CN101875978B - Identification method for differentiating Marek's disease virus vaccine strains from virulent strains - Google Patents
Identification method for differentiating Marek's disease virus vaccine strains from virulent strains Download PDFInfo
- Publication number
- CN101875978B CN101875978B CN 201010107794 CN201010107794A CN101875978B CN 101875978 B CN101875978 B CN 101875978B CN 201010107794 CN201010107794 CN 201010107794 CN 201010107794 A CN201010107794 A CN 201010107794A CN 101875978 B CN101875978 B CN 101875978B
- Authority
- CN
- China
- Prior art keywords
- strain
- virulent
- marek
- virus
- strains
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an identification method for differentiating Marek's disease virus vaccine strains from virulent strains, which adopts a PCR technique comprising: performing PCR amplication of A Marek's disease virus serum type-I vaccine strain CVI999, a Marek's disease virus serum type-I vaccine strain 814, a CVI988 regression chicken in-vivo first-generation separated strain CVI988/BP1,a very virulent virus strain 684A, a very virulent virus strain G2, a very virulent virus strain N, a virulent strain YL040920, a virulent strain GXY1, a virulent strain GXY2, a virulent strain GXYL1, a virulent strain GX070060, a virulent strain GX070079, a virulent strain GX070092, a virulent strain GX080036, a virulent strain GX080051 and a virulent strain 080059; and detecting the nucleotide sequences of PCR products for identification. The method established by the method can be used for detecting tumour viruses, diagnosing diseases and performing experiment for researching the mutual identification of the virus strains in culturing farms which widely use the vaccine strain CVI988 and the vaccine strain 814. The method has a great significant and high application value for the epidemiological authentic diagnosis of early virulent virus and disease infection and clinic authentic diagnosis of oncosis of chickens, the detection of ambient viruses and the prevention and control of Marek's disease.
Description
Technical field
The invention belongs to field of biology, specifically the discrimination method of a kind of differentiating Marek's disease virus vaccine strain and virulent strain.
Background technology
Marek is a kind ofly to have hyperinfection, a lymphadenosis tumor disease by what marek's disease virus caused.Mainly be with the Dutch strain CVI988 of the exquisite weak poison of the reasonable marek's disease virus serum 1 type of protection effect people and the Chinese distinctive natural attenuated vaccine strain 814 of Chinese Harbin veterinary institute development to the prevention of Marek at home in recent years.The problem that exists is: at first the 7-10 talent of chick after immunity produces good cellular immunization and the ability of humoral immunoresponse(HI); just be exposed in the environment that may have the Marek virulent strain and Immune Profile In Chicks is complete generally speaking; secondly immunization can not stop strong poison to infect and provide fully protection to chicken, and vaccine virus can long-term co-existence in the chicken body with strong poison.Marek's disease virus serum 1 type CVI988 and 814 strains use to Marek really the diagnosis broken belt come very large difficulty, the differential diagnosis of research differentiating Marek's disease virus vaccine strain and street strain receives great concern always.CVI988 strain pp38 upstream region of gene promoter sequence has continuous 5 nucleotide deletions, other strain bag is crossed 814 strains and is not found such disappearance, for two pairs of primers of this disappearance region sequence design, pair of primers can only amplify CVI988, pair of primers can amplify and cross other strain of 814 except CVI988 with outsourcing in addition, can comprise that 814 strain differentiates to CVI988 and other by PCR method, but fail 814 strains and other virulent strain are distinguished, therefore in production and scientific research, can not carry out to the chicken group who once used 814 vaccine strains the deterministic diagnosis of Marek.Detect chicken peripheral blood lymphocyte Marek's disease virus genic group DNA carrying capacity by real time quantitative PCR method and confirm that there is certain difference in duplicating dynamics strong, low virulent strain, the standard that is used for early diagnosis as Marek, but this method relatively difficulty apply in the actual production.
Summary of the invention
The invention provides the discrimination method of a kind of differentiating Marek's disease virus vaccine strain and virulent strain in order to overcome the deficiencies in the prior art.
The technical scheme that the present invention solves the problems of the technologies described above is as follows:
1. discrimination method that can be used for differentiating Marek's disease virus vaccine strain and virulent strain, adopt round pcr, to marek's disease virus serum 1 type vaccine strain CVI988,814, CVI988 returns generation strain isolated CVI988/BP1 and special highly virulent strain 648A in the chicken body, highly virulent strain G2, N and virulent strain YL040920, GXY1, GXY2, GXYL1, GX070060, GX070079, GX070092, GX080036, GX080051,16 strains such as GX080059 carry out pcr amplification, and the mensuration that the PCR product carries out nucleotide sequence obtained affirmation, concrete operation step is as follows:
1) designs and synthesizes primer
It is the synthetic pair of primers of sequences Design of the marek's disease virus Md5 strain of AF243438 according to the GenBank accession number, upstream primer USF:CTAACCACAGCGTGTCTCC, downstream primer USR:TGTATCTTTCCTCTGCCTTG, dissolve with ultrapure water before using, concentration is 25pmol, places-20 ℃ to save backup;
2) processing of strain
Take out frozen strain from liquid nitrogen: marek's disease virus serum 1 type living vaccine CVI988 separates malicious CVI988/BP1 strain with 814 strains, the interior generation of CVI988 recurrence chicken body, 10 strong malicious strain isolateds are respectively YL040920, GXY1, GXY2, GXYL1, GX070060, GX070079, GX070092, GX080036, GX080051, GX080059, put into rapidly 37 ℃ of water-baths and make its thawing, centrifugal 5min under the condition of room temperature 1500r/min, supernatant discarded, cell culture medium DMEM 1mL Eddy diffusion with serum-free carries out the extraction of the total DNA of cellular genome;
3) extraction of DNA
A. the preparation of extract, pH8.01mol/L Tris-Cl 4 μ L, pH8.00.5mol/L EDTA80 μ L, 20 μ g/ml Pancreatic RNases, 0.8 μ L, weight concentration 10%SDS 20 μ L, 20mg/mL Proteinase K 3 μ L and ultrapure water 42.2 μ L are mixed, obtain extract;
B. get step 2) each cell culture medium suspension 250 μ L place respectively 13 1.5mL centrifuge tubes, every pipe adds the 150 μ L extracts that prepare, and mixes rearmounted 55 ℃ of water-baths 2 hours;
C. from water-bath, take out postdigestive sample, in every pipe, add saturated phenol 400 μ L, after fully concussion shakes up under the condition of room temperature 12000r/min centrifugal 8 minutes;
D. then the supernatant liquor 400 μ L that get step add the saturated phenol of 200 μ L and the chloroformic solution of 200 μ L, after concussion shakes up under the condition of room temperature 12000r/min centrifugal 8 minutes;
E. the supernatant liquor 400 μ L that get step add the dehydrated alcohol 800 μ L that preserve under the sodium acetate of volume 40 μ L pH5.23mol/L and-20 ℃ of conditions again, and concussion shakes up, then under the condition of room temperature 12000r/min centrifugal 8 minutes;
F. discard the supernatant liquor of step, after the alcohol washing once of adding 1mL 75%, gained nucleic acid throw out is placed on 42 ℃ of drying in oven, obtain DNA;
G. add the ultrapure water of 20 μ L in every pipe, dissolving DNA, the DNA sample of acquisition are put-20 ℃ and are saved backup;
3) PCR reaction system
Adopt the reaction system of 50 μ L, under condition of ice bath, in 16 PCR reaction tubess, add respectively each composition: 10 * Buffer 5.0 μ L by following reagent dosage, 10mM dNTP 2.0 μ L, each 1.0 μ L of upstream and downstream primer, 5U/ μ L Taq archaeal dna polymerase 0.5 μ L, each reaction tubes adds respectively 648A, the G2 of 2.0 μ L, genomic dna and the step 2 of N strain) each sample template DNA, complementing to cumulative volume with the sterilization distilled water is 50 μ L;
4) PCR reaction conditions
Place the pcr amplification instrument to circulate the PCR reaction tubes, the reaction cycle parameter: 95 ℃ of denaturation 3min; 30 circulations: 94 ℃ of sex change 30sec, 60 ℃ of annealing 30sec, 72 ℃ of extension 1min; 72 ℃ are extended 5min, obtain the PCR product;
5) detection of PCR product
Getting 8 μ L PCR reaction product mixes with 1 μ L weight concentration, 10% tetrabromophenol sulfonphthalein dyestuff, put into that to contain ethidium bromide 0.5 μ g/mL weight concentration be 1% sepharose hole, at electrophoresis under the condition of 80V voltage after 1 hour, under ultraviolet transilluminator, observe the PCR product, check the expection size of PCR product, under gel imaging system, take pictures and log;
6) result and judgement
Under ultraviolet lamp, observe and contrast in standard molecular weight, institute's toxic strain all only amplifies a band, and the fragment that CV1988,814, CVI988/BP1,648A, G2, N, YL040920, GXY1, GXY2, GXYL1, GX070060, GX070079, GX070092, GX080036, GX080051, GX080059 occur is respectively 738bp, 735bp, 738bp, 818bp, 952bp, 951bp, 968bp, 972bp, 974bp, 968bp, 970bp, 966bp, 970bp, 1187bp, 1185bp, 1188bp.
7) purifying of PCR product
Cutting-out step 6 under ultraviolet lamp) fragment of judging reclaims test kit with the SIGEMA gel and reclaims;
8) clone of PCR product
The PCR product is connected with carrier pMD18-T Vector, and according to a conventional method with converted product difference transformed competence colibacillus cell, the single colony inoculation of picking white is to containing in the ampicillin medium, and 37 ℃ of isothermal vibrations increase bacterium and cultivate 12～16h;
9) to step 8) bacterium liquid PCR evaluation
A. the preparation of reaction system adds respectively 10 * Buffer, 5.0 μ L in the PCR reaction tubes, 10mM dNTP2.0 μ L, each 1.0 μ L of upstream and downstream primer, 5U/ μ L Taq archaeal dna polymerase 0.5 μ L, step 8) bacterium liquid 1.0 μ L, complementing to cumulative volume with the sterilization distilled water is 50 μ L;
B.PCR reaction conditions and step 4) identical, result's judgement and step 6) identical;
10) sequencing of amplified production and comparative analysis
With step 9) positive colony that screens transfers to Guangzhou Invitrogen company limited and biotechnology company limited in Shanghai carries out determined dna sequence, and measured sequence is carried out Blast at GenBank analyze, determine that the nucleotide sequence of pcr amplification gained belongs to the Marek's disease virus genic group.
The present invention's beneficial effect compared with the prior art is: the Difference in Pathogenicity of marek's disease virus serum 1 type vaccine strain and virulent strain is very large, but genome is very similar, CVI988 and 814 vaccine strains use to Marek really the diagnosis broken belt come very large difficulty.The method energy differentiating Marek's disease virus vaccine CV1988 that this patent is set up and the discrimination method of 814 strains and virulent strain.Solve at present the also difficult problem of unsolved differentiating Marek's disease serum virus 1 type vaccine virus and strong malicious particularly virulent and special highly virulent strain, can carry out to the plant that is widely used vaccine strain CV1988 and 814 both at home and abroad the mutual discriminating of these virus strain in the diagnosis of the detection of tumour virus and disease and the experimental study.This epidemiology of reason, the strong poison of investigation chicken group early infection, disease of Marek immuning failure and clinical tumor disease occur, and diagnosis is disconnected really for investigation chicken group, the prevention of environment Detecting and Marek is of great significance and using value with the equal tool of control.
Description of drawings
Fig. 1 is the electrophoresis result that PCR detects CV1988,814, CVI988/BP1,648A, G2, N, YL040920, GXY1, GXY2, GXYL1, GX070060, GX070079, GX070092, GX080036, GX080051, GX080059 strain in the specific embodiment of the invention.
Among the figure: 1:DL2000bp Ladder DNA Marker; 2:CVI988; 3:814; 4:CVI988/BP1; 5:648A; 6:G2; 7:N; 8:YL040920; 9:GXY1; 10:GXY2; 11:GXYL1; 12:GX070060; 13:GX070079; 14:GX070092; 15:GX080036; 16:GX080051; 17:GX080059; 18:150bp Ladder DNAMarker.
Embodiment
The invention will be further described below in conjunction with drawings and Examples.
1) designs and synthesizes primer
It is the synthetic pair of primers of sequences Design of the marek's disease virus Md5 strain of AF243438 according to the GenBank accession number, upstream primer USF:CTAACCACAGCGTGTCTCC, downstream primer USR:TGTATCTTTCCTCTGCCTTG, dissolve with ultrapure water before using, concentration is 25pmol, places-20 ℃ to save backup.
2) processing of strain
Take out frozen strain from liquid nitrogen: marek's disease virus serum 1 type living vaccine CVI988 separates malicious CVI988/BP1 strain with 814 strains, the interior generation of CVI988 recurrence chicken body, 10 strong malicious strain isolateds are respectively YL040920, GXY1, GXY2, GXYL1, GX070060, GX070079, GX070092, GX080036, GX080051, GX080059, put into rapidly 37 ℃ of water-baths and make its thawing, centrifugal 5min under the condition of room temperature 1500r/min, supernatant discarded.Cell culture medium DMEM 1mL Eddy diffusion with serum-free carries out the extraction of the total DNA of cellular genome.
3) extraction of DNA:
A. the preparation of extract, pH8.01mol/L Tris-Cl 4 μ L, pH8.00.5mol/L EDTA80 μ L, 20 μ g/ml Pancreatic RNases, 0.8 μ L, weight concentration 10%SDS 20 μ L, 20mg/mL Proteinase K 3 μ L and ultrapure water 42.2 μ L are mixed, obtain extract;
B. get step 2) each cell culture medium suspension 250 μ L place respectively 13 1.5mL centrifuge tubes, every pipe adds the 150 μ L extracts that prepare, and mixes rearmounted 55 ℃ of water-baths 2 hours;
C. from water-bath, take out postdigestive sample, in every pipe, add saturated phenol 400 μ L, after fully concussion shakes up under the condition of room temperature 12000r/min centrifugal 8 minutes;
D. then the supernatant liquor 400 μ L that get step add the saturated phenol of 200 μ L and the chloroformic solution of 200 μ L, after concussion shakes up under the condition of room temperature 12000r/min centrifugal 8 minutes;
E. the supernatant liquor 400 μ L that get step add the dehydrated alcohol 800 μ L that preserve under the sodium acetate of volume 40 μ L pH5.23mol/L and-20 ℃ of conditions again, and concussion shakes up, then under the condition of room temperature 12000r/min centrifugal 8 minutes;
F. discard the supernatant liquor of step, after the alcohol washing once of adding 1mL 75%, gained nucleic acid throw out is placed on 42 ℃ of drying in oven, obtain DNA;
G. add the ultrapure water of 20 μ L in every pipe, dissolving DNA, the DNA sample of acquisition are put-20 ℃ and are saved backup;
3) PCR reaction system:
Adopt the reaction system of 50 μ L, under condition of ice bath, in 16 PCR reaction tubess, add respectively each composition: 10 * Buffer 5.0 μ L by following reagent dosage, 10mM dNTP 2.0 μ L, each 1.0 μ L of upstream and downstream primer, 5U/ μ L Taq archaeal dna polymerase 0.5 μ L, each reaction tubes adds respectively 648A, the G2 of 2.0 μ L, genomic dna and the step 2 of N strain) each sample template DNA, complementing to cumulative volume with the sterilization distilled water is 50 μ L.
4) PCR reaction conditions:
Place the pcr amplification instrument to circulate the PCR reaction tubes, the reaction cycle parameter: 95 ℃ of denaturation 3min; 30 circulations: 94 ℃ of sex change 30sec, 60 ℃ of annealing 30sec, 72 ℃ of extension 1min; 72 ℃ are extended 5min, obtain the PCR product.
5) detection of PCR product:
Getting 8 μ L PCR reaction product mixes with 1 μ L weight concentration, 10% tetrabromophenol sulfonphthalein dyestuff, put into that to contain ethidium bromide 0.5 μ g/mL weight concentration be 1% sepharose hole, at electrophoresis under the condition of 80V voltage after 1 hour, under ultraviolet transilluminator, observe the PCR product, check the expection size of PCR product, under gel imaging system, take pictures and log.
6) result and judgement:
Under ultraviolet lamp, observe and contrast in standard molecular weight, institute's toxic strain all only amplifies a band, and the fragment that CV1988,814, CVI988/BP1,648A, G2, N, YL040920, GXY1, GXY2, GXYL1, GX070060, GX070079, GX070092, GX080036, GX080051, GX080059 occur is respectively 738bp, 735bp, 738bp, 818bp, 952bp, 951bp, 968bp, 972bp, 974bp, 968bp, 970bp, 966bp, 970bp, 1187bp, 1185bp, 1188bp.
7) purifying of PCR product:
Cutting-out step 6 under ultraviolet lamp) fragment of judging reclaims test kit with the SIGEMA gel and reclaims;
8) clone of PCR product:
The PCR product is connected with carrier pMD18-T Vector, and according to a conventional method with converted product difference transformed competence colibacillus cell, the single colony inoculation of picking white is to containing in the ampicillin medium, and 37 ℃ of isothermal vibrations increase bacterium and cultivate 12～16h.
9) to step 8) bacterium liquid PCR evaluation
A. the preparation of reaction system adds respectively 10 * Buffer, 5.0 μ L in the PCR reaction tubes, 10mM dNTP2.0 μ L, each 1.0 μ L of upstream and downstream primer, 5U/ μ L Taq archaeal dna polymerase 0.5 μ L, step 8) bacterium liquid 1.0 μ L, complementing to cumulative volume with the sterilization distilled water is 50 μ L.
B.PCR reaction conditions and step 4) identical, result's judgement and step 6) identical.
10) sequencing of amplified production and comparative analysis
With step 9) positive colony that screens transfers to Guangzhou Invitrogen company limited and biotechnology company limited in Shanghai carries out determined dna sequence, and measured sequence is carried out Blast at GenBank analyze.The nucleotide sequence of determining the pcr amplification gained belongs to the Marek's disease virus genic group.
Claims (1)
1. the primer pair of a differentiating Marek's disease virus vaccine strain and virulent strain is characterized in that,
The sequences Design of marek's disease virus Md5 strain that according to the GenBank accession number is AF243438 is synthetic, upstream primer USF:CTAACCACAGCGTGTCTCC, downstream primer USR:TGTATCTTTCCTCTGCCTTG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010107794 CN101875978B (en) | 2010-02-10 | 2010-02-10 | Identification method for differentiating Marek's disease virus vaccine strains from virulent strains |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010107794 CN101875978B (en) | 2010-02-10 | 2010-02-10 | Identification method for differentiating Marek's disease virus vaccine strains from virulent strains |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101875978A CN101875978A (en) | 2010-11-03 |
| CN101875978B true CN101875978B (en) | 2013-03-27 |
Family
ID=43018657
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010107794 Expired - Fee Related CN101875978B (en) | 2010-02-10 | 2010-02-10 | Identification method for differentiating Marek's disease virus vaccine strains from virulent strains |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101875978B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103131795B (en) * | 2013-01-15 | 2014-05-07 | 北京华都诗华生物制品有限公司 | Primer and kit for identifying marek's disease virus serum 1-type vaccine virus |
| CN114317827B (en) * | 2022-01-07 | 2023-03-24 | 河南省农业科学院 | Multiplex PCR (polymerase chain reaction) primer, method and application for identifying infection and immunity of Marek's disease viruses of different serotypes |
| CN114717200B (en) * | 2022-03-16 | 2023-03-24 | 河南省农业科学院 | Marek's disease virus super virulent strain and construction and application of gene deletion strain thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1513996A (en) * | 2003-06-16 | 2004-07-21 | 扬州大学 | Marek's disease virus vaccine CV1988 strain VP22 gene |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR0307512A (en) * | 2002-02-06 | 2004-12-07 | Inst Of Molecular Bilogy Fried | Methods for producing a continuous cell line, for generating and / or isolating and / or maintaining a marek disease virus strain, for producing a diagnostic antigen for a marek disease virus, for preparing a vaccine capable of inducing protection against disease in a vertebrate, and to protect a vertebrate against disease, a cell or its offspring, cell preparation, use of it, vaccine, and use of it |
-
2010
- 2010-02-10 CN CN 201010107794 patent/CN101875978B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1513996A (en) * | 2003-06-16 | 2004-07-21 | 扬州大学 | Marek's disease virus vaccine CV1988 strain VP22 gene |
Non-Patent Citations (2)
| Title |
|---|
| 丁家波等.区分马立克氏病病毒疫苗株CVl988与其他毒株的PCR方法的建立及应用.《中国兽医学报》.2007,第27卷(第1期),第39-42页. * |
| 丁维民等.I型马立克氏病强弱毒株Meq基因的克隆与序列分析.《安徽农业科学》.2009,第37卷(第30期),第14604-14606页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101875978A (en) | 2010-11-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111172321B (en) | Fluorescent PCR detection kit for identifying African swine fever infection and immunity | |
| CN104152584B (en) | Capripoxvirus virus Taqman-MGB probe multiple real-time fluorescence quantitative PCR detection primer, method and test kit | |
| Lian et al. | Distribution and molecular characterization of avian infectious bronchitis virus in southern China | |
| CN104195266A (en) | Quadruple fluorogenic quantitative PCR kit for detecting three pathogens of infantile pneumonia | |
| CN110964857A (en) | Kit for detecting bovine sarcoidosis virus by excluding capripoxvirus, preparation method and application thereof | |
| CN105349707A (en) | RT-LAMP (reverse transcriptase loop-mediated isothermal amplification) kit for porcine epidemic diarrhea viruses and applications thereof | |
| CN113278718A (en) | Primer pair, amplification reagent, amplification kit, detection method and application for detecting litopenaeus vannamei liver enterocytozoon | |
| CN103805719B (en) | Newcastle disease virus, H9 subtype avian influenza virus and avian pneumovirus Triplex RT-PCR kit and application thereof | |
| CN101875978B (en) | Identification method for differentiating Marek's disease virus vaccine strains from virulent strains | |
| CN104152582B (en) | Ox lumpy skin disease virus Taqman-MGB probe for real-time fluorescence is primer, kit and detection method for quantitative PCR detection | |
| CN105463136A (en) | Kit for RT-PCR typing detection of avian infectious bronchitis virus | |
| CN102676698A (en) | PRV, PCV-2, PPV multiple PCR (Polymerase Chain Reaction) detection kit | |
| CN103820575B (en) | Newcastle disease virus and avian pneumovirus duplex RT-PCR test kit and application thereof | |
| CN102373302B (en) | Primer, kit and detection method for quickly detecting capripoxvirus virus by adopting isothermal amplification technology | |
| CN106222297A (en) | One group of fluorescence quantification PCR primer for quick diagnosis Nosema antheraeae worm and application thereof | |
| CN109355434B (en) | Fluorescent quantitative PCR kit for quantitatively detecting chicken Marek's virus (McV) Meq gene deletion vaccine strain and wild strain and application thereof | |
| CN106148566A (en) | A kind of Andrias davidianus Blanchard irido virus CPA detection primer and application | |
| CN102534052B (en) | Nucleic-acid sequence-based amplification (NASBA) method for detecting swine influenza virus (SIV) | |
| CN104846098A (en) | Reagent box and detection method | |
| CN102618634B (en) | PCR (polymerase chain reaction) detection method for specificity of salmonella typhimurium | |
| Lachheb et al. | Molecular characterization of a unique variant of avian infectious bronchitis virus in Tunisia | |
| CN106319080A (en) | PCR detection kit for rapidly identifying mycoplasma hyopeumoniae, mycoplasma synoviae and mycoplasma hyorhinis, and applications of PCR detection kit | |
| CN107299154A (en) | A kind of sheep Theileria luwenshuni and Anaplasma phagocytophilum double PCR primer special and dual PCR detection method | |
| CN102827951A (en) | Qualitative and quantitative detection method of gene C-type duck hepatitis A virus | |
| Hedayati et al. | Detection of avian reoviruses causing tenosynovitis in breeder flocks in Iran by reverse transcription-polymerase chain reaction (RT-PCR) and restriction enzyme fragment length polymorphism (RFLP) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130327 Termination date: 20150210 |
|
| EXPY | Termination of patent right or utility model |