N, 7.73; Measured value C, 65.13; H, 8.31; N, 7.64.
??2(2-b) 1H-NMR (400MHz, CDCl3): d ppm:1.39-1.49 (1H, m), 1.44 (9H, s), 1.97 (1H, ddd, J=2.8,9.0,11.7Hz), 2.14 (1H, dd, J=2.3,16.8Hz), 2.25 (1H, d, J=13.7Hz), 2.32 (1H, d, J=13.7Hz), 2.47-2.55 (1H, m), 2.75 (1H, five peaks, J=7.4Hz), 2.88 (2H, s), 2.98-2.99 (1H, m), 5.77-5.79 (1H, m), 5.87-5.89 (1H, m).
Embodiment Analytical data
??2(2-c) Mp.190-191 ℃. and [a] 25D-159.3 ° (c=1.06, H2O). 1H-NMR (400MHz, CD3OD): d ppm:1.49 (1H, dd, J=7.6,12.5Hz), 2.06 (1H, ddd, J=2.6,7.6,12.5Hz), 2.17 (1H, dd, J=2.6,16.8Hz), 2.49 (2H, s), 2.48-2.56 (1H, m), 2.86 (1H, five peaks, J=7.6Hz), and 3.15-3.17 (1H, m), 3.18 (1H, d, J=12.7Hz), 3.22 (1H, d, J=12.7Hz), 5.75-5.78 (1H, m), and 5.91-5.93 (1H, m). IR (KBr): cm-l:2953,2896,2840,1635,1573,1504,1395,1174,724. MS (EI): m/z:181 (M)+. the theoretical analysis value of C10H15NO2: C, 66.27; H, 8.34; N, 7.73; Measured value C, 63.81; H, 8.31; N, 7.75.
??3(3-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.38-1.49(1H，m)，1.44(18H，s)，2.04(1H，ddd，??J＝2.7，8.6，11.3Hz)，2.08-2.12，2.12-2.16(total?1H，dd，each?s)，2.21(1H，d，??J＝14.0Hz)，2.28(1H，d，J＝14.5Hz)，2.46-2.55(1H，m)，2.80-2.91(1H，m)，3.02-3.08(1H，??m)，3.36(1H，dd，J＝6.2，14.1Hz)，3.45(1H，dd，J＝6.6，14.0Hz)，5.72-5.76(1H，m)，??5.85-5.89(1H，m).
Embodiment Analytical data
??3(3-b) 1H-NMR (400MHz, CD3OD): d ppm:1.49 (1H, dd, J=7.6,12.5Hz), 2.06 (1H, ddd, J=2.6,7.6,12.5Hz), 2.17 (1H, dd, J=2.6,16.8Hz), 2.49 (2H, s), 2.48-2.56 (1H, m), 2.86 (1H, dt, J=16.8,7.6Hz), 3.16 (1H, broad peaks), 3.18 (1H, d, J=12.7Hz), 3.22 (1H, d, J=12.7Hz), and 5.75-5.78 (1H, m), 5.91-5.93 (1H, m). IR (KBr): cm-1:2900,1572,1523,1383 MS (EI): m/z:181 (M)+. the theoretical analysis value of C10H15NO2: C, 66.27; H, 8.34; N, 7.73; Measured value C, 66.15; H, 8.33; N, D:-155 ° of 7.75. [a] (H2O, c=1.0) Mp.192-193 ℃.
??4(4-a) 1H-NMR (400MHz, CDCl3): d ppm:1.39-1.49 (1H, m), 1.44 (9H, s), 1.97 (1H, ddd, J=2.8,9.0,11.7Hz), 2.14 (1H, dd, J=2.3,16.8Hz), 2.25 (1H, d, J=13.7Hz), 2.32 (1H, d, J=13.7Hz), and 2.47-2.55 (1H, m), 2.75 (1H, dt, J=7.4,16.8Hz), 2.88 (2H, s), 2.99 (1H, broad peak), 5.77-5.79 (1H, m), 5.87-5.89 (1H, m).
[table 3]
??4(4-b) ??1H-NMR(400MHz、CD3OD)：d?ppm：1.49(1H，dd，J＝7.6，12.5Hz)，2.06(1H，ddd，J＝2.6，7.6，??12.5Hz)，2.17(1H，dd，J＝2.6，16.8Hz)，2.49(2H，s)，2.48-2.56(1H，m)，2.86(1H，dt，J＝7.6，??16.8Hz)，3.16(1H，broad)，3.18(1H，d，J＝12.7Hz)，3.22(1H，d，J＝12.7Hz)，5.75-5.78(1H，m)，??5.91-5.93(1H，m).??IR(KBr)：cm-1：2901，1571，1524，1383??MS(EI)：m/z：181(M)+.??Anal.calcd?for?C10H15NO2：C，66.27；H，8.34；N，7.73；Found?C，65.34；H，8.43；N，7.75.??[a]D：+156°(H2O，c＝1.0)??Mp.198-199℃.
??5(5-a) ??Mp.185-186℃??1H-NMR(400MHz、CD3OD)：d?ppm：1.51(1H，dd，J＝7.6，12.7Hz)，2.16(1H，ddd，J＝2.8，7.6，??15.6Hz)，2.19(1H，dd，J＝2.2，16.8Hz)，2.51(2H，s)，2.53-2.59(1H，m)，2.89(1H，quint，??J＝7.6Hz)，3.18-3.19(1H，m)，3.33(1H，d，J＝13.3Hz)，3.37(1H，d，J＝13.3Hz)，5.70-5.73(1H，??m)，5.97-6.00(1H，m).??IR(KBr)：cm-1：3128，2914，1702，1498，1236.??MS(FAB)：m/z：182(free+H)+.??Anal.calcd?for?C10H16NO2Cl：C，55.17；H，7.41；N，6.43；Cl，16.29；Found?C，54.71；H，??7.43；N，6.38，Cl：18.10.
??4(4-b) ??1H-NMR(400MHz、CD3OD)：d?ppm：1.49(1H，dd，J＝7.6，12.5Hz)，2.06(1H，ddd，J＝2.6，7.6，??12.5Hz)，2.17(1H，dd，J＝2.6，16.8Hz)，2.49(2H，s)，2.48-2.56(1H，m)，2.86(1H，dt，J＝7.6，??16.8Hz)，3.16(1H，broad)，3.18(1H，d，J＝12.7Hz)，3.22(1H，d，J＝12.7Hz)，5.75-5.78(1H，m)，??5.91-5.93(1H，m).??IR(KBr)：cm-1：2901，1571，1524，1383??MS(EI)：m/z：181(M)+.??Anal.calcd?for?C10H15NO2：C，66.27；H，8.34；N，7.73；Found?C，65.34；H，8.43；N，7.75.??[a]D：+156°(H2O，c＝1.0)??Mp.198-199℃.
??6 ??Mp.161-162℃.??1H-NMR(400MHz、CD3OD)：d?ppm：1.51(1H，dd，J＝7.4，12.7Hz)，2.12-2,21(2H，m)，??2.51(2H，s)，2.51-2.59(1H，m)，2.89(1H，quint，J＝7.4Hz)，3.17-3.18(1H，m)，3.32(1H，d，??J＝13.3Hz)，3.36(1H，d，J＝13.3Hz)，5.69-5.71(1H，m)，5.97-6.00(1H，m)，7.40-7.46(3H，m)，??7.80-7.84(2H，m).??IR(KBr)：cm-1：3094，3053，1704，1514，1445，1236，1163，1034，730.??MS(FAB+)：m/z：181(free+H)+.??Anal.calcd?for?C16H21NO5S：C，55，16；H，6.36；N，4.02；S，9.20；Found?C，56.42；H，6.21；??N，4.04；S，9.51.
??7(7-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：0.89-0.94(3H，m)，1.58-1.75(1H，m)，1.91-2.03(1H，m)，??2.21-2.33(1H，m)，2.43-2.56(2H，m)，3.72(3H，s)，3.84-4.00(1H，m)，5.01-5.07(2H，m)，??5.74-5.84(1H，m).??MS(FAB)：m/z：173(M+H)+.
??4(4-b) ??1H-NMR(400MHz、CD3OD)：d?ppm：1.49(1H，dd，J＝7.6，12.5Hz)，2.06(1H，ddd，J＝2.6，7.6，??12.5Hz)，2.17(1H，dd，J＝2.6，16.8Hz)，2.49(2H，s)，2.48-2.56(1H，m)，2.86(1H，dt，J＝7.6，??16.8Hz)，3.16(1H，broad)，3.18(1H，d，J＝12.7Hz)，3.22(1H，d，J＝12.7Hz)，5.75-5.78(1H，m)，??5.91-5.93(1H，m).??IR(KBr)：cm-1：2901，1571，1524，1383??MS(EI)：m/z：181(M)+.??Anal.calcd?for?C10H15NO2：C，66.27；H，8.34；N，7.73；Found?C，65.34；H，8.43；N，7.75.??[a]D：+156°(H2O，c＝1.0)??Mp.198-199℃.
??7(7-b) ??1H-NMR(400MHz、CDCl3)：d?ppm：0.90-0.94(3H，m)，1.64-1.74(1H，m)，1.93-2.00(1H，m)，??2.24-2.32(1H，m)，2.45-2.61(2H，m)，3.87-4.03(1H，m)，5.03-5.08(2H，m)，5.75-5.83(1H，??m).??MS(FAB)：m/z：159(M+H)+，181(M+Na)+.
??7(7-c) ??1H-NMR(400MHz、CDCl3)：d?ppm：??Major?isomer?1.45(9H，s)，2.11-2.22(4H，m)，2.59-2.71(2H，m)，2.87-2.97(1H，m)，??3.26-3.34(1H，m)，3.87(1H，broad)，5.22-5.23(1H，m)，5.45-5.47(1H，m).??Minor?isomer?1.49(9H，s)，2.11-2.21(4H，m)，2.43-2.46(1H，m)，2.59-2.70(1H，m)，??2.75-2.83(1H，m)，2.87-2.97(1H，m)，4.29(1H，broad)，5.36(1H，s)，5.59(1H，s).??MS(EI)：m/z：220(M)+.
??4(4-b) ??1H-NMR(400MHz、CD3OD)：d?ppm：1.49(1H，dd，J＝7.6，12.5Hz)，2.06(1H，ddd，J＝2.6，7.6，??12.5Hz)，2.17(1H，dd，J＝2.6，16.8Hz)，2.49(2H，s)，2.48-2.56(1H，m)，2.86(1H，dt，J＝7.6，??16.8Hz)，3.16(1H，broad)，3.18(1H，d，J＝12.7Hz)，3.22(1H，d，J＝12.7Hz)，5.75-5.78(1H，m)，??5.91-5.93(1H，m).??IR(KBr)：cm-1：2901，1571，1524，1383??MS(EI)：m/z：181(M)+.??Anal.calcd?for?C10H15NO2：C，66.27；H，8.34；N，7.73；Found?C，65.34；H，8.43；N，7.75.??[a]D：+156°(H2O，c＝1.0)??Mp.198-199℃.
??7(7-d) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.45(9H，s)，1.53(1H，dd，J＝7.6，12.9Hz)，1.80(3H，s)，??2.04(1H，d，J＝16.4Hz)，2.29(1H，ddd，J＝2.8，7.6，12.9Hz)，2.47(2H，s)，2.49(1H，dd，H＝7.6，??16.4Hz)，2.86(1H，quint，J＝7.6Hz)，3.21-3.22(1H，m)，4.74(1H，d，J＝11.7Hz)，4.84(1H，??J＝11.7Hz)，5.25(1H，s).
??7(7-e) ??Mp.188-190℃.??1H-NMR(400MHz、CD3OD)：d?ppm：1.40(1H，dd，J＝7.6，12.3Hz)，1.79(3H，s)，??2.02-2.08(2H，m)，2.43-2.50(1H，m)，2.45(1H，d，J＝16.2Hz)，2.51(1H，d，J＝16.2Hz)，2.85??(1H，quint，J＝7.6Hz)，3.05-3.12(1H，m)，3.13(1H，d，J＝13.0Hz)，3.17(1H，d，J＝13.0Hz)，??5.36(1H，t，J＝1.6Hz).??IR(KBr)：cm-1：2946，2927，2905，2832，1564，1525，1396，1384.??MS(FAB)：m/z：196(M+H)+，218(M+Na)+.??Anal.calcd?for?C11H17NO2：C，67.66；H，8.78；N，7.17；Found?C，C，66.84；H，8.78；N，7.21.
??4(4-b) ??1H-NMR(400MHz、CD3OD)：d?ppm：1.49(1H，dd，J＝7.6，12.5Hz)，2.06(1H，ddd，J＝2.6，7.6，??12.5Hz)，2.17(1H，dd，J＝2.6，16.8Hz)，2.49(2H，s)，2.48-2.56(1H，m)，2.86(1H，dt，J＝7.6，??16.8Hz)，3.16(1H，broad)，3.18(1H，d，J＝12.7Hz)，3.22(1H，d，J＝12.7Hz)，5.75-5.78(1H，m)，??5.91-5.93(1H，m).??IR(KBr)：cm-1：2901，1571，1524，1383??MS(EI)：m/z：181(M)+.??Anal.calcd?for?C10H15NO2：C，66.27；H，8.34；N，7.73；Found?C，65.34；H，8.43；N，7.75.??[a]D：+156°(H2O，c＝1.0)??Mp.198-199℃.
??8(8-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：0.91(3H，t，J＝7.5Hz)，1.28(3H，t，J＝7.2Hz)，1.43-1.55??(2H，m).1.98-2.28(2H，m)，2.45-2.48(2H，m)，2.88-2.93(1H，m)，4.07-4.10(1H，m)，??4.10-4.20(2H，m)，5.01-5.09(2H，m)，5.75-5.86(1H，m).??MS(FAB)：m/z：201(M+H)+.
??8(8-b) ??1H-NMR(400MHz、CDCl3)：d?ppm：0.91-0.96(3H，m)，1.39-1.52(3H，m)，2.01-2.28(2H，m)，??2.52-2.55(2H，m)，4.05-4.15(2H，m)，5.03-5.10(2H，m)，5.74-5.86(1H，m).??MS(FAB)：m/z：173(M+H)+，195(M+Na)+.
[table 4]
??8(8-c) ??1H-NMR(400MHz、CDCl3)：d?ppm：??Major?isomer?1.06(3H，t，J＝7.4Hz)，1.45(9H，s)，2.07-2.22(3H，m)，2.59-2.70(2H，m)，??2.87-2.96(1H，m)，3.30(1H，ddt，J＝8.6，18.4，2.7Hz)，3.86-3.88(1H，m)，5.22-5.23(1H，??m)，5.45-5.47(1H，m).??Minor?isomer?1.08(3H，t，J＝7.3Hz)，1.49(9H，s)，2.07-2.21(3H，m)，2.43-2.47(1H，m)，??2.59-2.70(1H，m)，2.75-2.85(1H，m)，2.87-2.96(1H，m)，4.28-4.31(1H，m)，5.35-5.38??(1H，m)，5.45-5.47(1H，m).??MS(FAB)：m/z：235(M+H)+，257(M+Na)+.
??8(8-d) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.09(3H，t，J＝7.4Hz)，1.46(9H，s)，1.52(1H，dd，??J＝7.6，13.2Hz)，2.06(1H，d，16.6Hz)，2.14(2H，q，J＝7.4Hz)，2.30(1H，ddd，J＝2.4，7.6，??13.2Hz)，2.47(2H，s)，2.49(1H，dd，J＝7.6，16.6Hz)，2.86(1H，quint，J＝7.6Hz)，3.21-3.22??(1H，m)，4.75(1H，d，J＝11.7Hz)，4.84(1H，d，J＝11.7Hz)，5.27(1H，s).??MS(FAB)：m/z：296(M+H)+，318(M+Na)+.
??8(8-e) ??Mp.175-176℃.??1H-NMR(400MHz、CD3OD)：d?ppm：1.10(3H，t，J＝7.4Hz)，1.48(1H，dd，J＝7.5，12.5Hz)，??2.03-2.08(2H，m)，2.14(2H，q，J＝7.4Hz)，2.46(1H，d，J＝16.2Hz)，2.46-2.53(1H，m)，??2.51(1H，d，J＝16.2Hz)，2.85(1H，quint，J＝7.5Hz)，3.09-3.10(1H，m)，3.14(1H，d，??J＝13.0Hz)，3.18(1H，d，J＝13.0Hz)，5.38(1H，dd，J＝1.7，3.7Hz).??IR(KBr)：cm-1：2962，2928，2897，2877，1559，1527，1403.??MS(FAB)：m/z：210(M+H)+，232(M+Na)+.??Anal.calcd?for?C12H19NO2：C，68.87；H，9.15；N，6.69；Found?C，C，67.64；H，9.18；N，??6.61.
??8(8-c) ??1H-NMR(400MHz、CDCl3)：d?ppm：??Major?isomer?1.06(3H，t，J＝7.4Hz)，1.45(9H，s)，2.07-2.22(3H，m)，2.59-2.70(2H，m)，??2.87-2.96(1H，m)，3.30(1H，ddt，J＝8.6，18.4，2.7Hz)，3.86-3.88(1H，m)，5.22-5.23(1H，??m)，5.45-5.47(1H，m).??Minor?isomer?1.08(3H，t，J＝7.3Hz)，1.49(9H，s)，2.07-2.21(3H，m)，2.43-2.47(1H，m)，??2.59-2.70(1H，m)，2.75-2.85(1H，m)，2.87-2.96(1H，m)，4.28-4.31(1H，m)，5.35-5.38??(1H，m)，5.45-5.47(1H，m).??MS(FAB)：m/z：235(M+H)+，257(M+Na)+.
??9(9-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：0.90(3H，t，J＝7.5Hz)，1.18-1.-1.55(4H，m)，1.95-2.30??(2H，m).2.42-2.53(2H，m)，2.75-2.82(1H，m)，3.72(3H，s)，4.01-4.11(1H，m)，5.01-5.09??(2H，m)，5.74-5.86(1H，m).
??9(9-b) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.21(3H，t，J＝7.5Hz)，1.31-1.-1.43(3H，m)，1.54-1.58??(1H，m).2.00-2.29(3H，m)，2.47-2.59(2H，m)，4.04-4.11(2H，m)，5.03-5.10(2H，m)，??5.77-5.89(1H，m).
??9(9-c) ??1H-NMR(400MHz、CDCl3)：d?ppm：??Major?isomer?0.91(3H，t，J＝7.3Hz)，1.45(9H，s)，1.48-1.50(3H，m)，2.06-2.19(2H，m)，??2.57-2.70(2H，m)，2.87-2.96(1H，m)，3.30(1H，ddt，J＝8.6，18.4，2.7Hz)，3.86(1H，broad)，??5.22-5.23(1H，m)，5.45-5.46(1H，m).??Minor?isomer?0.91(3H，t，J＝7.3Hz)，1.49(9H，s)，1.48-1.50(3H，m)，2.06-2.47(2H，m)，??2.57-2.70(2H，m)，2.87-2.96(2H，m)，4.29(1H，broad)，5.34-5.35(1H，m)，5.45-5.46(1H，??m).
??8(8-c) ??1H-NMR(400MHz、CDCl3)：d?ppm：??Major?isomer?1.06(3H，t，J＝7.4Hz)，1.45(9H，s)，2.07-2.22(3H，m)，2.59-2.70(2H，m)，??2.87-2.96(1H，m)，3.30(1H，ddt，J＝8.6，18.4，2.7Hz)，3.86-3.88(1H，m)，5.22-5.23(1H，??m)，5.45-5.47(1H，m).??Minor?isomer?1.08(3H，t，J＝7.3Hz)，1.49(9H，s)，2.07-2.21(3H，m)，2.43-2.47(1H，m)，??2.59-2.70(1H，m)，2.75-2.85(1H，m)，2.87-2.96(1H，m)，4.28-4.31(1H，m)，5.35-5.38??(1H，m)，5.45-5.47(1H，m).??MS(FAB)：m/z：235(M+H)+，257(M+Na)+.
??9(9-d) ??1H-NMR(400MHz、CDCl3)：d?ppm：0.91(3H，t，J＝7.4Hz)，1.27-1.32(2H，m)，1.46(9H，s)，??1.45-1.58(3H，m)，2.03-2.13(2H，m)，2.27-2.29(1H，m)，2.46-2.51(2H，m)，2.84-2.92??(1H，m)，3.22(1H，broad)，4.75(1H，d，J＝11.7Hz)，4.85(1H，d，J＝11.7Hz)，5.27(1H，s).
??9(9-e) ??Mp：174-175℃.??1H-NMR(400MHz、CD3OD)：d?ppm：0.94(3H，t，J＝7.4Hz)，1.45-1.58(3H，m)，??2.03-2.08(2H，m)，2.14(2H，t，J＝8.0Hz)，2.46-2.50(1H，m)，2.48(1H，d，J＝12.0Hz)，??2.52(1H，d，J＝12.0Hz)，2.85(1H，quint，J＝7.4Hz)，3.10-3.12(1H，m)，3.14(1H，d，??J＝13.1Hz)，3.18(1H，d，J＝13.1Hz)，5.38(1H，d，J＝1.7Hz).??IR(KBr)：cm-1：2957，2928，2905，2834，2629，1540，1397，1380，1285.??MS(FAB)：m/z：224(M+H)+，246(M+Na)+.??Anal.calcd?for?C13H21NO2：C，69.92；H，9.48；N，6.27；Found?C，C，69.13；H，9.51；N，??6.21.
??8(8-c) ??1H-NMR(400MHz、CDCl3)：d?ppm：??Major?isomer?1.06(3H，t，J＝7.4Hz)，1.45(9H，s)，2.07-2.22(3H，m)，2.59-2.70(2H，m)，??2.87-2.96(1H，m)，3.30(1H，ddt，J＝8.6，18.4，2.7Hz)，3.86-3.88(1H，m)，5.22-5.23(1H，??m)，5.45-5.47(1H，m).??Minor?isomer?1.08(3H，t，J＝7.3Hz)，1.49(9H，s)，2.07-2.21(3H，m)，2.43-2.47(1H，m)，??2.59-2.70(1H，m)，2.75-2.85(1H，m)，2.87-2.96(1H，m)，4.28-4.31(1H，m)，5.35-5.38??(1H，m)，5.45-5.47(1H，m).??MS(FAB)：m/z：235(M+H)+，257(M+Na)+.
??10(10-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：0.90(3H，t，J＝7Hz)，1.20-1.40(6H，m)，1.50-1.56??(1H，m)，1.95-2.27(3H，m)，2.46-2.49(2H，m)，2.74(1H，d，J＝4Hz)，3.72(3H，s)，??4.01-4.10(1H，m)，5.00-5.10(2H，m)，5.74-5.85(1H，m).
??10(10-c) ??1H-NMR(400MHz、CDCl3)：d?ppm：0.87-0.93(3H，m)，1.25-1.45(4H，m)，1.46(1.49)(9H，??s，1.98-2.20(3H，m)，2.40-2.95(4H，m)，3.86-3.88(4.29-4.40)(1H，m)，5.23(5.05)(1H，??br.s)，5.45(5.35)(1H，br.s.).
??10(10d) ??1H-NMR(400MHz、CDCl3)：d?ppm：0.92(3H，t，J＝7Hz)，1.25-1.38(4H，m)，1.45(9H，s)，??1.96-2.15(4H，m)，2.25-2.33(1H，m)，2.45-2.55(1H，m)，2.47(2H，s)，2.81-2.88(1H，m)，??3.18-3.23(1H，m)，4.75(1H，d，J＝12Hz)，4.84(1H，d，J＝12Hz)，5.26(1H，s).
??10(10-e) ??1H-NMR(400MHz、CDCl3)：d?ppm：0.91(3H，t，J＝7)，1.25-1.49(5H，m)，1.44(18H，s)，??1.95-2.15(4H，m)，2.24(2H，dd，J＝14，21Hz)，2.40-2.50(1H，m)，2.75-2.90(1H，m)，??2.97-3.03(1H，m)，3.30-3.45(2H，m)，4.99(1H，br.s)，5.33(1H，br.s).
[table 5]
??10(10-f) ??1H-NMR(400MHz、CD3OD)：d?ppm：0.93(3H，t，J＝7Hz)，1.26-1.53(5H，m)，1.97-2.17(4H，??m)，2.48-2.51(1H，m)，2.46(1H，d，J＝16Hz)，2.50(1H，d，J＝16Hz)，2.82-2.91(1H，m)，??3.05-3.11(1H，m)，3.14(1H，d，J＝13Hz)，3.18(1H，d，J＝13Hz)，5.38(1H，br.s).??IR(KBr)：cm-1：2957，2926，1564，1525，1397??MS(EI)：m/z：238(M)+.??Anal.calcd?for?C14H23NO2；0.2H2O：C，69.79；H，9.79；N，5.81；Found?C，69.94；H，9.74；N，??5.91.??Mp.150℃(decomp.)
??11(11-b) ??1H-NMR(400MHz、CDCl3)：d?ppm：0.92(isomerA3H，d，J＝7.0Hz)，0.93(isomerB3H，d，??J＝7.0Hz)，0.94(isomerB3H，d，J＝7.0Hz)，0.98(isomerA3H，，d，J＝7.0Hz)，1.28-1.33??(isomerA1H，m)，1.41-1.46(isomerB1H，m)，1.84(isomerA1H，d-sept，J＝4.7，7.0Hz)，1.95-2.07??(isomerB1H，m)，2.11-2.29(2H，m)，2.44(isomerB1H，dd，J＝3.1，13.3Hz)，2.48(isomerA1H，dd，??J＝3.1，13.3Hz)，2.51-2.62(1H，m)，2.66(isomerA1H，d，J＝3.9Hz)，2.82(isomerB1H，，d，??J＝3.9Hz)，3.72(3H，s)，4.04-4.09(isomerB1H，m)，4.18-4.22(isomerA1H，m)，4.98-5.09(2H，??m)，5.81(isomerB1H，ddt，J＝10.2，17.2，7.0Hz)，5.89(isomerA1H，ddt，J＝10.2，17.2，7.0Hz).
??11(11-c) ??1H-NMR(400MHz、CDCl3)：d?ppm：0.92(isomerA3H，d，J＝7.0Hz)，0.93(isomerB3H，d，??J＝7.0Hz)，0.95(isomerB3H，d，J＝7.0Hz)，0.98(isomerA3H，d，J＝7.0Hz)，1.32-1.37(isomerA1H，??m)，1.43-1.49(isomerB1H，m)，1.85(isomerA1H，d-sept，J＝5.5，7.0Hz)，1.98(isomerB1H，??d-sept，J＝4.3，7.0Hz)，2.04-2.25(2H，m)，2.49-2.68(2H，m)，4.10(isomerB1H，dt，J＝6.3，3.1??Hz)，4.22(isomerA1H，ddd，J＝2.7，4.3，9.4Hz)，5.01(1H，m)，5.08(isomerB1H，ddd，J＝1.6，3.2，??18.0Hz)，5.10(isomerA1H，ddd，J＝1.8，3.3，17.0Hz)，5.81(isomerB1H，m)，5.90(isomerA1H，??ddd，J＝7.0，9.8，17.0Hz).
??10(10-f) ??1H-NMR(400MHz、CD3OD)：d?ppm：0.93(3H，t，J＝7Hz)，1.26-1.53(5H，m)，1.97-2.17(4H，??m)，2.48-2.51(1H，m)，2.46(1H，d，J＝16Hz)，2.50(1H，d，J＝16Hz)，2.82-2.91(1H，m)，??3.05-3.11(1H，m)，3.14(1H，d，J＝13Hz)，3.18(1H，d，J＝13Hz)，5.38(1H，br.s).??IR(KBr)：cm-1：2957，2926，1564，1525，1397??MS(EI)：m/z：238(M)+.??Anal.calcd?for?C14H23NO2；0.2H2O：C，69.79；H，9.79；N，5.81；Found?C，69.94；H，9.74；N，??5.91.??Mp.150℃(decomp.)
??11(11-d) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.07(6H，d，J＝6.7Hz)，2.35(1H，m)，2.40(1H，sept，??J＝6.7Hz)，2.75-2.85(3H，m)，3.20(1H，m)，4.19(1H，br)，5.22(1H，br).
??11(11-e) ??1H-NMR(400MHz、CDCl3)：d?ppm：E/Z?mixture?1.05(isomerA3H，d，J＝6.6Hz)，1.06??(isomerB3H，d，J＝6.6Hz)，1.06(isomerA3H，d，J＝6.6Hz)，1.06(isomerB3H，d，J＝6.6Hz)，1.46??(isomerA9H，s)，1.49(isomerB9H，s)，2.18-2.25(1H，m)，2.36(1H，sept，J＝6.6Hz)，2.41-2.68??(2H，m)，2.87-2.95(isomerB1H+1H，m)，3.29(isomerA1H，ddt，J＝8.6，18.0，2.7Hz)，3.83-3.88??(isomerA1H，m)，4.26-4.31(isomerB1H，m)，5.21-5.23(isomerA1H，m)，5.34-5.35(isomerB1H，??m)，5.43-5.45(isomerB1H，m)，5.45-5.47(isomerA1H，m).
??11(11-f) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.08(3H，d，J＝6.8Hz)，1.09(3H，d，J＝6.8Hz)，1.46(9H，s)，??1.45-1.52(1H，m)，2.09(1H，d，J＝16.4Hz)，2.30(1H，m)，2.41(1H，sept，J＝6.8Hz)，2.47(2H，s)，??2.52(1H，dd，J＝7.8，16.4Hz)，2.86(1H，quint，J＝7.8Hz)，3.20(1H，br)，4.75(1H，d，J＝11.5Hz)，??4.85(1H，d，J＝11.5Hz)，5.26(1H，s).
??10(10-f) ??1H-NMR(400MHz、CD3OD)：d?ppm：0.93(3H，t，J＝7Hz)，1.26-1.53(5H，m)，1.97-2.17(4H，??m)，2.48-2.51(1H，m)，2.46(1H，d，J＝16Hz)，2.50(1H，d，J＝16Hz)，2.82-2.91(1H，m)，??3.05-3.11(1H，m)，3.14(1H，d，J＝13Hz)，3.18(1H，d，J＝13Hz)，5.38(1H，br.s).??IR(KBr)：cm-1：2957，2926，1564，1525，1397??MS(EI)：m/z：238(M)+.??Anal.calcd?for?C14H23NO2；0.2H2O：C，69.79；H，9.79；N，5.81；Found?C，69.94；H，9.74；N，??5.91.??Mp.150℃(decomp.)
??11(11-g) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.07(3H，d，J＝6.8Hz)，1.09(3H，d，J＝6.8Hz)，1.40(1H，m)，??1.44(9H，s)，1.95(1H，ddd，J＝2.3，8.6，12.1Hz)，2.04(1H，m)，2.24(1H，d，J＝13.7Hz)，2.31(1H，??d，J＝13.7Hz)，2.40(1H，sept，J＝6.8Hz)，2.48(1H，m)，2.73(1H，quint，J＝7.8Hz)，2.85(2H，s)，??2.93(1H，br)，5.37(1H，s).
??11(11-h) ??Mp.161-163℃(decompose)；??1H-NMR(400MHz、CD3OD)：d?ppm：1.09(3H，d，J＝6.7Hz)，1.10(3H，d，J＝6.7Hz)，1.46(1H，dd，??J＝7.4，12.1Hz)，2.02-2.11(2H，m)，2.42(1H，sept，J＝6.7Hz)，2.48(2H，br)，2.52(1H，d，??J＝7.4Hz)，2.85(1H，quint，J＝7.4Hz)，3.10(1H，br)，3.15(1H，d，J＝13.0Hz)，3.20(1H，d，??J＝13.0Hz)，5.37(1H，s).??IR(KCl)vmax?1616.1，1506.1，1396.2cm-1??MS(ESI+)m/z：278(M+Na+MeOH)+，268(M+2Na-H)+，246(M+Na)+，224(M+H)+??HRMS(ESI+)calcd?for(M+Na)+：246.14700.Found?246.14815(1.15mmu).
??10(10-f) ??1H-NMR(400MHz、CD3OD)：d?ppm：0.93(3H，t，J＝7Hz)，1.26-1.53(5H，m)，1.97-2.17(4H，??m)，2.48-2.51(1H，m)，2.46(1H，d，J＝16Hz)，2.50(1H，d，J＝16Hz)，2.82-2.91(1H，m)，??3.05-3.11(1H，m)，3.14(1H，d，J＝13Hz)，3.18(1H，d，J＝13Hz)，5.38(1H，br.s).??IR(KBr)：cm-1：2957，2926，1564，1525，1397??MS(EI)：m/z：238(M)+.??Anal.calcd?for?C14H23NO2；0.2H2O：C，69.79；H，9.79；N，5.81；Found?C，69.94；H，9.74；N，??5.91.??Mp.150℃(decomp.)
??12(12-a) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.89(6H，d，J＝7Hz)，1.1-1.3(3H，m)，1.55-1.75(2H，m)，??2.10-2.14(1H，m)，3.53(1H，dd，J＝6，11Hz)，3.57(1H，dd，J＝6，11Hz)，5.01-5.11(2H，m)，??5.73-5.87(1H，m).
??12(12-c) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.86-0.92(6H，m)，1.16-1.24(2H，m)，1.60-1.73(2H，m)，??1.96-2.29(2H，m)，2.40-2.53(2H，m)，2.73-2.78(1H，m)，3.27(3H，s)，4.0-4.15(1H，m)，??5.01-5.11(1H，m)，5.77-5.85(1H，m).
??12(12-e) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.86-0.89(6H，m)，1.45(1.49)(9H，m)，1.74-2.01(4H，m)，??2.50-2.95(4H，m)，3.25-3.90(1H，m)，5.20-5.24(4.98-5.02)(1H，m)，5.43-5.48(5.30-5.36)(1H，??m).
??12(12-l) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.90(3H，d，J＝6Hz)，0.92((3H，d，J＝6Hz)，1.46(9H，s)，??1.50-1.55(1H，m)，1.76-1.83(1H，m)，2.02-2.07(4H，m)，2.25-2.34(1H，m)，2.43-2.52(1H，m)，??2.49(2H，br.s)，2.84-2.91(1H，m)，3.21-3.74(1H，m)，4.76(1H，d?J＝11Hz)，4.85(1H，d?J＝11??Hz)，5.27(1H，s).
??10(10-f) ??1H-NMR(400MHz、CD3OD)：d?ppm：0.93(3H，t，J＝7Hz)，1.26-1.53(5H，m)，1.97-2.17(4H，??m)，2.48-2.51(1H，m)，2.46(1H，d，J＝16Hz)，2.50(1H，d，J＝16Hz)，2.82-2.91(1H，m)，??3.05-3.11(1H，m)，3.14(1H，d，J＝13Hz)，3.18(1H，d，J＝13Hz)，5.38(1H，br.s).??IR(KBr)：cm-1：2957，2926，1564，1525，1397??MS(EI)：m/z：238(M)+.??Anal.calcd?for?C14H23NO2；0.2H2O：C，69.79；H，9.79；N，5.81；Found?C，69.94；H，9.74；N，??5.91.??Mp.150℃(decomp.)
??12(12-g) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.90(3H，d，J＝6Hz)，0.92((3H，d，J＝6Hz)，1.40-1.50(2H，??m)，1.44(18H，s)，1.75-1.81(1H，m)，1.95-2.05(5H，m)，2.25(2H，dd，J＝14，22Hz)，2.35-2.46??(1H，m)，2.80-2.90(1H，m)，3.30-3.41(2H，m)，4.98-5.04(1H，m)，5.33(1H，s).
[table 6]
??12(12-h) ??1H-NMR(400MHz，CD3OD)：d?ppm：0.90(3H，d，J＝6Hz)，0.92((3H，d，J＝6Hz)，1.48(1H，dd，??J＝7，13Hz)，1.81(1H，sep，J＝6Hz)，2.02-2.08(4H，m)，2.43-2.51(3H，m)，2.82-2.91(1H，m)，??3.09-3.14(1H，m)，3.16(2H，dd，J＝13，23Hz)，5.37(1H，s).??Anal.calcd?for?C14H23NO20.25H2O：C，69.58；H，9.79；N，5.80；Found?C，69.31；H，10.01；N，??6.08.??IR(KBr)：cm-1：2951，2905，1541，1461，1398??MS(EI)：m/z：237(M)+.??Mp.171-174℃.
??13(13-b) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.85-0.92(6H，m)，1.13-1.33(2H，m)，1.37-1.65(3H，m)，??2.12-2.16(1H，m)，3.63-3.69(2H，m)，4.99-5.10(2H，m)，5.90(1H，m).
??13(13-d) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.86-0.96(6H，m)，1.10-2.05(4H，m)，2.07-2.31(2H，m)，??2.40-2.84(3H，m)，3.72(3H，s)，4.03-4.28(1H，m)，4.97-5.09(2H，m)，5.74-5.96(1H，m).
??13(13-e) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.86-0.97(6H，m)，1.13-1.79(4H，m)，1.97-2.31(2H，m)，??2.47-2.69(2H，m)，4.06-4.26(1H，m)，4.99-5.12(2H，m)，5.74-5.97(1H，m).
??13(13-f) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.83(isomerX3H，d，J＝7.0Hz)，0.84(isomerX3H，d，??J＝7.0Hz)，1.04(isomerX3H，d，J＝7.0Hz)，1.04(isomerX3H，d，J＝7.0Hz)，1.33-1.52(2H，m)，??2.22-2.37(2H，m)，2.85-2.88(3H，m)，3.16-3.24(1H，m)，4.17-4.22(1H，m)，5.24(1H，br).
??12(12-h) ??1H-NMR(400MHz，CD3OD)：d?ppm：0.90(3H，d，J＝6Hz)，0.92((3H，d，J＝6Hz)，1.48(1H，dd，??J＝7，13Hz)，1.81(1H，sep，J＝6Hz)，2.02-2.08(4H，m)，2.43-2.51(3H，m)，2.82-2.91(1H，m)，??3.09-3.14(1H，m)，3.16(2H，dd，J＝13，23Hz)，5.37(1H，s).??Anal.calcd?for?C14H23NO20.25H2O：C，69.58；H，9.79；N，5.80；Found?C，69.31；H，10.01；N，??6.08.??IR(KBr)：cm-1：2951，2905，1541，1461，1398??MS(EI)：m/z：237(M)+.??Mp.171-174℃.
??13(13-g) ??1H-NMR(400MHz，CDCl3)：d?ppm：E/Z?mixture?0.84(3H，t，J＝7.0Hz)，1.02-1.04(3H，m)，??1.29-1.48(2H，m)，1.45(isomerA9H，s)，1.49(isomerB9H，s)，2.10-2.25(2H，m)，2.40-2.68(2H，??m)，2.86-2.96(isomerB1H+1H，m)，3.29(isomerA1H，m)，3.85(isomerA1H，br)，4.29??(isomerB1H，br)，5.24(isomerA1H，br)，5.34(isomerB1H，m)，5.46(isomerA1H+isomerB1H，??m).
??13(13-h) ??1H-NMR(500MHz，CDCl3)：d?ppm：0.86(isomerX3H，t，J＝7.3Hz)，0.87(isomerX3H，t，J＝7.3Hz)，??1.05(isomerX3H，d，J＝7.3Hz)，1.06(isomerX3H，d，J＝7.3Hz)，1.46(9H，s)，1.33-1.57(3H，m)，??2.03(isomerX1H，d，J＝16.1Hz)，2.08(isomerX1H，d，J＝16.1Hz)，2.24-2.32(2H，m)，2.48(2H，??m)，2.43-2.52(1H，m)，2.88(1H，sep，J＝7.3Hz)，3.21(1H，br)，4.75(1H，d，J＝11.7Hz)，4.86(1H，??d，J＝11.7Hz)，5.28(1H，s).
??12(12-h) ??1H-NMR(400MHz，CD3OD)：d?ppm：0.90(3H，d，J＝6Hz)，0.92((3H，d，J＝6Hz)，1.48(1H，dd，??J＝7，13Hz)，1.81(1H，sep，J＝6Hz)，2.02-2.08(4H，m)，2.43-2.51(3H，m)，2.82-2.91(1H，m)，??3.09-3.14(1H，m)，3.16(2H，dd，J＝13，23Hz)，5.37(1H，s).??Anal.calcd?for?C14H23NO20.25H2O：C，69.58；H，9.79；N，5.80；Found?C，69.31；H，10.01；N，??6.08.??IR(KBr)：cm-1：2951，2905，1541，1461，1398??MS(EI)：m/z：237(M)+.??Mp.171-174℃.
??13(13-i) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.86(isomerX3H，t，J＝7.4Hz)，0.87(isomerX3H，t，J＝7.4Hz)，??1.04(isomerX3H，d，J＝7.0Hz)，1.06(isomerX3H，d，J＝7.0Hz)，1.33-1.51(3H，m)，1.44(9H，s)，??1.92-1.99(1H，m)，1.99-2.06(1H，m)，2.22-2.29(1H，m)，2.25(1H，dd，J＝2.7，13.7Hz)，2.32??(1H，dd，J＝2.0，13.7Hz)，2.38-2.48(1H，m)，2.72(1H，sep，J＝7.8Hz)，2.85(2H，s)，2.94(1H，br)，??5.38(1H，m).
??13(13-j) ??Mp.151-154℃；??1H-NMR(400MHz，CD3OD)：d?ppm：0.87(isomerX3H，t，J＝7.4Hz)，0.90(isomerX3H，t，??J＝7.4Hz)，1.06(isomerX3H，d，J＝7.0Hz)，1.08(isomerX3H，d，J＝7.0Hz)，1.39(1H，m)，??1.44-1.53(2H，m)，2.00-2.10(2H，m)，2.28(1H，sep，J＝6.6Hz)，2.46(1H，m)，2.49(1H，d，??J＝2.0Hz)，2.85(1H，sep，J＝7.4Hz)，3.11(1H，br)，3.14(1H，d，J＝12.9Hz)，3.20(1H，d，??J＝12.9Hz)，5.40(1H，d，J＝2.0Hz).??MS(ESI+)m/z：292(M+Na+MeOH)+，282(M+2Na-H)+，260(M+Na)+，238(M+H)+??HRMS(ESI+)calcd?for(M+Na)+：260.16265.Found?260.16353(0.88mmu).
??12(12-h) ??1H-NMR(400MHz，CD3OD)：d?ppm：0.90(3H，d，J＝6Hz)，0.92((3H，d，J＝6Hz)，1.48(1H，dd，??J＝7，13Hz)，1.81(1H，sep，J＝6Hz)，2.02-2.08(4H，m)，2.43-2.51(3H，m)，2.82-2.91(1H，m)，??3.09-3.14(1H，m)，3.16(2H，dd，J＝13，23Hz)，5.37(1H，s).??Anal.calcd?for?C14H23NO20.25H2O：C，69.58；H，9.79；N，5.80；Found?C，69.31；H，10.01；N，??6.08.??IR(KBr)：cm-1：2951，2905，1541，1461，1398??MS(EI)：m/z：237(M)+.??Mp.171-174℃.
??14(14-a) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.11-1.21(2H，m)，1.25(3H，t，J＝7.0Hz)，1.48-1.73(5H，m)，??1.80-1.87(1H，m)，1.94-2.05(1H，m)，2.21-2.35(2H，m)，4.13(2H，q，J＝7.0Hz)，4.98(1H，ddd，??J＝1.2，2.0，10.2Hz)，5.05(1H，dd，J＝1.2，17.2Hz)，5.75(1H，ddt，J＝10.2，17.2，7.0Hz).
??14(14-b) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.09-1.20(2H，m)，1.30(1H，dd，J＝5.9，6.3Hz)，1.40-1.67??(5H，m)，1.71-1.85(3H，m)，2.13(1H，ddt，J＝7.8，14.1，1.2Hz)，2.30(1H，dddt，J＝4.3，6.6，14.1，??1.6Hz)，3.58(1H，dt，J＝10.6，5.9Hz)，3.69(1H，ddd，J＝4.3，6.3，10.6Hz)，5.02(1H，dtt，J＝10.2，??1.2，1.6Hz)，5.09(1H，ddt，J＝1.2，17.2，1.6Hz)，5.87(1H，dddd，J＝6.6，7.8，10.2，17.2Hz).
??14(14-d) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.11-1.26(2H，m)，1.33-1.68(5H，m)，1.70-2.01(3H，m)，??2.41-2.73(2H，m)，3.72(3H，s)，4.11-4.24(1h，m)，5.06(isomerA1H，ddd，J＝1.6，3.5，15.6Hz)，??5.08(isomerB1H，ddd，J＝1.6，3.5，15.6Hz)，5.84-5.97(1H，m).
??14(14-e) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.12-1.26(2H，m)，1.40-1.67(5H，m)，1.71-2.01(3H，m)，??2.19-2.27(2H，m)，2.46-2.71(2H，m)，4.18-4.25(1H，m)，5.00-5.03(1H，m)，5.06-5.10??(isomerA1H，m)，5.07-5.12(isomerB1H，m)，5.84-5.97(1H，m).
??12(12-h) ??1H-NMR(400MHz，CD3OD)：d?ppm：0.90(3H，d，J＝6Hz)，0.92((3H，d，J＝6Hz)，1.48(1H，dd，??J＝7，13Hz)，1.81(1H，sep，J＝6Hz)，2.02-2.08(4H，m)，2.43-2.51(3H，m)，2.82-2.91(1H，m)，??3.09-3.14(1H，m)，3.16(2H，dd，J＝13，23Hz)，5.37(1H，s).??Anal.calcd?for?C14H23NO20.25H2O：C，69.58；H，9.79；N，5.80；Found?C，69.31；H，10.01；N，??6.08.??IR(KBr)：cm-1：2951，2905，1541，1461，1398??MS(EI)：m/z：237(M)+.??Mp.171-174℃.
??14(14-f) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.36-1.45(2H，m)，1.54-1.62(2H，m)，1.62-1.69(2H，m)，??1.78-1.86(2H，m)，2.30-2.38(1H，m)，2.54(1H，quint，J＝8.2Hz)，2.76-2.83(3H，m)，3.14-3.24??(1H，m)，4.16-4.21(1H，m)，5.23(1H，m).
??14(14-g) ??1H-NMR(500MHz，CDCl3)：d?ppm：E/Z?mixture?1.39-1.59(13H，m)，1.62-1.69(2H，m)，??1.78-1.83(2H，m)，2.18-2.23(1H，m)，2.51(1H，quint，J＝7.8Hz)，2.60-2.68(2H，m)，2.85-2.94??(isomerB1H+1H，m)，3.29(isomerA1H，ddd，J＝2.9，5.9，12.5Hz)，3.85(isomerA1H，br)，4.28??(isomerB1H，br)，5.23(isomerA1H，s)，5.34(isomerB1H，m)，5.45(1H，m).
??14(14-h) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.38-1.52(12H，m)，1.56-1.72(4H，m)，1.82(2H，m)，2.08??(1H，d，J＝16.4Hz)，2.29(1H，ddd，J＝2.7，9.0，12.9Hz)，2.46(2H，s)，2.49-2.59(2H，m)，2.86(1H，??quint，J＝7.8Hz)，3.20(1H，br)，4.74(1H，d，J＝11.7Hz)，4.85(1H，d，J＝11.7Hz)，5.26(1H，s).
[table 7]
??14(14-i) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.37-1.49(12H，m)，1.55-1.71(4H，m)，1.82(2H，m)，1.95??(1H，ddd，J＝2.7，9.0，12.5Hz)，2.04(1H，m)，2.23(1H，d，J＝14.1Hz)，2.31(1H，d，J＝14.1Hz)，??2.48(1H，m)，2.55(1H，quint，J＝8.6Hz)，2.73(1H，quint，J＝7.4Hz)，2.85(2H，s)，2.94(1H，br)，??5.83(1H，s).
??14(14-j) ??Mp.168℃(decompse)；??1H-NMR(500MHz，CD3OD)：d?ppm：1.44-1.52(3H，m)，1.56-1.73(4H，m)，1.80-1.87(2H，m)，??2.05(1H，ddd，J＝2.9，8.8，11.7Hz)，2.07-2.10(1H，m)，2.48-2.53(3H，m)，2.58(1H，quint，??J＝8.3Hz)，2.85(1H，quint，J＝7.8Hz)，3.09(1H，m)，3.13(1H，d，J＝13.2Hz)，3.18(1H，d，??J＝13.2Hz)，5.39(1H，s)；??IR(KCl)vmax?1616.1，1505.2，1395.2cm-1；??MS(ESI+)m/z：272(M+Na)+，250(M+H)+；??HRMS(ESI+)calcd?for(M+H)+：250.18070.Found?250.18174(1.04mmu).
??15(15-a) ??1H-NMR(400MHz，CDCl3)：d?ppm：2.11-2.29(4H，m)，2.35-2.44(1H，m)，5.05(4H，d，??J＝12.9Hz)，5.66-5.82(3H，m)，6.93(1H，ddd，J＝1.2，8.6，15.8H?z).
??15(15-b) ??1H-NMR(400MHz，CDCl3)：d?ppm：??Major?isomer?1.45(9H，s)，2.18-2.22(1H，m)，2.58-2.71(2H，m)，2.84-2.97(3H，m)，3.26-3.34??(1H，m)，3.87-3.88(1H，m)，5.02-5.09(2H，m)，5.28-5.50(2H，m)，5.80-5.90(1H，m).??Minor?isomer?1.47(9H，s)，2.18-2.22(1H，m)，2.58-2.71(2H，m)，2.84-2.97(3H，m)，3.26-3.34??(1H，m)，4.31-4.32(1H，m)，5.02-5.09(2H，m)，5.28-5.50(2H，m)，5.80-5.90(1H，m).
??14(14-i) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.37-1.49(12H，m)，1.55-1.71(4H，m)，1.82(2H，m)，1.95??(1H，ddd，J＝2.7，9.0，12.5Hz)，2.04(1H，m)，2.23(1H，d，J＝14.1Hz)，2.31(1H，d，J＝14.1Hz)，??2.48(1H，m)，2.55(1H，quint，J＝8.6Hz)，2.73(1H，quint，J＝7.4Hz)，2.85(2H，s)，2.94(1H，br)，??5.83(1H，s).
??15(15-c) ??1H-NMR(400MHz，CDCl3)：d??ppm：1.45(9H，s)，1.52(1H，dd，J＝7.6，13.2Hz)，??2.05-2.10(1H，m)，2.30(1H，ddd，J＝2.4，7.6，13.2Hz)，2.47(2H，s)，2.51(1H，dd，??J＝8.6，16.4Hz)，2.86(1H，quint，J＝7.6Hz)，2.88(2H，d，6.7Hz)，3.22-3.23(1H，m)，4.75(1H，d，??J＝11.7Hz)，4.84(1H，d，J＝11.7Hz)，5.05-5.11(2H，m)，5.32(1H，s)，5.81-5.91(1H，m).
??15(15-d) ??Mp.175-176℃??1H-NMR(400MHz，CD3OD)：d?ppm：1.49(1H，dd，J＝7.5，12.2Hz)，2.03-2.09(2H，m)，2.46(1H，??d，J＝16.2Hz)，2.49(1H，dd，J＝8.7，15.5Hz)，2.51(1H，d，J＝16.2Hz)，2.86(1H，quint，J＝7.5Hz)，??2.89(2H，d，J＝5.0Hz)，3.10-3.12(1H，m)，3.14(1H，d，J＝13.1Hz)，3.19(1H，d，J＝13.1Hz)，??5.10-5.01(2H，m)，5.42(1H，d，J＝1.7H?z)，5.94-5.84(1H，m).??IR(KBr)：cm-1：2948，2900，2835，1563，1542，1525，1397，1383，910，663.??MS(EI)：m/z：221(M)+.??Anal.calcd?for?C13H19NO2：C，70.56；H，8.65；N，6.33；Found?C，C，69.69；H，8.73；N，6.31.
??16(16-a) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.27(3H，t，J＝7.0Hz)，1.34(3H，d，J＝7.0Hz)，2.31-2.38(2H，??m)，2.56-2.74(2H，m)，3.52(1H，q，J＝7.0Hz)，4.19(2H，q，J＝7.0Hz)，4.98，5.00，5.02，and??5.05(total?2H，each?dd，J＝1.5，3.1Hz，1.6，3.1Hz，1.6，3.2Hz?and?1.6，3.2Hz)，5.75-5.85(1H，m).
??14(14-i) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.37-1.49(12H，m)，1.55-1.71(4H，m)，1.82(2H，m)，1.95??(1H，ddd，J＝2.7，9.0，12.5Hz)，2.04(1H，m)，2.23(1H，d，J＝14.1Hz)，2.31(1H，d，J＝14.1Hz)，??2.48(1H，m)，2.55(1H，quint，J＝8.6Hz)，2.73(1H，quint，J＝7.4Hz)，2.85(2H，s)，2.94(1H，br)，??5.83(1H，s).
??16(16-b) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.20and?1.23(total?3H，each?d，J＝7.0and?7.4Hz)，1.29(3H，??t，J＝7.0Hz)，1.43-1.66(2H，m)，2.09-2.34(2H，m)，2.47-2.57(1H，m)，3.63-3.73and??3.88-3.95(total?1H，each?m)，4.18(2H，q，J＝7.0Hz)，4.97，5.00，5.04，and?5.08(total?2H，each??m)，5.77-5.89(1H，m).
??16(16-c) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.23and?1.27(total?3H，each?d，J＝7.4and?7.1Hz)，??1.47-1.73(2H，m)，2.10-2.33(2H，m)，2.53-2.67(1H，m)，3.69-3.76and?3.93-4.02(total?1H，??each?m)，4.99，5.02，5.05，and?5.09(total?2H，each?m)，5.79-5.89(1H，m).
??16(16-d) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.29(3H，s)，2.44and?2.48(1H，d，J＝18.0Hz)，2.59-2.65(1H，??m)，2.75(1H，dd，J＝5.9，18.1Hz)，2.90(1H，dd，J＝7.8，17.6Hz)，3.18(1H，dd，J＝8.8，18.1Hz)，??5.45-5.48(1H，m)，5.82-5.86(1H，m).
??16(16-e) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.26(3H，s)，1.46(9H，s)，2.30(1H，d，J＝16.9Hz)，??2.47-2.60(2H，m)，2.68-2.75(1H，m)，3.30(1H，ddd，J＝2.4，9.7，17.9Hz)，5.44-5.47(1H，m)，??5.48-5.49(1H，m)，5.71-5.74(1H，m).
??14(14-i) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.37-1.49(12H，m)，1.55-1.71(4H，m)，1.82(2H，m)，1.95??(1H，ddd，J＝2.7，9.0，12.5Hz)，2.04(1H，m)，2.23(1H，d，J＝14.1Hz)，2.31(1H，d，J＝14.1Hz)，??2.48(1H，m)，2.55(1H，quint，J＝8.6Hz)，2.73(1H，quint，J＝7.4Hz)，2.85(2H，s)，2.94(1H，br)，??5.83(1H，s).
??16(16-f) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.41(3H，s)，1.48(9H，s)，1.60(1H，dd，J＝5.4，11.2Hz)，??2.10-2.16(1H，m)，2.55(2H，s)，2.57-2.68(3H，m)，5.52-5.55(1H，m)，5.87-5.90(1H，m).??byproduct：1H-NMR(400MHz，CDCl3)：d?ppm：1.10(3H，s)，1.48(9H，s)，2.09(1H，d，J＝7.8，??12.7Hz)，2.18-2.20and?2.21-2.22(total?1H，each?m)，2.30(1H，dd，J＝8.8，12.7Hz)，2.51(1H，dd，??J＝7.3，7.9Hz)，2.60-2.66(1H，m)，2.72(2H，dd，J＝16.1，24.4Hz)，5.82-5.86(1H，m)，??5.87-5.91(1H，m).
??16(16-g) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.45，1.46?and?1.48(total?18H，each?s)，1.54-1.62(4H，m)，??2.00-2.20(2H，m)，2.55(2H，s)，2，55-2.69(2H，m)，3.28(1H，dd，J＝5.4，13.7Hz)，3.62(1H，dd，??J＝6.9，13.2Hz)，5.52-5.55(1H，m)，5.88-5，91(1H，m).
??16(16-h) ??1H-NMR(400MHz，CD3OD)：d?ppm：1.12(3H，s)，1.37(1H，dd，J＝7.3，12.2Hz)，2.02(1H，dd，??8.8，12.2Hz)，2.08-2.10and?2.11-2.13(total?1H，each?m)，2.44(1H，dd，J＝7.3，15.2Hz)，??2.52(2H，s)，2.52-2.59(1H，m)，3.19(1H，d，J＝13.2Hz)，3.32(1H，d，J＝13.2Hz)，5.74-5.80(2H，??m).??IR(KBr)：cm-1：2904，1568，1516，1395，1381??MS(FAB)：m/z：196(M+H)+，234(M+K)+??Mp.145-148℃.
[table 8]
??17(17-a) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.03(1.04)(3H，d，J＝3Hz)，1.31-1.40(1H，m)，1.51-1.66??(1H，m)，2.34-2.54(3H，m)，2.79(2.86)(1H，d，J＝4Hz)，3.71(3.72)(3H，s)，4.01-4.11(1H，m)，??4.93-5.08(2H，m)，5.60-5.80(1H，m).
??17(17-c) ??1H-NMR(400MHz，CDCl3)：d?ppm：major?0.95(3H，d，J＝7Hz)，1.45(9H，s)，2.43-2.70(2H，m)，??2.85-23.20(2H，m)，3.94(1H，br.s)，5.49(1H，br.s)，5.56-5.58(1H，m)，5.77-5.79(1H，m).
??17(17-d) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.91(3h，d，J＝7Hz)，1.45(9H，s)，1.45-1.50(1H，m)，??2.25-2.35(1H，m)，2.45-2.55(1H，m)，2.86-2.95(1H，m)，3.30-3.35(1H，m)，4.78(1H，d，J＝12??H?z)，4.86(1H，d，J＝12Hz)，5.58-5.62(1H，m)，5.70-5.77(1H，m)，5.90-5.93(1H，m).
??17(17-e) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.89(3h，d，J＝7Hz)，1.53(18H，s)，2.01(1H，m)，2.19(1H，??d，J＝12Hz)，2.25(1H，d，J＝12Hz)，2.42-2.46(1H，m)，2.85-3.20(2H，m)，3.30-3.50(2H，m)，??5.0(1H，br.s)，5.65-5.70(1H，m)，5.82-5.89(1H，m).
??17(17-f) ??1H-NMR(400MHz，CD3OD)：d?ppm：0.92(3H，t，J＝7Hz)，1.47-1.53(1H，m)，1.65-1.75(1H，m)，??2.02-2.10(1H，m)，2.42-2.55(3H，m)，3.15-3.30(3H，m)，5.70-5.76(1H，m)，5.90-5.93(1H，m).??IR(KBr)：cm-1：2952，1618，1560，1514，1394??MS(EI)：m/z：196(M)+.??Anal.calcd?for?C14H23NO2；0.2H2O：C，66.50；H，8.82；N，7.05；Found?C，66.55；H，8.60；N，??7.17.??Mp.148-152℃
??17(17-a) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.03(1.04)(3H，d，J＝3Hz)，1.31-1.40(1H，m)，1.51-1.66??(1H，m)，2.34-2.54(3H，m)，2.79(2.86)(1H，d，J＝4Hz)，3.71(3.72)(3H，s)，4.01-4.11(1H，m)，??4.93-5.08(2H，m)，5.60-5.80(1H，m).
??18(18-a) ??1H-NMR(CDCl3，400MHz)：d?1.27(3H，t，J＝7.4Hz)，1.74-1.87(1H，m)，2.11-2.32(2H，m)，??2.43-2.58(2H，m)，3.32(1H?of?minor，d，J＝4.3Hz)，3.40(1H?of?major，d，J＝5.5Hz)，3.49-3.64??(2H，m)，3.81(3H，s)，4.10-4.26(3H，m)，4.38-4.45(2H，m)，5.00-5.09(2H，m)，5.70-5.81(1H，??m)，6.88(2H，d，J＝8.2Hz)，7.23-7.26(2H，m).
??18(18-b) ?? 1H-NMR(CDCl 3，400MHz)：d?1.77-1.84(1H?of?m?ajo?r，m)，1.89-1.96(1H?of?mino?r，m)，2.??11-2.31(2H，m)，2.46-2.60(2H，m)，3.47-3.70(2H，m)，3.82(3H，s)，4.08-4.15(1H?of?m??ajo?r，m)，4.21-4.25(1H?of?minor，m)，4.39-4.48(2H，m)，5.03-5.09(2H，m)，5.68-5.79(1??H，m)，6.89(2H，d，J＝8.6Hz)，7.23(2H，d，J＝8.6Hz).
??18(18-c) ??1H-NMR(CDCl3，500MHz)：??Major?isomer：d?1.45(9H，s)，2.27-2.31(1H，m)，2.66-2.74(2H，m)，2.92-3.01(2H，m)，3.81(3H，??s)，3.93(1H，br?s)，4.06(2H，s)，4.44(2H，s)，5.47(1H，br?s)，5.56(1H，br?s)，6.87-6.90(2H，m)，??7.26-7.31(2H，m).??Minor?isomer(detectable?peaks)：d?1.48(9H，s)，2.45-2.52(1H，m)，3.29-3.36(2H，m)，4.08??(2H，s)，4.35(1H，br?s)，5.37(1H，brs)，5.77(1H，br?s).
??18(18-d) ??1H-NMR(CDCl3，500MHz)：d?1.45(9H，s)，1.55-1.60(1H，m)，2.16(1H，br?d，J＝16.6H?z)，??2.30-2.35(1H，m)，2.49(2H，s)，2.58(1H，dd，J＝7.8，16.6Hz)，2.89-2.96(1H，m)，3.29(1H，br??s)，3.81(3H，s)，4.10(2H，s)，4.46(2H，s)，4.78(1H，d，J＝11.2Hz)，4.84(1H，d，J＝11.2Hz)，??5.59(1H，br?s)，6.89(2H，d，J＝9.8Hz)，7.27(2H，d，J＝9.8Hz).
??17(17-a) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.03(1.04)(3H，d，J＝3Hz)，1.31-1.40(1H，m)，1.51-1.66??(1H，m)，2.34-2.54(3H，m)，2.79(2.86)(1H，d，J＝4Hz)，3.71(3.72)(3H，s)，4.01-4.11(1H，m)，??4.93-5.08(2H，m)，5.60-5.80(1H，m).
??18(18-e) ??1H-NMR(CDCl3，400MHz)：d?1.42-1.46(1H，m)，1.44(9H，s)，1.45(9H，s)，2.03-2.13(2H，m)，??2.23(1H，d，J＝14.1H?z)，2.29(1H，d，J＝14.1Hz)，2.50-2.57(1H，m)，2.85-2.94(1H，m)，3.06??(1H，br?s)，3.35(1H，dd，J＝6.3，13.9Hz)，3.43(1H，dd，J＝6.7，13.9H?z)，3.81(3H，s)，4.10??(2H，s)，4.45(2H，s)，4.99(1H，br?s)，5.67(1H，br?s)，6.88(2H，d，J＝8.6Hz)，7.28(2H，d，J＝??8.6Hz).
??18(18-f) ??1H-NMR(CDCl3，400MHz)：d?1.43-1.47(1H，m)，1.45(18H，s)，2.04-2.13(2H，m)，2.23(1H，d，??J＝14.1H?z)，2.29(1H，d，J＝14.1Hz)，2.48-2.58(1H，m)，2.82-2.96(1H，m)，3.07(1H，br?s)，??3.35(1H，dd，J?＝6.3，14.1Hz)，3.43(1H，dd，J＝6.3，14.1Hz)，4.25(2H，br?s)，4.99(1H，br?s)，??5.65(1H，br?s).
??18(18-g) ??1H-NMR(CD3OD，400MHz)：d?1.54(1H，dd，J＝7.8，12.5Hz)，2.06(3H，s)，2.06-2.17(2H，m)，??2.48(2H，s)，2.55(1H，br?dd，J＝7.8，16.4Hz)，2.88-2.96(1H，m)，3.15(1H，d，J＝12.9Hz)，??3.15-3.20(1H，m)，3.22(1H，d，J＝12.9Hz)，4.69(2H，s)，5.71(1H，br?s).??MS(FAB)：m/z：254(M+1)+.??Anal.Calcd?for?C13H19NO4：C?61.64；H?7.56；N?5.53；Found：C?60.66；H?7.32；N?5.62.??IR(KBr)：cm-1：2904，1742，1567，1524，1381，1242.??Mp.175-176℃
??17(17-a) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.03(1.04)(3H，d，J＝3Hz)，1.31-1.40(1H，m)，1.51-1.66??(1H，m)，2.34-2.54(3H，m)，2.79(2.86)(1H，d，J＝4Hz)，3.71(3.72)(3H，s)，4.01-4.11(1H，m)，??4.93-5.08(2H，m)，5.60-5.80(1H，m).
??19(19-a) ??1H-NMR(CDCl3，400MHz)：d?0.03(6H，s)，0.88(9H，s)，2.10-2.17(1H，m)，2.29-2.36(1H，m)，??2.40-2.48(1H，m)，3.59(2H，d，J＝5.9Hz)，3.73(3H，s)，5.00-5.08(2H，m)，5.67-5.78(1H，m)，??5.85(1H，d，J＝16.3Hz)，6.86(1H，dd?J＝8.2，16.3Hz).
??19(19-b) ??1H-NMR(CDCl3，400MHz)：d?0.04(6H，s)，0.88(9H，s)，2.12-2.19(1H，m)，2.28-2.36(1H，m)，??2.43-2.52(1H，m)，3.59(1H，dd，J＝5.9，9.8Hz)，3.63(1H，dd，J＝5.9，9.8Hz)，5.02-5.09(2H，??m)，5.73(1H，dddd，J＝7.0，7.0，10.2，17.2Hz)，5.86(1H，dd，J＝1.2，15.6Hz)，6.97(1H，dd?J＝??8.2，15.6Hz).
[table 9]
??19(19-c) ??1H-NMR(CDCl3)，400MHz)：??Major?isomer：d?0.07(6H，s)，0.91(9H，s)，1.45(9H，s)，2.18-2.25(1H，m)，2.59-2.73(2H，m)，??2.92-3.01(1H，m)，3.31(1H，ddt，J＝2.7，8.6，18.4Hz)，3.88-3.94(1H，m)，4.21(2H，br?s)，??5.46-5.50(2H，m).??Minor?isomer(detectable?peaks)：d?1.48(9H，s)，4.30-4.35(1H，m)，4.23(2H，br?s)，5.35-5.36??(1H，m)，5.69-5.71(1H，m).
??19(19-d) ??1H-NMR(CDCl3，400MHz)：Major?isomer：d?1.45(9H，s)，2.28(1H，br?d，J?＝16.4Hz)，??2.64-2.74(2H，m)，2.93-3.04(1H，m)，3.33(1H，ddt，J＝2.7，8.6，18.4Hz)，3.91-3.96(1H，m)，??4.23(2H，br?d，J＝4.3Hz)，5.47-5.49(1H，m)，5.52-5.55(1H，m).??Minor?isomer(detectable?peaks)：d?1.49(9H，s)，2.45-2.54(1H，m)，4.33-4.38(1H，m)，??5.37-5.39(1H，m)，5.74-5.77(1H，m).
??19(19-e) ??1H-NMR(CDCl3，400MHz)：d?1.45(9H，s)，1.56-1.62(1H，m)，2.12-2.19(1H，m)，2.33(1H，??ddd，J＝2.7，9.0，12.9Hz)，2.49(2H，s)，2.51-2.59(1H，m)，2.88-2.97(1H，m)，3.27-3.31(1H，??m)，3.37(3H，s)，4.03(2H，s)，4.78(1H，d，J＝11.7Hz)，4.84(1H，d，J＝11.7Hz)，5.56-5.59(1H，??m).
??19(19-f) ??1H-NMR(CDCl3，400MHz)：d?1.43-1.46(1H，m)，1.44(18H，s)，2.03-2.12(2H，m)，2.23(1H，d，??J＝14.1Hz)，2.29(1H，d，J＝14.1Hz)，2.47-2.55(1H，m)，2.82-2.94(1H，m)，3.04-3.09(1H，m)，??3.35(3H，s)，3.35(1H，dd，J＝6.3，13.7Hz)，3.42(1H，dd，J?＝6.3，13.7Hz)，4.02(2H，s)，4.99??(1H，br?s)，5.64(1H，br?s).
??19(19-c) ??1H-NMR(CDCl3)，400MHz)：??Major?isomer：d?0.07(6H，s)，0.91(9H，s)，1.45(9H，s)，2.18-2.25(1H，m)，2.59-2.73(2H，m)，??2.92-3.01(1H，m)，3.31(1H，ddt，J＝2.7，8.6，18.4Hz)，3.88-3.94(1H，m)，4.21(2H，br?s)，??5.46-5.50(2H，m).??Minor?isomer(detectable?peaks)：d?1.48(9H，s)，4.30-4.35(1H，m)，4.23(2H，br?s)，5.35-5.36??(1H，m)，5.69-5.71(1H，m).
??19(19-g) ??1H-NMR(CD3OD，400MHz)：d?1.53(1H，dd，J＝7.4，12.5Hz)，2.09(1H，ddd，J＝2.7，8.6，12.5??Hz)，2.10-2.16(1H，m)，2.48-2.56(1H，m)，2.50(2H，s)，2.87-2.95(1H，m)，3.16(1H，d，J＝13.3??Hz)，3.16-3.20(1H，m)，3.22(1H，d，J＝13.3Hz)，3.33(3H，s)，4.04(2H，s)，5.68(1H，br?s).??MS(FAB)：m/z：226(M+1)+.??Anal.Calcd?for?C12H19NO3：C?63.98；H?8.50；N?6.22；Found：C?62.83；H?8.37；N?6.21.??IR(KBr)：cm-1：2903，1565，1525，1397，1382，1103.??Mp.160-162℃
??20(20-a) ??1H-NMR(400MHz，CDCl3)：d?ppm：0.87(1.5H，d，J?＝7Hz)，0.92(1.5H，d，J＝1.5Hz)，1.16??(1.5H，s)，1.20(1.5H，s)，1.60-1.72(2H，m)，2.38-2.60(3H，m)，3.51(0.5H，s)，3.54(0.5H，s)，??3.73(3H，s)，4.98-5.05(2H，m)，5.73-5.82(1H，m).
??20(20-c) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.46(9H，s)，1.60(3H，br.s)，1.64(3H，br.s)，2.59-2.84(4H，??m)，3.25-3.33(1H，m)，3.65-3.73(1H，m)，5.38-5.40(0.1H，m)，5.45-5.50(0.9H，m).
??19(19-c) ??1H-NMR(CDCl3)，400MHz)：??Major?isomer：d?0.07(6H，s)，0.91(9H，s)，1.45(9H，s)，2.18-2.25(1H，m)，2.59-2.73(2H，m)，??2.92-3.01(1H，m)，3.31(1H，ddt，J＝2.7，8.6，18.4Hz)，3.88-3.94(1H，m)，4.21(2H，br?s)，??5.46-5.50(2H，m).??Minor?isomer(detectable?peaks)：d?1.48(9H，s)，4.30-4.35(1H，m)，4.23(2H，br?s)，5.35-5.36??(1H，m)，5.69-5.71(1H，m).
??20(20-d) ??1H-NMR(400MHz，CDCl3)：d?ppm：??1.44(9H，s)，1.58(3H，br.s)，1.54-1.60(2H，m)，1.68(3H，br.s)，2.05-2.21(2H，m)，2.44(1H，d，??J＝17Hz)，2.52(1H，d，J＝17Hz)，2.65-2.74(1H，m)，3.16-3.23(1H，m)，4.80(1H，d，J＝??12Hz)，4.88(1H，d，J＝12Hz).
??20(20-e) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.52-1.56(1H，m)，1.53(9H，s)，1.56(9H，s)，1.61(3H，br.s)，??1.66(3H，br.s)，2.15-2.30(2H，m)，2.40-2.70(2H，m)，2.90-2.98(1H，m)，3.26-3.51(2H，m)，??4.94-5.05?81H，br.s).
??20(20-f) ??1H-NMR(400MHz，CD3OD)：d?ppm：1.45-1.55(1H，m)，1.62(3H，br.s)，1.70(3H，br.s)，??2.05-2.20(2H，m)，2.35(3H，br.s)，2.50-2.57(3H，m)，2.68-2.74(1H，m)，2.95-3.02(1H，m)，??3.32-3.36(2H，m)，7.20-7.24(2H，m)，7.68-7.72(2H，m).??Anal.calcd?for?C19H27NO5S：C，59.58；H，7.19；N，3.75；S，8.59；Found?C，59.82；H，7.13；N，??3.67；S，8.41.??IR(KBr)：cm-1：1725，1516，1235，1162，1120.??MS(EI)：m/z：210(M)+.??Mp.186-189℃.
??19(19-c) ??1H-NMR(CDCl3)，400MHz)：??Major?isomer：d?0.07(6H，s)，0.91(9H，s)，1.45(9H，s)，2.18-2.25(1H，m)，2.59-2.73(2H，m)，??2.92-3.01(1H，m)，3.31(1H，ddt，J＝2.7，8.6，18.4Hz)，3.88-3.94(1H，m)，4.21(2H，br?s)，??5.46-5.50(2H，m).??Minor?isomer(detectable?peaks)：d?1.48(9H，s)，4.30-4.35(1H，m)，4.23(2H，br?s)，5.35-5.36??(1H，m)，5.69-5.71(1H，m).
??21(21-b) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.08(3H，t，J＝7.6Hz)，1.39(1H，dd，J＝7.6，12.1H?z)，??1.44(18H，s)，1.98-2.02(2H，m)，2.12(2H，q，J＝7.6Hz)，2.22(1H，d，J＝14.5Hz)，2.27(1H，d，??J＝14，5Hz)，2.46-2.50(1H，m)，2.80-2.88(1H，m)，2.99-3.00(1H，m)，3.33(1H，dd，J＝6.2，13.7Hz)，??3.41(1H，dd，J＝6.2，13.7H?z)，5.00(1H，broad)，5.33(1H，d，J＝1.6Hz).??[a]25D-90.6°(c＝1.37，CHCl3).
??21(21-c) ??Mp.182-183℃??[a]25D-110.3°(c＝0.85，MeOH).??1H-NMR(400MHz，CD3OD)：d?ppm：1.10(3H，t，J＝7.4Hz)，1.48(1H，dd，J＝7.5，12.5Hz)，??2.03-2.08(2H，m)，2.14(2H，q，J＝7.4Hz)，2.46(1H，d，J＝16.2Hz)，2.46-2.53(1H，m)，2.51(1H，d，??J＝16.2Hz)，2.85(1H，quint，J＝7.5Hz)，3.09-3.10(1H，m)，3.14(1H，d，J＝13.0Hz)，3.18(1H，d，??J＝13.0Hz)，5.38(1H，dd，J＝1.7，3.7Hz).??IR(KBr)：cm-1：2962，2928，2897，2877，1559，1527，1403.??MS(FAB)：m/z：210(M+H)+，232(M+Na)+.??Anal.calcd?for?C12H19NO2：C，68.87；H，9.15；N，6.69；Found?C，C，65.55；H，9.16；N，6.45.
[table 10]
??22 ??Mp.171-172℃??[a]25D-59.6°(c＝1.02，MeOH)??1H-NMR(400MHz，CD3OD)：d?ppm：1.11(3H，t，J＝7.4Hz)，1.51(1H，dd，7.4，12.7Hz)，2.06-2,20??(4H，m)，2.37(3H，s)，2.49-2.56(1H，m)，2.51(2H，s)，2.87(1H，quint，J＝7.4Hz)，3.12-3.14(1H，??m)，3.28(1H，d，J＝13.5Hz)，3.33(1H，d，J＝13.5Hz)，5.31-5.32(1H，m)，7.21-7.25(2H，m)，??7.69-7.72(2H，m).??IR(KBr)：cm-1：3155，2963，1707，1497，1410，1236，1163，1037，812，687，567.??MS(FAB+)：m/z：210(free+H)+；(FAB-)：m/z：208(free-H)-，171(TsOH-H)-.??Anal.calcd?for?C19H27NO5S：C，59.82；H，7.21；N，3.67；S，8.41；Found?C，59.16；H，7.21；N，??4.10；S，8.53.
??23(23-a) ??1H-NMR(400MHz，CDCl3)：d?ppm：1.08(3H，t，J＝7.6Hz)，1.39(1H，dd，J＝7.6，12.1Hz)，??1.44(18H，s)，1.98-2.02(2H，m)，2.12(2H，q，J＝7.6Hz)，2.22(1H，d，J＝14.5Hz)，2.27(1H，d，??J＝14，5Hz)，2.46-2.50(1H，m)，2.80-2.88(1H，m)，2.99-3.00(1H，m)，3.33(1H，dd，J＝6.2，13.7Hz)，??3.41(1H，dd，J＝6.2，13.7Hz)，5.00(1H，broad)，5.33(1H，d，J＝1.6Hz).??[a]21D+68.1°(c＝1.37，CHCl3)
??22 ??Mp.171-172℃??[a]25D-59.6°(c＝1.02，MeOH)??1H-NMR(400MHz，CD3OD)：d?ppm：1.11(3H，t，J＝7.4Hz)，1.51(1H，dd，7.4，12.7Hz)，2.06-2,20??(4H，m)，2.37(3H，s)，2.49-2.56(1H，m)，2.51(2H，s)，2.87(1H，quint，J＝7.4Hz)，3.12-3.14(1H，??m)，3.28(1H，d，J＝13.5Hz)，3.33(1H，d，J＝13.5Hz)，5.31-5.32(1H，m)，7.21-7.25(2H，m)，??7.69-7.72(2H，m).??IR(KBr)：cm-1：3155，2963，1707，1497，1410，1236，1163，1037，812，687，567.??MS(FAB+)：m/z：210(free+H)+；(FAB-)：m/z：208(free-H)-，171(TsOH-H)-.??Anal.calcd?for?C19H27NO5S：C，59.82；H，7.21；N，3.67；S，8.41；Found?C，59.16；H，7.21；N，??4.10；S，8.53.
??23(23-b) ??1H-NMR(400MHz，CD3OD)：d?ppm：1.10(3H，t，J＝7.4Hz，Et)，1.48(1H，dd，J＝7.5，12.5Hz)，??2.03-2.08(2H，m)，2.14(2H，q，J＝7.4Hz，Et)，2.46(1H，d，J＝16.2Hz)，2.46-2.53(1H，m)，2.51(1H，??d，J＝16.2Hz)，2.85(1H，quint，J＝7.5Hz)，3.09-3.10(1H，m)，3.14(1H，d，J＝13.0Hz)，3.18(1H，d，??J＝13.0Hz)，5.38(1H，dd，J＝1.7，3.7Hz).??Mp.163-166℃??IR(KBr)：cm-1：2963，2926，2877，1560，1527，1402??MS(FAB)：m/z：210(M+H)+，232(M+Na)+.??Anal.calcd?for?C12H19NO20.7H2O：C，64.95；H，9.30；N，6.30；Found?C，64.97；H，9.08；N，??6.41.??[a]21D+96.2°(c＝1.0，MeOH)
??22 ??Mp.171-172℃??[a]25D-59.6°(c＝1.02，MeOH)??1H-NMR(400MHz，CD3OD)：d?ppm：1.11(3H，t，J＝7.4Hz)，1.51(1H，dd，7.4，12.7Hz)，2.06-2,20??(4H，m)，2.37(3H，s)，2.49-2.56(1H，m)，2.51(2H，s)，2.87(1H，quint，J＝7.4Hz)，3.12-3.14(1H，??m)，3.28(1H，d，J＝13.5Hz)，3.33(1H，d，J＝13.5Hz)，5.31-5.32(1H，m)，7.21-7.25(2H，m)，??7.69-7.72(2H，m).??IR(KBr)：cm-1：3155，2963，1707，1497，1410，1236，1163，1037，812，687，567.??MS(FAB+)：m/z：210(free+H)+；(FAB-)：m/z：208(free-H)-，171(TsOH-H)-.??Anal.calcd?for?C19H27NO5S：C，59.82；H，7.21；N，3.67；S，8.41；Found?C，59.16；H，7.21；N，??4.10；S，8.53.
??24(24-a) ??1H-NMR(CDCl3，400MHz)：d?1.45(9H，s)，1.56-1.61(1H，m)，2.15(1H，br?d，J＝17.2Hz)，2.34??(1H，ddd，J＝2.7，8.6，12.5Hz)，2.49(2H，s)，2.58(1H，brdd，J＝7.8，17.2Hz)，2.90-2.99(1H，??m)，3.28(1H，br?s)，4.28(2H，s)，4.78(1H，d，J＝11.7Hz)，4.84(1H，d，J＝11.7Hz)，5.58(1H，br??s).
??24(24-b) ??1H-NMR(CDCl3，400MHz)：??d?1.45(9H，s)，1.55-1.60(1H，m)，2.04(3H，s)，2.20(1H，brd，J＝16.4Hz)，2.34(1H，ddd，J＝??2.7，9.0，12.9Hz)，2.49(2H，s)，2.64(1H，br?dd，J＝7.8，16.4Hz)，2.89-2.98(1H，m)，3.24(2H，??s)，3.28(1H，br?s)，4.77(1H，d，J＝11.7Hz)，4.84(1H，d，J＝11.7Hz)，5.48(1H，br?s).
??22 ??Mp.171-172℃??[a]25D-59.6°(c＝1.02，MeOH)??1H-NMR(400MHz，CD3OD)：d?ppm：1.11(3H，t，J＝7.4Hz)，1.51(1H，dd，7.4，12.7Hz)，2.06-2,20??(4H，m)，2.37(3H，s)，2.49-2.56(1H，m)，2.51(2H，s)，2.87(1H，quint，J＝7.4Hz)，3.12-3.14(1H，??m)，3.28(1H，d，J＝13.5Hz)，3.33(1H，d，J＝13.5Hz)，5.31-5.32(1H，m)，7.21-7.25(2H，m)，??7.69-7.72(2H，m).??IR(KBr)：cm-1：3155，2963，1707，1497，1410，1236，1163，1037，812，687，567.??MS(FAB+)：m/z：210(free+H)+；(FAB-)：m/z：208(free-H)-，171(TsOH-H)-.??Anal.calcd?for?C19H27NO5S：C，59.82；H，7.21；N，3.67；S，8.41；Found?C，59.16；H，7.21；N，??4.10；S，8.53.
??24(24-c) ??1H-NMR(CDCl3，500MHz)：d?1.41-1.48(1H，m)，1.44(18H，s)，2.03(3H，s)，2.05-2.09(1H，m)，??2.17(1H，brd，J＝16.1Hz)，2.24(1H，d，J＝14.2Hz)，2.28(1H，d，J＝14.2Hz)，2.57(1H，brdd，??J＝8.8，16.1Hz)，2.86-2.95(1H，m)，3.07(1H，br?s)，3.22(1H，d，J＝13.7Hz)，3.26(1H，d，J＝??13.7Hz)，3.34(1H，dd，J＝5.9，13.7Hz)，3.42(1H，dd，J＝5.9，13.7Hz)，5.00(1H，br?s)，5.55??(1H，br?s).
??22 ??Mp.171-172℃??[a]25D-59.6°(c＝1.02，MeOH)??1H-NMR(400MHz，CD3OD)：d?ppm：1.11(3H，t，J＝7.4Hz)，1.51(1H，dd，7.4，12.7Hz)，2.06-2,20??(4H，m)，2.37(3H，s)，2.49-2.56(1H，m)，2.51(2H，s)，2.87(1H，quint，J＝7.4Hz)，3.12-3.14(1H，??m)，3.28(1H，d，J＝13.5Hz)，3.33(1H，d，J＝13.5Hz)，5.31-5.32(1H，m)，7.21-7.25(2H，m)，??7.69-7.72(2H，m).??IR(KBr)：cm-1：3155，2963，1707，1497，1410，1236，1163，1037，812，687，567.??MS(FAB+)：m/z：210(free+H)+；(FAB-)：m/z：208(free-H)-，171(TsOH-H)-.??Anal.calcd?for?C19H27NO5S：C，59.82；H，7.21；N，3.67；S，8.41；Found?C，59.16；H，7.21；N，??4.10；S，8.53.
??24(24-d) ??Mp.165-167℃.??1H-NMR(CD3OD，500MHz)：d?1.51(1H，dd，J＝7.3，12.2H?z)，2.02(3H，s)，2.09(1H，ddd，J＝??2.4，8.8，12.2Hz)，2.21(1H，br?d，J＝16.6Hz)，2.51(2H，s)，2.58(1H，br?dd，J＝7.8，16.6Hz)，??2.87-2.94(1H，m)，3.15(1H，d，J?＝13.2Hz)，3.15-3.19(1H，m)，3.21(1H，d，J＝13.2Hz)，3.23??(1H，d，J＝13.7Hz)，3.27(1H，d，J＝13.7Hz)，5.58(1H，br?s).??MS(FAB)：m/z：242(M+1)+.??Anal.Calcd?for?C12H19NO2S：C?59.72；H?7.93；N?5.80；S?13.29；Found：C?58.72；H?8.03；N??5.71；S?13.12.??IR(KBr)：cm-1：2906，2632，1542，1398，1283.
??25(25-b) ??1H-NMR(400MHz、CDCl3)：d?ppm：??1.40-1.50(1H，m)，1.43(9H，s)，1.51(9H，s)，1.81(3H，s)，1.96-2.08(2H，m)，2.27(2H，dd，J＝23Hz，??14Hz)，2.43-2.52(1H，m)，2.81-2.91(1H，m)，3.0(1H，s)，3.31-3.46(2H，m)，5.0(1H，br.s)，??5.34(1H，m)
??22 ??Mp.171-172℃??[a]25D-59.6°(c＝1.02，MeOH)??1H-NMR(400MHz，CD3OD)：d?ppm：1.11(3H，t，J＝7.4Hz)，1.51(1H，dd，7.4，12.7Hz)，2.06-2,20??(4H，m)，2.37(3H，s)，2.49-2.56(1H，m)，2.51(2H，s)，2.87(1H，quint，J＝7.4Hz)，3.12-3.14(1H，??m)，3.28(1H，d，J＝13.5Hz)，3.33(1H，d，J＝13.5Hz)，5.31-5.32(1H，m)，7.21-7.25(2H，m)，??7.69-7.72(2H，m).??IR(KBr)：cm-1：3155，2963，1707，1497，1410，1236，1163，1037，812，687，567.??MS(FAB+)：m/z：210(free+H)+；(FAB-)：m/z：208(free-H)-，171(TsOH-H)-.??Anal.calcd?for?C19H27NO5S：C，59.82；H，7.21；N，3.67；S，8.41；Found?C，59.16；H，7.21；N，??4.10；S，8.53.
??25(25-c) ??1H-NMR(400MHz、CD3OD)：d?ppm：??1.46-1.53(1H，m)，1.80(3H，s)，2.1-2.17(2H，m)，2.42-2.54(3H，m)，2.78-2.90(1H，m)，??3.07-3.15(1H，m)，5.25-5.30(1H，m)，7.37-7.44(3H，m)，7.78-7.84(2H，m)
??25(25-d) ??1H-NMR(400MHz、CD3OD)：d?ppm：??1.40(1H，dd，J＝7.6，12.3Hz)，1.79(3H，s)，2.02-2.08(2H，m)，2.43-2.50(1H，m)，2.45(1H，d，??J＝16.2Hz)，2.51(1H，d，J＝16.2Hz)，2.85(1H，quint，J＝7.6Hz)，3.05-3.12(1H，m)，3.13(1H，d，??J＝13.0Hz)，3.17(1H，d，J＝13.0Hz)，5.36(1H，t，J＝1.6Hz).??IR(KBr)：cm-1：2946，2927，2905，2832，1564，1525，1396，1384.??MS(FAB)：m/z：196(M+H)+，218(M+Na)+.??Anal.calcd?for?C11H17NO2：C，67.66；H，8.78；N，7.17；Found：C，67.53；H，8.90；N，7.28.??[a]21D-140.4°(c＝1.23，MeOH)
[table 11]
??26(26-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：??1.40-1.50(1H，m)，1.43(9H，s)，1.51(9H，s)，1.81(3H，s)，1.96-2.08(2H，m)，2.27(2H，dd，J＝23Hz，??14Hz)，2.43-2.52(1H，m)，2.81-2.91(1H，m)，3.0(1H，s)，3.31-3.46(2H，m)，5.0(1H，br.s)，??5.34(1H，m)
??26(26-b) ??1H-NMR(400MHz、CD3OD)：d?ppm：??1.46-1.53(1H，m)，1.80(3H，s)，2.1-2.17(2H，m)，2.42-2.54(3H，m)，2.78-2.90(1H，m)，??3.07-3.15(1H，m)，5.25-5.30(1H，m)，7.37-7.44(3H，m)，7.78-7.84(2H，m)
??26(26-c) ??1H-NMR(400MHz、CD3OD)：d?ppm：??1.40(1H，dd，J＝7.6，12.3Hz)，1.79(3H，s)，2.02-2.08(2H，m)，2.43-2.50(1H，m)，2.45(1H，d，??J＝16.2Hz)，2.51(1H，d，J＝16.2Hz)，2.85(1H，quint，J＝7.6Hz)，3.05-3.12(1H，m)，3.13(1H，d，??J＝13.0Hz)，3.17(1H，d，J＝13.0Hz)，5.36(1H，t，J＝1.6Hz).??IR(KBr)：cm-1：2946，2927，2905，2832，1564，1525，1396，1384.??MS(FAB)：m/z：196(M+H)+，218(M+Na)+.??Anal.calcd?for?C11H17NO2：C，67.66；H，8.78；N，7.17；Found：C，67.46；H，8.89；N，7.25.??[a]21D+130.71°(c＝1.41，MeOH)
??27(27-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：??0.90(1.5H，d，J＝6.4Hz)，0.95(1.5H，d，J＝6.4Hz)，1.18(1.5H，s)，1.23(1.5H，s)，1.63-1.78(1H，m)，??2.39-2.64(4H，m)，4.98-5.08(2H，m)，5.72-5.86(1H，m)
??26(26-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：??1.40-1.50(1H，m)，1.43(9H，s)，1.51(9H，s)，1.81(3H，s)，1.96-2.08(2H，m)，2.27(2H，dd，J＝23Hz，??14Hz)，2.43-2.52(1H，m)，2.81-2.91(1H，m)，3.0(1H，s)，3.31-3.46(2H，m)，5.0(1H，br.s)，??5.34(1H，m)
??27(27-b) ??1H-NMR(400MHz、CDCl3)：d?ppm：??Major?isomer??1.42(9H，s)，1.56(3H，s)，1.60(3H，s)，2.07-2.20(1H，m)，2.51-2.67(2H，m)，2.69-2.83(1H，m)，??3.17-3.31(1H，m)，3.59-3.70(1H，m)
??27(27-d) ??1H-NMR(400MHz、CDCl3)：d?ppm：??1.47(9H，s)，1.61(3H，s)，1.71(3H，s)，2.04-2.27(2H，m)，2.51-2.78(2H，m)，2.51(2H，dd，J＝16.6，??43.5Hz)，2.65-2.79(2H，m)，4.87(2H，dd，J＝11.7，39.6Hz)
??27(27-e) ??1H-NMR(400MHz、CDCl3)：d?ppm：??1.46(9H，s)，1.56(9H，s)，1.58(3H，s)，1.68(3H，s)，2.00-2.35(3H，m)，2.46-2.56(1H，m)，??2.62-2.78(1H，m)，2.95-3.02(1H，m)，3.25-3.35(1H，m)，3.46-3.57(1H，m)，4.96-5.08(1H，m)
??27(27-f) ??1H-NMR(400MHz、CD3OD)：d?ppm：??1.47(1H，dd，J＝7.2，12.3hz)，1.64(3H，s)，1.68(3H，s)，2.06-2.1(1H，m)，2.1-2.18(1，m)，??2.46-2.55(1H，m)，2.48(2H，dd，J＝16.3，39.5Hz)，2.66-2.77(1H，m)，2.87-2.93(1H，m)，3.18(2H，??dd，12.7，32.9Hz)??MS(FAB)：m/z：210(M+H)+.
??26(26-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：??1.40-1.50(1H，m)，1.43(9H，s)，1.51(9H，s)，1.81(3H，s)，1.96-2.08(2H，m)，2.27(2H，dd，J＝23Hz，??14Hz)，2.43-2.52(1H，m)，2.81-2.91(1H，m)，3.0(1H，s)，3.31-3.46(2H，m)，5.0(1H，br.s)，??5.34(1H，m)
??28(28-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：??1.28(3H，t，J＝7.1Hz)，1.50-1.63(1H，m)，1.72-1.83(1H，m)，2.11-2.25(2H，m)，2.42-2.51(1H，m)，??3.54-3.73(2H，m)，4.17(2H，q，J＝7.2Hz)，4.99-5.07(2H，m)，5.64-5.77(1H，m)，5.81(1H，d，??J＝15.6Hz)，6.77(1H，dd，J＝6.77，15.6Hz).
??28(28-b) ??1H-NMR(400MHz、CDCl3)：d?ppm：??1.30(3H，t，J＝7.2Hz)，1.58-1.76(1H，m)，1.86-2.03(1H，m)，2.15-2.30(2H，m)，2.44-2.57(1H，m)，??4.19(2H，q，J＝7.1Hz)，5.00-5.11(2H，m)，5.64-5.77(1H，m)，5.85(1H，d，J＝15.6Hz)，6.77(1H，dd，??J＝6.77，15.6Hz).
??28(28-c) ??1H-NMR(400MHz、CDCl3)：d?ppm：??1.45(9H，s)，2.08-2.17(1H，m)，2.26-2.37(1H，m)，2.42-2.63(4H，m)，2.83-2.95(1H，m)，??3.17-3.29(1H，m)，4.52(1H，t，J＝6.3Hz)，4.64(1H，t，J＝6.1Hz)，4.76(1H，d，J＝11.7Hz)，4.84(1H，??d，J＝11.7Hz)，5.4-5.44(1H，m).
??28(28-d) ??1H-NMR(400MHz、CDCl3)：d?ppm：??1.44(18H，s)，1.50-1.60(2H，m)，2.01-2.10(2H，m)，2.21(1H，d，J＝14.1Hz)，2.27(1H，d，??J＝14.7Hz)，2.45-2.60(3H，m)，2.78-2.92(1H，m)，3.00-3.07(1H，m)，3.33(1H，dd，J＝6.1，13.9Hz)，??3.41(1H，dd，J＝6.4，13.9Hz)，4.52(1H，t，J＝6.3Hz)，4.63(1H，t，J＝6.3Hz)，4.92-5.03(1H，m).
??26(26-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：??1.40-1.50(1H，m)，1.43(9H，s)，1.51(9H，s)，1.81(3H，s)，1.96-2.08(2H，m)，2.27(2H，dd，J＝23Hz，??14Hz)，2.43-2.52(1H，m)，2.81-2.91(1H，m)，3.0(1H，s)，3.31-3.46(2H，m)，5.0(1H，br.s)，??5.34(1H，m)
??28(28-e) ??1H-NMR(400MHz、CD3OD)：d?ppm：??1.50(1H，dd，J＝7.4，12.1Hz)，2.03-2.16(2H，m)，2.44-2.61(5H，m)，2.81-2.92(1H，m)，3.15(1H，d，??J＝12.9Hz)，3.20(1H，d，J＝12.9Hz)，3.10-3.17(1H，m)，4.50(1H，t，J＝6.3Hz)，4.64(1H，t，??J＝6.3Hz)，5.46-5.53(1H，m).??IR(KBr)：cm-1：1627，1564，1524，1398，1382.??MS(FAB)：m/z：228(M+H)+.??Anal.calcd?for?C12H18NFO2：C，63.42；H，7.98；N，6.16；F，8.36；Found：C，62.85；H，8.04；N，??6.22；F，8.39.
[table 12]
??29(29-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.30(3H，s)，1.63-1.71(1H，m)，2.06-2.20(2H，m)，2.52(1H，??d，J＝15.9Hz)，2.59(1H，d，J＝15.9Hz)，3.50(1H，q，J＝7.4Hz)，4.97(1H，d，J＝10.3Hz)，5.50(1H，d，??J＝17.1Hz)，5.79-5.87(1H，m).
??29(29-b) ??MS(FAB)：m/z：155(M+H)+.??1H-NMR(400MHz、CDCl3)：d?ppm：1.76(3H，s)，2.35-2.41(2H，m)，2.76-2.84(3H，m)，4.02(1H，??s)，5.46(1H，s).
??29(29-c) ??1H-NMR(400MHz、CDCl3)：d?ppm：Major?isomer?1.46(9H，s)，1.71(3H，s)，2.22-2.27(1H，m)，??2.59-2.72(2H，m)，2.88-2.97(1H，m)，3.27-3.35(1H，m)，3.65-3.68(1H，m)，5.39(1H，s)，??5.49-5.50(1H，m)：Minor?isomer?1.49(9H，s)，1.77(3H，s)，2.18-2.27(1H，m)，2.47-2.97(2H，??m)，2.78-2.85(1H，m)，2.88-2.97(1H，m)，4.31-4.32(1H，m)，5.41-5.42(1H，m)，5.49-5.50(1H，m).
??29(29-d) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.44(9H，s)，1.65(1H，dd，J＝7.4，12.9Hz)，1.70(3H，s)，2.12??(1H，dd，J＝1.6，17.2Hz)，2.20-2.25(1H，m)，2.45-2.55(1H，m)，2.49(1H，d，J＝17.2Hz)，2.55(1H，??d，J＝17.2H?z)，2.85(1H，quint，J＝7.8Hz)，3.15-3.17(1H，m)，4.82(1H，d，J＝12.1Hz)，4.90(1H，d，??J＝12.1Hz)，5.56(1H，s).
??29(29-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.30(3H，s)，1.63-1.71(1H，m)，2.06-2.20(2H，m)，2.52(1H，??d，J＝15.9Hz)，2.59(1H，d，J＝15.9Hz)，3.50(1H，q，J＝7.4Hz)，4.97(1H，d，J＝10.3Hz)，5.50(1H，d，??J＝17.1Hz)，5.79-5.87(1H，m).
??29(29-e) ??Mp.160℃(decompose).??1H-NMR(400MHz、CD3OD)：d?ppm：1.53(1H，dd，J＝6.9，12.9Hz)，1.75(3H，d，J＝1.8Hz)，??2.08-2.17(2H，m)，2.46(1H，d，J＝16.2Hz)，2.47-2.54(1H，m)，2.56(1H，d，J＝16.2Hz)，2.84(1H，??quint，J＝6.9Hz)，2.86-2.88(1H，m)，3.16(1H，dd，J＝1.2，13.2Hz)，3.23(1H，dd，J＝1.2，13.2Hz)，??5.54(1H，s).??IR(KBr)：cm-1：3029，2950，2937，2910，1889，2842，1631，1589，1500，1396，1188，1024，680，??603.??MS(FAB)：m/z：196(M+H)+，218(M+Na)+.??Anal.calcd?for?C11H17NO2：C，67.66；H，8.78；N，7.17；Found?C，C，66.43；H，8.77；N，7.11.
??30 ??1H-NMR(400MHz、CDCl3)：d?ppm：1.09(3H，t，J＝7.8Hz)，1.44(9H，s)，1.44-1.46(1H，m)，??1.97-2.05(2H，m)，2.13(2H，q，J＝7.8Hz)，2.28(1H，d，J＝14.1Hz)，2.35(1H，d，J＝14.1Hz)，??2.43-2.51(1H，m)，2.76(1H，quint.J＝7.6Hz)，2.92(2H，s)，2.98-2.99(1H，m)，5.35-5.35(1H，m).??MS(FAB+)：m/z：296(M+H)+，334(M+K)+.
??29(29-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.30(3H，s)，1.63-1.71(1H，m)，2.06-2.20(2H，m)，2.52(1H，??d，J＝15.9Hz)，2.59(1H，d，J＝15.9Hz)，3.50(1H，q，J＝7.4Hz)，4.97(1H，d，J＝10.3Hz)，5.50(1H，d，??J＝17.1Hz)，5.79-5.87(1H，m).
??31 ??Mp.172-173℃.??[a]20D-68.1°(c?0.98，MeOH).??1H-NMR(400MHz、CD3OD)：d?ppm：1.11(3H，t，J＝7.4Hz)，1.50(1H，dd，J＝7.5，12.6Hz)，2.08??(1H，d，16.5Hz)，2.10-2.20(3H，m)，2.46-2.56(3H，m)，2.87(1H，quint.J＝7.5Hz)，3.12-3.13(1H，??m)，3.28(1H，d，J＝13.4Hz)，3.33(1H，d，J＝13.4Hz)，5.31(1H，d，J＝1.8Hz)，7.39-7.45(3H，m)，??7.80-7.85(2H，m).??IR(KBr)：cm-1：3197，3149，3054，2964，2927，2878，2831，1714，1495，1445，1410，1220，1164，??1123，1019，730.??MS(FAB+)：m/z：210(free+H)+，(FAB-)：m/z：157(bensensulfonic?acid-H)-.??Anal.calcd?for?C18H25NO5S：C，58.83；H，6.86；N，3.81；S，8.73；Found?C，58.69；H，6.94；N，??3.99；S，8.73.
??32(32-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：2.06-2.31(2H，m)，2.82-2.87(2H，m)，3.11-3.15(2H，m)，3.68??(3H，s)，5.59-5.61(1H，m).
??32(32-b) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.94-2.03(2H，m)，2.65-2.75(4H，m)，4.00-4.02(2H，m)，??5.31-5.35(1H，m).
??32(32-c) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.81-2.05(6H，m)，3.59(2H，t，J＝7.1H?z)，3.73-3.77(3H，m)，??5.03-5.07(2H，m)，5.88-5.95(1H，m).
??29(29-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.30(3H，s)，1.63-1.71(1H，m)，2.06-2.20(2H，m)，2.52(1H，??d，J＝15.9Hz)，2.59(1H，d，J＝15.9Hz)，3.50(1H，q，J＝7.4Hz)，4.97(1H，d，J＝10.3Hz)，5.50(1H，d，??J＝17.1Hz)，5.79-5.87(1H，m).
??32(32-d) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.66(1H，dd，J＝4.2，14.0Hz)，1.82-1.88(4H，m)，1.94-2.08??(3H，m)，2.42-2.44(2H，m)，2.67(1H，d，J＝3.9Hz)，3.70(3H，s)，4.02-4.07(1H，m)，5.11-5.14??(2H，m)，5.94(1H，dd，J＝10.3，17.6Hz).??MS(FAB)：m/z：199(M+H)+.
??32(32-e) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.70(1H，dd，J＝3.9，14.8Hz)，1.83-2.11(7H，m)，2.48-2.50??(2H，m)，4.04-4.10(1H，m)，5.13-5.17(2H，m)，5.95(1H，dd，J＝10.2，17.6Hz).??MS?(FAB)：m/z：185(M+H)+，207(M+Na)+.
??32(32-f) ??1H-NMR(400MHz、CDCl3)：d?ppm：Major?isomer?1.45(9H，s)，1.79-2.19(7H，m)，2.68-2.76(1H，??m)，2.78-2.89(1H，m)，3.10-3.18(1H，m)，3.85-3.87(1H，m)，5.36-5.91(3H，m)：??Minor?isomer?1.47(9H，s)，1.79-2.19(7H，m)，2.49-2.54(1H，m)，2.68-2.76(2H，m)，4.28-4.10??(1H，m)，5.36-5.91(3H，m).??MS(FAB)：m/z：247(M+H)+，285(M+K)+.
??32(32-g) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.45(9H，s)，1.57(1H，dd，J＝7.6，12.9Hz)，1.76-2.05(6H，m)，??2.15(1H，ddd，J＝2.7，9.0，12.9Hz)，2.42(2H，s)，2.80(1H，q，J＝7.8Hz)，3.25(1H，d，7.8H?z)，4.75??(1H，d，J＝11.5Hz)，4.85(1H，d，J＝11.5Hz)，5.52(1H，dd，J＝2.4，5.5Hz)，6.01(1H，d，J＝5.5Hz).??MS(FAB)：m/z：308(M+H)+，346(M+K)+.
[table 13]
??32(32-h) ??Mp.180-190℃??1H-NMR(400MHz、CD3OD)：d?ppm：1.53(1H，dd，J＝7.7，12.4Hz)，1.75-2.07(7H，m)，2.40(1H，??d，J＝16.1Hz)，2.45(1H，d，J＝16.1Hz)，2.80(1H，quint.J＝7.5Hz)，3.12-3.14(1H，m)，3.14(1H，d，??J＝13.2Hz)，3.19(1H，d，J＝13.2Hz)，5.63(1H，dd，J＝2.3，5.7Hz)，6.00(1H，dd，J＝0.6，5.7Hz).??IR(KBr)：cm-1：3029，2969，2943，2925，1740，1617，1510，1394，748.??MS(FAB)：m/z：222(M+H)+.??Anal.calcd?for?C13H19NO2：C，70.56；H，8.65；N，6.33；Found?C，69.82；H，8.80；N，6.34.
??33(33-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.63-1.70(2H，m)，1.72-1.79(2H，m)，2.42-2.46(2H，m)，??2.76-2.79(2H，m)，3.69(3H，s)，5.80-5.82(1H，m).
??33(33-b) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.59-1.72(4H，m)，2.24-2.32(4H，m)，4.11-4.15(2H，m)，??5.49-5.54(1H，m).
??33(33-c) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.40-1.45(2H，m)，1.59-1.74(8H，m)，3.65(2H，t，J＝7.2Hz)，??4.96-5.02(2H，m)，5.10(1H，s)，5.10(1H，dd，J＝10.6，17.2Hz).
??33(33-d) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.40-1.74(10H，m)，2.44-2.26(2H，m)，2.71(1H，d，??J＝7.5Hz)，3.70(3H，s)，4.10-4.15(1H，m)，5.03(1H，d，J＝17.2H?z)，5.07(1H，d，J＝10.7Hz)，??5.86(1H，dd，J＝10.7，17.2Hz).??MS(FAB)：m/z：212(M+H)+.
??33(33-e) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.40-1.79(10H，m)，2.49-2.51(2H，m)，4.11-4.17(1H，m)，??5.06(1H，d，J＝17.6Hz)，5.10(1H，d，J＝10.8Hz)，5.88(1H，dd，J＝10.8，17.6Hz).??MS(FAB)：m/z：199(M+H)+，221(M+Na)+.
??32(32-h) ??Mp.180-190℃??1H-NMR(400MHz、CD3OD)：d?ppm：1.53(1H，dd，J＝7.7，12.4Hz)，1.75-2.07(7H，m)，2.40(1H，??d，J＝16.1Hz)，2.45(1H，d，J＝16.1Hz)，2.80(1H，quint.J＝7.5Hz)，3.12-3.14(1H，m)，3.14(1H，d，??J＝13.2Hz)，3.19(1H，d，J＝13.2Hz)，5.63(1H，dd，J＝2.3，5.7Hz)，6.00(1H，dd，J＝0.6，5.7Hz).??IR(KBr)：cm-1：3029，2969，2943，2925，1740，1617，1510，1394，748.??MS(FAB)：m/z：222(M+H)+.??Anal.calcd?for?C13H19NO2：C，70.56；H，8.65；N，6.33；Found?C，69.82；H，8.80；N，6.34.
??33(33-f) ??1H-NMR(400MHz、CDCl3)：d?ppm：Major?isomer：1.46(9H，s)，1.43-1.76(7H，m)，2.70-2.58??(2H，m)，2.90-2.93(1H，m)，3.04-3.08(1H，m)，3.87-3.88(1H，m)，5.49-5.52(2H，m)，5.62-5.52??(1H，m)：Minor?isomer：1.48(9H，s)，1.43-1.76(7H，m)，2.70-2.58(2H，m)，2.85-2.88(1H，m)，??3.09-3.12(1H，m)，5.37-5.38(1H，m)，5.62-5.65(1H，m)，5.69-5.71(1H，m).??MS(FAB)：m/z：261(M+H)+.
??33(33-g) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.37-1.66(8H，m)，1.45(9H，s)，1.75(1H，dd，J＝8.0，??12.9Hz)，2.07(1H，ddd，J＝3.1，8.6，12.5Hz)，2.46(2H，s)，2.54-2.60(1H，m)，3.27-3.28(1H，m)，??4.75(1H，d，J＝11.3Hz)，4.85(1H，d，J＝11.3Hz)，5.52(1H，dd，J＝2.4，5.5Hz)，5.75(1H，d，??J＝5.5Hz).
??32(32-h) ??Mp.180-190℃??1H-NMR(400MHz、CD3OD)：d?ppm：1.53(1H，dd，J＝7.7，12.4Hz)，1.75-2.07(7H，m)，2.40(1H，??d，J＝16.1Hz)，2.45(1H，d，J＝16.1Hz)，2.80(1H，quint.J＝7.5Hz)，3.12-3.14(1H，m)，3.14(1H，d，??J＝13.2Hz)，3.19(1H，d，J＝13.2Hz)，5.63(1H，dd，J＝2.3，5.7Hz)，6.00(1H，dd，J＝0.6，5.7Hz).??IR(KBr)：cm-1：3029，2969，2943，2925，1740，1617，1510，1394，748.??MS(FAB)：m/z：222(M+H)+.??Anal.calcd?for?C13H19NO2：C，70.56；H，8.65；N，6.33；Found?C，69.82；H，8.80；N，6.34.
??33(33-h) ??Mp.178-180℃??1H-NMR(400MHz、CD3OD)：d?ppm：1.37-1.46(2H，m)，1.53-1.87(9H，m)，2.44(1H，d，??J＝16.3Hz)，2.49(1H，d，J＝16.3Hz)，2.57(1H，dd，J＝8.1，14.5Hz)，2.85(1H，quint.J＝7.5Hz)，??3.14(1H，d，J＝13.1Hz)，3.20(1H，d，J＝13.1Hz)，5.62-5.64(1H，m)，5.72-5.74(1H，m).??IR(KBr)：cm-1：3504，3448，3020，2940，2864，1557，1511，1405，1291，1260，757.??MS(FAB)：m/z：236(M+H)+.??Ahal.calcd?for?C14H21NO2：C，71.46；H，8.99；N，5.95；Found?C，68.84；H，9.81；N，5.80.
??34(34-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.26(3H，t，J＝7.3Hz)，1.68-1.92(4H，m)，1.97-2.13(2H，m)，??2.17-2.29(2H，m)，2.43(1H，ddd，J＝4.9，6.8，11.7Hz)，2.47-2.54(1H，m)，4.14(2H，dq，J＝2.9，??7.3Hz)，5.01(1H，d-quint，J＝9.8，1.0Hz)，5.07(1H，dt，J＝17.1，1.5H?z)，5.76(1H，ddt，J＝9.8，??17.1，7.3Hz).
??32(32-h) ??Mp.180-190℃??1H-NMR(400MHz、CD3OD)：d?ppm：1.53(1H，dd，J＝7.7，12.4Hz)，1.75-2.07(7H，m)，2.40(1H，??d，J＝16.1Hz)，2.45(1H，d，J＝16.1Hz)，2.80(1H，quint.J＝7.5Hz)，3.12-3.14(1H，m)，3.14(1H，d，??J＝13.2Hz)，3.19(1H，d，J＝13.2Hz)，5.63(1H，dd，J＝2.3，5.7Hz)，6.00(1H，dd，J＝0.6，5.7Hz).??IR(KBr)：cm-1：3029，2969，2943，2925，1740，1617，1510，1394，748.??MS(FAB)：m/z：222(M+H)+.??Anal.calcd?for?C13H19NO2：C，70.56；H，8.65；N，6.33；Found?C，69.82；H，8.80；N，6.34.
??34(34-d) ??1H-NMR(500MHz、CDCl3)：d?ppm：E/Z?mixture?1.48(isomerA9H，s)，1.52(isomerB9H，s)，??1.77-1.83(1H，m)，1.90-2.23(6H，m)，2.45-2.72(2H，m)，2.91-2.99(isomerB1H+1H，m)，??3.00-3.06(1H，m)，3.33(isomerA1H，ddt，J＝8.8，19.0，2.9Hz)，3.90(isomerA1H，br)，4.33??(isomerB1H，br)，5.24(isomerA1H，br)，5.38(isomerB1H，br)，5.45-5.48(isomerB1H，m)，??5.48-5.51(isomerA1H，m).
??34(34-e) ??1H-NMR(500MHz、CDCl3)：d?ppm：1.49(9H，s)，1.79-1.89(1H，m)，1.92-2.23(6H，m)，2.33??(1H，ddd，J＝2.9，8.8，12.7Hz)，2.46-2.54(3H，m)，2.90(1H，quint，J＝7.3Hz)，3.01-3.09(1H，m)，??3.25(1H，br)，4.78(1H，d，J＝12.2Hz)，4.88(1H，d，J＝12.2Hz)，5.28(1H，br).
??34(34-f) ??1H-NMR(400MHz、CDCl3)：d?ppm：1.33-1.42(10H，m)，1.73-1.80(1H，m)，1.85-1.99(5H，m)，??2.04-2.15(2H，m)，2.21(1H，d，J＝13.7Hz)，2.28(1H，d，J＝13.7Hz)，2.40(1H，ddd，J＝1.2，7.8，??16.4Hz)，2.70(1H，quint，J＝7.8Hz)，2.81(2H，s)，2.91(1H，br)，2.95-3.03(1H，m)，5.32(1H，br).
??32(32-h) ??Mp.180-190℃??1H-NMR(400MHz、CD3OD)：d?ppm：1.53(1H，dd，J＝7.7，12.4Hz)，1.75-2.07(7H，m)，2.40(1H，??d，J＝16.1Hz)，2.45(1H，d，J＝16.1Hz)，2.80(1H，quint.J＝7.5Hz)，3.12-3.14(1H，m)，3.14(1H，d，??J＝13.2Hz)，3.19(1H，d，J＝13.2Hz)，5.63(1H，dd，J＝2.3，5.7Hz)，6.00(1H，dd，J＝0.6，5.7Hz).??IR(KBr)：cm-1：3029，2969，2943，2925，1740，1617，1510，1394，748.??MS(FAB)：m/z：222(M+H)+.??Anal.calcd?for?C13H19NO2：C，70.56；H，8.65；N，6.33；Found?C，69.82；H，8.80；N，6.34.
??34(34-g) ??Mp.157-159℃；??1H-NMR(500MHz、CD3OD)：d?ppm：1.50(1H，dd，J＝7.8，12.2Hz)，1.83-2.20(8H，m)，2.45-2.50??(1H，m)，2.52(2H，d，J＝4.9Hz)，2.89(1H，quint，J＝7.8Hz)，3.08(1H，quint，J＝8.3Hz)，3.14(1H，??br)，3.17(1H，d，J＝12.7Hz)，3.21(1H，d，J＝12.7Hz)，5.40(1H，br).??IR(KCl)：cm-1：1616，1503，1395.??MS(ESI+)：m/z：274(M+K)+，258(M+Na)+，236(M+H)+.??HRMS(ESI+)calcd?for?(M+H)+：258.14700.Found?258.14669(-0.31mmu).
??35(35-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：E/Z?mixture?1.02-1.09(3H，m)，2.14-2.26(4H，m)，2.61??(isomerA2.H，q，J＝7.4Hz)，2.68(isomerB2H，dd，J＝7.4，8.2Hz)，3.67(3H，s)，4.92-5.07(2H，m)，??5.61(isomerA1H，s)，5.64(isomerB1H，s)，5.73-5.89(1H，m).
[table 14]
??35(35-b) ??1H-NMR(500MHz、CDCl3)：d?ppm：E/Z?mixture?1.11(3H，t，J＝7.8Hz)，2.22-2.33(4H，m)，2.66??(isomerA2H，q，J＝7.8Hz)，2.74(isomerB2H，t，J＝7.8Hz)，4.98-5.13(2H，m)，5.67(isomerA1H，??s)，5.71(isomerB1H，s)，5.79-5.91(1H，m).
??35(35-c) ??1H-NMR(500MHz、CDCl3)：d?ppm：E/Z?mixture?1.09(3H，t，J＝7.3Hz)，1.48(9H，s)，1.95-2.03??(1H，m)，2.13-2.21(1H，m)，2.26-2.33(1H，m)，3.63-2.73(2H，m)，2.96(1H，quint，J＝7.3Hz)，??3.34(1H，ddt，J＝8.3，18.1，2.4Hz)，3.78(1H，br)，5.42(1H，br)，5.51(1H，ddd，J＝1.5，2.0，??3.4Hz).
??35(35-d) ??1H-NMR(500MHz、CDCl3)：d?ppm：1.08(3H，t，J＝7.3Hz)，1.46(9H，s)，1.68(1H，dd，J＝7.3，??12.7Hz)，1.87-1.96(1H，m)，2.10-2.20(2H，m)，2.24(1H，ddd，J＝2.4，8.8，12.7Hz)，2.50(1H，d，??J＝17.1Hz)，2.53-2.60(1H，m)，2.87(1H，quint，J＝7.8Hz)，3.28-3.32(1H，m)，4.83(1H，d，??J＝12.2Hz)，4.95(1H，d，J＝12.2Hz)，5.60(1H，br).
??35(35-e) ??1H-NMR(500MHz、CDCl3)：d?ppm：1.09(3H，t，J＝7.3Hz)，1.45(9H，s)，1.70(1H，dd，J＝6.8，??12.2Hz)，1.87-1.95(1H，m)，1.96(1H，ddd，J＝2.4，9.3，12.2Hz)，2.09-2.19(2H，m)，2.29(1H，d，??J＝13.7Hz)，2.35(1H，d，J＝13.7Hz)，2.49-2.58(1H，m)，2.75(1H，quint，J-7.8Hz)，2.90(2H，s)，??2.93-2.97(1H，br)，5.54(1H，s).
??35(35-b) ??1H-NMR(500MHz、CDCl3)：d?ppm：E/Z?mixture?1.11(3H，t，J＝7.8Hz)，2.22-2.33(4H，m)，2.66??(isomerA2H，q，J＝7.8Hz)，2.74(isomerB2H，t，J＝7.8Hz)，4.98-5.13(2H，m)，5.67(isomerA1H，??s)，5.71(isomerB1H，s)，5.79-5.91(1H，m).
??35(35-l) ??Mp.152-155℃；??1H-NMR(500MHz、CD3OD)：d?ppm：1.10(3H，t，J＝7.3Hz)，1.54(1H，dd，J＝7.3，12.7Hz)，1.68??(1H，m)，2.15-2.28(3H，m)，2.47(1H，d，J＝16.1Hz)，2.54(1H，ddt，J＝2.0，2.9，8.3Hz)，2.57(1H，??d，J＝16.1Hz)，2.86(1H，quint，J＝7.8Hz)，2.97-3.01(1H，m)，3.19(1H，d，J＝13.2Hz)，3.26(1H，d，??J＝13.2Hz)，5.61(1H，s).??IR(KCl)：cm-1：1624，1499，1394，1296，1197，1025.??MS(ESI+)：m/z：254(M+2Na-H)+，232(M+Na)+，210(M+H)+.??HRMS(ESI+)calcd?for(M+H)+：210.14940.Found?210.14898(-0.42mmu).??Anal.calcd?for?C12H19NO2：C，68.87；H，9.15；N，6.69；O，15.29.Found?C，68.22；H，9.04；N，??6.88；O，16.05.
??35(35-b) ??1H-NMR(500MHz、CDCl3)：d?ppm：E/Z?mixture?1.11(3H，t，J＝7.8Hz)，2.22-2.33(4H，m)，2.66??(isomerA2H，q，J＝7.8Hz)，2.74(isomerB2H，t，J＝7.8Hz)，4.98-5.13(2H，m)，5.67(isomerA1H，??s)，5.71(isomerB1H，s)，5.79-5.91(1H，m).
??36 ??Mp.98-99℃；??1H-NMR(500MHz、CDCl3)：d?ppm：??1.13(3H，t，J＝7.3Hz)，1.55(1H，dd，J＝7.8，12.7Hz)，2.12(1H，d，J＝16.6Hz)，2.20(2H，q，J??＝7.3Hz)，2.26(1H，ddd，J?＝3.4，7.8，12.7Hz)，2.55(1H，dd，J＝7.8，16.6Hz)，2.60(2H，d，J＝??3.4Hz)，2.94(1H，quint，J＝7.8Hz)，3.24(1H，br)，3.63(1H，d，J＝13.2Hz)，3.68(1H，d，J＝??13.2Hz)，5.32(1H，s).??IR(KCl)：cm-1：1700，1443，1246.??MS(ESI+)：m/z：226(M+H)+.??HRMS(ESI+)：calcd?for(M+H)+：226.14432.Found?226.14259(-1.72mmu).??Anal.calcd?for?C12H20NO3Cl：C，55.06；H，7.70；N，5.35；O，18.34；Cl，13.54.Found?C，53.67；??H，7.71；N，5.36；O，18.09；Cl，13.50.
??37 ??Mp.167-169℃；??1H-NMR(500MHz、CDCl3)：d?ppm：1.14(3H，t，J＝7.3Hz)，1.54(1H，dd，J＝7.3，11.7Hz)，??2.06-2.14(2H，m)，2.20(1H，q，J＝7.3Hz)，2.54(1H，dd，J＝7.3，17.1Hz)，2.71(1H，d，J＝15.6??Hz)，2.81(1H，d，J＝15.6Hz)，2.95(2H，s)，2.96(1H，m)，3.04(1H，br)，5.42(1H，s).??MS(ESI+)：m/z：254(M+2Na-H)+，232(M+Na)+，210(M+H)+.??HRMS(ESI+)calcd?for?(M+H)+：210.14940.Found?210.14842(-0.98mmu).??Anal.calcd?for?C12H19NO2：C，68.87；H，9.15；N，6.69；O，15.29.Found?C，67.32；H，9.05；N，??6.53；O，16.30.
??35(35-b) ??1H-NMR(500MHz、CDCl3)：d?ppm：E/Z?mixture?1.11(3H，t，J＝7.8Hz)，2.22-2.33(4H，m)，2.66??(isomerA2H，q，J＝7.8Hz)，2.74(isomerB2H，t，J＝7.8Hz)，4.98-5.13(2H，m)，5.67(isomerA1H，??s)，5.71(isomerB1H，s)，5.79-5.91(1H，m).
??38(38-a) ??1H-NMR(400MHz、CDCl3)：d?ppm：E/Z?mixture?1.31(isomerB3H，s)，1.31(isomerA3H，s)，1.46??(isomerA9H，d，J＝1.2Hz)，1.49(isomerB9H，d，J＝0.8Hz)，2.34-2.50(2H，m)，2.54(isomerB1H，??dt，J＝17.6，2.7Hz)，2.67(isomerB1H，dt，J＝17.6，2.7Hz)，2.91(isomerA1H，dt，J＝18.0，2.3Hz)，??2.93(isomerA1H，dt，J＝18.0，2.3Hz)，3.45(isomerA1H，br)，3.87(ismerB1H，br)，5.53-5.55??(isomerB1H，m)，5.57-5.61(isomerA1H，m)，5.57-5.60(isomerB2H，m)，5.74-5.82(isomerA2H，??m).
??38(38-b) ??1H-NMR(500MHz、CDCl3)：d?ppm：1.31(isomerB3H，s)，1.35(isomerA3H，s)，1.45??(isomerA9H，s)，1.46(isomerB9H，s)，1.73(isomerB1H，d，J＝13.2Hz)，1.86(isomerA1H，d，??J＝13.2Hz)，1.94(isomerA1H，dd，J＝2.0，13.2Hz)，2.10(isomerB1H，dd，J＝2.4，13.2Hz)，??2.24-2.38(2H，m)，2.47(isomerA2H，8)，2.75(isomerB2H，s)，2.86(isomerB1H，br)，2.89??(isomerA1H，br)，4.55(isomerA1H，d，J＝12.7Hz)，4.62(isomerA1H，d，J＝12.7Hz)，4.81??(isomerB1H，d，J＝11.7Hz)，4.94(isomerB1H，d，J＝11.7Hz)，5.06(isomerA1H，dt，J＝7.8，2.4Hz)，??5.72(isomerB1H，dt，J＝7.8，2.4Hz)，5.90(isomerA1H，dq，J＝7.8，2.0Hz)，5.92(isomerB1H，dq，??J＝7.8，2.0Hz).
??38(38-c) ??1H-NMR(500MHz、CDCl3)：d?ppm：1.29(isomerA3H，s)，1.31(isomerB3H，s)，1.44??(isomerA9H，s)，1.46(isomerB9H，s)，1.57(isomerB1H，d，J＝12.2Hz)，1.67(isomerA1H，d，??J＝12.2Hz)，1.76(isomerA1H，d，J＝12.2Hz)，1.90(isomerB1H，d，J＝12.2Hz)，2.19-2.35??(2H+isomerA2H，m)，2.55-2.77(1H+isomerB4H，m)，2.92(isomerA1H，d，J＝13.2Hz)，2.94??(isomerA1H，d，J＝13.2Hz)，5.70(1H，br)，5.82-5.83(1H，m).
[table 15]
??38(38-d) ??Mp.177-178℃；??1H-NMR(400MHz、CD3OD)：d?ppm：1.33(isomerA3H，s)，1.36(isomerB3H，s)，1.71??(isomerA1H，d，J＝12.5Hz)，1.76(isomerB1H，d，J＝12.5Hz)，1.89(isomerA1H，d，J＝12.5Hz)，??2.21-2.23(isomerB1H，m)，2.25-2.28(isomerA1H，m)，2.33-2.37(isomerA1H，m)，2.38-2.41??(isomerB1H，m)，2.48(isomerB2H，s)，2.70(isomerB1H，br)，2.76(isomerB1H，d，J＝15.6Hz)，??2.79(isomerA1H，br)，2.85(isomerB1H，d，J＝15.6Hz)，2.92(isomerB2H，s)，3.18(isomerA1H，??d，J＝12.9Hz)，3.27(isomerA1H，d，J＝12.9Hz)，5.68-5.74(1H，m)，5.88(isomerA1H，ddd，J＝2.0，??3.5，5.9Hz)，5.93(isomerB1H，ddd，J＝2.0，3.5，5.9Hz).??IR(KCl)：cm-1：1632，1508，1397，711.??MS(ESI+)：m/z：250(M+Na+MeOH)+，240(M+2Na-H)+，218(M+Na)+，196(M+H)+.??HRMS(ESI+)calcd?for(M+H)+：196.13375.Found?196.13106(-2.69mmu).??Anal.calcd?for?C11H17NO2：C，67.66；H，8.78；N，7.17.Found?C，67.31；H，8.97；N，7.16.
??39(39-a) ??1H?NMR(CDCl3，400MHz)：Two?isomers：??d?1.16(1.5H，d，J＝7.4Hz)and?1.34(1.5H，d，J＝7.0Hz)，1.46(4.5H，s)and?1.49(4.5H，s)，??1.61-1.72(1H，m)，2.30-2.38(1H，m)，2.43-2.51(1H，m)，2.62-2.73(1H，m)，3.85-3.93(0.5H，m)??and?4.30-4.34(0.5H，m)，5.38-5.39(0.5H，m)and?5.44-5.46(0.5H，m)，5.59-5.65(0.5H，m)and??5.77-5.89(1.5H，m).
??38(38-d) ??Mp.177-178℃；??1H-NMR(400MHz、CD3OD)：d?ppm：1.33(isomerA3H，s)，1.36(isomerB3H，s)，1.71??(isomerA1H，d，J＝12.5Hz)，1.76(isomerB1H，d，J＝12.5Hz)，1.89(isomerA1H，d，J＝12.5Hz)，??2.21-2.23(isomerB1H，m)，2.25-2.28(isomerA1H，m)，2.33-2.37(isomerA1H，m)，2.38-2.41??(isomerB1H，m)，2.48(isomerB2H，s)，2.70(isomerB1H，br)，2.76(isomerB1H，d，J＝15.6Hz)，??2.79(isomerA1H，br)，2.85(isomerB1H，d，J＝15.6Hz)，2.92(isomerB2H，s)，3.18(isomerA1H，??d，J＝12.9Hz)，3.27(isomerA1H，d，J＝12.9Hz)，5.68-5.74(1H，m)，5.88(isomerA1H，ddd，J＝2.0，??3.5，5.9Hz)，5.93(isomerB1H，ddd，J＝2.0，3.5，5.9Hz).??IR(KCl)：cm-1：1632，1508，1397，711.??MS(ESI+)：m/z：250(M+Na+MeOH)+，240(M+2Na-H)+，218(M+Na)+，196(M+H)+.??HRMS(ESI+)calcd?for(M+H)+：196.13375.Found?196.13106(-2.69mmu).??Anal.calcd?for?C11H17NO2：C，67.66；H，8.78；N，7.17.Found?C，67.31；H，8.97；N，7.16.
??39(39-b) ??1H?NMR(CDCl3，400MHz)：Three?isomers：??d?0.93(0.9H，d，J＝7.8Hz)and?0.97(1.2H，d，J＝7.0Hz)and?1.04(0.9H，d，J＝7.4Hz)，1.44??(2.7H，s)and?1.46(2.7H，s)and?1.47(3.6H，s)，2.02-2.22(1H，m)，2.35-2.42(1H，m)，2.44-2.49??(2H，m)，2.52-2.59(1H，m)，2.65-2.67(1H，m)，3.05-3.12(0.3H，m)and?3.18-3.22(0.4H，m)and??3.33-3.37(0.3H，m)，4.61(0.4H，d，J＝12.1Hz)and?4.71(0.3H，d，J＝12.1Hz)and?4.81(0.3H，??d，J＝11.7Hz)，4.76(0.4H，d，J＝12.1Hz)and?4.92(0.3H，d，J＝11.7Hz)and?4.98(0.3H，d，J??＝12.1Hz)，5.65-5.69(0.6H)and?5.71-5.74(0.4H)，5.90-5.96(1H，m).
??38(38-d) ??Mp.177-178℃；??1H-NMR(400MHz、CD3OD)：d?ppm：1.33(isomerA3H，s)，1.36(isomerB3H，s)，1.71??(isomerA1H，d，J＝12.5Hz)，1.76(isomerB1H，d，J＝12.5Hz)，1.89(isomerA1H，d，J＝12.5Hz)，??2.21-2.23(isomerB1H，m)，2.25-2.28(isomerA1H，m)，2.33-2.37(isomerA1H，m)，2.38-2.41??(isomerB1H，m)，2.48(isomerB2H，s)，2.70(isomerB1H，br)，2.76(isomerB1H，d，J＝15.6Hz)，??2.79(isomerA1H，br)，2.85(isomerB1H，d，J＝15.6Hz)，2.92(isomerB2H，s)，3.18(isomerA1H，??d，J＝12.9Hz)，3.27(isomerA1H，d，J＝12.9Hz)，5.68-5.74(1H，m)，5.88(isomerA1H，ddd，J＝2.0，??3.5，5.9Hz)，5.93(isomerB1H，ddd，J＝2.0，3.5，5.9Hz).??IR(KCl)：cm-1：1632，1508，1397，711.??MS(ESI+)：m/z：250(M+Na+MeOH)+，240(M+2Na-H)+，218(M+Na)+，196(M+H)+.??HRMS(ESI+)calcd?for(M+H)+：196.13375.Found?196.13106(-2.69mmu).??Anal.calcd?for?C11H17NO2：C，67.66；H，8.78；N，7.17.Found?C，67.31；H，8.97；N，7.16.
??39(39-c) ??1H?NMR(CDCl3，400MHz)：Two?major?isomers：??d?0.89(1.8H，d，J＝7.8Hz)and?0.99(1.2H，d，J＝7.4Hz)，1.42-1.47(19H，m)，2.04-2.17(1H，??m)，2.26-2.36(2H，m)，2.40-2.47(2H，m)，2.97-3.03(1H，m)，3.18-3.22(0.4H，m)and?3.31??(0.6H，dt，J＝11.3，13.7Hz)，3.40-3.54(1H，m)，4.89(0.4H，br?s)and?5.01(0.6H，br?s)，??5.71-5.86(2H，m).
??38(38-d) ??Mp.177-178℃；??1H-NMR(400MHz、CD3OD)：d?ppm：1.33(isomerA3H，s)，1.36(isomerB3H，s)，1.71??(isomerA1H，d，J＝12.5Hz)，1.76(isomerB1H，d，J＝12.5Hz)，1.89(isomerA1H，d，J＝12.5Hz)，??2.21-2.23(isomerB1H，m)，2.25-2.28(isomerA1H，m)，2.33-2.37(isomerA1H，m)，2.38-2.41??(isomerB1H，m)，2.48(isomerB2H，s)，2.70(isomerB1H，br)，2.76(isomerB1H，d，J＝15.6Hz)，??2.79(isomerA1H，br)，2.85(isomerB1H，d，J＝15.6Hz)，2.92(isomerB2H，s)，3.18(isomerA1H，??d，J＝12.9Hz)，3.27(isomerA1H，d，J＝12.9Hz)，5.68-5.74(1H，m)，5.88(isomerA1H，ddd，J＝2.0，??3.5，5.9Hz)，5.93(isomerB1H，ddd，J＝2.0，3.5，5.9Hz).??IR(KCl)：cm-1：1632，1508，1397，711.??MS(ESI+)：m/z：250(M+Na+MeOH)+，240(M+2Na-H)+，218(M+Na)+，196(M+H)+.??HRMS(ESI+)calcd?for(M+H)+：196.13375.Found?196.13106(-2.69mmu).??Anal.calcd?for?C11H17NO2：C，67.66；H，8.78；N，7.17.Found?C，67.31；H，8.97；N，7.16.
??39(39-d) ??1H?NMR(CD3OD，400MHz)：Two?major?isomers：??d?0.99(1.5H，d，J＝7.8Hz)and?1.03(1.5H，d，J＝7.0Hz)，1.81-1.92(0.5H，m)and?2.13-2.20??(0.5H，m)，2.26-2.51(4H，m)，2.64-2.75(1H，m)，2.94-2.99(1H，m)，3.08-3.24(2H，m)，??5.77-5.81(1H，m)，5.88-5.95(1H，m).??MS(EI)：m/z：195(M+).??Anal.Calcd?for?C11H17NO2：C?67.66；H?8.78；N?7.17；Found：C?67.00；H?8.83；N?7.18.??IR(KBr)：cm-1：2951，2651，1628，1540，1399，652.
??38(38-d) ??Mp.177-178℃；??1H-NMR(400MHz、CD3OD)：d?ppm：1.33(isomerA3H，s)，1.36(isomerB3H，s)，1.71??(isomerA1H，d，J＝12.5Hz)，1.76(isomerB1H，d，J＝12.5Hz)，1.89(isomerA1H，d，J＝12.5Hz)，??2.21-2.23(isomerB1H，m)，2.25-2.28(isomerA1H，m)，2.33-2.37(isomerA1H，m)，2.38-2.41??(isomerB1H，m)，2.48(isomerB2H，s)，2.70(isomerB1H，br)，2.76(isomerB1H，d，J＝15.6Hz)，??2.79(isomerA1H，br)，2.85(isomerB1H，d，J＝15.6Hz)，2.92(isomerB2H，s)，3.18(isomerA1H，??d，J＝12.9Hz)，3.27(isomerA1H，d，J＝12.9Hz)，5.68-5.74(1H，m)，5.88(isomerA1H，ddd，J＝2.0，??3.5，5.9Hz)，5.93(isomerB1H，ddd，J＝2.0，3.5，5.9Hz).??IR(KCl)：cm-1：1632，1508，1397，711.??MS(ESI+)：m/z：250(M+Na+MeOH)+，240(M+2Na-H)+，218(M+Na)+，196(M+H)+.??HRMS(ESI+)calcd?for(M+H)+：196.13375.Found?196.13106(-2.69mmu).??Anal.calcd?for?C11H17NO2：C，67.66；H，8.78；N，7.17.Found?C，67.31；H，8.97；N，7.16.
??40(40-a) ??1H?NMR(CDCl3，400MHz)：??d?1.08(3H，t，J＝7.4Hz)，1.46(9H，s)，1.51-1.58(1H，m)，1.92-2.04(2H，m)，2.13(2H，q，J＝??7.4Hz)，2.31(1H，d，J＝14.1Hz)，2.39(1H，d，J＝14.1H?z)，2.47(1H，dd，J＝7.8，16.4Hz)，??2.76-2.84(1H，m)，2.98-3.03(1H，m)，3.32(1H，dd，J?＝6.3，14.5Hz)，3.47(1H，dd，J＝6.3，14.5??Hz)，2.72(1H，br?s)，5.31-5.33(1H，m).
??40(40-b) ??1H?NMR(CDCl3，400MHz)：??d?1.08(3H，t，J＝7.4Hz)，1.46-1.47(1H，m)，1.47(9H，s)，1.98-2.00(1H，m)，2.02-2.04(1H，m)，??2.09-2.16(2H，m)，2.32-2.38(1H，m)，2.43-2.49(2H，m)，2.79-2.83(1H，m)，3.02(3H，s)，??3.18-3.20(1H，m)，3.35-3.44(1H，m)，3.64-3.72(1H，m)，5.32-5.34(1H，m).
??38(38-d) ??Mp.177-178℃；??1H-NMR(400MHz、CD3OD)：d?ppm：1.33(isomerA3H，s)，1.36(isomerB3H，s)，1.71??(isomerA1H，d，J＝12.5Hz)，1.76(isomerB1H，d，J＝12.5Hz)，1.89(isomerA1H，d，J＝12.5Hz)，??2.21-2.23(isomerB1H，m)，2.25-2.28(isomerA1H，m)，2.33-2.37(isomerA1H，m)，2.38-2.41??(isomerB1H，m)，2.48(isomerB2H，s)，2.70(isomerB1H，br)，2.76(isomerB1H，d，J＝15.6Hz)，??2.79(isomerA1H，br)，2.85(isomerB1H，d，J＝15.6Hz)，2.92(isomerB2H，s)，3.18(isomerA1H，??d，J＝12.9Hz)，3.27(isomerA1H，d，J＝12.9Hz)，5.68-5.74(1H，m)，5.88(isomerA1H，ddd，J＝2.0，??3.5，5.9Hz)，5.93(isomerB1H，ddd，J＝2.0，3.5，5.9Hz).??IR(KCl)：cm-1：1632，1508，1397，711.??MS(ESI+)：m/z：250(M+Na+MeOH)+，240(M+2Na-H)+，218(M+Na)+，196(M+H)+.??HRMS(ESI+)calcd?for(M+H)+：196.13375.Found?196.13106(-2.69mmu).??Anal.calcd?for?C11H17NO2：C，67.66；H，8.78；N，7.17.Found?C，67.31；H，8.97；N，7.16.
??40(40-c) ??Mp.177-179℃.??1H?NMR(CD3OD，400MHz)：??d?1.11(3H，t，J＝7.4Hz)，1.51(1H，dd，J＝7.4，12.5Hz)，2.08-2.12(1H，m)，2.15-2.21(3H，m)，??2.50-2.56(1H，m)，2.54(2H，s)，2.77(3H，s)，2.87-2.95(1H，m)，3.14-3.19(1H，m)，3.35(1H，d，??J＝12.9Hz)，3.40(1H，d，J＝12.9Hz)，5.30-5.33(1H，m).??MS(FAB)：m/z：224(M(free)+H)+.??Anal.Calcd?for?C13H22NO2Cl：C?60.11；H?8.54；N?5.39；Cl?13.65；Found：C?58.70；H?8.43；N??5.32；Cl?15.67.??IR(KBr)：cm-1：2965，1714，1467，1208，1020，788.
??38(38-d) ??Mp.177-178℃；??1H-NMR(400MHz、CD3OD)：d?ppm：1.33(isomerA3H，s)，1.36(isomerB3H，s)，1.71??(isomerA1H，d，J＝12.5Hz)，1.76(isomerB1H，d，J＝12.5Hz)，1.89(isomerA1H，d，J＝12.5Hz)，??2.21-2.23(isomerB1H，m)，2.25-2.28(isomerA1H，m)，2.33-2.37(isomerA1H，m)，2.38-2.41??(isomerB1H，m)，2.48(isomerB2H，s)，2.70(isomerB1H，br)，2.76(isomerB1H，d，J＝15.6Hz)，??2.79(isomerA1H，br)，2.85(isomerB1H，d，J＝15.6Hz)，2.92(isomerB2H，s)，3.18(isomerA1H，??d，J＝12.9Hz)，3.27(isomerA1H，d，J＝12.9Hz)，5.68-5.74(1H，m)，5.88(isomerA1H，ddd，J＝2.0，??3.5，5.9Hz)，5.93(isomerB1H，ddd，J＝2.0，3.5，5.9Hz).??IR(KCl)：cm-1：1632，1508，1397，711.??MS(ESI+)：m/z：250(M+Na+MeOH)+，240(M+2Na-H)+，218(M+Na)+，196(M+H)+.??HRMS(ESI+)calcd?for(M+H)+：196.13375.Found?196.13106(-2.69mmu).??Anal.calcd?for?C11H17NO2：C，67.66；H，8.78；N，7.17.Found?C，67.31；H，8.97；N，7.16.
??41(41-a) ??1H?NMR(CDCl3，400MHz)：??d?0.04(6H，s)，0.87(3H，t，J＝7.4Hz)，0.89(9H，s)，1.17-1.30(1H，m)，1.51-1.60(1H，m)，??2.03-2.11(1H，m)，3.49(1H，dd，J＝6.3，9.8Hz)，3.53(1H，dd，J＝6.3，9.8Hz)，5.00-5.03(1H，??m)，5.05-5.06(1H，m)，5.57-5.66(1H，m).
[table 16]
??41(41-b) ??1H?NMR(CDCl3，400MHz)：??d?0.87(3H，t，J＝7.4Hz)，1.29(3H，t，J＝7.4Hz)，1.29-1.36(1H，m)，1.41-1.51(1H，m)，??2.03-2.12(1H，m)，2.17-2.31(2H，m)，4.18(2H，q，J?＝7.4Hz)，4.97-5.05(2H，m)，5.53-5.62??(1H，m)，5.81(1H，d，J＝15.6Hz)，6.91(1H，dt，J＝7.4，15.6Hz).
??41(41-c) ??1H?NMR(CDCl3，500MHz)：??d?0.88(3H，t，J＝7.3Hz)，1.25-1.35(1H，m)，1.42-1.50(1H，m)，2.05-2.12(1H，m)，2.20-2.27??(1H，m)，2.29-2.35(1H，m)，4.98-5.06(2H，m)，5.53-5.60(1H，m)，5.82(1H，d，J＝15.6Hz)，??7.03(1H，dt，J＝7.8，15.6Hz).
??41(41-d) ??1H?NMR(CDCl3，400MHz)：??Major?isomer：??d?0.86(3H，t，J＝7.4Hz)，1.23-1.38(2H，m)，1.45(9H，s)，2.45-2.51(1H，m)，2.54-2.62(1H，m)，??2.97-3.07(1H，m)，3.25-3.33(1H，m)，3.86-3.90(1H，m)，5.48-5.50(1H，m)，5.57-5.63(1H，m)，??5.79-5.84(1H，m).??Minor?isomer：??d?0.93(3H，t，J＝7.4Hz)，1.23-1.38(2H，m)，1.49(9H，s)，2.40-2.43(1H，m)，2.65-2.68(1H，m)，??2.78-2.86(1H，m)，2.88-2.96(1H，m)，4.30-4.33(1H，m)，5.36-5.38(1H，m)，5.65-5.68(1H，m)，??5.79-5.84(1H，m).
??41(41-b) ??1H?NMR(CDCl3，400MHz)：??d?0.87(3H，t，J＝7.4Hz)，1.29(3H，t，J＝7.4Hz)，1.29-1.36(1H，m)，1.41-1.51(1H，m)，??2.03-2.12(1H，m)，2.17-2.31(2H，m)，4.18(2H，q，J?＝7.4Hz)，4.97-5.05(2H，m)，5.53-5.62??(1H，m)，5.81(1H，d，J＝15.6Hz)，6.91(1H，dt，J＝7.4，15.6Hz).
??41(41-e) ??1H?NMR(CDCl3，400MHz)：??Major?isomer：??d?0.83(3H，t，J＝7.4Hz)，1.18-1.34(2H，m)，1.45(9H，s)，1.50-1.54(1H，m)，2.29(1H，ddd，J＝??2.7，8.9，12.9Hz)，2.33-2.38(1H，m)，2.46(2H，s)，2.50-2.56(1H，m)，3.22-3.28(1H，m)，4.78??(1H，d，J＝11.7Hz)，4.85(1H，d，J＝11.7Hz)，5.65-5.67(1H，m)，5.92-5.95(1H，m).??Minor?isomer：??d?0.88(3H，t，J＝7.4Hz)，1.33-1.39(1H，m)，1.45(9H，s)，1.85(1H，dd，J＝8.2，12.9Hz)，1.97??(1H，ddd，J＝3.1，8.6，12.9Hz)，2.46(2H，s)，2.69-2.70(1H，m)，2.71-2.77(1H，m)，2.95-3.03??(1H，m)，3.17-3.21(1H，m)，4.54(1H，d，J＝12.5Hz)，4.60(1H，d，J＝12.5Hz)，5.59-5.62(1H，??m)，5.76-5.82(1H，m).
??41(41-b) ??1H?NMR(CDCl3，400MHz)：??d?0.87(3H，t，J＝7.4Hz)，1.29(3H，t，J＝7.4Hz)，1.29-1.36(1H，m)，1.41-1.51(1H，m)，??2.03-2.12(1H，m)，2.17-2.31(2H，m)，4.18(2H，q，J?＝7.4Hz)，4.97-5.05(2H，m)，5.53-5.62??(1H，m)，5.81(1H，d，J＝15.6Hz)，6.91(1H，dt，J＝7.4，15.6Hz).
??41(41-f) ??1H?NMR(CDCl3，500MHz)：??Major?isomer：??d?0.83(3H，t，J＝7.3Hz)，1.17-1.22(1H，m)，1.24-1.31(1H，m)，1.43(9H，s)，1.44-1.48(1H，m)，??1.95(1H，ddd，J＝2.9，8.8，12.2Hz)，2.22(1H，d，J＝13.7Hz)，2.29(1H，d，J＝13.7Hz)，??2.29-2.32(1H，m)，2.37-2.42(1H，m)，2.87(2H，s)，2.95-2.99(1H，m)，5.77-5.79(1H，m)，??5.85-5.86(1H，m).??Minor?isomer：??d?0.87(3H，t，J＝7.3H?z)，1.24-1.31(1H，m)，1.43(9H，s)，1.48-1.54(1H，m)，1.61(1H，ddd，J＝??2.9，8.3，12.2Hz)，1.75(1H，dd，J＝7.8，12.2Hz)，2.22(1H，d，J＝13.7Hz)，2.29(1H，d，J＝??13.7Hz)，2.29-2.32(1H，m)，2.53-2.59(1H，m)，2.67-2.71(1H，m)，2.88(2H，s)，5.69-5.74(2H，??m).
??41(41-b) ??1H?NMR(CDCl3，400MHz)：??d?0.87(3H，t，J＝7.4Hz)，1.29(3H，t，J＝7.4Hz)，1.29-1.36(1H，m)，1.41-1.51(1H，m)，??2.03-2.12(1H，m)，2.17-2.31(2H，m)，4.18(2H，q，J?＝7.4Hz)，4.97-5.05(2H，m)，5.53-5.62??(1H，m)，5.81(1H，d，J＝15.6Hz)，6.91(1H，dt，J＝7.4，15.6Hz).
??41(41-g) ??1H?NMR(CD3OD，400MHz)：??Major?isomer：??d?0.85(3H，t，J＝7.4Hz)，1.17-1.28(1H，m)，1.28-1.36(1H，m)，1.50(1H，dd，J＝7.4，12.5Hz)，??2.15(1H，ddd，J＝2.7，9.0，12.5Hz)，2.33-2.37(1H，m)，2.37(3H，s)，2.50(2H，s)，2.53-2.59??(1H，m)，3.14-3.18(1H，m)，3.32(1H，d，J＝13.3Hz)，3.36(1H，d，J＝13.3Hz)，5.70-5.72(1H，??m)，5.97-5.98(1H，m)，7.23(2H，d，J?＝7.8Hz)，7.70(2H，d，J?＝7.8Hz).??Minor?isomer：??d?0.91(3H，t，J＝7.4Hz)，1.36-1.42(1H，m)，1.56(1H，dd，J＝6.7，13.7Hz)，1.81-1.88(2H，m)，??2.37(3H，s)，2.49(2H，s)，2.70-2.77(1H，m)，2.97-3.04(1H，m)，3.12-3.19(2H，m)，3.32-3.35??(1H，m)，5.64-5.66(1H，m)，5.81-5.84(1H，m)，7.23(2H，d，J＝7.8Hz)，7.70(2H，d，J＝7.8Hz).
??41(41-b) ??1H?NMR(CDCl3，400MHz)：??d?0.87(3H，t，J＝7.4Hz)，1.29(3H，t，J＝7.4Hz)，1.29-1.36(1H，m)，1.41-1.51(1H，m)，??2.03-2.12(1H，m)，2.17-2.31(2H，m)，4.18(2H，q，J?＝7.4Hz)，4.97-5.05(2H，m)，5.53-5.62??(1H，m)，5.81(1H，d，J＝15.6Hz)，6.91(1H，dt，J＝7.4，15.6Hz).
??41(41-h) ??1H?NMR(CD3OD，400MHz)：??Major?isomer：??d?0.85(3H，t，J＝7.4Hz)，1.19-1.27(1H，m)，1.27-1.35(1H，m)，1.48(1H，dd，J＝7.4，12.5Hz)，??2.05(1H，ddd，J＝2.7，9.0，12.5Hz)，2.31-2.37(1H，m)，2.47(2H，s)，2.51-2.57(1H，m)，??3.12-3.24(3H，m)，5.76-5.78(1H，m)，5.92-5.93(1H，m).??Minor?isomer：??d?0.90(3H，t，J＝7.4Hz)，1.35-1.42(1H，m)，1.55(1H，dd，J＝6.7，13.7Hz)，1.72(1H，ddd，J＝??2.7，8.2，12.1Hz)，1.83(1H，dd，J＝7.8，12.1Hz)，2.46(2H，s)，2.67-2.75(1H，m)，2.95-3.02??(1H，m)，3.12-3.25(3H，m)，5.70-5.72(1H，m)，5.76-5.78(1H，m).??MS(EI)：m/z：209(M+).??Anal.Calcd?for?C12H19NO2：C?68.87；H?9.15；N?6.69；Found：C?68.52；H?9.24；N?6.68.??IR(KBr)：cm-1：2958，2641，1621，1511，723.
[table 17]
??42(42-a) ??1H?NMR(CDCl3，400MHz)：??d?2.05(1H，dd，J＝4.7，12.5Hz)，2.18-2.23(1H，m)，2.32(1H，ddd，J＝2.0，10.2，19.6Hz)，??2.44-2.55(2H，m)，2.68-2.82(2H，m)，3.17-3.22(1H，m)，3.80-3.95(4H，m).
??42(42-b) ??1H?NMR(CDCl3，400MHz)：??d?2.25-2.33(1H，m)，2.42(1H，ddd，J＝1.6，3.9，16.8Hz)，2.59-2.68(2H，m)，2.82-2.89(1H，m)，??3.46-3.51(1H，m)，3.81-3.99(4H，m)，5.66-5.68.
??42(42-c) ??1H?NMR(CDCl3，400MHz)：??d?2.09(1H，ddd，J＝1.6，6.7，12.9Hz)，2.31-2.38(1H，m)，2.50-2.56(1H，m)，2.62-2.70(2H，m)，??3.53-3.56(1H，m)，3.84-3.89(2H，m)，3.93-3.97(2H，m)，5.10-5.14(2H，m)，5.68(1H，br?s)，??6.63(1H，dd，J＝10.2，18.0Hz).
??42(42-d) ??1H?NMR(CDCl3，400MHz)：??Major?isomer：??d?1.45(9H，s)，2.40-2.46(1H，m)，2.70-2.79(2H，m)，2.96-3.05(1H，m)，3.33(1H，ddt，J＝2.7，??8.6，18.4Hz)，3.95-3.99(1H，m)，5.11-5.17(2H，m)，5.48-5.49(1H，m)，5.60(1H，br?s)，??6.56-6.66(1H，m).??Minor?isomer：??d?1.49(9H，s)，2.40-2.51(2H，m)，2.65-2.68(1H，m)，2.96-3.05(2H，m)，4.38-4.42(1H，m)，??5.11-5.17(2H，m)，5.38-5.39(1H，m)，5.83(1H，br?s)，6.56-6.66(1H，m).
??42(42-a) ??1H?NMR(CDCl3，400MHz)：??d?2.05(1H，dd，J＝4.7，12.5Hz)，2.18-2.23(1H，m)，2.32(1H，ddd，J＝2.0，10.2，19.6Hz)，??2.44-2.55(2H，m)，2.68-2.82(2H，m)，3.17-3.22(1H，m)，3.80-3.95(4H，m).
??42(42-e) ??1H?NMR(CDCl3，500MHz)：??d?1.45(9H，s)，1.45-1.47(1H，m)，2.29-2.32(1H，m)，2.34(1H，ddd，J?＝2.9，8.8，12.7Hz)，2.48??(2H，s)，2.63(1H，dd，J＝7.3，16.1Hz)，2.92-2.98(1H，m)，3.32-3.35(1H，m)，4.78(1H，d，J＝??11.7Hz)，4.84(1H，d，J＝11.7Hz)，5.15-5.19(2H，m)，5.64(1H，br?s)，6.64(1H，dd，J＝10.7，??17.6Hz).
??42(42-f) ??1H?NMR(CDCl3，400MHz)：??d?1.44(9H，s)，1.44-1.48(1H，m)，2.01(1H，ddd，J＝2.4，8.6，12.1Hz)，2.24(1H，d，J＝14.1??Hz)，2.24-2.29(1H，m)，2.31(1H，d，J＝14.1Hz)，2.56-2.63(1H，m)，2.78-2.86(1H，m)，2.88??(2H，s)，3.04-3.08(1H，m)，5.10-5.14(2H，m)，5.77-5.78(1H，m)，6.66(1H，dd，J＝10.2，17.6??Hz).
??42(42-g) ??1H?NMR(CD3OD，400MHz)：??d?1.51(1H，dd，J＝7.4，12.5H?z)，2.20(1H，ddd，J＝2.7，8.6，12.5Hz)，2.30-2.34(1H，m)，2.37??(3H，s)，2.51(2H，s)，2.63(1H，dd，J＝7.8，16.4Hz)，2.91-2.99(1H，m)，3.22-3.26(1H，m)，3.31??(1H，d，J＝13.3Hz)，3.36(1H，d，J＝13.3Hz)，5.16-5.21(2H，m)，5.68(1H，brs)，6.68(1H，dd，??J＝11.0，17.6Hz)，7.23(2H，d，J＝8.2Hz)，7.71(2H，d，J＝8.2Hz).
??42(42-a) ??1H?NMR(CDCl3，400MHz)：??d?2.05(1H，dd，J＝4.7，12.5Hz)，2.18-2.23(1H，m)，2.32(1H，ddd，J＝2.0，10.2，19.6Hz)，??2.44-2.55(2H，m)，2.68-2.82(2H，m)，3.17-3.22(1H，m)，3.80-3.95(4H，m).
??42(42-h) ??Mp.183-185℃.??1H?NMR(CD3OD，400MHz)：??d?1.48(1H，dd，J＝7.4，12.1Hz)，2.11(1H，ddd，J＝2.7，8.6，12.1Hz)，2.27-2.32(1H，m)，2.49??(2H，s)，2.60(1H，dd，J＝7.4，16.0Hz)，2.90-2.97(1H，m)，3.17(1H，d，J＝12.9Hz)，3.19-3.24??(1H，m)，3.22(1H，d，J＝12.9Hz)，5.12-5.17(2H，m)，5.75(1H，br?s)，6.67(1H，dd，J＝11.0，??17.6Hz).??MS(FAB)：m/z：208(M+H)+.??Anal.Calcd?for?C12H17NO2：C?69.54；H?8.27；N?6.76；Found：C?68.74；H?8.10；N?6.76.??IR(KBr)：cm-1：2905，2648，1634，1525，1397，896.
??43(43-a) ??1H?NMR(CDCl3，400MHz)：??d?0.19(9H，s)，2.17(1H，ddd，J＝1.2，6.7，12.9Hz)，2.30-2.36(1H，m)，2.49-2.55(1H，m)，??2.56-2.63(1H，m)，2.72(1H，ddt，J＝2.4，7.8，16.4Hz)，3.52-3.57(1H，m)，3.81-3.96(4H，m)，??6.02(1H，ddd，J＝2.4，2.4，2.4Hz).
??42(42-a) ??1H?NMR(CDCl3，400MHz)：??d?2.05(1H，dd，J＝4.7，12.5Hz)，2.18-2.23(1H，m)，2.32(1H，ddd，J＝2.0，10.2，19.6Hz)，??2.44-2.55(2H，m)，2.68-2.82(2H，m)，3.17-3.22(1H，m)，3.80-3.95(4H，m).
??43(43-b) ??1H?NMR(CDCl3，400MHz)：??Major?isomer：??d?0.20(9H，s)，1.45(9H，s)，2.39-2.45(1H，m)，2.76-2.79(1H，m)，2.80-2.86(1H，m)，2.91-3.00??(1H，m)，3.31(1H，ddt，J＝2.7，8.6，18.4Hz)，3.96-4.01(1H，m)，5.46-5.48(1H，m)，5.94-5.96??(1H，m).??Minor?isomer：??d?0.20(9H，s)，1.48(9H，s)，2.38-2.45(1H，m)，2.51-2.57(1H，m)，2.71-2.75(1H，m)，2.91-3.00??(2H，m)，4.37-4.42(1H，m)，5.37-5.39(1H，m)，6.16-6.18(1H，m).
??43(43-c) ??1H?NMR(CDCl3，500MHz)：??d?1.45(9H，s)，1.64(1H，dd，J＝7.3，13.2Hz)，2.29-2.34(1H，m)，2.36(1H，ddd，J＝2.9，8.8，??13.2Hz)，2.49(2H，s)，2.72(1H，ddt，J＝2.4，8.3，16.6Hz)，2.90-2.96(1H，m)，3.08(1H，s)，??3.37-3.38(1H，m)，4.77(1H，d，J＝11.7Hz)，4.82(1H，d，J＝11.7Hz)，6.04-6.05(1H，m).
[table 18]
??43(43-d) ??1H?NMR(CDCl3，400MHz)：??d?1.44(9H，s)，1.49-1.54(1H，m)，2.02(1H，ddd，J＝2.4，8.6，12.5Hz)，2.25(1H，d，J＝14.1??Hz)，2.25-2.31(1H，m)，2.32(1H，d，J＝14.1Hz)，2.69(1H，ddt，J＝2.4，7.8，16.0Hz)，??2.76-2.82(1H，m)，2.86(2H，s)，3.03(1H，s)，3.06-3.11(1H，m)，6.19-6.21(1H，m).
??43(43-e) ??1H?NMR(CD3OD，400MHz)：??d?1.58(1H，dd，J＝7.8，12.9Hz)，2.20(1H，ddd，J＝2.4，8.6，12.9Hz)，2.26-2.31(1H，m)，??2.37(3H，s)，2.51(2H，s)，2.69(1H，ddt，J＝2.4，7.8，16.4Hz)，2.89-2.97(1H，m)，3.23-3.28??(1H，m)，3.31(1H，d，J＝13.3Hz)，3.35(1H，d，J＝13.3Hz)，3.48(1H，s)，6.00-6.02(1H，m)，??7.23(2H，d，J＝8.2Hz)，7.70(2H，d，J＝8.2Hz).
??43(43-l) ??Mp.184-186℃.??1H?NMR(CD3OD，500MHz)：??d?1.56(1H，dd，J＝7.8，12.2Hz)，2.11(1H，ddd，J＝2.9，8.8，12.2Hz)，2.23-2.28(1H，m)，??2.49(2H，s)，2.66(1H，ddt，J＝2.4，7.8，16.1Hz)，2.88-2.94(1H，m)，3.16(1H，d，J＝12.7??Hz)，3.22(1H，d，J＝12.7Hz)，3.22-3.26(1H，m)，3.42(1H，s)，6.08-6.10(1H，m).??MS(FAB)：m/z：206(M+H)+.??Anal.Calcd?for?C12H15NO2：C?70.22；H?7.37；N?6.82；Found：C?69.00；H?7.49；N?6.77.??IR(KBr)：cm-1：3288，2908，1525，1397，1063，665.
Literal implication among the above-mentioned table 3-18 is as follows:
Broad: broad peak Quint: five peaks
Sept: seven peak Anal.calcd for: theoretical value
Calcd for: theoretical value Found: measured value
Major isomer: main isomer Minor isomer: less important isomer
Isomer: isomer Detectable peaks: detectable peak
Decompose: decompose Total: total
Each: each And: and
Ofminor: accessory Of major: main
Free: free bensensulfonic acid: Phenylsulfonic acid
E/Z mixture:E/Z mixture Two isomers: two kinds of isomer
Three isomers: three kinds of isomer Two major isomers: two kinds of main isomer
(preparation embodiment)
Use compound, 90g lactose, 34g W-Gum, 20g crystalline cellulose and the 1g Magnesium Stearate of agitator mixing 5g embodiment 21, use the tabletting machine compacting then, to obtain tablet.
(test implementation example 1) people's calcium channel subunit α 2δ 1The preparation of structure of (hereinafter being called people Cacna2d1) gene expression plasmid and the cell membrane component of expressing human Cacna2d1
A) structure of people Cacna2d1 expression plasmid pRK/hCacna2d1
A-1) preparation of dna fragmentation
Acquisition is the people Cacna2d1 gene of two fragments (half fragment of preceding half fragment and back).((TOYOBO CO. LTD.), according to the scheme that provides for this enzyme, carries out PCR to QUICK-Clone cDNA Human Brain (ClontechLaboratories, Inc.)) as template and enzyme KOD polysaccharase to use the cDNA library.The PCR primer used to preceding half fragment is the primer with following sequence available from SIGMA GENOSYS:
Primer 1:5 '-agctgcggcc gctagcgcca ccatggctgg ctgcctgctg gc-3 ' (SEQID NO:1) and
Primer 2: 5 '-attaggatcg attgcaaagt aataccc-3 ' (SEQ ID NO:2); With
For half fragment in back, primer has following sequence:
Primer 3:5 '-aatgggtatt actttgcaat cgatcc-3 ' (SEQ ID NO:3) and
Primer 4:5 '-agtcggatcc tcataacagc cggtgtgtgc tg-3 ' (SEQ ID NO:4).
Half fragment of preceding half fragment and back is used thermal cycler (GeneAmp PCR System9700 (Applied Biosystems, Inc.)) carry out the PCR reaction by a kind of method, described method be included in 94 ℃ the heating 1 minute, carry out then 35 thermal cyclings (94 ℃, 15 seconds, 60 ℃, 30 seconds and 68 ℃, 2 minutes), place 68 ℃ 5 minutes, and be cooled to 4 ℃.
Use PCR product purification test kit (MiniElute PCR Purification Kit (QIAGEN)) according to these two reaction product of the scheme purifying that in this test kit, contains.(TOYOBO CO. LTD.) digests preceding half fragment that is obtained with restriction enzyme Not1.Half fragment in back with restriction enzyme Cla1 (TOYOBO CO., LTD.) and BamH1 (TOYOBO CO. LTD.) digests.Subsequently, use reaction product purification kit (MiniElute Reaction Cleanup Kit (QIAGEN)) according to these fragments of scheme purifying that in this test kit, comprise.
A-2) preparation of carrier
To change into the MCS of carrier pBluescript 2 (STRATAGENE) at the multiple clone site (hereinafter being called MCS) of the expression vector pRK5 (BD Pharmingen) of zooblast, with the preparation carrier.Specifically, with restriction enzyme Cla1 (TOYOBO CO., LTD.) and Hind3 (TOYOBO CO., LTD.) processing pRK5 use two ends of Klenow fragment (TAKARABIO INC.) this DNA of flush end then.Use the Roll alkaline phosphatase (hereinafter to be called CIAP; TAKARA BIO INC.) further these two ends of dephosphorylation use MiniElute Reaction Cleanup Kit (QIAGEN) purifying fragment then.Then, DNA electrophoresis on 1.0% sepharose that this enzyme is handled.Behind electrophoresis, use the ethidium bromide staining gel.Then, under UV irradiation with razor blade separately corresponding to the strip portion of about 4.7kbp.Use gel extraction/purification kit (MiniElute Gel Extract Kit (QIAGEN)) to extract DNA by it according to the scheme that in this test kit, comprises.
For obtaining dna fragmentation corresponding to the MCS of pBluescript 2, with restriction enzyme Sac1 (TOYOBO CO., LTD.) and Kpn1 (TOYOBO CO. LTD.) handles pBluescript2, uses two ends of Klenow fragment (TAKARA BIO INC.) this DNA of flush end then.Then, DNA electrophoresis on 2.0% sepharose of this enzyme processing.Behind electrophoresis, the gel ethidium bromide staining.Then, under UV irradiation with razor blade separately corresponding to the strip portion of about 100bp.Use gel extraction/purification kit (MiniElute Gel ExtractKit (QIAGEN)) to extract DNA by it according to the scheme that in this test kit, comprises.
Use dna ligation kit (TAKARA BIO INC.) according to the scheme that in test kit, comprises connect the dna fragmentation that obtains and the pRK5 that cut.With this reaction product transformed into escherichia coli (E.Coli) DH5 α competent cell (TOYOBO CO., LTD.), to obtain the amicillin resistance bacterium colony.Collect some bacterium colony, cultivate collected bacterium colony then.Extract plasmid by the bacterial cell that is obtained, and (3700 types (Applied Biosystems, Inc.)) are analyzed its nucleotide sequence, import among the pRK5 to confirm the MCS sequence to use the dna sequencing instrument.In the context of this article, in being called the carrier of pRK-SK, when the CMV promotor is regarded as being in the upstream, mix the MCS sequence, make it in the following orientation of downstream direction: 5 '-ccaccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcg atatcaagcttatcgataccgtcgacctcgagggggggcccg-3 ' (SEQ ID NO:5), wherein the MCS sequence carrier that mixes sequence with the direction opposite with it is called as pRK-KS.
A-3) structure of plasmid
At paragraph a-2) in the pRK-SK that obtains (TOYOBO CO. LTD.) handles, two terminal Klenow fragment (TAKARA BIO INC.) flush ends that use of DNA with restriction enzyme Xba1.The DNA of flush end use again restriction enzyme Not1 (TOYOBO CO., LTD.) digestion, and with paragraph a-2) identical mode purifying.Become this linear pRK-SK thus and at paragraph a-1) preceding half dna fragmentation electrophoresis on 1.0% sepharose of the people Cacna2d1 gene that obtains, with paragraph a-2) identical mode is by DNA and the purifying of the about 4.7kbp of gel extraction and about 1.5kbp.Two DNA that obtained with paragraph a-2) identical mode is connected, with connecting the product transformed into escherichia coli.Extract plasmid by the escherichia coli cloning that obtains, and (3700 types (Applied Biosystems, Inc.)) are analyzed its nucleotide sequence, introduce wherein with the sequence that confirms to be represented by SEQ ID NO:6 to use the dna sequencing instrument.Then, with restriction enzyme Cla1 (TOYOBO CO., LTD.) and the identical mode of BamH1 (TOYOBO CO. LTD.) handles the plasmid that is obtained, with paragraph a-2) carry out CIAP processing and purifying.With become this linear plasmid DNA thus and at paragraph a-1) back half dna fragmentation electrophoresis on 1.0% sepharose of the people Cacna2d1 gene that obtains, with paragraph a-2) identical mode is by DNA and the purifying of the about 6.2kbp of gel extraction and about 1.8kbp.Two DNA that obtained with paragraph a-2) identical mode is connected, with connecting the product transformed into escherichia coli.Extract plasmid by the escherichia coli cloning that obtains, and (3700 types (Applied Biosystems, Inc.)) are analyzed its nucleotide sequence, introduce among the carrier pRK-SK with the sequence that confirms to be represented by SEQ ID NO:7 to use the dna sequencing instrument.The plasmid that is obtained is called as pRK/hCacna2d1.
B) acquisition of 293 clones of expressing human Cacna2d1
Be used in a) the middle people Cacna2d1 expression plasmid pRK/hCacna2d1 rotaring redyeing 293 cell that makes up of paragraph, as indication, obtain the clone of stably express people Cacna2d1 with people Cacna2d1 protein expression.Specifically, with 2 * 10 6Individual 293 cell inoculations and were cultivated 12 hours to φ 6cm ware.Then, use transfection reagent Lipofectamine Plus (InvitrogenCorp.), according to the scheme that provides for described reagent, with 5 μ g pRK/hCacna2d1 and 0.5 μ g neomycin resistance gene expression plasmid pSV2neo (Clontech) cotransfection cell.
Collect cells transfected thus, be inoculated into after the dilution on the φ 15cm ware then, and adding 10% foetal calf serum (Cansera International Inc.) and among the DMEM (Invitrogen Corp.) of 500 μ g/ml G418 (Invitrogen Corp.) cultivated for 2 weeks.Separate the neomycin resistance cell that successfully forms bacterium colony.After amplification cultivation, collecting cell is estimated cell lysate by protein determination, to obtain 293 clones of expressing human Cacna2d1.In protein determination, anti-hCacna2d1 antibody (Chemicon Inc.) is as first antibody.
C) preparation of the cell membrane component of 293 cells of expressing human Cacna2d1
Adding 10% foetal calf serum (Cansera International, Inc.) large scale culturing is at paragraph b and among the DMEM (Invitrogen Corp.) of 500 μ g/mlG418 (Invitrogen Corp.)) in 293 cells of expressing human Cacna2d1 of acquisition, and collecting cell.The recommended amounts of proteinase inhibitor (Complete EDTA free (Roche Applied Science)) with described reagent added in conjunction with measuring damping fluid (10mM MOPS (pH 7.4), 10mM HEPES (pH7.4), 100mM NaCl), prepare damping fluid with the preparation membrane component.The cell of collecting prepares the damping fluid washing with membrane component, uses ultrasonic apparatus homogenate then.Then, use whizzer with 12,000rpm was in 4 ℃ of centrifugal homogenates 1 hour.Discarded supernatant liquor is suspended in membrane component with precipitation and prepares in the damping fluid.Ultrasonic apparatus is ultrasonic to be repeated 3 times to the floating sedimentary step of centrifugal rear overhang again by using, and institute's suspension that obtains is used as the cell membrane component of expressing human Cacna2d1.UV absorbancy by the 280nm wavelength is calculated the proteic aggregate level that comprises in membrane component.
(test implementation example 2) is used for the structure of detection system of the association reaction between Cacna2d1 and the gabapentin (hereinafter being called GBP) and the Cacna2d1/GBP association reaction of embodiment compound suppresses active detection
A) be used for the structure of the detection system of the association reaction between Cacna2d1 and the GBP
With in conjunction with measuring damping fluid (10mM MOPS (pH 7.4), 10mM HEPES (pH7.4), 100mM NaCl) respectively with the total protein level of 2.5mg/ml final concentration and 4.5nM 3The cell membrane component of H-GBP final concentration dilution table intelligent Cacna2d1 and use radio isotope 3The GBP of H mark (hereinafter is called 3H-GBP; Tocris Cookson Ltd.), to prepare 120 μ l reaction solns, this solution left standstill 3 hours in 4 ℃ again.This reaction product is added to the hole of filter plate (UniFilter 350GF/B (Whatman)), and filter by filter.Then, repeated washing step 3 time, washing step comprises and adds 350 μ l in conjunction with measuring damping fluid (10mM MOPS (pH 7.4), 10mM HEPES (pH 7.4), 100mM NaCl), and filters by filter.Finish-drying filter plate, and sealing downside.Adding 50 μ l Microscint 20 (PerkinElmerInc.) afterwards, seal upper surface in the same old way, and use TopCount (PerkinElmer Inc.) counting by isotropic substance residual on the filter 3The radiation that H sends.By the measured value that is obtained deduct with 20 μ M final concentrations add unlabelled GBP (SIGMA-ALDRICH INC.) to this mensuration obtain as the value that produces by non-specific adsorption, the value of obtaining is used as 3H-GBP to the ratio of Cacna2d1 in conjunction with level (unit: " counting ").
B) the Cacna2d1/GBP association reaction of test compounds suppresses active detection
Every kind of test compounds adds to the Cacna2d1/GBP association reaction detection assay that makes up in a) at paragraph with multiple concentration, and by paragraph a) described in method detect in conjunction with level.Then, be defined as " in conjunction with level [x] " than combination water is flat by the Cacna2d1/GBP that adds the compound acquisition with x nM concentration, and Cacna2d1/GBP in contrast is defined as " inhibition ratio [x] " in conjunction with inhibition ratio, and inhibition ratio (%) is determined based on following equation:
Inhibition ratio [x] (%)=(1-(in conjunction with level [x] /)) * 100 in conjunction with level [0], wherein
Be meant in conjunction with level [0] and do not add that compound obtains 3H-GBP in conjunction with level.
Inhibition ratio is mapped to concentration.Calculate " IC by this result 50Value ", it is the concentration of the Cacna2d1/GBP of inhibition 50% in conjunction with essential test compounds.The test result of test compounds is shown in table 2.
[table 19]
Embodiment ??IC 50(nM)
??1 ??51
??2 ??27
??5 ??24
??6 ??26
??7 ??36
??8 ??28
??9 ??32
??10 ??28
??11 ??89
??12 ??32
??13 ??200
??14 ??55
??15 ??73
??16 ??65
??17 ??120
??18 ??670
??20 ??100
Embodiment ??IC 50(nM)
??21 ??14
??22 ??10
??23 ??41
??24 ??85
??31 ??14
(test implementation example 3) mechanical hyperalgesia is measured
It is reported that the animal of peripheral nerve injury and diabetes model animal show the hyperpathia of mechanical stimulus or thermal stimulus and unusual pain symptom.In the present invention, the mouse that mechanical hyperalgesia occurs is used for estimating.
Make mouse in plastics cage, adapt to 30 minutes, so that detect.Then, orally give mouse test compounds is estimated the mechanical hyperalgesia of mouse more predetermined detection time in the test owner.Revise people's such as Takasaki method (Pain 8695-101,2000) by part and carry out the evaluation of mechanical hyperalgesia, to confirm the effect of test compounds mechanical hyperalgesia.Specifically, thus mark and estimate mechanical hyperalgesia by 1.4g von Frey silk being pressed in the behavior of bringing out in the mouse vola according to following standard:
0: do not have response, 1: by the withdrawal of von Frey silk and 2: after stimulation, tremble or lick rear solid end immediately.
In a detection, giving mouse stimulates for 6 times, and overall score is as pain scores.
By calculating ID 50The evaluation test compound, ID 50Be the dosage that 50% compound that improves is provided with respect to the pain scores that gives the solvent group.In these models, for example, embodiment 2 described compounds have the ID of 10.4mg/kg 50
(test implementation example 4) thermal hyperalgesia is measured
In the present invention, the mouse of thermal hyperalgesia and rat occurring is used for estimating.
Orally give animal testing compound is estimated the thermal hyperalgesia of animal more predetermined detection time in the test owner.Specifically, the vola of the rear solid end of thermal stimulus animal was detected to the potential time of withdrawal behavior (for example licking pawl or vibration pawl).
The test of (test implementation example 5) cooling table
In the present invention, cold unusual pain mouse and rat occurring is used for estimating.
Method (Behavioural Pharmacology 19,85-90,2008) according to people such as Tanimoto-Mori is carried out the evaluation of cold unusual pain.Specifically, animal is placed on the low-temperature metal platform, and detect the time length of lifting the potential time of rear solid end behavior and lifting the pawl behavior to observable.
(test implementation example 5) acetate inductive mouse twisting test
Orally give mouse test compounds, in test owner predetermined detection time again intraperitoneal give mouse 0.6% acetate.Count the sum of (giving back 5 minutes to 15 minutes thereafter) interior twisting behavior in 10 minutes by intraperitoneal.
The test of (test implementation example 6) adjuvant inductive rat arthritis pain
By using agate mortar to grind heat-inactivated butyric acid mycobacterium (Mycobacteriumbutyricum) bacterial cell, then with powder suspension in the whiteruss of dry sterilization, ultrasonic afterwards, the preparation adjuvant.
The right back pawl of rat is gone in this adjuvant (with regard to the amount of heat-inactivated bacterial cell, 100 μ g/0.05mL/ pawls) intradermal injection, to induce sacroiliitis.Handle the back the 18th day at adjuvant, carry out the pain test.Specifically, orally give animal testing compound.In crooked their tarsometatarsal joint (tarsotibial joint) 5 times test owner predetermined detection time, and record sounding number of times (0-5) is a pain scores.
(test implementation example 7) electric inductive spasm test
Orally give mouse test compounds.Use electrical stimulation device and the two poles of the earth electrode in the cornea of their two eyes of predetermined electricity irritation detection time of test owner (60Hz, 50mA, 0.2 second), the existence of the TE of observation and record rear solid end or do not exist.
The test of (test implementation example 8) Yetrazol inductive spasm
Orally give mouse test compounds is in the subcutaneous again mouse Yetrazol solution (85mg/10ml/kg,, be dissolved in the salt solution) that gives test owner predetermined detection time.Observation is also write down the existence of clonic spasm in 30 minutes or is not existed.
(test implementation example 9)
In addition, effect of the present invention can confirm according to the method evaluation that the homepage of following NIH (NIH) is described:
NIH HP: antiepileptic drug development (ADD) plan
(http://www.ninds.nih.gov./funding/research/asp/addadd_review.pdf)
Industrial usability
Active component in compound of the present invention or its pharmaceutically acceptable salt useful as drug composition is used for the treatment of and/or pre-pain or obstacle, for example relates to pain or the obstacle of central nervous system.
The free text of sequence table
SEQ ID NO:1: preceding half segmental PCR of people Cacna2d1 has adopted primer.
SEQ ID NO:2: preceding half segmental PCR antisense primer of people Cacna2d1.
SEQ ID NO:3: back half segmental PCR antisense primer of people Cacna2d1.
SEQ ID NO:4: back half segmental PCR antisense primer of people Cacna2d1.
SEQ ID NO:5: the multiple clone site of carrier pBluescript 2.
Sequence table
＜110〉Sankyo Co.
 
＜120〉dicyclo γ amino acid derivative
 
<130>DSPCT-FP0834
 
<150>JP2007-255430
<151>2007-09-28
 
<160>7
 
<170>PatentIn?version?3.4
 
<210>1
<211>42
<212>DNA
＜213〉artificial sequence
 
<220>
＜223〉at people Cacna2d1 forward PCR adopted primer is arranged
 
<400>1
agctgcggcc?gctagcgcca?ccatggctgg?ctgcctgctg?gc????????????????????????42
 
<210>2
<211>27
<212>DNA
＜213〉artificial sequence
 
<220>
＜223〉at people Cacna2d1 forward PCR antisense primer
 
<400>2
at?taggatcg?at?tgcaaagt?aataccc???????????????????????????????????????27
 
<210>3
<211>26
<212>DNA
＜213〉artificial sequence
 
<220>
＜223〉PCR at people Cacna2d1 rear portion has adopted primer
 
<400>3
aatgggtatt?actttgcaat?cgatcc??????????????????????????????????????????26
 
<210>4
<211>32
<212>DNA
＜213〉artificial sequence
 
<220>
＜223〉at the PCR antisense primer at people Cacna2d1 rear portion
 
<400>4
agtcggatcc?tcataacagc?cggtgtgtgc?tg???????????????????????????????????32
 
<210>5
<211>98
<212>DNA
＜213〉artificial sequence
 
<220>
＜223〉multiple clone site of carrier pBluescript 2
 
<400>5
ccaccgcggt?ggcggccgct?ctagaactag?tggatccccc?gggctgcagg?aattcgatat?????60
caagcttatc?gataccgtcg?acctcgaggg?ggggcccg?????????????????????????????98
 
<210>6
<211>1573
<212>DNA
＜213〉people
 
<400>6
ggcggccgct?agcgccacca?tggctgctgg?ctgcctgctg?gccttgactc?tgacactttt?????60
ccaatctttg?ctcatcggcc?cctcgtcgga?ggagccgttc?ccttcggccg?tcactatcaa????120
atcatgggtg?gataagatgc?aagaagacct?tgtcacactg?gcaaaaacag?caagtggagt????180
caatcagctt?gttgatattt?atgagaaata?tcaagatttg?tatactgtgg?aaccaaataa????240
tgcacgccag?ctggtagaaa?ttgcagccag?ggatattgag?aaacttctga?gcaacagatc????300
taaagccctg?gtgcgcctgg?cattggaagc?ggagaaagtt?caagcagctc?accagtggag????360
agaagatttt?gcaagcaatg?aagttgtcta?ctacaatgca?aaggatgatc?tcgatcctga????420
gaaaaatgac?agtgagccag?gcagccagag?gataaaacct?gttttcattg?aagatgctaa????480
ttttggacga?caaatatctt?atcagcacgc?agcagtccat?attcctactg?acatctatga????540
gggctcaaca?attgtgttaa?atgaactcaa?ctggacaagt?gccttagatg?aagttttcaa????600
aaagaatcgc?gaggaagacc?cttcattatt?gtggcaggtt?tttggcagtg?ccactggcct????660
agctcgatat?tatccagctt?caccatgggt?tgataatagt?agaactccaa?ataagattga????720
cctttatgat?gtacgcagaa?gaccatggta?catccaagga?gctgcatctc?ctaaagacat????780
gcttattctg?gtggatgtga?gtggaagtgt?tagtggattg?acacttaaac?tgatccgaac????840
atctgtctcc?gaaatgttag?aaaccctctc?agatgatgat?ttcgtgaatg?tagcttcatt????900
taacagcaat?gctcaggatg?taagctgttt?tcagcacctt?gtccaagcaa?atgtaagaaa????960
taaaaaagtg?ttgaaagacg?cggtgaataa?tatcacagcc?aaaggaatta?cagattataa???1020
gaagggcttt?agttttgctt?ttgaacagct?gcttaattat?aatgtttcca?gagcaaactg???1080
caataagatt?attatgctat?tcacggatgg?aggagaagag?agagcccagg?agatatttaa???1140
caaatacaat?aaagataaaa?aagtacgtgt?attcacgttt?tcagttggtc?aacacaatta???1200
tgacagagga?cctattcagt?ggatggcctg?tgaaaacaaa?ggttattatt?atgaaattcc???1260
ttccattggt?gcaataagaa?tcaatactca?ggaatatttg?gatgttttgg?gaagaccaat????1320
ggttttagca?ggagacaaag?ctaagcaagt?ccaatggaca?aatgtgtacc?tggatgcatt????1380
ggaactggga?cttgtcatta?ctggaactct?tccggtcttc?aacataaccg?gccaatttga????1440
aaataagaca?aacttaaaga?accagctgat?tcttggtgtg?atgggagtag?atgtgtcttt????1500
ggaagatatt?aaaagactga?caccacgttt?tacactgtgc?cccaatgggt?attactttgc????1560
aatcgatcct?aat???????????????????????????????????????????????????????1573
 
<210>7
<211>3301
<212>DNA
＜213〉people
 
<400>7
ggcggccgct?agcgccacca?tggctgctgg?ctgcctgctg?gccttgactc?tgacactttt?????60
ccaatctttg?ctcatcggcc?cctcgtcgga?ggagccgttc?ccttcggccg?tcactatcaa????120
atcatgggtg?gataagatgc?aagaagacct?tgtcacactg?gcaaaaacag?caagtggagt????180
caatcagctt?gttgatattt?atgagaaata?tcaagatttg?tatactgtgg?aaccaaataa????240
tgcacgccag?ctggtagaaa?ttgcagccag?ggatattgag?aaacttctga?gcaacagatc????300
taaagccctg?gtgcgcctgg?cattggaagc?ggagaaagtt?caagcagctc?accagtggag????360
agaagatttt?gcaagcaatg?aagttgtcta?ctacaatgca?aaggatgatc?tcgatcctga????420
gaaaaatgac?agtgagccag?gcagccagag?gataaaacct?gttttcattg?aagatgctaa????480
ttttggacga?caaatatctt?atcagcacgc?agcagtccat?attcctactg?acatctatga????540
gggctcaaca?attgtgttaa?atgaactcaa?ctggacaagt?gccttagatg?aagttttcaa????600
aaagaatcgc?gaggaagacc?cttcattatt?gtggcaggtt?tttggcagtg?ccactggcct????660
agctcgatat?tatccagctt?caccatgggt?tgataatagt?agaactccaa?ataagattga????720
cctttatgat?gtacgcagaa?gaccatggta?catccaagga?gctgcatctc?ctaaagacat????780
gcttattctg?gtggatgtga?gtggaagtgt?tagtggattg?acacttaaac?tgatccgaac????840
atctgtctcc?gaaatgttag?aaaccctctc?agatgatgat?ttcgtgaatg?tagcttcatt????900
taacagcaat?gctcaggatg?taagctgttt?tcagcacctt?gtccaagcaa?atgtaagaaa????960
taaaaaagtg?ttgaaagacg?cggtgaataa?tatcacagcc?aaaggaatta?cagattataa???1020
gaagggcttt?agttttgctt?ttgaacagct?gcttaattat?aatgtttcca?gagcaaactg???1080
caataagatt?attatgctat?tcacggatgg?aggagaagag?agagcccagg?agatatttaa???1140
caaatacaat?aaagataaaa?aagtacgtgt?attcacgttt?tcagttggtc?aacacaatta???1200
tgacagagga?cctattcagt?ggatggcctg?tgaaaacaaa?ggttattatt?atgaaattcc???1260
ttccattggt?gcaataagaa?tcaatactca?ggaatatttg?gatgttttgg?gaagaccaat???1320
ggttttagca?ggagacaaag?ctaagcaagt?ccaatggaca?aatgtgtacc?tggatgcatt???1380
ggaactggga?cttgtcatta?ctggaactct?tccggtcttc?aacataaccg?gccaatttga???1440
aaataagaca?aacttaaaga?accagctgat?tcttggtgtg?atgggagtag?atgtgtcttt???1500
ggaagatatt?aaaagactga?caccacgttt?tacactgtgc?cccaatgggt?attactttgc???1560
aatcgatcct?aatggttatg?ttttattaca?tccaaatctt?cagccaaaga?accccaaatc???1620
tcaggagcca?gtaacattgg?atttccttga?tgcagagtta?gagaatgata?ttaaagtgga???1680
gattcgaaat?aagatgattg?atggggaaag?tggagaaaaa?acattcagaa?ctctggttaa???1740
atctcaagat?gagagatata?ttgacaaagg?aaacaggaca?tacacatgga?cacctgtcaa???1800
tggcacagat?tacagtttgg?ccttggtatt?accaacctac?agtttttact?atataaaagc???1860
caaactagaa?gagacaataa?ctcaggccag?atcaaaaaag?ggcaaaatga?aggattcgga???1920
aaccctgaag?ccagataatt?ttgaagaatc?tggctataca?ttcatagcac?caagagatta???1980
ctgcaatgac?ctgaaaatat?cggataataa?cactgaattt?cttttaaatt?tcaacgagtt???2040
tattgataga?aaaactccaa?acaacccatc?atgtaacgcg?gatttgatta?atagagtctt???2100
gcttgatgca?ggctttacaa?atgaacttgt?ccaaaattac?tggagtaagc?agaaaaatat???2160
caagggagtg?aaagcacgat?ttgttgtgac?tgatggtggg?attaccagag?tttatcccaa???2220
agaggctgga?gaaaattggc?aagaaaaccc?agagacatat?gaggacagct?tctataaaag???2280
gagcctagat?aatgataact?atgttttcac?tgctccctac?tttaacaaaa?gtggacctgg???2340
tgcctatgaa?tcgggcatta?tggtaagcaa?agctgtagaa?atatatattc?aagggaaact???2400
tcttaaacct?gcagttgttg?gaattaaaat?tgatgtaaat?tcctggatag?agaatttcac???2460
caaaacctca?atcagagatc?cgtgtgctgg?tccagtttgt?gactgcaaaa?gaaacagtga???2520
cgtaatggat?tgtgtgattc?tggatgatgg?tgggtttctt?ctgatggcaa?atcatgatga???2580
ttatactaat?cagattggaa?gattttttgg?agagattgat?cccagcttga?tgagacacct???2640
ggttaatata?tcagtttatg?cttttaacaa?atcttatgat?tatcagtcag?tatgtgagcc???2700
cggtgctgca?ccaaaacaag?gagcaggaca?tcgctcagca?tatgtgccat?cagtagcaga???2760
catattacaa?attggctggt?gggccactgc?tgctgcctgg?tctattctac?agcagtttct???2820
cttgagtttg?acctttccac?gactccttga?ggcagttgag?atggaggatg?atgacttcac???2880
ggcctccctg?tccaagcaga?gctgcattac?tgaacaaacc?cagtatttct?tcgataacga???2940
cagtaaatca?ttcagtggtg?tattagactg?tggaaactgt?tccagaatct?ttcatggaga???3000
aaagcttatg?aacaccaact?taatattcat?aatggttgag?agcaaaggga?catgtccatg???3060
tgacacacga?ctgctcatac?aagcggagca?gacttctgac?ggtccaaatc?cttgtgacat???3120
ggttaagcaa?cccagatacc?gaaaagggcc?tgatgtctgc?tttgataaca?atgtcttgga???3180
ggattatact?gactgtggtg?gtgtttctgg?attaaatccc?tccctgtggt?atatcattgg???3240
aatccagttt?ctactacttt?ggctggtatc?tggcagcaca?caccggctgt?tatgaggatc???3300
c???????????????????????????????????????????????????????????????????3301

Claims (27)

1. compound or its pharmacy acceptable salt by following general formula (I) representative:
Figure FPA00001143598000011
Wherein
R 1, R 2, R 2 ', R 4, R 5, R 6, R 7, R 8And R 8 'Independent separately is hydrogen atom, halogen atom or C1-C6 alkyl, perhaps R 2And R 2 'Form the C3-C7 cycloalkyl with their bonded carbon atoms; With
R 3Be hydrogen atom, halogen atom, C1-C6 alkyl, C1-C6 alkylogen group, hydroxyl-C1-C6 alkyl, sulfane base-C1-C6 alkyl, C1-C6 alkoxy-C 1-C6 alkyl, C2-C6 thiazolinyl, C2-C6 alkynyl, C1-C6 alkoxyl group, C1-C6 alkyl alkylthio base, C1-C6 alkyl alkylthio base-C1-C6 alkyl, C2-C7 acyl group sulfo--C1-C6 alkyl, C2-C7 acyloxy-C1-C6 alkyl or C3-C7 cycloalkyl.
2. the compound of claim 1 or its pharmacy acceptable salt, wherein R 1Be hydrogen atom.
3. claim 1 or 2 compound or its pharmacy acceptable salt, wherein R 2And R 2 'It all is hydrogen atom.
4. each compound or its pharmacy acceptable salt, wherein R in the claim 1 to 3 3Be hydrogen atom or C1-C6 alkyl.
5. the compound of claim 4 or its pharmacy acceptable salt, wherein R 3Be hydrogen atom, methyl, ethyl, propyl group or butyl.
6. the compound of claim 5 or its pharmacy acceptable salt, wherein R 3Be hydrogen atom or ethyl.
7. each compound or its pharmacy acceptable salt, wherein R in the claim 1 to 6 4Be hydrogen atom.
8. each compound or its pharmacy acceptable salt, wherein R in the claim 1 to 7 5Be hydrogen atom.
9. each compound or its pharmacy acceptable salt, wherein R in the claim 1 to 8 6Be hydrogen atom.
10. each compound or its pharmacy acceptable salt, wherein R in the claim 1 to 9 7Be hydrogen atom.
11. each compound or its pharmacy acceptable salt, wherein R in the claim 1 to 10 8And R 8 'Be hydrogen atom.
12. the pharmacy acceptable salt of each compound in the claim 1 to 11, wherein said pharmacy acceptable salt are hydrochloride, benzene sulfonate or tosilate.
13. compound or its pharmacy acceptable salt by following general formula (Ia) representative:
Figure FPA00001143598000021
Wherein
R 1, R 2, R 2 ', R 4, R 5, R 6, R 7, R 8And R 8 'Independent separately is hydrogen atom, halogen atom or C1-C6 alkyl, perhaps R 2And R 2 'Form the C3-C7 cycloalkyl with their bonded carbon atoms; With
R 3Be hydrogen atom, halogen atom, C1-C6 alkyl, C1-C6 alkylogen group, hydroxyl-C1-C6 alkyl, sulfane base-C1-C6 alkyl, C1-C6 alkoxy-C 1-C6 alkyl, C2-C6 thiazolinyl, C2-C6 alkynyl, C1-C6 alkoxyl group, C1-C6 alkyl alkylthio base, C1-C6 alkyl alkylthio base-C1-C6 alkyl, C2-C7 acyl group sulfo--C1-C6 alkyl, C2-C7 acyloxy-C1-C6 alkyl or C3-C7 cycloalkyl.
14. compound or its pharmacy acceptable salt by following general formula (Ib) representative:
Figure FPA00001143598000031
Wherein
R 1, R 2, R 2 ', R 4, R 5, R 6, R 7, R 8And R 8 'Independent separately is hydrogen atom, halogen atom or C1-C6 alkyl, perhaps R 2And R 2 'Form the C3-C7 cycloalkyl with their bonded carbon atoms; With
R 3Be hydrogen atom, halogen atom, C1-C6 alkyl, C1-C6 alkylogen group, hydroxyl-C1-C6 alkyl, sulfane base-C1-C6 alkyl, C1-C6 alkoxy-C 1-C6 alkyl, C2-C6 thiazolinyl, C2-C6 alkynyl, C1-C6 alkoxyl group, C1-C6 alkyl alkylthio base, C1-C6 alkyl alkylthio base-C1-C6 alkyl, C2-C7 acyl group sulfo--C1-C6 alkyl, C2-C7 acyloxy-C1-C6 alkyl or C3-C7 cycloalkyl.
15. compound or its pharmacy acceptable salt by following general formula (II) representative:
Figure FPA00001143598000032
Wherein
R 3Be hydrogen atom, halogen atom, C1-C6 alkyl, C1-C6 alkylogen group, hydroxyl-C1-C6 alkyl, sulfane base-C1-C6 alkyl, C1-C6 alkoxy-C 1-C6 alkyl, C2-C6 thiazolinyl, C2-C6 alkynyl, C1-C6 alkoxyl group, C1-C6 alkyl alkylthio base, C1-C6 alkyl alkylthio base-C1-C6 alkyl, C2-C7 acyl group sulfo--C1-C6 alkyl, C2-C7 acyloxy-C1-C6 alkyl or C3-C7 cycloalkyl.
16. a compound, described compound is selected from:
(±)-[(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
(±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-methyl bicycle [3.2.0] heptan-3-alkene-6-yl] acetate;
(±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
(±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-propyl group dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
(±)-[(1S, 5R, 6R)-the 6-amino methyl-and 3-butyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
[(1R, 5S, 6S)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
[(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
[(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] acetic acid hydrochloride;
[(1S, 5R, 6R)-and 6-(amino methyl) dicyclo [3.2.0] heptan-3-alkene-6-yl] the acetate benzene sulfonate;
[(1R, 5S, 6S)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate;
[(1R, 5S, 6S)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] the acetate tosilate;
[(1R, 5S, 6S)-6-(amino methyl)-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] the acetate benzene sulfonate; With
[(1S, 5R, 6R)-the 6-amino methyl-and 3-ethyl dicyclo [3.2.0] heptan-3-alkene-6-yl] acetate.
17. a pharmaceutical composition, described pharmaceutical composition comprise in the claim 1 to 16 each compound or its pharmacy acceptable salt as activeconstituents.
18. the pharmaceutical composition of claim 17, described pharmaceutical composition is used for the treatment of and/or prevent irritation.
19. the pharmaceutical composition of claim 17, described pharmaceutical composition are used for the treatment of and/or prevent to be selected from following disease: acute pain, chronic pain, the pain that causes by soft tissue injury or peripheral damage, postherpetic neuralgia, occipital neuralgia, trigeminal neuralgia, myelomere neurodynia or intercostal neuralgia, central pain, neuropathic pain, migraine, the pain relevant with osteoarthritis or rheumatic arthritis, with contusion, sprain or pain that wound is relevant, spondylalgia, injure the pain that causes by spinal cord or brain stem, back pain, sciatica, toothache, myofasical pain syndrome, episiotomy pain, gouty pain, the pain that causes by burn, heart pain, myalgia, ocular pain, inflammatory pain, actinal surface pain, abdominal pain, the pain relevant with dysmenorrhoea, labor pains or endometriosis, somatalgia, with nerve or the relevant pain of nerve root injury, the pain relevant with amputation, trigeminal neuralgia, neuroma or vasculitis, the pain (or diabetic peripheral neuralgia) that causes by diabetic neuropathy, the pain that causes by chemotherapy inductive DPN, the atypia prosoponeuralgia, lower back neurodynia, trigeminal neuralgia, occipital neuralgia, myelomere neurodynia or intercostal neuralgia, the neurodynia relevant with HIV, the neurodynia relevant with AIDS, hyperpathia, burn pain, sudden pain, the pain that causes by chemotherapy, occipital neuralgia, psychogenic pain, the pain relevant with cholelith, neurodynia relevant or non-neurodynia with cancer, phantom limb pain, functional abdominal pain, headache, acute or chronic tension headache, sinus headache, cluster headache, temporomandibular arthralgia, maxillary sinus pain, the pain that causes by stiff property arthritis vertebralis, postoperative pain, scar pain, chronic non-neurodynia, fibromyalgia, amyotrophic lateral sclerosis, epilepsy (part epilepsy, adult's partial seizure and epileptic's partial seizure), generalized anxiety disorder and restless leg syndrome.
20. the pain that the pharmaceutical composition of claim 17, described pharmaceutical composition are used for the treatment of and/or prevent to be caused by diabetic neuropathy.
21. the purposes that each compound or its pharmacy acceptable salt are used to produce pharmaceutical composition in the claim 1 to 16.
22. the purposes of claim 21, wherein said pharmaceutical composition are to be used for the treatment of and/or the composition of prevent irritation.
23. the purposes of claim 21, wherein said pharmaceutical composition are to be used for the treatment of and/or the composition of the pain preventing to be caused by diabetic neuropathy.
24. a method that treats and/or prevents pain, described method comprise in the claim 1 to 16 that gives significant quantity on the Mammals pharmacology each compound or its pharmacy acceptable salt.
25. the method for claim 24, wherein said pain are the pain that diabetic neuropathy causes.
26. the method for claim 24 or 25, wherein said Mammals is behaved.
27. compound by following general formula (III) representative:
Wherein
R 1a, R 2a, R 2a ', R 4a, R 5a, R 8aAnd R 8a 'Independent separately is hydrogen atom, halogen atom or C1-C6 alkyl, perhaps R 2aAnd R 2a 'Form the C3-C7 cycloalkyl with their bonded carbon atoms; With
R 3aBe hydrogen atom, halogen atom, C1-C6 alkyl, C1-C6 alkylogen group, hydroxyl-C1-C6 alkyl, sulfane base-C1-C6 alkyl, C1-C6 alkoxy-C 1-C6 alkyl, C2-C6 thiazolinyl, C2-C6 alkynyl, C1-C6 alkoxyl group, C1-C6 alkyl alkylthio base, C1-C6 alkyl alkylthio base-C1-C6 alkyl, C2-C7 acyl group sulfo--C1-C6 alkyl, C2-C7 acyloxy-C1-C6 alkyl or C3-C7 cycloalkyl.
CN200880118892.8A 2007-09-28 2008-09-25 Bicyclic gamma-amino acid derivative Active CN101878193B (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
JP2007-255430 2007-09-28
JP2007255430 2007-09-28
PCT/JP2008/067223 WO2009041453A1 (en) 2007-09-28 2008-09-25 Bicyclic γ-amino acid derivative

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN201310389454.8A Division CN103483169A (en) 2007-09-28 2008-09-25 Bicyclic gamma-amino acid derivative

Publications (2)

Publication Number Publication Date
CN101878193A true CN101878193A (en) 2010-11-03
CN101878193B CN101878193B (en) 2014-07-09

Family

ID=40511336

Family Applications (2)

Application Number Title Priority Date Filing Date
CN200880118892.8A Active CN101878193B (en) 2007-09-28 2008-09-25 Bicyclic gamma-amino acid derivative
CN201310389454.8A Pending CN103483169A (en) 2007-09-28 2008-09-25 Bicyclic gamma-amino acid derivative

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201310389454.8A Pending CN103483169A (en) 2007-09-28 2008-09-25 Bicyclic gamma-amino acid derivative

Country Status (26)

Country Link
US (1) US7947738B2 (en)
EP (2) EP2657219B1 (en)
JP (1) JP4479974B2 (en)
KR (2) KR101409079B1 (en)
CN (2) CN101878193B (en)
AU (1) AU2008304933B2 (en)
BR (2) BR122013020635A2 (en)
CA (1) CA2701110C (en)
CO (1) CO6270314A2 (en)
CY (1) CY1114836T1 (en)
DK (1) DK2192109T3 (en)
ES (2) ES2433890T3 (en)
HK (2) HK1139381A1 (en)
HR (1) HRP20130935T1 (en)
IL (1) IL204621A (en)
MX (1) MX2010003394A (en)
MY (2) MY153910A (en)
NZ (1) NZ584699A (en)
PH (1) PH12013501663A1 (en)
PL (1) PL2192109T3 (en)
PT (1) PT2192109E (en)
RU (1) RU2446148C2 (en)
SI (1) SI2192109T1 (en)
TW (2) TWI526425B (en)
WO (1) WO2009041453A1 (en)
ZA (1) ZA201002013B (en)

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103582622A (en) * 2011-06-08 2014-02-12 第一三共株式会社 Method for producing bicyclic compound via iminium salt
CN103987687A (en) * 2011-12-15 2014-08-13 第一三共株式会社 Optical resolution method for bicyclic compound using asymmetric catalyst
CN104334169A (en) * 2013-04-04 2015-02-04 第一三共株式会社 Solid composition of amino carboxylate salt
CN104755456A (en) * 2013-07-08 2015-07-01 第一三共株式会社 Method for producing optically active bicyclic [gamma]-amino acid derivative
CN105899495A (en) * 2013-12-18 2016-08-24 诺瓦色生物公司 Gamma-aminobutyric acid (GABA) analogues for the treatment of pain and other disorders
WO2017107907A1 (en) * 2015-12-25 2017-06-29 四川海思科制药有限公司 Condensed ring γ-amino acid derivative and preparation method and medical use thereof
WO2017114225A1 (en) * 2015-12-31 2017-07-06 四川海思科制药有限公司 Fused tricyclic γ-amino acid derivative and preparation method and pharmaceutical application thereof
CN106928081A (en) * 2015-12-31 2017-07-07 四川海思科制药有限公司 Fused rings γ amino acid derivativges and preparation method thereof and in application pharmaceutically
WO2018050046A1 (en) * 2016-09-14 2018-03-22 四川海思科制药有限公司 Fused tricyclic γ-amino acid derivative, preparation method therefor, and medical use thereof
CN110511141A (en) * 2019-09-09 2019-11-29 上海凌凯医药科技有限公司 A kind of synthetic method of apronal
WO2020011258A1 (en) * 2018-07-12 2020-01-16 四川海思科制药有限公司 Crystal form of salt of fused tricyclic γ-amino acid derivative and preparation and use thereof
WO2020029762A1 (en) * 2018-08-09 2020-02-13 四川海思科制药有限公司 PREPARATION METHOD FOR FUSED TRICYCLIC γ-AMINO ACID DERIVATIVE AND INTERMEDIATE THEREOF
US10561628B2 (en) 2015-03-19 2020-02-18 Daiichi Sankyo Company, Limited Solid preparation including antioxidant
CN110818582A (en) * 2019-11-20 2020-02-21 合肥拓锐生物科技有限公司 GABA analogue and salt thereof, and synthesis method, application and medicament thereof
US10603285B2 (en) 2015-03-19 2020-03-31 Daiichi Sankyo Company, Limited Solid preparation including colorant
CN111116345A (en) * 2019-12-30 2020-05-08 上海华理生物医药股份有限公司 Novel method for preparing Mirogabalin
WO2021043117A1 (en) * 2019-09-03 2021-03-11 四川海思科制药有限公司 Impurity detection method for 2-((1s,2s,3r,6s,8s)-2-(aminomethyl)tricyclo[4.2.1.0 3,8]nonane-2-yl)acetate benzenesulfonate or composition thereof
CN114195661A (en) * 2021-12-21 2022-03-18 苏州楚凯药业有限公司 Preparation method of milobalin besylate
CN114599397A (en) * 2019-10-25 2022-06-07 国立大学法人京都大学 Preventive or therapeutic agent for tauopathy
CN116903468A (en) * 2023-07-14 2023-10-20 山东新时代药业有限公司 Preparation method of milbelin intermediate
CN117800858A (en) * 2023-12-28 2024-04-02 南京津泓科技有限公司 Preparation method for catalytic cyanation of milbelin
WO2024093678A1 (en) * 2022-11-03 2024-05-10 中科中山药物创新研究院 Gamma-aminobutyric acid derivative comprising polycyclic structure, method for preparing same, and use thereof
US12083226B2 (en) 2018-07-30 2024-09-10 Daiichi Sankyo Company, Limited Stabilizer-containing solid drug formulation

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX2010003394A (en) 2007-09-28 2010-04-09 Daiichi Sankyo Co Ltd Bicyclic ?“-amino acid derivative.
WO2010079668A1 (en) * 2009-01-08 2010-07-15 第一三共株式会社 Olefin compound
ES2635354T3 (en) * 2009-03-26 2017-10-03 Daiichi Sankyo Company, Limited Production procedure of a bicyclic gamma-amino acid derivative
WO2012169475A1 (en) * 2011-06-08 2012-12-13 第一三共株式会社 Method for producing bicyclic compound via claisen rearrangement
WO2013089189A1 (en) * 2011-12-16 2013-06-20 第一三共株式会社 Optical resolution method for bicyclic compound using hydroxysulfonic acid
EP2813513B1 (en) * 2012-02-08 2019-07-03 Stella Pharma Corporation Method for producing cereulide and derivative thereof, intermediate for production of cereulide, and cereulide derivative
ES2624314T3 (en) * 2012-04-10 2017-07-13 Daiichi Sankyo Company, Limited Optical resolution procedure for bicyclic compounds using enzyme
WO2017183539A1 (en) * 2016-04-18 2017-10-26 第一三共株式会社 Method for producing bicyclic compound using meldrum's acid
TW201806928A (en) * 2016-07-01 2018-03-01 第一三共股份有限公司 Crystals of aminocarboxylic acid acid addition salts and the synthetic method thereof
US10800765B2 (en) * 2016-07-21 2020-10-13 Chia Tai Tianqing Pharmaceutical Group Co., Ltd. Indole derivative used as CRTH2 inhibitor
JP7051332B2 (en) * 2017-08-23 2022-04-11 キヤノン株式会社 Organic compounds and photoelectric conversion elements
CA3106382C (en) * 2018-07-12 2023-11-07 Sichuan Haisco Pharmaceutical Co., Ltd. Composition of fused tricyclic gamma-amino acid derivatives and the preparation thereof
WO2022238335A1 (en) 2021-05-12 2022-11-17 Boehringer Ingelheim International Gmbh Pyridine derivatives with c-linked cyclic substituents as cgas inhibitors
CN118420477A (en) * 2024-07-01 2024-08-02 中节能万润股份有限公司 Preparation method of milobalin benzenesulfonate

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040116525A1 (en) * 2002-04-10 2004-06-17 Derrick Andrew Michael Cyclic nitromethyl acetic acid derivatives
CN1720219A (en) * 2001-04-19 2006-01-11 沃纳-兰伯特公司 Fused bicyclic or tricyclic amino acids

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19547766A1 (en) * 1995-12-20 1997-06-26 Gruenenthal Gmbh 1-phenyl-2-dimethylaminomethyl-cyclohexan-1-ol compounds as active pharmaceutical ingredients
BR9813284B1 (en) 1997-10-27 2012-08-21 cyclic amino acids and derivatives thereof useful as pharmaceutical agents and pharmaceutical composition.
HN2000000224A (en) 1999-10-20 2001-04-11 Warner Lambert Co BICYCLE AMINO ACIDS AS PHARMACEUTICAL AGENTS
BR0208922A (en) * 2001-04-19 2004-04-20 Warner Lambert Co Fused Bicyclic or Tricyclic Amino Acids
CA2492022A1 (en) 2002-07-11 2004-01-22 Merck & Co., Inc. Treatment of neuropathic pain with 6h-pyrrolo[3,4-d]pyridazine compounds
US8168181B2 (en) * 2006-02-13 2012-05-01 Alethia Biotherapeutics, Inc. Methods of impairing osteoclast differentiation using antibodies that bind siglec-15
MX2010003394A (en) 2007-09-28 2010-04-09 Daiichi Sankyo Co Ltd Bicyclic ?“-amino acid derivative.

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1720219A (en) * 2001-04-19 2006-01-11 沃纳-兰伯特公司 Fused bicyclic or tricyclic amino acids
US20040116525A1 (en) * 2002-04-10 2004-06-17 Derrick Andrew Michael Cyclic nitromethyl acetic acid derivatives

Cited By (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103582622A (en) * 2011-06-08 2014-02-12 第一三共株式会社 Method for producing bicyclic compound via iminium salt
CN103582622B (en) * 2011-06-08 2015-06-10 第一三共株式会社 Method for producing bicyclic compound via iminium salt
CN103987687B (en) * 2011-12-15 2015-12-02 第一三共株式会社 Use the method for optical resolution of the dicyclic compound of asymmetric catalyst
CN103987687A (en) * 2011-12-15 2014-08-13 第一三共株式会社 Optical resolution method for bicyclic compound using asymmetric catalyst
TWI645863B (en) * 2013-04-04 2019-01-01 日商第一三共股份有限公司 Solid composition of a salt of an aminocarboxylic acid
CN104334169B (en) * 2013-04-04 2016-11-02 第一三共株式会社 Comprise the solid composite of aminocarboxylate
US9675570B2 (en) 2013-04-04 2017-06-13 Daiichi Sanky Company, Limited Solid compositions comprising a salt of aminocarboxylic acid
CN104334169A (en) * 2013-04-04 2015-02-04 第一三共株式会社 Solid composition of amino carboxylate salt
CN104755456B (en) * 2013-07-08 2016-10-12 第一三共株式会社 The preparation method of optically active bicyclo-gamma-amino acid derivative
TWI635071B (en) * 2013-07-08 2018-09-11 第一三共股份有限公司 OPTICALLY ACTIVE BICYCLIC γ-AMINO ACID AND PREPARATION METHOD FOR THE SAME
CN104755456A (en) * 2013-07-08 2015-07-01 第一三共株式会社 Method for producing optically active bicyclic [gamma]-amino acid derivative
CN105899495B (en) * 2013-12-18 2019-02-19 诺瓦色生物公司 For treating γ-aminobutyric acid (GABA) analog of pain and other illnesss
CN105899495A (en) * 2013-12-18 2016-08-24 诺瓦色生物公司 Gamma-aminobutyric acid (GABA) analogues for the treatment of pain and other disorders
CN109721562A (en) * 2013-12-18 2019-05-07 诺瓦色生物公司 For treating γ-aminobutyric acid (GABA) analog of pain and other illnesss
US10561628B2 (en) 2015-03-19 2020-02-18 Daiichi Sankyo Company, Limited Solid preparation including antioxidant
US10603285B2 (en) 2015-03-19 2020-03-31 Daiichi Sankyo Company, Limited Solid preparation including colorant
CN107848953A (en) * 2015-12-25 2018-03-27 四川海思科制药有限公司 Fused rings γ amino acid derivativges and preparation method thereof and application in medicine
CN107848953B (en) * 2015-12-25 2021-05-18 四川海思科制药有限公司 Fused ring gamma-amino acid derivative, preparation method and application thereof in medicine
WO2017107907A1 (en) * 2015-12-25 2017-06-29 四川海思科制药有限公司 Condensed ring γ-amino acid derivative and preparation method and medical use thereof
CN106928081A (en) * 2015-12-31 2017-07-07 四川海思科制药有限公司 Fused rings γ amino acid derivativges and preparation method thereof and in application pharmaceutically
CN106928080A (en) * 2015-12-31 2017-07-07 四川海思科制药有限公司 Fused rings γ amino acid derivativges and preparation method thereof and in application pharmaceutically
CN107848952B (en) * 2015-12-31 2021-04-09 四川海思科制药有限公司 Fused tricyclic gamma-amino acid derivative, preparation method and application thereof in medicine
TWI662019B (en) * 2015-12-31 2019-06-11 大陸商四川海思科製藥有限公司 Fused tricyclic γ-amino acid derivative, preparation method and application thereof in medicine
WO2017114225A1 (en) * 2015-12-31 2017-07-06 四川海思科制药有限公司 Fused tricyclic γ-amino acid derivative and preparation method and pharmaceutical application thereof
CN106928080B (en) * 2015-12-31 2020-12-25 四川海思科制药有限公司 Fused ring gamma-amino acid derivative, preparation method and application thereof in medicine
CN107848952A (en) * 2015-12-31 2018-03-27 四川海思科制药有限公司 Fused tricyclic γ amino acid derivativges and preparation method thereof and application in medicine
CN106928081B (en) * 2015-12-31 2020-12-15 四川海思科制药有限公司 Fused ring gamma-amino acid derivative, preparation method and application thereof in medicine
EA036525B1 (en) * 2016-09-14 2020-11-19 Сычуань Хайско Фармасьютикал Ко., Лтд. Fused tricyclic -amino acid derivative, preparation method therefor, and medical use thereof
CN109195945B (en) * 2016-09-14 2022-02-25 四川海思科制药有限公司 Fused tricyclic gamma-amino acid derivative, preparation method and application thereof in medicine
US10654794B2 (en) 2016-09-14 2020-05-19 Sichuan Haiso Pharmaceutical Co., Ltd. Fused tricyclic Γ-amino acid derivative, preparation method therefor, and medical use thereof
CN109195945A (en) * 2016-09-14 2019-01-11 四川海思科制药有限公司 Fused tricyclic gamma-amino acid derivative and preparation method thereof and application in medicine
WO2018050046A1 (en) * 2016-09-14 2018-03-22 四川海思科制药有限公司 Fused tricyclic γ-amino acid derivative, preparation method therefor, and medical use thereof
CN111918859B (en) * 2018-07-12 2023-06-30 四川海思科制药有限公司 Crystal forms of salts of fused tricyclic gamma-amino acid derivatives, preparation and use
CN111918859A (en) * 2018-07-12 2020-11-10 四川海思科制药有限公司 Crystal form of salt of fused tricyclic gamma-amino acid derivative, preparation and application
WO2020011258A1 (en) * 2018-07-12 2020-01-16 四川海思科制药有限公司 Crystal form of salt of fused tricyclic γ-amino acid derivative and preparation and use thereof
US12083226B2 (en) 2018-07-30 2024-09-10 Daiichi Sankyo Company, Limited Stabilizer-containing solid drug formulation
WO2020029762A1 (en) * 2018-08-09 2020-02-13 四川海思科制药有限公司 PREPARATION METHOD FOR FUSED TRICYCLIC γ-AMINO ACID DERIVATIVE AND INTERMEDIATE THEREOF
WO2021043117A1 (en) * 2019-09-03 2021-03-11 四川海思科制药有限公司 Impurity detection method for 2-((1s,2s,3r,6s,8s)-2-(aminomethyl)tricyclo[4.2.1.0 3,8]nonane-2-yl)acetate benzenesulfonate or composition thereof
CN110511141A (en) * 2019-09-09 2019-11-29 上海凌凯医药科技有限公司 A kind of synthetic method of apronal
CN110511141B (en) * 2019-09-09 2022-04-29 上海凌凯医药科技有限公司 Synthesis method of valproyl urea
CN114599397B (en) * 2019-10-25 2024-05-28 国立大学法人京都大学 Preventive or therapeutic agent for tauopathy
CN114599397A (en) * 2019-10-25 2022-06-07 国立大学法人京都大学 Preventive or therapeutic agent for tauopathy
CN110818582A (en) * 2019-11-20 2020-02-21 合肥拓锐生物科技有限公司 GABA analogue and salt thereof, and synthesis method, application and medicament thereof
CN110818582B (en) * 2019-11-20 2023-06-09 合肥拓锐生物科技有限公司 GABA analogue and salt thereof, and synthetic method, application and medicine thereof
CN111116345A (en) * 2019-12-30 2020-05-08 上海华理生物医药股份有限公司 Novel method for preparing Mirogabalin
CN114195661B (en) * 2021-12-21 2023-12-22 苏州楚凯药业有限公司 Preparation method of milobalin benzenesulfonate
CN114195661A (en) * 2021-12-21 2022-03-18 苏州楚凯药业有限公司 Preparation method of milobalin besylate
WO2024093678A1 (en) * 2022-11-03 2024-05-10 中科中山药物创新研究院 Gamma-aminobutyric acid derivative comprising polycyclic structure, method for preparing same, and use thereof
CN116903468A (en) * 2023-07-14 2023-10-20 山东新时代药业有限公司 Preparation method of milbelin intermediate
CN116903468B (en) * 2023-07-14 2024-01-26 山东新时代药业有限公司 Preparation method of milbelin intermediate
CN117800858A (en) * 2023-12-28 2024-04-02 南京津泓科技有限公司 Preparation method for catalytic cyanation of milbelin
CN117800858B (en) * 2023-12-28 2024-06-21 南京津泓科技有限公司 Preparation method for catalytic cyanation of milbelin

Also Published As

Publication number Publication date
ES2531324T3 (en) 2015-03-13
NZ584699A (en) 2011-04-29
MY153910A (en) 2015-04-15
AU2008304933A1 (en) 2009-04-02
KR101409079B1 (en) 2014-06-18
TW200924743A (en) 2009-06-16
EP2657219B1 (en) 2014-12-10
PH12013501663B1 (en) 2015-02-09
TWI526425B (en) 2016-03-21
RU2010116708A (en) 2011-11-10
EP2192109A4 (en) 2012-04-18
CN101878193B (en) 2014-07-09
JP4479974B2 (en) 2010-06-09
EP2192109A1 (en) 2010-06-02
CY1114836T1 (en) 2016-12-14
BRPI0818193B8 (en) 2021-05-25
KR20100065342A (en) 2010-06-16
CA2701110C (en) 2013-01-08
CN103483169A (en) 2014-01-01
RU2446148C2 (en) 2012-03-27
BR122013020635A2 (en) 2019-08-06
MY172034A (en) 2019-11-12
CA2701110A1 (en) 2009-04-02
PL2192109T3 (en) 2014-01-31
AU2008304933B2 (en) 2011-02-24
DK2192109T3 (en) 2013-12-16
HK1139381A1 (en) 2010-09-17
KR20130093181A (en) 2013-08-21
TWI436762B (en) 2014-05-11
PH12013501663A1 (en) 2015-02-09
EP2192109B1 (en) 2013-09-04
TW201439053A (en) 2014-10-16
HK1190698A1 (en) 2014-07-11
EP2657219A1 (en) 2013-10-30
US7947738B2 (en) 2011-05-24
PT2192109E (en) 2013-12-09
CO6270314A2 (en) 2011-04-20
ES2433890T3 (en) 2013-12-12
IL204621A0 (en) 2010-11-30
KR101335784B1 (en) 2013-12-05
BRPI0818193B1 (en) 2020-11-10
US20100249229A1 (en) 2010-09-30
IL204621A (en) 2013-04-30
ZA201002013B (en) 2010-11-24
MX2010003394A (en) 2010-04-09
HRP20130935T1 (en) 2013-11-22
JPWO2009041453A1 (en) 2011-01-27
BRPI0818193A2 (en) 2017-12-12
SI2192109T1 (en) 2014-03-31
WO2009041453A1 (en) 2009-04-02

Similar Documents

Publication Publication Date Title
CN101878193B (en) Bicyclic gamma-amino acid derivative
JP6980648B2 (en) Production of 3-hydroxy-3,6-dimethylhexahydrobenzofuran-2-one and its derivatives
WO2010079668A1 (en) Olefin compound
JP2010241796A (en) PHARMACEUTICAL COMPOSITION CONTAINING BICYCLIC gamma-AMINO ACID DERIVATIVE
JP7088933B2 (en) NRF2 activator
US20240279197A1 (en) Nrf2 activator
Prasad et al. Efficient enantiospecific synthesis of ent-conduramine F-1
Etheridge et al. Kinetic resolution of 4, 5-dihydroxylated cyclopentenones
Nagatsugi et al. Synthesis of ω-fluorinated octanoic acid and its β-substituted derivatives
Byun et al. Practical multigram-scale synthesis of 4, 6-and 4, 8-sphingadienes, chemopreventive sphingoid bases
Roberts The allylic amination of silyl enol ethers using N, N-bis-(trichloroethoxycarbonyl) sulfur diimide and efforts towards the synthesis of proaporphine alkaloids
Nesman Synthetic studies towards one isomer of (-)-mucosin
Williams Chiral pool approaches to lycopodium alkaloids, orchidaceae alkaloids and photoswitchable ceramides
CN113493430A (en) Intermediate of beraprost and salt thereof and preparation method thereof
JPS6233136A (en) Optically active gamma-alkyl-alpha-acyloxycarboxylic ester and production thereof
Beyersbergen van Hen First total synthesis of (+)-gelsedine
Pereira Total synthesis of Fumonisin B1. Chapter 2. Synthesis of Unnatural Sphingolipids: 1-deoxy-5-hydroxysphinganine and its diastereomers. Chapter 3. Development of Methodology: Synthesis of cis-and trans-homoallylic alcohols. Chapter 4. Human Milk Oligosaccharides: Synthesis of Natural and Unnatural oligomers

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant