CN101864491B - Quick bacterium identification kit for sputum sample and detection method for the same - Google Patents

Abstract

The invention relates to the field of clinical microbiological assay and provides a quick bacterium identification kit for a sputum sample and a detection method for the same. The kit comprises two universal primers for propagating the V1 variable regions of the 16S rRNA of a bacterium, two specific primers for shielding the variable regions of the 16S rRNA of a neisseria bacterium, two specific primers for shielding the variable regions of the 16S rRNA of a veillonella parvula, a sequencing primer for sequencing the positive segment of the V1, and an avidin-marked magnetic ball, wherein the sequencing result is compared with a database to determine the species of the bacteria. By applying the kit, the bacteria in a sputum sample can be distinguished by once sequencing, thus, the kit can be applied in the clinical diagnosis on the bacterial infection in the sputum sample. The invention wins precious rescuing time for a clinical treatment and has the advantages of low cost, convenient operation and high specificity.

Description

This bacterium of sputum sample quick identification kit and detection method thereof

Technical field

The invention belongs to the clinical microorganism identification technical field, be specifically related to test kit and the detection method of a kind of this pathogenic bacteria of Rapid identification sputum sample.

Background technology

Traditional bacteria is cultivated and biochemical analysis; Diagnosis and epidemiological study can not have been satisfied to various pathogenic micro-organisms; The investigator not only hopes on molecular level, various bacteriums and virus to be studied, and hopes the method for inspection simultaneously more fast, accurately, and flux is higher; Artifical influence factor will reduce as far as possible, is convenient to make up standardized operating process.The method of PCR and quantitative PCR can't obtain the golden standard-gene order of molecular diagnosis, and the restriction of examined bacterial classification, every kind of bacterial classification need special PCR primer with or probe, big limitations its application in Bacteria Identification; And utilize conventional dna sequencing technology that big segmental DNA is carried out sequencing, can not satisfy requirement in speed with consuming to extensive sample rapid detection.In real work, the mensuration of one section very short conservative/distinguished sequence just can satisfy the needs to molecular diagnosis.Because the 16srRNA sequence all exists in all bacterium kinds; Can satisfy the requirement that compares, therefore be the basis, take virulence and toxin gene authentication method with the 16SrRNA sequential analysis; Identified unknown bacterium in the shortest time is made accurate judgement to bacillary New Development transmissible disease.The tetra-sodium sequencing technologies can carry out the short dna sequential analysis quickly and accurately, and flux is high, easy to operate, is convenient to make up the normalizing operation flow process, therefore favored by the investigator, and aspect much, has been applied to the somatotype evaluation and the Drug Resistance Detection of Clinical microorganism.

Pyrosequencing (tetra-sodium order-checking) technology is a dna sequence analysis of new generation technology, and this technology need not be carried out electrophoresis, and dna fragmentation also need not fluorescent mark, operates very easy.The Pyrosequencing technology is by the enzyme cascade chemiluminescence reaction in 4 kinds of enzymatic same reaction systems; Take turns in the sequencing reaction at each; Only add a kind of dNTP; If this dNTP and template are matched, polysaccharase just can be incorporated into it in primer strand and the tetra-sodium group (PPi) of mole number such as discharges.PPi can finally be converted into visible light signal, and is converted into a peak value by PyrogramTM.The Nucleotide number that mixes is directly proportional in the height of each peak value and the reaction.Add a kind of dNTP down then, continue the synthetic of DNA chain.

Monstein etc. (2001) detect V1 and the V3 region sequence of helicobacter pylori 16S rRNA gene 16S rDNA with the tetra-sodium sequencing technologies; With the nucleotide sequence difference of 23 helicobacter pylori samples that obtain in the gastroscopic biopsy sample according to its V1 district; Identify 8 kinds of different allelic gene types; The sequence unanimity of, 1 sample consistent with helicobacter pylori 26695 strain sequences and 199 strains, show as the sudden change of 1 or 2 Nucleotide or the insertion of single Nucleotide is divided into 4 allelic gene types according to the change in V1 district except that 11 samples.Other has the V3 district of 2 samples C to T to occur to change, prove that this technology can satisfy Rapid identification and the somatotype to clinical pathogenic bacteria sample.(2001) such as Unner stad utilize the tetra-sodium sequencing technologies that the monocyte hyperplasia listeria spp of 106 strain different serotypes has been carried out somatotype; Variation according to the 1575th of inIB gene and 1578 Nucleotide; Serotype 1/2a and 1/2c are divided into one group; 1/2b and 3b are divided into one group, and serotype 4b can be divided into 2 groups.This technology also is applied to Rapid identification and the somatotype (Ronaghi etc., 1999) of bordetella pertussis (Bordetella pert ussis) and parapertussis bacillus bacteriums such as (Parapert ussis).Martin etc. (2006) use this technology that the relevant ptxSl gene of bordetella pertussis virulence has been carried out the somatotype evaluation; And done methodological comparison with quantitative PCR; The result shows that two kinds of methods have good consistence, and the tetra-sodium sequencing technologies is fit to the extensive screening of bordetella pertussis.In addition, Alistair etc. (2003) detect the anti-Linezolid site on the enterococcal 23s rRNA with the tetra-sodium sequencing technologies, and compare with the PCR-RFLP method, and the result has shown 100% consistence.Marjo etc. (2005) detect bird mycobacterium with the tetra-sodium sequencing technologies; Streptococcus pneumoniae, streptococcus pyogenes, campylobacter jejuni; 2058 polymorphums of 23S rRNA gene of several diseases substances such as influenza (bloodthirsty) bacillus are to obtain the macrocyclic lactone resistance information of pathogenic agent.Zhao Jinrong etc. (2005) have set up the method based on the high throughput testing Mycobacterium tuberculosis of anti-Rifampin of tetra-sodium sequencing technologies; And verifying that with traditional sequence measurement the result has shown 100% consistence, they think that this method has characteristics such as the high and result of level of automation is accurate; Compare traditional order-checking; Have characteristics such as quicker, easy, be applicable to the detection of the fast high-flux of the Mycobacterium tuberculosis of anti-the Rifampin.

Yet; Above-mentioned report all is the detections that are based upon the bacterial strain or the aseptic body fluid single culture of purifying; The sputum sample has the existence of a lot of normal microfloras clinically; The sequence that the situation that this various bacteria exists is used universal primer to check order to be produced through bacterial 16 S rRNA universal primer amplification back is the mixed sequence of normal microflora and pathogenic bacterium, and this mixed sequence is difficult to directly to solve through the mode of sequence alignment; The present invention is through designing to the normal bacterium-neisseria of advantage in the sputum sample and the special primer of veillonella parvula; Two special primers and bacterium universal primer are mixed into the performing PCR amplification according to a certain percentage, the PCR product through the strand purification step remove the amplified fragments of Neisseria and veillonella parvula and the extension increasing sequence that only stays pathogenic bacterium reach the sputum sample in the purpose that shields of normal microflora.The sequence that PCR product after the shielding is produced after the tetra-sodium order-checking is the unique sequence of pathogenic bacterium, and this unique sequence and DB comparison can be judged the pathogenic bacterium kind.This method can once sequencing be distinguished pathogenic bacterium in the sputum sample.Do not see product and the report of pathogenic bacterium in the once sequencing differentiation sputum sample up to now both at home and abroad, therefore clinically if obtain the information of sputum sample infectation of bacteria fast, needs etc. 3-7 days or longer time.

Summary of the invention

Technical problem to be solved by this invention provides a kind of reliably this bacterium of sputum sample quick identification kit accurately.

The technical problem that the present invention also will solve provides the detection method of mentioned reagent box.

For solving the problems of the technologies described above, the technical scheme that the present invention adopts is following:

A kind of this bacterium of sputum sample quick identification kit, it comprises:

(1) universal primer of the V1 variable region of amplification bacterial 16 S rRNA: its nucleotide sequence primer shown in SEQ ID NO:1 and SEQ ID NO:2 is right;

(2) special primer of the V1 variable region of shielding neisseria bacterial 16 S rRNA: its nucleotide sequence primer shown in SEQID NO:3 and SEQ ID NO:2 is right;

(3) special primer of the V1 variable region of shielding veillonella parvula 16S rRNA: its nucleotide sequence primer shown in SEQ IDNO:4 and SEQ ID NO:2 is right;

(4) sequencing primer: its nucleotide sequence is shown in SEQ ID NO:2;

(5) magnetic bead of avidin mark;

Wherein, SEQ ID NO:1 is at its 5 ' end mark vitamin H;

In one-time detection, use jointly.

Above-mentioned this bacterium of sputum sample quick identification kit specifically comprises following reagent:

(1) liquefied reagent: 0.2M NaOH;

(2) washing reagent: 0.9%NaCl solution;

(3) DNA extraction reagent: 5% (w/v) g/mLChelex, 100 damping fluids, 20mg/mL Proteinase K;

Wherein, Chelex 100 damping fluids are specially: contain 0.03% (w/v) g/mL SDS, 1% (v/v) Tween-20,1% (v/v) NP-40.

(4) reaction solution: PCR Buffer, special primer SEQ ID NO:1～2,2mM MgCl ₂, 0.2mM dNTPs, 2U/ μ LTaq archaeal dna polymerase;

Wherein, PCR Buffer is specially: 0.1% (v/v) NP-40,0.02% (v/v) gelatin, 0.06% (w/v) g/mL BSA, 0.1% (v/v) Tween-20,0.06M pH8.9Tricine.

(5) strand purified reagent: 75% (v/v) ethanolic soln, 0.2M NaOH, 10mM pH 7.6Tris-Acetate, binding buffer liquid, annealing buffer;

Wherein, binding buffer liquid is specially: 10mM Tris-HCl, 2M NaCl, 1mM EDTA, 0.1% (v/v) Tween-20; Annealing buffer is specially: 20mM pH 7.6Tris-Acetate, 2mM magnesium acetate.

(6) sequencing reagent: archaeal dna polymerase, the ATP sulfurylase, luciferase, apyrase, substrate A PS, resorcinolphthalein and dNTP (dNTP is dATP S, dTTP, and dCTP, dGTP).

A kind of this bacterium of sputum sample quick identification kit, it comprises the complementary base sequences thereof of all above-mentioned nucleotide sequences, just comprises:

(1) universal primer of the V1 variable region of amplification bacterial 16 S rRNA: its nucleotide sequence primer shown in SEQ ID NO:5 and SEQ ID NO:6 is right;

(2) special primer of the V1 variable region of shielding neisseria bacterial 16 S rRNA: its nucleotide sequence primer shown in SEQID NO:7 and SEQ ID NO:6 is right;

(3) special primer of the V1 variable region of shielding veillonella parvula 16S rRNA: its nucleotide sequence primer shown in SEQ IDNO:8 and SEQ ID NO:6 is right;

(4) sequencing primer: its nucleotide sequence is shown in SEQ ID NO:6;

(5) magnetic bead of avidin mark;

Wherein, SEQ ID NO:5 is at its 5 ' end mark vitamin H;

In one-time detection, use jointly.

Above-mentioned this bacterium of sputum sample quick identification kit specifically comprises following reagent:

(1) liquefied reagent: 0.2MNaOH;

(2) washing reagent: 0.9%NaCl solution;

(3) DNA extraction reagent: 5% (w/v) g/mL Chelex, 100 damping fluids, 20mg/mL Proteinase K;

Wherein, 5% (w/v) g/mL Chelex, 100 damping fluids are specially: contain 0.03% (w/v) g/mL SDS, 1% (v/v) Tween-20,1% (v/v) NP-40.

(4) reaction solution: PCR Buffer, special primer SEQ ID NO:3～4,2mM MgCl ₂, 0.2mM dNTPs, 2U/ μ LTaq archaeal dna polymerase;

Wherein, PCR Buffer is specially: 0.1% (v/v) NP-40,0.02% (v/v) gelatin, 0.06% (w/v) g/mL BSA, 0.1% (v/v) Tween-20,0.06M pH8.9Tricine.

(5) strand purified reagent: 75% (v/v) ethanolic soln, 0.2M NaOH, 10mM pH 7.6Tris-Acetate, binding buffer liquid, annealing buffer;

Wherein, binding buffer liquid is specially: 10mM Tris-HCl, 2M NaCl, 1mM EDTA, 0.1% (v/v) Tween-20; Annealing buffer is specially: 20mM pH 7.6Tris-Acetate, 2mM magnesium acetate.

(6) sequencing reagent: archaeal dna polymerase, the ATP sulfurylase, luciferase, apyrase, substrate A PS, resorcinolphthalein and dNTP (dNTP is dATP S, dTTP, and dCTP, dGTP).

Bacterium of the present invention is the bacterium of narrow sense, comprising: Rhodopseudomonas, Staphylococcus, enterococcus spp, streptococcus, klebsiella spp, citrobacter genus, proteus, acinetobacter.

The detection method of above-mentioned this bacterium of sputum sample quick identification kit comprises the steps:

(1) this pre-treatment of sputum sample;

(2) extract DNA of bacteria

(3) be template with step (2) gained DNA, utilize universal primer and shielding primer to carry out the pcr amplification of the V1 variable region of bacterial 16 S rRNA;

(4) pcr amplification product that obtains of step (3) combines to carry out the strand purifying with the magnetic bead of avidin mark;

The PCR product of the purifying that (5) step (4) is obtained carries out the tetra-sodium order-checking;

(6) kind is judged in the comparison of sequencing result and DB.

In the step (2), described pcr amplification system is: 10 * PCR Buffer, 5 μ L, SEQ ID NO:10.3 μ L, SEQ ID NO:21 μ L; SEQ ID NO:36 μ L, SEQ ID NO:46 μ L, Template 0.2ng; DNTPS200mM, taqE 2U adds sterilized water to 50 μ L; The pcr amplification condition is: 94 ℃ of 3min; 94 ℃ of 25s, 42 ℃ of 30s, 72 ℃ of 20s, 28 circulations; 72 ℃ of 3min.Perhaps SEQ ID NO:5 is replaced above-mentioned SEQ ID NO:1; SEQ ID NO:6 is replaced above-mentioned SEQ ID NO:2; SEQ ID NO:7 is replaced above-mentioned SEQ ID NO:3, simultaneously SEQ ID NO:8 is replaced above-mentioned SEQ ID NO:4, other pcr amplification system is identical with condition.

Beneficial effect: test kit of the present invention utilizes the sequence and the DB comparison of the V1 backward section of tetra-sodium sequencing technologies mensuration to judge kind.Use this test kit and can once sequencing distinguish the clinical diagnosis that this bacterium of sputum sample can be used for respiratory tract bacterial infection.Be not merely clinic diagnosis and won valuable rescue time, and have with low cost, easy to operate, the advantage of high specificity.The inventive method can make this bacterium of sputum sample kind identify and shorten to 5 hours; Cost is 1/3rd of traditional identification method; In addition, identify that through sequence alignment bacterium is the ultimate method of strain identification, particularly some difficult bacterium sequence alignments of identifying are identified the advantage that has more.

Description of drawings

Fig. 1 is 1 routine sputum specimen pathogenic bacterium detected result figure, and V1 district sequencing result is negative.

Fig. 2 is 1 routine sputum specimen pathogenic bacterium detected result figure, and V1 district sequencing result is AACGGACGAGAAGCTTGCTTCTCTG, is judged to be streptococcus aureus with the DB comparison.

Fig. 3 is 1 routine sputum specimen pathogenic bacterium detected result figure, and V1 district sequencing result is GGGGAAGGTAGCTTGCTACTGG, is judged to be Acinetobacter bauamnnii with the DB comparison.

Fig. 4 is 1 routine bacterial strain detected result figure, and V1 district sequencing result is GTAGCACAGAGAGCTTG, is judged to be Klebsiella Pneumoniae with the DB comparison.

Fig. 5 is 1 routine bacterial strain detected result figure, and V1 district sequencing result is GTAGCAGGAGAAAGGTGTCGTTTC, is judged to be hemophilus influenzae with the DB comparison.

Fig. 6 is 1 routine bacterial strain detected result figure, and V1 district sequencing result is GCAGCATGATCTAGCTTG, is judged to be the Pi Shi Burkholder with the DB comparison.

Fig. 7 is 1 routine bacterial strain detected result figure, and V1 district sequencing result is AACAGACGAGGAGCTTGCTCCTC, is judged to be staphylococcus epidermidis with the DB comparison.

Fig. 8 is 1 routine bacterial strain detected result figure, and V1 district sequencing result is GTAACATGAAGAAGCTTGCTTC, is judged to be Proteus mirabilis with the DB comparison.

Embodiment

According to following embodiment, can understand the present invention better.Yet, those skilled in the art will readily understand that embodiment only is used to explain the present invention, and the present invention that should also can not limit in claims to be described in detail.

Embodiment 1: the preparation method of test kit.

(1) liquefied reagent: 0.2M NaOH, purchase in Shishewei Chemical Co., Ltd., Shanghai.

(2) washing reagent: 0.9%NaCl solution, purchase in Shishewei Chemical Co., Ltd., Shanghai.

(3) DNA extraction reagent:

5% (w/v) g/mL Chelex, 100 damping fluids: contain 0.03% (w/v) g/mL SDS (purchasing the safe Bioisystech Co., Ltd of fluorescence) in Hangzhou, 1% (v/v) Tween-20 (purchasing Sigma company) in the U.S., 1% (v/v) NP-40 (purchasing Sigma company) in the U.S.,

20mg/mL Proteinase K: (purchasing) in Amresco.

(4) reaction solution:

PCR Buffer:0.1% (v/v) NP-40; 0.02% (v/v) gelatin (purchasing Sigma company) in the U.S., 0.06% (w/v) g/mL BSA (purchasing Sigma company), 0.1% (v/v) Tween-20 (purchasing Sigma company) in the U.S. in the U.S.; (0.06MpH8.9Tricine purchasing company) in Merck

Special primer SEQ ID NO:1～4 or SEQ ID NO:5～8,2mM,

MgCl ₂: purchase Sigma company in the U.S.,

0.2mM dNTPs: purchase ancient cooking vessel state Bioisystech Co., Ltd in Shanghai,

2U/ μ L Taq archaeal dna polymerase: available from U.S. Fermentas company.

(5) strand purified reagent:

75% (v/v) ethanolic soln: purchase Long March chemical reagent ltd in Hangzhou,

0.2M NaOH: purchase in Shishewei Chemical Co., Ltd., Shanghai,

10mM Tris-Acetate (pH 7.6): Tris-base purchases the Sigma company in the U.S., and anhydrous acetic acid is purchased the chemical reagent ltd in Hangzhou,

Binding buffer liquid: (Tris-base purchases the Sigma company in the U.S. by 10mM Tris-HCl; Hydrochloric acid is purchased the chemical reagent ltd in Hangzhou); 2M NaCl (purchasing) in Shishewei Chemical Co., Ltd., Shanghai; 1mM EDTA (purchasing the chemical reagent ltd in Hangzhou), 0.1% (v/v) Tween 20 (purchasing the Sigma company in the U.S.) forms

Annealing buffer: by 20mM Tris-Acetate (pH 7.6) (Tris-base purchases the Sigma company in the U.S., and anhydrous acetic acid is purchased the chemical reagent ltd in Hangzhou), 2mM magnesium acetate (purchasing in Shishewei Chemical Co., Ltd., Shanghai) is formed.

The magnetic bead of avidin mark (purchasing AB) in GE healthcare Bioscience.

(6) sequencing reagent:

Archaeal dna polymerase, ATP sulfurylase, luciferase and apyrase: purchase company in QIAGEN,

Substrate A PS and resorcinolphthalein: purchase company in QIAGEN,

Four kinds of dNTP (dATP S, dTTP, dCTP, dGTP): purchase company in QIAGEN.

Embodiment 2: detection method.

Instrument: Bio-Rad S1000PCR appearance, the desk-top micro-refrigerated centrifuge of Beckman Microfuge 22R, clear gel imaging system is trained in Beijing 61 agarose gel electrophoresis appearance, Shanghai, QIAGEN PyroMark Q96ID sequenator.

(1) this pre-treatment of sputum sample

(1a) liquefied reagent of adding equivalent in the sputum sample basis is rocked mixing, and room temperature left standstill 10～20 minutes;

(1b) in the sputum after the absorption 1mL liquefaction to the 1.5mL sterilization centrifuge tube, the centrifugal 10min of 13000rpm removes supernatant;

(1c) in deposition, add the 1mL washing reagent, the concussion mixing, the centrifugal 10min of 13000rpm removes supernatant;

(1d) repeating step (1c) once.

(2) extract DNA of bacteria, specifically comprise the steps:

(2a) in the deposition that (1) is obtained, add 5% (w/v) g/mL Chelex, 100 damping fluids, 200 μ L and Proteinase K 2 μ L (20mg/mL), hatch 60min, boil 15min for 56 ℃.

(2b) 13000rpm is centrifugal 10 minutes, and it is subsequent use as dna profiling to get supernatant 2 μ L.

(3) be template with step (2) gained DNA, utilize universal primer and shielding primer to carry out the pcr amplification of the V1 variable region of bacterial 16 S rRNA;

Wherein, described pcr amplification system is: 10 * buffer, 5 μ L, SEQ ID NO:10.3 μ L, SEQ ID NO:21 μ L; SEQ ID NO:36 μ L, SEQ ID NO:46 μ L, Template 0.2ng; DNTPS 200mM, taqE2U adds sterilized water to 50 μ L; The pcr amplification condition is: 94 ℃ of 3min; 94 ℃ of 25s, 42 ℃ of 30s, 72 ℃ of 20s, 28 circulations; 72 ℃ of 3min.Perhaps SEQ ID NO:5 is replaced above-mentioned SEQ ID NO:1; SEQ ID NO:6 is replaced above-mentioned SEQ ID NO:2; SEQ ID NO:7 is replaced above-mentioned SEQ ID NO:3, simultaneously SEQ IDNO:8 is replaced above-mentioned SEQ ID NO:4, other pcr amplification system is identical with condition.

(4) pcr amplification product that obtains of step (3) combines to carry out the strand purifying with the magnetic bead of avidin mark:

● before use, guarantee that all solution all reach room temperature;

● in PSQ 96 plates, add 45 μ l annealing buffer, every then hole adds SEQ ID NO:2 sequencing primer (10uM) 1uL;

● use Vertex mixing Sepharose beads; The sepharoe beads total amount (every sample 3 μ L) that needs use is transferred in the Eppendorf pipe; In sepharose bead, add binding buffer; Make average each sample that the volume of 50 μ L arranged approximately, with the mixture mixing;

● above mixture is added in the PCR product (50 μ L reaction volume), and every sample 50 μ L with PCR product mixing 10 minutes at normal temperatures, make beads combine with vitamin H;

● in Vacuum prep workstation, add 180mL high purity water, 70% ethanol, washing buffer and 120ml Denaturation buffer in four sample panel successively;

● open the pump of vacuum prep workstation, vacuum prep tool was cleaned in high purity water 30 seconds, then vacuum prep tool is moved on in the PCR plate; Grasp sepharose beads, vacuum prep tool was put into 70% ethanol 5 seconds, moved on to then among the denatureation buffer 5 seconds; Move on to again among the washing buffer and cleaned 10 seconds, be placed on the corresponding top of containing the plate hole of sequencing primer to suction nozzle, do not contact liquid level; Turn off pump; Vacuum prep tool is put into the plate that contains sequencing primer, shake, discharge sepharose beads;

● use high purity water to clean vacuum prep tool.

With the PSQ that is placed with sample 96 plates be placed on be heated on the ThermoPlate 80 ℃ 2 minutes, put into sequenator behind the cool to room temperature again.

The PCR product of the purifying that (5) step (4) is obtained carries out the tetra-sodium order-checking;

(6) kind is judged in the comparison of sequencing result and American National biology information technology center (NCBI) DB.

The inventive method is used for the evaluation of 8 routine clinical sputum specimens, and sequencer map is shown in Fig. 1-8.The inventive method and sputum specimen divide through microorganism culturing, pathogenic bacterium and compare with the microbial identification system of French biological Mei Liai after pure, and the result is consistent.

Claims (2)

1. this bacterium of sputum sample quick identification kit is characterized in that it comprises:

(1) universal primer of the V1 variable region of amplification bacterial 16 S rRNA: its nucleotide sequence primer shown in SEQ ID NO:1 and SEQ ID NO:2 is right;

(2) special primer of the V1 variable region of shielding neisseria bacterial 16 S rRNA: its nucleotide sequence primer shown in SEQIDNO:3 and SEQIDNO:2 is right;

(3) special primer of the V1 variable region of shielding veillonella parvula 16S rRNA: its nucleotide sequence primer shown in SEQ IDNO:4 and SEQ IDNO:2 is right;

(4) sequencing primer: its nucleotide sequence is shown in SEQ ID NO:2;

(5) magnetic bead of avidin mark;

Wherein, SEQ ID NO:1 is at its 5 ' end mark vitamin H;

Above-mentioned primer uses in one-time detection jointly.

2. this bacterium of sputum sample quick identification kit according to claim 1 is characterized in that also comprising following 6 group reagents:

(1) liquefied reagent: 0.2MNaOH;

(2) washing reagent: 0.9%NaCl solution;

(3) DNA extraction reagent: 5% (w/v) g/mL Chelex, 100 damping fluids, 20mg/mL Proteinase K;

(4) reaction solution: PCR Buffer, 2mM MgCl ₂, 0.2mM dNTPs, 2U/ μ L Taq archaeal dna polymerase;

(5) strand purified reagent: 75% (v/v) ethanolic soln, 0.2M NaOH, 10mM pH 7.6Tris-Acetate, binding buffer liquid, annealing buffer;

(6) sequencing reagent: archaeal dna polymerase, ATP sulfurylase, luciferase, apyrase, substrate A PS, resorcinolphthalein and dNTP.

Images