CN101864435B - Turbot reovirus whole genome and application thereof - Google Patents
Turbot reovirus whole genome and application thereof Download PDFInfo
- Publication number
- CN101864435B CN101864435B CN2010101623459A CN201010162345A CN101864435B CN 101864435 B CN101864435 B CN 101864435B CN 2010101623459 A CN2010101623459 A CN 2010101623459A CN 201010162345 A CN201010162345 A CN 201010162345A CN 101864435 B CN101864435 B CN 101864435B
- Authority
- CN
- China
- Prior art keywords
- reovirus
- turbot
- sequence
- sections
- turbot reovirus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a turbot reovirus whole genome as well as a preparation method and application thereof. The method comprises the following steps of: A. extraction of turbot reovirus nucleic acid: extracting turbot reovirus dsRNA (double-stranded Ribonucleic Acid) by using a Trizol Reagent; B. artificial joint connection: carrying out agarose gel electrophoresis on purified virus nucleic acid and recycling all sections of dsRNA by using a gel recovery kit; C. reverse transcription: carrying out reverse transcription on the dsRNA connected with an artificial joint by using a primer; D. PCR (Polymerase Chain Reaction) amplification and sequence detection: carrying out PCR amplification on 2 microliters of cDNA, cutting off an amplified belt, connecting the amplified belt to a carrierafter recycled and selecting a positive clone for sequence detection; and E. expression of an NS22 gene in a fish culture cell and confirmation of an initiation codon: designing and constructing a nucleotide sequence of a 1-613 basic group in the S7 section in a carrier into an eukaryotic expression plasmid. The invention also provides application of a turbot reovirus gene sequence and the coded protein thereof in preparing a turbot reovirus diagnostic reagent or being used as a cell fusion inductive agent.
Description
Technical field
The present invention relates to hydrocoles virus; Be specifically related to a kind of turbot reovirus genome; Also relate to the application of a kind of turbot reovirus genome in virus detects, particularly from the function and usage of turbot reovirus S7 sections clone's an inducing cell fusion rotein.
Background technology
Reovirus is to have the genomic virus of segmented double-stranded RNA, extensively infected person, other vertebratess, insect and plant.The early diagnosis of virus disease and vaccine immunity play keying action to the prevention of virus disease; And virus genomic nucleotide sequence can be used as the specific molecular marker of the inside and outside virus of detection bodies, also is the target of development antiviral and the basic material of virus vaccines.Therefore, separate, identify that aquatic reovirus and genome thereof are the preconditions of the hydrocoles virus disease being carried out molecular diagnosis and development virus vaccines.
Aquatic reovirus is the reovirus that infects hydrocoles.From multiple ill hydrocoles, be separated to reovirus at present, as from the grass carp that suffers from hemorrhagic disease, being separated to the GCRV cause of disease, this viroid cause of disease causes serious harm to each department, the Asia grass carp aquaculture that comprises China.According to RNA-RNA blot hybridization analysis and genome sequence similarity, Aquareovirus virus has been divided into six hypotypes (aquatic reovirus A-F).So far; The aquatic reovirus that has obtained whole genome sequence information has: GCHV 873 strains (Grass carp reovirus 873; GCRV 873), and America gold body bream reovirus (Golden shiner reoviru, GSRV); U.S.'s GCRV (American grass carp reovirus, AGCRV).Other has some virus strain partial sequences to measure (Attoui, H et al, (2002), general virology magazine (Journal of General Virology), 83:1941-1951; Mohd Jaafar, F et al, (2008), virusology (Virology), 373:310-321).The acquisition of genome sequence column information is for further relation between each virus strain of research and viral functional gene provide solid basis.
The symptom of virus infection and its virulence have closely related property.During existing known aquatic reovirus cells infected, but inducing cell merge, cause producing synplasm, caused typical cytopathic when this also is the reovirus cells infected.Turbot reovirus (Scophthalmus maximus reovirus; SMReV) be by our the reovirus cause of disease of isolation identification from ill turbot first; Belong to Reoviridae (reoviridae) Aquareovirus (aquareovirus) member; The important economic fish turbot of main infection, this viral genome sequence column information and functional gene does not also appear in the newspapers.
Summary of the invention
The objective of the invention is to be to provide a kind of turbot reovirus full genome, it forms length overall 24042bp by 11 segmented double-stranded RNAs.Each sections size is respectively: L1,3947bp; L2,3866bp; L3,3687bp; M4,2640bp; M5,2241bp; M6,2057bp; S7,1399bp; S8,1317bp; S9,1118bp; S10,986bp; S11,784bp.Wherein, encode the respectively structural protein of virus of L1, L2, L3, M5, M6, S8, S10 sections, and the Nonstructural Protein of other sections coding virus.The genome that utilization the present invention obtains can be made into available preparation or product through existing technology, is applied to the aspects such as detection and immunoprophylaxis of turbot reovirus.
Another object of the present invention is to be to provide the application of the full gene of a kind of turbot reovirus in virus detects.
A further object of the present invention is to be to provide the inducing cell fusion rotein of a kind of turbot reovirus coding to be used for the application of cytogamy inductor as preparation.
In order to realize above-mentioned task, the present invention has adopted following technical measures:
A kind of preparation method of turbot reovirus genome sequence the steps include:
The extraction of A, turbot reovirus nucleic acid
Use Trizol Reagent reagent (Invitrogen) to extract turbot reovirus dsRNA nucleic acid, see the reagent service manual for details.
B, connection manual splice
The viral nucleic acid of purifying is in 1% (W/V) agarose gel electrophoresis, and the band that each sections is corresponding downcuts, and uses gel to reclaim test kit (Fermentas) and reclaims each sections dsRNA.
The nucleic acid that reclaims adopts the tailing method to measure sequence.Use T4RNA ligase (Takara) the oligonucleotide joint P1 of synthetic to be connected to the 3 ' end of each sections dsRNA.Connect product with isopyknic phenol/chloroform extracting and purifying, be dissolved in 20 μ lTE solution.
C, rt
The dsRNA that connects manual splice uses primer P2 (5 ' AGTCTAAGTGAGGATGGCGGG3 ') rt.RNA composition in the rt product uses final concentration to remove as the NaOH hydrolysis of 0.1M, uses the HCl neutralization reaction.Add Tris-HCl damping fluid (PH7.5) to final concentration 20mM.CDNA was 68 ℃ of annealing 20 hours, and phenol/chloroform extracting and purifying is dissolved in 10 μ lTE solution.
D, pcr amplification and sequencing
Get 2 μ l cDNA pcr amplifications.Extend 2min in 72 ℃ in advance before the PCR circulation.The PCR product downcuts amplified band in 1% (W/V) agarose gel electrophoresis, is connected to pMD18-T carrier (Takara) after the recovery, selects the positive colony order-checking.Obtain the sequence information of each sections.
Confirming of E, NS22 gene expression and the initiator codon in the fish culturing cell
The nucleotides sequence of S7 sections 1-613 base is listed in pcDNA3.1 carrier (Invitrogen) design construction become eukaryon expression plasmid.Make up successful plasmid and use Lipofectamine2000 transfection reagent (Invitrogen) transfection in fish cell system, undertaken by the reagent operational manual.24h after the transfection uses nucleic acid dye Hoechst33342 to dye nuclear, observes down in fluorescent microscope.
As stated above, respectively with S7 sections 11-613,14-613,15-613, the nucleotide sequence of 18-613 base inserts the pcDNA3.1 carrier, transfection fish culturing cell system, observe phenomena.Follow the initiator codon of confirming the NS22 gene according to the appearance of cytogamy phenomenon.The result shows that the NS22 gene originates in non-classical initiator codon CUG, the fusion that encoded protein can inducing cell.
The full genome of a kind of isolating turbot reovirus, its sequence are the nucleotide sequence shown in the SEQ ID NO.1, and wherein 1-3947 is a L1 sections sequence; 3948-7813 is a L2 sections sequence, and 7814-11500 is a L3 sections sequence, and 11501-14140 is a M4 sections sequence; 14141-16381 is a M5 sections sequence, and 16382-18438 is a M6 sections sequence, and 18439-19837 is a S7 sections sequence; 19838-21154 is a S8 sections sequence; 21155-22272 is a S9 sections sequence, and 22273-23258 is a S10 sections sequence, and 23259-24042 is a S11 sections sequence.In step D, obtain, form length overall 24042bp by 11 segmented double-stranded RNAs.Each sections size is respectively: L1,3947bp; L2,3866bp; L3,3687bp; M4,2640bp; M5,2241bp; M6,2057bp; S7,1399bp; S8,1317bp; S9,1118bp; S10,986bp; S11,784bp.Wherein, encode the respectively structural protein of virus of L1, L2, L3, M5, M6, S8, S10 sections, and the Nonstructural Protein of other sections coding virus.This genome is acquisition first, and its sequence and encoded protein can be used for the specific detection of virus.
A kind of isolating protein, its sequence are the aminoacid sequence shown in the SEQ ID NO.2, in step e, obtain, and the gene NS22 that is comprised by turbot reovirus S7 sections encodes.Obtain the NS22 full length gene through pcr amplification, and confirmed the initiator codon of this gene through deletion mutantion.This gene cDNA total length 597bp, 198 amino acid of encoding originate in a non-classical initiator codon CTG, contain one and stride the film district.The albumen of this genes encoding can be applicable to the preparation of cytogamy inductor.
A kind of turbot reovirus gene order and proteins encoded thereof the purposes in preparation turbot reovirus diagnostic reagent.
Genome sequence and the albumen thereof of virus can be used for the existence of specific this virus of detection; With S11 sections proteins encoded is that example has been illustrated the application of virus gene sequence in the viral detection of drugs of preparation, through S11 sections encoding sox being cloned among the prokaryotic expression carrier pET32a (Novagen) vivoexpression; Purifying protein; With the purified proteins immune animal, the preparation antiserum(antisera) has been investigated the application of serum in virus diagnose reagent of antiviral protein.The result shows: the antiserum(antisera) of antiviral protein can be used as the existence that a kind of pharmaceutical agent detects virus.
A kind of inducing cell fusion rotein of turbot reovirus coding is as the purposes in a kind of cytogamy inductor.
Through the NS22 gene clone is arrived among the carrier for expression of eukaryon pcDNA3.1 (Invitrogen), in the fish cell of vitro culture, express, investigated of the influence of this expression of gene to fish cell.The result shows: this expression of gene causes that tangible fusion phenomenon appears in the fish culturing cell, and synplasm appears in cell.Explain that this gene can induce the fusion of fish cell.Owing to when the albumen of NS22 genes encoding is expressed, can cause tangible cytogamy phenomenon in fish cell, so this gene can be used as a kind of cytogamy inductor, in the fusion of inducing various kinds of cell, plays an important role.
Advantage of the present invention:
1. obtained the genomic full sequence structural information of turbot reovirus first, the sequence information that utilization obtains, detection turbot reovirus that can be special is sick, in agriculture prodn, can be used widely; The preparation of viral nucleic acid material programmable is produced in batches.
2. the purposes of utilization turbot reovirus genome sequence and protein Preparation virus-specific diagnostic reagent thereof is provided; Set up special, responsive, the localized diagnostic method of turbot reovirus disease; But standard operation, the quick diagnosis turbot reovirus is sick.
3.S7 the evaluation of sections coding inducing cell fusion rotein provides a kind of purposes of development of novel cell fusion-inducing agent.Expression explanation in multiple fish cell, it can induce the fusion between the multiple fish cell, thereby can be used as the fusion that novel cytogamy inductor is widely used in inducing other cell.
Description of drawings
Fig. 1 is a turbot reovirus genome electrophoretogram, and virogene is organized structural representation.
Fig. 2 is that the prokaryotic expression and the turbot reovirus western of S11 sections detects.
Figure A is the prokaryotic expression of S11 sections:
M, marker; 1, contrast; 2, abduction delivering.
Figure B is that western detects virus:
1 is contrast, and 2 is the cell of virus infection.
Fig. 3 expresses NS22 gene and deletion fragment thereof in fish cell.
Figure a, b, c are that phase microscope is observed;
Figure d, e, f observes for the nucleus fluorescent dye;
Figure g, h, i differ and the overlapping of Fluirescence observation picture.
Microscopic examination shows that the NS22 gene can induce the fusion of fish cell, and sequence 15-613 and sequence 18-613 all can not merge by inducing cell, according to S7 sections 14-19 bit sequence AUCCUG and eukaryotic initiation codon conserved sequence
A/
GThe NNAUG comparative analysis explains that the NS22 gene uses the initial albumen of non-classical initiator codon CUG synthetic.
Embodiment
Below in conjunction with accompanying drawing and examples of implementation the present invention is described further, but not as the restriction to interest field of the present invention.
Embodiment 1:
The preparation method of the full gene of a kind of turbot reovirus the steps include:
The extraction of A, turbot reovirus nucleic acid:
Use Trizol Reagent reagent (Invitrogen) to extract turbot reovirus dsRNA nucleic acid, see the reagent service manual for details.100 μ l viral suspensions are added 900 μ l Trizol reagent, put upside down mixing 5-10 time, 15-30 ℃ leaves standstill 5min, thoroughly lytic virus albumen.Add the 0.2ml chloroform, firmly shake Eppdorf pipe 15s, 15-30 ℃ leaves standstill 2-3min; 2-8 ℃ to be no more than 12, the centrifugal 15min of 000g; The careful upper strata water that takes out adds isopyknic Virahol mixing in another clean Eppdorf pipe, 15-30 ℃ leaves standstill 10min; 2-8 ℃ to be no more than 12, the centrifugal 10min of 000g; Deposition is with the washing with alcohol of 1ml 75% (V/V), shakes up afterwards at 2-8 ℃ to be no more than 7, the centrifugal 5min of 500g; Abandon ethanol, air drying 10min; Add 20 μ l DEPC treating water ,-80 ℃ of preservations are subsequent use.
B, connection manual splice:
The viral nucleic acid of purifying is in 1% (W/V) agarose gel electrophoresis, and the band that each sections is corresponding downcuts, and uses gel to reclaim test kit (Fermentas) and reclaims each sections dsRNA.
The nucleic acid that reclaims adopts the tailing method to measure sequence.Use the oligonucleotide joint P1 (5 ' PO of T4RNA ligase (Takara) with synthetic
4-CCCGCCATCCTCACTTAGACT-NH
23 ') be connected to the 3 ' end of each sections dsRNA.Undertaken by kit method, 20 μ l linked systems comprise 50mM Tris-HCl (PH7.8), 100ng dsRNA, 10mM MgCl
2, 10mM DTT, 10mM ATP, 50pM P1,40%DMSO, 10%PEG6000,20U T4RNA ligase enzyme, 15 ℃ of connections of spending the night.Connect product with isopyknic phenol/chloroform extracting and purifying, be dissolved in 20 μ lTE solution.
C, rt:
The dsRNA that connects manual splice uses primer P2 (5 ' AGTCTAAGTGAGGATGGCGGG 3 ') rt.DsRNA 10 μ l add P2 primer 1 μ l, DMSO 99.8MIN. 4 μ l, 94 ℃ of sex change 5min behind the mixing.Be to add reaction buffer 5 μ l, RNA enzyme inhibitors 1 μ l, dNTP1 μ l, MMLV reversed transcriptive enzyme 1 μ l, H in the system of 25 μ l in final volume then
2 O 2 μ l.Rt was carried out in 42 ℃ of insulations in 1 hour.RNA composition in the rt product uses final concentration to remove as the NaOH hydrolysis of 0.1M, uses the HCl neutralization reaction.Add Tris-HCl damping fluid (PH7.5) to final concentration 20mM.CDNA was 68 ℃ of annealing 20 hours, and phenol/chloroform extracting and purifying is dissolved in 10 μ lTE solution.
D, pcr amplification and sequencing:
Get 2 μ l cDNA and add 10xPCR damping fluid 5 μ l, dNTP 2 μ l, primer P21 μ l, Ex Taq enzyme (Takara) 1 μ l carries out pcr amplification in 50 μ l reaction systems.Extend 2min in 72 ℃ in advance before the PCR circulation.PCR circulates as follows: behind 94 ℃ of sex change 4min, and with 94 ℃ of 30s, 58 ℃ of 30s, 32 circulations of 72 ℃ of 2min reactions, last 72 ℃ are extended 10min.The PCR product downcuts amplified band (about 1.4kb) in 1% (W/V) agarose gel electrophoresis, is connected to pMD18-T carrier (Takara) after the recovery, selects the positive colony order-checking.
Confirming of E, NS22 gene expression and the initiator codon in the fish culturing cell:
The nucleotides sequence of S7 sections 1-613 base is listed in the pcDNA3.1 carrier design be built into eukaryon expression plasmid: use primer P3/P4 (P3:5 ' ACTGGTACCGTTTTAGTCAATCATCCTG 3 '; P4:5 ' ATTCTCGAGTAAAGTC AACGGAAG 3 ') amplification, amplified production and pcDNA3.1 carrier be double digestion simultaneously, uses restriction endonuclease Kpn I and Xho I.Enzyme is cut product and is used the T4DNA ligase enzyme to connect, and transformed into escherichia coli is selected positive colony then.
Make up successful plasmid and use Lipofectamine2000 transfection reagent (Invitrogen) transfection in fish cell system, undertaken by the reagent operational manual.24h after the transfection uses nucleic acid dye Hoechst33342 to dye nuclear, observes down in fluorescent microscope.
As stated above, respectively with S7 sections 11-613,14-613,15-613, the nucleotide sequence of 18-613 base inserts the pcDNA3.1 carrier, transfection fish culturing cell system, observe phenomena is to confirm the initiator codon of NS22 gene.The result shows that the NS22 gene originates in non-classical initiator codon CUG, the fusion that encoded protein can inducing cell.
F, experimental result:
From 100ul turbot reovirus suspension, obtained highly purified viral nucleic acid material; As shown in Figure 1; In 1% agarose gel electrophoresis, show 10 genome bands clearly, and obtained the turbot reovirus genomic information first, as shown in table 1.
Table 1 turbot reovirus genomic information
Embodiment 2: turbot reovirus gene order and proteins encoded thereof are applied to the preparation of turbot reovirus diagnostic reagent.
Be that example explanation turbot reovirus genome sequence is listed in the application in the viral detection of drugs with S11 sections proteins encoded below:
The vivoexpression of A, S11 sections:
The nucleotides sequence of S11 sections encoding sox is listed in the pET32a carrier design be built into prokaryotic expression plasmid: use primer P5/P6 (P5:5 ' GAAGAATTCGGAGCAGGAATG 3 '; P6:5 ' GCCAAGCTTACTCAAGACTCTACTC 3 ') amplification, amplified production and pET32a carrier be double digestion simultaneously, uses restriction endonuclease EcoR I and Hind III.Enzyme is cut product and is used the T4DNA ligase enzyme to connect, and Transformed E .coli DE3 selects positive colony.
The positive colony bacterium is cultured to logarithmic phase, and the adding final concentration is that the IPTG of 1mmol/L induces 4-8h at 37 ℃, and expressed proteins can be used affinitive layer purification.
B, Antiserum Preparation:
Purified proteins adopts the intraperitoneal injection immune mouse, and the per injection amount is 50ug.First immunisation is used Freund's complete adjuvant, back 4 use Freunds.Mouse blood was got in the 5th immunity in back 3 days.Blood is put 4 ℃ spend the night behind 37 ℃ of 1h, behind the centrifugal 10min of 4000g, draw the upper strata polyvalent antibody ,-80 ℃ of preservations are subsequent use.
C, immunological method detect turbot reovirus:
Immunological method detects can be divided into ELISA, and Western etc. are that example is set forth the application of viral protein polyvalent antibody in viral detection of drugs below with Western:
The protein sample that need are detected separates through 12% (W/V) SDS-PAGE glue; Electrophoresis finishes the back and changes film Sandwich according to the assembling of MiniTrans-Blot electrophoretic transfer system operation guide, and the electrotransfer system is installed, and changes film 40min with 70V voltage ice bath, and albumen is transferred on the pvdf membrane that the aperture is 0.45 μ m; The PVDF behind the film is changeed in ponceau dyeing, mark Marker after, wash film three times with TBST solution, at every turn 10min; 5% (W/V) skim-milk (being dissolved among the TBST) room temperature sealing 1h; Antiserum(antisera) is diluted among the TBST incubated at room 2h with 1: 500 Dilution ratio (according to the antibody titer adjustment); TBST washes film 3 times, each 10min; With the goat anti-rabbit igg (or sheep anti mouse) of 1: 1000 Dilution ratio adding alkali phosphatase enzyme mark, incubated at room 1h; TBST washes film 3 times, each 10min; Adopt NBT/BCIP colouring reagents box to develop the color, observe the colour developing situation at any time, purpose is taken now out of and is washed termination reaction with flowing water; After film dries, deposit figure with the scanning of gel scanning analysis system.
D, detected result
Use S11 sections encoded protein successfully to prepare the serum of antiviral protein as antigen, shown in Fig. 2 A, the prokaryotic expression bacterial strain of structure has obtained a large amount of expressing protein (Fig. 2 A swimming lane 2) after inducing 6h.Still can the special existence that effectively detects viral protein after using this antiserum(antisera) with dilution in 1: 500, shown in Fig. 2 B swimming lane 2, obtained special band after the colour developing.The about 10ug of total protein that detects, thereby the precision of detection viral protein can reach Gamma Magnitude, has very high susceptibility, overview such as table 2.
The anti-S11 albumen of table 2 serum detects viral protein
Serum dilution | Normal control | Virus |
1∶100 | - | +++++ |
1∶200 | - | +++++ |
1∶300 | - | +++++ |
1∶400 | - | ++++ |
1∶500 | - | +++ |
1∶1000 | + |
"-" expression does not have the positive signal of detection, and the quantitaes of "+" detects the power of positive signal.
Embodiment 3:NS22 gene is as artificial cytogamy inductor
A, the nucleotides sequence of S7 sections 1-613 base listed in the pcDNA3.1 carrier design be built into eukaryon expression plasmid:
Use primer P3/P4 (P3:5 ' ACTGGTACCGTTTTAGTCAATCATCCTG 3 '; P4:5 ' ATTCTCGAGTAAAGTC AACGGAAG 3 ') carries out pcr amplification;
B, amplified production and pcDNA3.1 carrier be double digestion simultaneously, uses restriction endonuclease Kpn I and Xho I.Enzyme is cut product and is used the T4DNA ligase enzyme to connect, and transformed into escherichia coli DH5 α selects positive colony then;
C, make up successful clone in the substratum that contains the ammonia benzyl, 37 degree are cultivated 12h, make to spend endotoxic plasmid extraction kit (OMEGA) extraction plasmid, are undertaken by operational manual;
D, the successful plasmid of structure use Lipofectamine2000 transfection reagent (Invitrogen) transfection in fish cell system, are undertaken by the reagent operational manual.24h after the transfection uses nucleic acid dye Hoechst33342 to dye nuclear, observes down in fluorescent microscope.
After E, the about 2ug of use contained the plasmid transfection cell of NS22 gene, in 24h, tangible fusion phenomenon appearred in cell, and like Fig. 3 g, shown in the h, the cytolemma that shows as flanking cell is fused to together, and nucleus is assembled the formation synplasm.And in the cell of the different cells of fish of the same race and different fishes, all can cause the fusion of cell.
According to observations (Fig. 3), the protokaryon of NS22 gene or eukaryotic expression product can be used as a kind of artificial cytogamy inductor that designs, and are used to induce the fusion of other fish cell or zooblast.Also can be used to promote the fusion of allogenic material and cytolemma, and then help allogenic material entering cell.
The protein induced different cytogamy overviews of table 3NS22
Cell | Inducing cell merges situation | The cytogamy time of occurrence |
Grass carp fin ray cell | Good | 16h |
The grass carp kidney cell | Good | 24h |
The grass carp gonad cell | Good | 24h |
A fertile carp cell | Good | 16h |
Sequence table (SEQUENCE LISTING)
< 110>Inst. of Hydrobiology, Chinese Academy of Sciences
< 120>full genome of turbot reovirus and application thereof
<130>2
<160>2
<170>PatentIn version 3.1
<210>1
<211>24042
<212>RNA
< 213>turbot reovirus
<400>1
guuuuaucac gacauggcga ccguauacgg cauucaacuc acugaccgac ugaacaccgc 60
aacuguccga cgcccccuua gacuucgacg cuacgacuca uacauuacca cuuuuaccac 120
uccuaauggc aucucccaac uguaccgcgc ucuggauuuc caaccaacuc aguuuagcgc 180
uucuguuuua caaacuuucc cuccacuuaa cgccuggagu cccgcuccuc aauuccuucc 240
cgaugaucua gaccuauccc aguggaaaga auggauuacu gaucgaaugc gaucccuugc 300
caccguacuu caacgugcuu acccacuagu agccaacuca cgucgggagg ugaaccccau 360
cguuaucggu cuggucacau cagcguuccu caaccaacgc ccaauugagc gauuucuucc 420
auugcuauuc cuucgaccag gaaaccgcga uccuaucgcg cccuugguaa cgguggaugc 480
cacuuucucu gacgauaccu acgucucaaa ccguguucug uacacgccug ccggucucaa 540
guaucuaacc uuaaggucgu augauuccac gaaaucaucc gcuaucugua ccuucgguaa 600
acacguucca uucuacgcca ucgcugcuuu cuaucccgac gagcacgccc gacugaccau 660
ccuccaucgu uacaacggcg gaccaccucu aauagagcau uuugaucaac caacguacgg 720
accccacgua cucauucccg cacuuggcuc cccugagggu uaugauacgg ccaagccgac 780
guucgccgau cuccucuuga cugagggacu ucucgauuca uuccgccuaa acgccucagc 840
cggccccuca acugccgugg cucguaucga ccagacuuau cauauuguca ugaauggcaa 900
cccaagugau cacacccagu uggccacucg ccuguccaau cugucacuac ucgcugucca 960
agguugucag augacgguuc agguuguuga ccauccaucc augucggacg ucuguggcuu 1020
ucuagugcgc cuucucggcc ccggugaccc ucaacgguug cucaacuauc aaaccgauca 1080
gauucuaauc uggcaggcua gccccuuccc cuuugguaac aacccucguu auaucagacg 1140
ucaaggucgc guaccguuca ccgucgguaa cacgacguac gugccagaca ccaagacccc 1200
acuaccguuc cuuccccagu aucggcgugc uguugugaau aagaacaacg cucuggcguc 1260
auaccaagag aaucucuugc cuaguuuacc aaucuaccac gguuucgcuc ucaccggugg 1320
ugccuucuuc caaucucgug acauuacugg ugaucccgcu aauguauggc cggugaauac 1380
uaugccuacu cugccucaag acuauuuuag cauccguucc aggcagcguc gcgagcuacu 1440
cucccggcug cgaucaccgu cagaucguuc guacaucaag gaccuucaua acaucucguu 1500
cgcugcuacc guucucaacc ccgugaauaa ucagaucguc cucucugaag guuucuccau 1560
ggcuuaccuu ggcgccgccu ccacccacgg ugcaucggau caaccacuca ucaucgacgc 1620
gcucaagaau ggaacugucc caggaguccc cgugccaucc aaaguggcuc aauuugguua 1680
ugacgucgcc aaugguagca ucauggacgc gacucucucg ccaccaacug gaacguucuc 1740
cuuuguuuac ucagacgucg accaagugga ggacgcuggc cuauccaucg uugccgcuaa 1800
ccgggcugca gcugcuguga cgaccgucgc auuauccaug acuacggcag guggucuaac 1860
gaucgugaag auuaacuucc cgacucccgc uuucuggacu cacuuguucc ggcagcacgc 1920
caugcaugcg cgcgcgaugu acauccuaaa accguugauc gugaacucag uggaggucuu 1980
ccuccuguuc gucagccgcg cuuccgacgg uaaccugguc uccucccccg ccuugcggca 2040
auuccuaguc cagcuuuuug acaggucagc guaucuaacu gacuugaugg cucacguccc 2100
uuugcucggu gauguagaug auggcgcgac cucccucggc uuuaacgcuu gucgacugua 2160
uagcccugac cuccccucua cuaacgucac gcccgagaua cagacucuug ccuaccaacu 2220
ggcuacgauc gugccgucca ccucguucau cgcccgugag gauuaugaug gggcuacagc 2280
cgucacguuc uacgguaaac guacauuccu gucccaaaac cgccuugacc guuugguaga 2340
cgucccaguu cccgcaacca augccaucaa ucaucagacg cgcuucacug gcuccccggu 2400
guaccagcug uuuccugcca aucccgcucc ugucacccaa cuucucgcug gcgcguauaa 2460
ccguuuaguu cacucucagc ucgcucgugu ccagccccaa gcucuagugg acuguggaac 2520
ggguccggaa ugccgcgucc ucucgcucau accucccacg acugcuauca ccaugauuga 2580
cgcgcggccc ccggcugaau ugcuugcagc cuucaauccg gcuaugaacc aguacauuga 2640
ggaugacuuc cuuaacccgg cucuuugggu cgcgcauccg uaugacgccu uaaccgcuau 2700
cuucucuuua ggagcugccu ucgcaggugc caacuuagau cuugucgucg gucugacagc 2760
cuuccugcgc cuuguucaac cagguaaccu ccagcaccuu uggcugcagc uuaacacacc 2820
ccucacaucc aacacuucuc uccccggccu auuggagauu gacaccagga cuaaucaaua 2880
caucuucaac ggaggacagc gcaccgagcc cuacgcuuua cccaaugaca uuuugacugc 2940
agugcgucag guauuccccg cggccaccac cuccuggcug acugcuuccc caucgaugga 3000
uugggcugag uacguuaucg cucugggcuc cucaaugucg uuagaugacg ucaacacgau 3060
gaucacuuac ucaggccugg cucccauucu ucacauugau caaacucagc ggcccaugga 3120
cguuccugua ccuuugguug uuggagucca agcuaauauc caugucgcug cccccgucca 3180
acagaccacc guaauuggca cgaucgccgg cguucaaguc uuuaccgcug auggcgugac 3240
cgcccccucg accuugggcc ccuuagcugc cguuugggac gcugcgcuau cccguuggaa 3300
ccuuacucuc acgcccaauc aggccggagu cuuggacguu guuguggacc augcuggugu 3360
uaugcucaac cguggcucaa ccacuaucgc auuaccaccc gcuaccauca augucaccuu 3420
cccucaagcg gcuaaccgag acuacacuaa cgcugguaac gacgcggcca ucguaugcga 3480
cccuuuuuau cgucucgggg ucuucguuag ugugaacggu acuuuccagc ccguuaaccc 3540
agaacgugcc gccaucauua cugcugccaa cgucagaucu cuccacuaug uauaugaccu 3600
cucugacaau cacguucuga uguacauaug ugacaucacu gacaacaacg ugggccgcaa 3660
cauugccuuc ccgcucgccg acaucuucca aacuguguuc ccaaacaaua cuccacuccu 3720
cgccuccccc cccuaccccu cugccucggg ucgacuacug cugaauggcc agccguuccu 3780
agaccuggac ccccucccac cgguauuacc uccagguguu cagauccagg ccuuaucuac 3840
cgcggucgaa ccagcgcgcc agacgguuga ggugccagcg ggugucuacg uguauguggu 3900
uguuuagucu uggugagcgc cccgcgguuc gcgucgugcu auucaucguu uuauccacua 3960
uguccgcguu guucaacgcg cugccacccg agcuccagca acuuucacuc gcacuaucug 4020
guucccaacc acucaccgac aaaaccuuua ccgcugccgc ugaugccugg cauauccgcc 4080
cccgauccca agccuaccac cuacucgaua cccucacauu ucgauccucc gugguuaucc 4140
cuaacucuau cuucgucggu cgagucuggu cggauuauug ggccuuacag gacaacaucg 4200
ucauccgaau cagcccggaa ggugcgaaag acgccgacua uugccacaau ucgaacaucg 4260
caccuguccu gucgccucuu aagaagauuc cggaauaugg uacgcuccau ccgacgauug 4320
acaaggaugc aucugaacgc gguuacccuu cagcccgcau ggcgucuucc uucuuuaagc 4380
ucgccuccuc ccaagccaga caaguaaaga ucgauccaac uagguuucuu gaguuccuuc 4440
ucgucgucaa cgccaccacg cgagucccuu cgggugucga cucagaccag ccuaauccau 4500
gguuacccga auccaguccc gcgcuucaag cgauuuggca gauuaugcaa cgcuacaagg 4560
uagacuccaa guacuacgcu cccgcccucg uugugaacac cggagccguu ugguggauuc 4620
cgcccccagg ucgcaccaau ugcguaacug ugcaguuccu caucacugau cugauuaauc 4680
uagccgugaa cgcuuucgcc acucgguuau ccccugagcu ugagaugugu gcuguuagag 4740
ucuaccuugc cgcggcggcu acgcccaauu acgcucacgc ccuccucgau cugaaggcaa 4800
ucuuccccaa ucucagccuc cacagcaugg accgcagugg ugaauucggu gguaagugcc 4860
cucgcauuga auggacugaa ccgcguucau cguaucgauu caaauggggu ggugucacgc 4920
aacuucacga gggacuacgc ccccugaccc cgucacgcga cgagaaagcu auggaaaaga 4980
ugcgcgcgua uggcuuaagc gacgucgccc aagugaucau ccgaaugcgu caaucccacc 5040
cccgucacaa cgccgauuca gugcgguucg uccgugaugu acucagccuc acaaguggca 5100
uguaccuugu ucgaccucca accauguccg uccuccgaga guacucccaa accccccaga 5160
uugaagaacc cauccccccu gacuggugga cuggagcugu ugguucacuu gcuuacuuca 5220
acgaacgcgc caaaggacca cucucucauc ucuacuccgu guggcuggaa gcugcccgua 5280
aggucguuau ggaucccucg acgcaugacc cucugacaca agccaucuac aagacucaau 5340
uuguuacccc ucgcggaggc uccagcgccg cccucaagca agcccuagcc gagagcaaag 5400
uugaguugcc cgacuucacc aguacuggcg ucaaacgauc cucuaagauu uaccagaccg 5460
cccaacuugc ccaucucagc uuccaagcuc ucauuccagc cauuaugggu caagucacuc 5520
ucggaauuag gaaucaagug caacgucgcg cccgguccau caugccuaug aguaaccccc 5580
agcaaacugu cucgguucca cacacuuugg uggcuaauua caucaacaaa cacaugaacc 5640
gaucaaccac uucugguagc gccguucagg auaaagucau cccucuccuc uuguacgcuu 5700
cgaccccacc gaggacuguc aucaaugucg acaucaaggc cugcgacgcg ucgaucacau 5760
acgcggccuu ccucgccccg aucuguggcg ccaugcauca aggcuucgac cucggugacc 5820
cauccgcucc guucaugaac guucccucgu ccacccagua cgaccgucgc aauccugagg 5880
ccccauacaa ucguccuguu uccggucucc agacaaugac ccagcaccuc gcgaaacuuu 5940
accaagcugg cuucuccuac aaggucgaug accccuucuc caguggcaac agcuucgucu 6000
ucccuaccac caccuucccc ucagguucca cugcuacauc uaccgagcau acugcaaaca 6060
auggagcuau ggccgacuac uuucuccgcg aguacguucc gcaacacgcc accuccagca 6120
cucugaaauu caucguuaaa gacaugacca uucagaacaa cuaugucugc caaggugaug 6180
ucggaauguu gauccuucca gaucucggca cuaagagagu cuccccugau gaccuggccg 6240
aguugauguc auuguuagag aaguacggac gcgguuucgg cuggguuuac gacauugaca 6300
guuccgauuc agcugaauau cugaaguugu acgcccuguu cggugcacgu auccccaaca 6360
ucagucgcca uccccccguu ggcaaagagu acgcuucccc ugaaacuggu gagaucuggc 6420
caucccucgu gaacaucgcc augggcuccu ucuacaacgg cgucacugac ugccucgaau 6480
ggcgugauug guuaagguuc aguugggcau ucgcauguuu cgccucccgu gguuccuucc 6540
auccgaagau ugguccucgu gucgacgcgc aguaccccgu gugguccuuc auuuacaugg 6600
gcuuaccucc aauccuccuu ccuggccaga ccccguuccu uaccucggua uacaugccug 6660
cgggagacca agguauuuuu gccaucuuac accaguggcg cgacuauuua accgcccggg 6720
ccacugccga auauccacca cucacgcgcc gccaccccgu cuggcaguug gccgacguuc 6780
ccucucuucu agcugaccuu ggcguuuacc guggcuacug ggcugcucag gucucccgcc 6840
gacccgaacc cucaccugau gacgccgacc cgaccaacgu ggaagcgaug agugcagcuc 6900
ucuccacuua ccuucucaaa gauccagugc uccgcgaccg aguuguucgu gguacuaacg 6960
cauggcggcg ucucaccgau ucccaacccg gucgcuuacc uucucgcgug cccucccuac 7020
uugauguccc cacucguugg auuaaagcug gacgugacgc ugaaaaaccc agacccucgg 7080
cuguugccau gaugaugaag gacauucaac gcgcugcuag cucuucacgc aaggacuucu 7140
cucgucuucu ugaacuguac cugcacgucc auguccaccu uggaccaccc guaccccucg 7200
cuguugaucc cgaaguaccu cauguugcug gugcugacau ucuuaacgac gaccacuggu 7260
auaaagugac cucccucggu cccaucgcuc aauccaccaa gaaguguuuc gacgcuaccc 7320
uuuucgucgg aaagacuguu ucaggacuag acguugaagc cgucgacgca accuuacucc 7380
gucucucuau ucuuggcgcu gaaccugaag aguaccacgc uuucuuagcu ggcauuggca 7440
ugucugacgc ugaagcucau cgcauugcua gcgccaucuc ucuugcagac gcucagauug 7500
uccaacucgc ccgaaccguu aaucuggccg uccccucauc cuggauguca cuagauuucg 7560
acacccuaau cagaucacac ucauacccac gucagcccgg uaucagcgac uccucuacuc 7620
ucgucaggga acgcgcgucc uggauaaauu cgguccuucg acucuuaugc gccacugucg 7680
ccaugacucg aguuggaccu guaugccaag cgacuguugc aaguguugau ggugguguga 7740
accaaaucgu cggguguuug cgugccugga ugcgggaugu gugagccgug cggcgggcag 7800
ugguacaauc aucguuuuau caucacgcau caugccacgc accucgcgua acguacgcgc 7860
caccgagguu gcuacuacug ccauuccucc uaccaaugcc gccacugacu ccaccgucga 7920
cacuacuacu gcuccaacua uugcuagugc agaugcagcu caacaugcuu cacacaucac 7980
aucagcucag cuuggagcag cuggaauagc agacaaaguc cccucauccg ucgucacuaa 8040
cgauggagac auuuccguca ccccuauauc cgagaacgca gcucagcuag cgucuuccaa 8100
ccaacccgcc ucagucaucu caaacccagc aggagccgcc ucugugucca uugucaaccc 8160
auccgcuuua cgcugccaac aauguggugc cgaauucuca uccaugacuc agcuggcuga 8220
acauguccgu acugaacauc gaacuggugc agguucacuu gucacaucgc cagccaucaa 8280
ccaagcgauc gaguccuggc uccucaccug ggaagaucuc cgucuucuag cacccaccau 8340
cgccaccgau gcccucaaca aguacauggg ugaaucuguc gccaaggcgc cccuucugau 8400
cauugaggac ucaggucucu gcacauccuu ccucgcuuca gacaccgucu caaucgcugg 8460
ucugcaacgu gaacucgucg gauucacaug guucauggag acccuccaaa ugauccccgc 8520
guuacccgag ggugccguua aucaucuuau cugucacacc gguugggcau caaaagacuc 8580
cgcaucccgc aaccuaaacg uuaggcuauc accacccacg cacggugccg ucucagcaua 8640
caccacagug cuguccaaag gcuacgugaa agauaugcag uuuaaucucc auaccuucag 8700
agcuaacgcc cucaugcuua gccucaaguu cgugcugucc aaccucaaga uuaacaaguc 8760
cacuccccua acccaagauc agacuccacg uucccgaggc cgcuacauca gauuccauga 8820
cgacaaggaa uugcucgcug uugcauaccc cggucgugaa gugcucaugg aggccaaccg 8880
uaacgcccuu uuccucgaug aagccauccc agaucgcguc ggucguauug gucgugcuca 8940
gaacguuucc ggugauguca gugcucacau cgacaccuac gagcuuugug acgaccuaac 9000
ccuggccauu cgggagaugu aucacaacau gcuguucagc augcaccugg auccugcguc 9060
ggugauggaa auuguucagg augugucuca gcaacugguc gccgccucca uuccauucgc 9120
ucaaacugac accauucugu gccccugggc ugcaucaucc ccuacucucc agcuuggaca 9180
gguucugaac cugcugaaug uggcuaacaa uacaucagcc gcucuucccc uuaucgaagc 9240
cgccgcuacg cucaucaugg gcaucacccc acuccggaug gaaccuagga uuuugucaga 9300
agccaucaaa cguguaccag agaccacuac caucgugccc ucucccacug gugagcucac 9360
acgucuacua aaaccguugg guaaugacua uucugccuuc uaccgaugca uugcuggcug 9420
gcuguauagu gguaucgucc agacuuucau cuccgcggac ucguacccag aucccacgca 9480
guccaucacc agcauuccag ccauuuggaa gucucucauu gugacguugg ccgcgccgau 9540
gacaacagac ccccacgcgg cugugaaggc cuucaugucc auggcaaauc ugcuggccca 9600
accagagccg aucauuaucc ccgcuccugg caugacucag uccacgcccg ccguucaguu 9660
uggacacccc gaaguguggc caccagguuu uauugauccc accaccuugg aucggaaccg 9720
gaccccccug cuucacgcuc ucgccaccau gauccaugcg cauuggccac aaccuggagu 9780
uaucccguac ggcagugcuc gccuugguuc cgccaaccug uuccuccccg ccaaucagcu 9840
ggcuuauccu uggcccacac aaccccuucc ccgcaucacg guagguccua ccuaugacuc 9900
cgccauguca cgauggauug acaacguuuu cggcuuuuac aucaacgucg uuaauucccg 9960
auacgucgca acgaucguag gugacacuac ucgucggacc cucauuggcc ugauguccgc 10020
cuuacgacag gugaagacga ugacuccauu cuacaucgag cguaugugcc ccacugagau 10080
cgccguugug gguggaguua cagucgugcc cccguuucaa gugccauucu cacgguuaga 10140
ccccgaucag gucaucacca acgucauggu uucgcgcguu gacccccaac uucgugcuga 10200
cgucgcaguc gaccccaucg ucaccaugcc cacccuggcu aauucccuuc caguggaccc 10260
agcggccauu gucguugcca ugcugugcgg ccagacagac gcaacucucg ucccuucgua 10320
ccacuaugga ucggccauca cgccaauguu ccuguccgaa ggaaucuuca cacgaaacca 10380
acgcgccguc aucgcaagug aagccuucgu gugcgcucga ucaaucaucg cccagugcau 10440
ccccgauggc uuucagguac cccggccucu gcaagccuuc aaccaguaua acgcgucugg 10500
gagcaccgcc gccgaucucc ucaaagcagu ggacgauaug uucaaaaccg cguucgaccu 10560
ugacggcucg uugaucgagg gcauuggauu auauggugac ccacgugucg cagaucuauc 10620
gguugcauac auacgucaaa acggugcugu ugaacggguc cacacagcuc cugacucauc 10680
cuucauucac gaagcgaugc aagugacuuc ucagguuaug aucaacgaac cgaaccugug 10740
ggcaaucgcg agaggugacg ucauucuggc ccagaacgcg accaacaaca auugggaccc 10800
caugaacccg gucggccuuc cccuuaucgu uagaggcgcu ccuggcguac gugucgucgg 10860
ucagcauggc augaucaucc cucaaccugg uggcuucuca cccaugauua gagacgaaac 10920
uggcaacccc cagcccaucg acggugauug gaucuauccc auuagcguuc uccaaguuuc 10980
gguagccaac uuccgugauc acgucuggcc caugauccaa acuggccgca cgcgcguacg 11040
caucgagaug ggccacuuuc ucuauuccau ccacuaccac gaacccuucg gucagaucac 11100
ugaagccccc gcuuuggaug ccuggcuugc uggcauuucc ccgaccggug ucccaccuuu 11160
cccguucagc gcaccuaucc cccagaucaa cauucccauu acagcgcgac gcguguacuu 11220
cgguuacugu acuaugaaca acaacggagc aaccuucucc acucugggag ccgccauuca 11280
guccgccugg gguacugaug uaaccaucca acgcaaucga uggccagcgc ugauugaucc 11340
cgccuacauc ccgggccauu cccaacuucc cgcucguauc caacuguaca aucccuugcg 11400
ccgcuacaac uaccgcuacc ccgugcugaa gggcauguug uauauccccg guguugagua 11460
agcgugcgug ccgcgcgccu ggcuaguggu gauuuucauc guuuuaagug aacugcucga 11520
gaagauggcc gcccgcauca accuccgaau gcucagugcc gacucuaguc uuacuacaaa 11580
caaaccgucu accccuuccc auccuccuuc cgacaaccca uccaccuccg ccgcagccgg 11640
cuuccagucc cugccuaacc uguccuuccg uuccccaccc accugguccc ucaccuacaa 11700
agguguugcu uuccauggcg ucugugaccc uccuugcgag ccuuucaucc ccauugcugg 11760
cuaccuuagu cagaugauau cgcacaugac cccuuccucc gaaccccauc gcaucgagga 11820
ugucaacaac cugguugccg uuggucuuuc ccagcucggu guaacaccca gcaugucucu 11880
cggcgaagug gaaguccuuc ugaaugaucg uguggcucgu guccaugacg gaucuggccc 11940
uuucuucgac ccuguccccg cuccgguucc ugcuccucuc uccccuguuc cagccgcuac 12000
ugucucuccu cccccacccg caccucccgc aucucuggcu ccggccguca ccucccuuaa 12060
cccggcucuc gccgcagccc ccacccucaa gcccuccucu gucccgacug gcacccagac 12120
ccuccucaug ccacuccaac ugaccgcugc caccucuacc gcuacaccga cugccucccc 12180
uacugugacc gacgcucucu ccaccacccg ugcugacugu ggcccgacau ccgugaacga 12240
acccuccacc cugugguccg aaucugcucu ggaugaauuu gauggcccug cucacuguuc 12300
ucucgcuacc aauccaccuc ugauugaugg ccgccuguac ucccaagucg uucagccccc 12360
cgucaagccc gucgaccagu ucaucgugug ugacucacgu cgugugucca uugguuccac 12420
cuccaaggcu uccucugucg cuagcgagac cccggcauug auggagcuua augucacccc 12480
agcuucgacu gguccccguc guccuccucg cccugccccc ggccccuucc caccucggac 12540
ugguagacgu agggcccacc auaucgcuga cgacaacacg uacaaugagg cacguuuggc 12600
uuacgcucgc ggucgaccca cuacuucccc ucuguacaac caagguuugg agauucacuc 12660
cgagcgcgcu uucuucuccu ccuucccuca ccacaucaac ggcaaauggg uugcuccuac 12720
aucugugcuc aacgucguug cuggugcuga ugaggaucug aaugacucca ccauccacuc 12780
cguccgcgcc accgacugua gugguaugua cgaggucacc gcgaccaacg gcgaagucau 12840
cucccgacug aacgucaugu ucaucgacag ugacaccacc ucacaggcuc ugacucacuu 12900
caucaccccg cauucacuca uugcuauuac uccuuaugcc gccgcccuca ugguccaguu 12960
uagacucacc aaaggcgucu ucuccaaguc acaccgacgu auggucaugg ggauugaucc 13020
agugaugauc caccugaacu cgcguggagu ugcucucugg aacguccuua cucagcaucu 13080
gcuggaguac gccgagcuau acgccucugc cagucugagg gaucuuguca ccgcccugcu 13140
cgacccugug aaugucacca ccaugcgaug gaugaagcgc acgcuuccca auugugucgc 13200
agccgugugc gagaugcgua ccgaucccau ccccacccug ucccacauuc ugaacgucga 13260
gacccccacc acgccuguuu ccagugccgc cagcagccuc aaguuguccg aacuucaagc 13320
cgagaauacc gcucugacau cccagaucuc aaccuuggag gcccaacuug aggcagcuac 13380
ccucucucuc gccaccaccc gcgaauccau ccaacgugag caggcggugc auucagccga 13440
cucccuaaag caguaccucc augaccacgu cugugugaac ugucaugagg aaccauuccu 13500
uaacgcgacc guuggcgucg aagccgcugg ccagauucuc ucugcccguc agaaugcccg 13560
agagcgugcc gcugauaaag uucgucaggc ugucagugcu gguuucgccg agacugucac 13620
caugcuucaa gagcguaauc uuucccugga ucaacguguc aaagccaccg uagacgaauu 13680
gaaugccacc gccacacaac uccgaucugc acuuagccgu uugucguccg cagagggccg 13740
uucccaugac uugguucaga gaaaugagcu gcuugaaucc caacucgucg aagcccgcca 13800
gcucucaucc uaucaagaca gccaccagaa ggagaccauc accgcucucc agacuacuau 13860
ucgagacagc uuaccuuaca ccccagucca cuauggacaa ggccaauuca cuaugcccuc 13920
ccuuccaccc guccggucca ugaugccuga cuucgacccg ucagaccuuc ucauguaguc 13980
acuuacucgu uaucgaccuc acgcucugcc ucccgaccau gauuuaagcg cgccgauccc 14040
cacccgcccg uauucacccc auucccuuuu cccaggcuaa guccacuggc cuucucuggu 14100
uguugccgac ccucucuucc gaugcuucac ucuauucauc guuuuaugca cacgcgccag 14160
gaugauuacg auugucuuca ucccagguca cggcuucaac uggaacgacu ccaccccacu 14220
uaaguacaua gacucccgaa uauaucgaac ccgcaucccu aaagauaccc uuacccuauu 14280
cgcucccgcu ugguucaaau cccagcucga acacuacguu ggaacucacg gcauugagga 14340
aguuuacuca uggugccaac gcuugaucag uccccuuacu aaccgauucg uccuccuacc 14400
ccgaccuaag ucauucgcga aauggcucuu guccacuccc uccgcuaaca uuugggauau 14460
uccucguugg aaacucgauc ucgcugcugc aggcaaagcc cccccggauc uuuacgaugg 14520
aauacaucca uuauuagguc augacgccac cgucaccaag ucugucucgc ucaucgcugg 14580
ucaucccauc gucuacucac guacacguca ugucuuuggu gguccucuuu accuugccac 14640
cgauguuucc gccuauucug guuucaucaa ucagucagcc uuggacgcca ucuucaagca 14700
cgacgcugac cuuccguccu cucgccgcuc agcuguucau auuacuaucc ucccaaaccu 14760
gaccaacucc cgcuccuuua ugcucgaucu accugacuug acaaucgacc cagacuaucc 14820
acuuuccgcc uuucaugguc auuuaacacg uguaggacag aacacuaccc ggaugaugcc 14880
ccuagauggc cuaugcuggc gacugacacg ugguucggcu aaaccaacgu ggacuccaga 14940
guucgaugag gccuuuagac uccuucgacu uucccguccc gcugcaucgg augcucgccc 15000
uaacuuugga accgagacgg uguugguuca uguagaucuc acacuaaacg ucgacacccg 15060
ggacaauucg gcuccccgcg cuccgcuuca cguacacgua cugaaugugc cgcucgccua 15120
cuugacauug auggacuuaa aacuuucaca augcuaucca cuccguacag aagaugggaa 15180
caccguaccu ugguuccucg ugcugguccu gcuauccgau ggaguccaac uggcugguac 15240
caagagacca guguuacuac agacaucgau ugccgaguua cagcccuggu gggaagugac 15300
cuuaaaugcu uuccucaauc cccaugccgu gacggucaga uccggaguga uuaaagacau 15360
caugggagug gcccucgccc uacccaaagg aucguauaaa uccacguuca ucgacgugau 15420
cacuaagaac uugaguaacc cggacgccau cuucccucag gaaacuguca ccgacucgga 15480
cgauuuaggu gacucgcucu cccccaguuu cgaaaaucag aucauggaug uguggcaugc 15540
ucuugggacc gauguguugg agcaaggugu ccgcgccauu cuaacucccg gugccuacgg 15600
cgcuguguuc cccauugaga uauaucagga guucuccaag uuguaucaug acguuaugau 15660
ccccgcacaa cgugcucgcg cggcuuucau cucccaacgu ggcaggucac uuguuuacgu 15720
ccacacccca uacgagauag ucucugccaa cgucccgaug cagguagcuc cuugccaaau 15780
ugcccucgau ucaaugguca acguucucau ucgucacaag cguguuggcg gugucacagg 15840
ucaaguacug cucgaccauu gcuauagauu gaugggugcg acaacuacuc cgcaacccgc 15900
cggacuauac uaccggucuc uuuuuggccc auggcucgag cucgcggccc acccaacguc 15960
cacggucccc aucuggcuag agacagaggu auccgcccau acucuacgug aagucggcug 16020
guccguugac ggugaugagc cucuucucau uaacauccuc gagggucuug uuccgacaga 16080
cuccgucuuc uuggucaagc ugccccagcg uguacccuca cgugcauccg ucgucguaac 16140
cgcuguuacc gaccuuagga ucuccuuauc cccacccuua cccacccgca ugguucacuc 16200
uagcguacug cuccccguua caucagucgc ucgcuucaug gcgccuaacc gcauucuacu 16260
cgccgggacg ucgaucucag uacguggucc ugugaccugg augacaacgu cgucgcccgu 16320
ggcggagagc ggaucagggc cgucaggucc gugaaccccc acgagugugu gcugauucau 16380
cguuuuaucu ccuugcgccc uucucaauca ugggaaacgu ccaaaccuca acuaacgucu 16440
acaacguaaa cggcgauaac aaugcuuuca caccaacuuc cgagauggug gcgucagcuu 16500
cgcccgcuau ugaccucaaa cccggcgugc ucaaucccaa uggcaagcuc uaucaacuug 16560
aggcuggcuc agcuccagau ccuaccaacu uaauuuuggu ggucgacgca ucagagggug 16620
acuucucgua ccucaccaac aacacauggg agacacucag caaaucggcu uuggagacca 16680
acuccuggga accaauguuc agcgugacga ugaccgguug cgguccgcuc aaauugggug 16740
acuacacugu gacgaugucc ggcuacgucg gugccucucc aagugacgcc uucgauggug 16800
gugugaucga agauggcuca uucauuucca gucgaagacu gaagaacuuc aagcugaugc 16860
ucuccaacag gugugaagcc aucgcaaagu ggaacauguc cuugaaucaa gccaugucac 16920
uacugacucc cgaccugcuu gcuggaucug guuccuguaa guggaaaucc gucuugcagu 16980
acaugcagaa agugcuuccc ucugacaacg aggugcuuca guacccagau gaguucuaca 17040
ccguggcagu cggcaaguac cccgcgcuca agcccggauc cucgcccgau acucccccac 17100
cugcugcagg accccuuggc gagauagcau gugucaugaa cgcagccagc gccuccguug 17160
gucucaugag uggaucaagc gcacuccuca ccuccgccau ggacacccug gcugcaaaga 17220
aucuggaucu uguaugcgcu gaagccccgc ugccugucuc caccuucacc ccuucgcuag 17280
cgccacggga cuacaggccu gccuucauca aagaugcgga ugcccauugg gucacgucca 17340
uaaccccgac gacguacuuu cgcgugacga ccacccuguc cgccaaaaac uacucggucc 17400
agcucggccc aggcgcgacu aaaguuuugg acaugaaucg cauggucgac ucagaucucc 17460
ugcucgaugu caguggcaug cccauugauu ggaugucuaa ucccgacuac gccaccucgg 17520
ucgccgccau cguccuguug gagucacgcg uuccagcuuc agagaucucc gccgcugagg 17580
acaucacugg cguuuccauc guggcaagcu cgccgcuuuc aaucgucaau ucgaccguga 17640
acgugcgggg acaacacuuc cuggagaugc uccacuuaag gaccacuuuc gaacgugaaa 17700
ccaucgccgg aaagccauac aucuaugguc ucgggacucu guugcugcug ucccccacca 17760
ccgcgucaaa cucacggaac cccacucuga uggauggucu gcuaaccauc acuccaaucc 17820
uccugcguga cacgaccuac aagggcgaaa ucgucgagga gaucgugccc uccgacauuc 17880
ucggcaacca cacuucagaa gaaauggcug uagcguuagc aaacgaugcu gucguucuga 17940
uggagaauag cuugaaggaa guggcugaag ugaucggaaa cgccgucccc aucgcuuccg 18000
aucuugauga cagugccacc gcaucggucg uaagucgucu ggccaucacc gagaccgccu 18060
cuacgcgcuc acgauccaac aauccccucg cauucccaga uuucggagcu cucuggaaga 18120
aagccaagcg cgccgccuca cuguucgucu cuaauccgaa aucuguacuc caagucggug 18180
ucccaguucu cgcauccgcc ggggugaucg augcacucac gucagccguu ggcacaucug 18240
ucaggacggg caacauugga aaaggugucc aagaugcucu aucuauucuu aaagcacgaa 18300
auagugugac gaaguugagg cagggguucu ucucaaagau ugaggagcuu uggccaguac 18360
ucgaaggcua gacguguggc uuguccacgu cgcgcccuag agcccucggg ugacgccgag 18420
gggggauauc cauucaucgu uuuagucaau cauccugggg aacacuaucu caagcaccuu 18480
ucaguacacg guacugcaga ucgacagauc uugcuguauc aaaaccaguc ucaccgccac 18540
cuccgaagcc acuuccuggg ccauuccucc acucgcgauu uguuguugcu guugccucug 18600
uugcaccggc gguuuauacc ucguucacuc uggacguauu ccaagcauca gccgaagguu 18660
ggacgugcuc agagauaccc ggucagccuc agaauacaag gugcguagca accggaaccc 18720
aaagucacgu guacgucgcg uuagcaucag ugauucuagu gacucuagua gucucucuga 18780
ucuggaguug ucucggcacc ggucucaucc uuuggcgcau ucauucaggc cugagagcua 18840
uagccaacgc ccucauuccc ccucgcaagc ccagucgucg auuauccucc cgcucguacc 18900
uguccacucc cgaacaaguc uagacgaugg agucauucgc ucucaacccu cacgguauca 18960
gggaccccac cagcaauuug aggauuggcu ucaacaagca caucuccuac gaccuggaga 19020
cguaucccga gauaccaacc ccuuccguug acuuuauucc ggaaugcguc ccauccaccg 19080
aucgcuacaa uggugauccc gucccccuga ucuacgaugg ucgguugacc ccaguuaccg 19140
guccucauca ccuaugggaa auugacaguc augucgagug gcagaccugg ggcaaucucc 19200
guccauucuc cccauucagc guguggcccc cauccacccc uaacuggacc aacaggaagg 19260
ccauccacgu guucagcagu cugucaccgu augcguaugc cgcugagcgc agccaaaauc 19320
cacugucgua ucacuuccug aacgaucagg gucgugacug gggucgcuuc ugggauuuaa 19380
uuuggcgaug ugcucagacc cguggcgcuc guaucugcca ugccagcacu ucauucaucu 19440
ccuccaugcu gcggcugacu gaggaccagc ucucaaaacu cccagcggcu cgggacccaa 19500
ucgaacugcu caaugcugcu ggcugggacg cucuggcacu aaacgcccua ccacccaauc 19560
ugucccgcuc acugaugaga uccccuccaa accccuccgu cgucgucuuu gagugucuga 19620
cggauugguu ugacgucaug auucguguuc cauaugacgu ccaacauccg cucggucucg 19680
gucucaaccc gugccaauuc uggacucacc ccuuugucgu ucugugcuau cugcgcugga 19740
ggcuguuggg aggugaugac uaggauggcg accgcgacag uugagaccuu ggucucgggg 19800
auuuaguccc cugccgcagu cgugacuguu auucaucguu uuaucaucua uggcgcgucg 19860
cacuuuugua ggguucacuc cgagcuuuua cggccaaccu ggcccuuuau ucacugacaa 19920
cgauuaccuu gaccucgcug guacgaccgu ccgcccaugg cagaaccgca ucacaaacau 19980
ugcgauuaac ucuggugguu acccgguagg gggaggaaag uaucccacag ucgccucacg 20040
ccagcucauc cucaacgcgu ugcuuggagc ucacguaucc ccuuacgcag caggagcugu 20100
uaaccaguuu aauggcauug cuuggagaga cgcaccccuc aguucauucg ucaccauacc 20160
accagcgguc gcccccgcgc cuccagaucc uccaauaugg gucccagcug agaacguacg 20220
ucuugacuca aaucaguacc cuacauacgg gcugaaguuu gaugcuaugu ggccucaaaa 20280
ccaagaccuc cacaugauga cgaugugguc acugacugau cgcggcccga uagccaugcu 20340
caccuucccc ucccaaaaca ucccagcaau ggucgccacc uccaugaagu cccugaucgg 20400
agccuccgug gcccaaaucg ccauucgugc cuaucgcuac aguggucagc uuccacagga 20460
aggcgugucu auucaagccc aagucuacca auggcuugcg ugcauucucu ucggcucccu 20520
aaccggccgg uugcaucgug ggcgcacuug ugaagguuuc uucuuugcgu acucgaaacc 20580
ugccgcaagc caagaugaca ugauccuucg guggaaugau ggaccaagag cgagaaaacc 20640
cgucaaugac gucaccgucu acgucgccgc uggcucaccu cacuggcagc aguccauguu 20700
gcaugucucg uucgcuaugc ucgcgcaguc caccuccugu uugcgaccga uggcgacauu 20760
gauacgcaau cguaaccucc cagcgcgcuc ucacaauaua gccggacuga cuggaggugg 20820
uggugcuuug cgagaugugg aaagauacaa cgugccugau cucgcuuugc agugucaugc 20880
cgcguggcuc gcugacggua ucauugacgc uggagcgcug gcugcguacg augcugcuac 20940
uaacgcucag uuugucaacu ucauggcgca cauugucgcg acggaagcug ccaauccacu 21000
agcucguggu cggauuauug ugcaaccauu cgcggcugga gaugacgugg cccccuuuga 21060
aaccgcucag gugauugccg gagcgcgucg gauguuccuu uaggugcguc ccagggggcc 21120
aggacaaaac cccccugcca agaugacauu caucguuuua gagaucaccc ggaguagaca 21180
uggcaacccc aucagcuaaa cucaucaccc aagagaacac cgagcguguu acacgcuugc 21240
ucgagaacua uccgacauua agucugaccc uccgacagga caccuccaac cguggagcga 21300
uugaauccaa cuacagugcc ucuggucccg cugguucccu gagacuccug aaccccaucg 21360
cugugaacaa gaacccacau cagccuggcu acucucgccc ugaccccgag gcuacacgcc 21420
cucccccccu gcgcacccug aucaacgcug gccuugaugc ugcucugcaa cauggcucuc 21480
agugcccagu ggaccaagcu cugcguguau ucaucgagaa ggccugcccu cauuggcacg 21540
cugagguacu ucccaaugac uggacucgug ucugcccccu gacucuggcg ucucgcauca 21600
gucuugcugc agccggguuc gaccccaaca cucuugaccu ccaggcgcca ucauccacau 21660
caauggucau cgccuacacc uccaaggugc uuggccuaug ugccgaucug gccaacucau 21720
cccucggaua cuuccagaca uccgcugcug augcuauccg caaccccgac ucacucgccg 21780
ucgucaucac ucaguauggu uacgagacaa aagguuucca gcgacaggau gcccccaccu 21840
gcaucucccc uaacgaccug gacccuaagu acgacaucgc cuggcugucu gccaucguga 21900
uccugaucgc cuaccagcug gagcucgacc ugacugcagc aucacugucc accacugacg 21960
ugaauuccau guccacucac aguaccgcug ucgagacucu cauguucaag augaaguggc 22020
uagcccccuu cuccuccagg aucaugcauc ucugcgccgc uaaugcggcu aacccauucc 22080
gcagcuucag cgagauguuc uugauguggc agaaacccac gaaguaugug cuucccaaca 22140
ucaccaugaa acugucaggc agguuccugg agguuaucgc ugauggcucc gaguuguuca 22200
gugucuccag cucgcgggug ggagguaacu aggcacggcc auaggccuac ugccucauuc 22260
ucuuuauuca ucguuuuaua aagcacaccg guaaacacca uggagaccaa accaauucuu 22320
ccaacuauug cgacccaguu cugugacuca cucguccgcg gucauuuauc cggagcccau 22380
auugauggac aaugguccac ccaccuggau gaccccgaac ugcuaacuga cggcgguuac 22440
aucaucugug ccugcugcuu caaagugcug cugaauuggg augggccaac ggcauacauc 22500
acccacgagu gucacgauuc ccauggagcu cgucgcaccg gacgccaccu cgcaggaaac 22560
cugcugcgca ugcaagacac aauccaacgc acuguucaag acggguuccu cgcgcugcgc 22620
agccgagacu cacuggccaa agccgcaucc ggugccggua augagauggc cgcugaggcc 22680
uucgaagaca ucaaggaaac caucaagaag gcaagaaccg guaaagucgc caagguaaug 22740
agucuagacc gcaucugcgg ugcagucaac ugugaucgcg cucucacuuu cuaugggaag 22800
gaucuggcag accauccgcu ugucacuggu gcuaccgcac ucaagaccga gcuggaggag 22860
gugacuggug agaagcuugc gcgagugagg cagaccgugg ucgguggucc aguugacguc 22920
aucguucaga ccgaugcgau gcccaucccc auucuauacc gaccggccau ggaaaugauc 22980
gagccagucg ucuccaaagg ugcacgugcc aucugggcuc acgccauucu gaaccagagc 23040
ugcacgaaac ugagcaccgc cugcaagcag cgcgccuaug gucgagucgg gguuaaucug 23100
gccaaucucu cucucuccag cgccaacaag agcagcgcca cacguuguuu caaggggugc 23160
acuccagagc uguucgcgcc ugugggugag gauuaggucu cccgguggcu cgggauugcc 23220
caccccauug ccguggcguu uggugugcuc cauucaucgu uuuagaagac aucggagcag 23280
gaauggcuca ggacuugauc aacauuuccc aauuggccaa caaacuuucc cacaucaccg 23340
uuaacaaugc agaacgacuc gucaccggcg ccgaacucac cucccucgaa acaagacucg 23400
agcaguccau caaggccgca aaguccagug ucgaucguca ccucacgcgu cacgcugcag 23460
acccauuugc ucaugagcac acuucuggag gugccccccc ugccacugcc uucaucccua 23520
cugucccacg ccagagcuau cggcuuucag cuaugccagu cgugcuccac ucuugcgggg 23580
gccacagcuc uuccgugucu gugccgacua agaucauugu cgaggcaacu caaugcacca 23640
uuacucucca uacccccgcc uucgacuucg cccacguccc ugccaccguc cccggaggaa 23700
agcucuuuau aaagguggac aaagguuccu ggcaugacac cgccuucgga gcuuucaacc 23760
ccgcugccua ugaccagcug cucacuguag ccagacgucu caaguccacu gagguuaacg 23820
ucaaguggua uggugguuca ggcccuuccc gaugcgaccu gcgcucgaca ggcagacgug 23880
cucaaaucca cgcuacggac aaccucauca uguucgagcu gccaggugug gauuccgccg 23940
gugcauaccc cgaccugacc uguuggccaa ucaugggcgu auuugaguag agucuugagu 24000
ccgccuggcg uggccgcgua gacccgaugu cugccauuca uc 24042
<210>2
<211>198
<212>PRT
< 213>turbot reovirus
<400>2
Met Gly Asn Thr Ile Ser Ser Thr Phe Gln Tyr Thr Val Leu Gln Ile
1 5 10 15
Asp Arg Ser Cys Cys Ile Lys Thr Ser Leu Thr Ala Thr Ser Glu Ala
20 25 30
Thr Ser Trp Ala Ile Pro Pro Leu Ala Ile Cys Cys Cys Cys Cys Leu
35 40 45
Cys Cys Thr Gly Gly Leu Tyr Leu Val His Ser Gly Arg Ile Pro Ser
50 55 60
Ile Ser Arg Arg Leu Asp Val Leu Arg Asp Thr Arg Ser Ala Ser Glu
65 70 75 80
Tyr Lys Val Arg Ser Asn Arg Asn Pro Lys Ser Arg Val Arg Arg Val
85 90 95
Ser Ile Ser Asp Ser Ser Asp Ser Ser Ser Leu Ser Asp Leu Glu Leu
100 105 110
Ser Arg His Arg Ser His Pro Leu Ala His Ser Phe Arg Pro Glu Ser
115 120 125
Tyr Ser Gln Arg Pro His Ser Pro Ser Gln Ala Gln Ser Ser Ile Ile
130 135 140
Leu Pro Leu Val Pro Val His Ser Arg Thr Ser Leu Asp Asp Gly Val
145 150 155 160
Ile Arg Ser Gln Pro Ser Arg Tyr Gln Gly Pro His Gln Gln Phe Glu
165 170 175
Asp Trp Leu Gln Gln Ala His Leu Leu Arg Pro Gly Asp Val Ser Arg
180 185 190
Asp Thr Asn Pro Phe Arg
195
Claims (4)
1. full gene of isolating turbot reovirus, its sequence is the nucleotide sequence shown in the SEQ ID NO.1.
2. isolating protein, its sequence is the aminoacid sequence shown in the SEQ ID NO.2.
3. the application of the S11 sections of the full gene of the described a kind of isolating turbot reovirus of claim 1 in preparation turbot reovirus detection of drugs.
4. the protein of the NS22 coded by said gene of the S7 sections of the full gene of the described a kind of turbot reovirus of claim 1 is induced the application in the cell Fusion of Fish protein drug in preparation.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010101623459A CN101864435B (en) | 2010-04-27 | 2010-04-27 | Turbot reovirus whole genome and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010101623459A CN101864435B (en) | 2010-04-27 | 2010-04-27 | Turbot reovirus whole genome and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101864435A CN101864435A (en) | 2010-10-20 |
CN101864435B true CN101864435B (en) | 2012-04-04 |
Family
ID=42956357
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2010101623459A Expired - Fee Related CN101864435B (en) | 2010-04-27 | 2010-04-27 | Turbot reovirus whole genome and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101864435B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104569391B (en) * | 2015-01-30 | 2016-05-25 | 肇庆大华农生物药品有限公司 | A kind of GCHV antibody ELISA detection kit and preparation method thereof |
CN110283883B (en) * | 2019-05-08 | 2023-03-14 | 湖南农业大学 | Primer and method for unknown RNA fungal virus genome cloning |
-
2010
- 2010-04-27 CN CN2010101623459A patent/CN101864435B/en not_active Expired - Fee Related
Non-Patent Citations (3)
Title |
---|
Ke F et al..Turbot reovirus (SMReV) genome encoding a FAST protein with a non-AUG start site.《BMC Genomics》.2011,第12卷1-13. * |
史成银 等.大菱鲆病毒性疾病研究进展.《高技术通讯》.2003,(第9期),99-105. * |
柯飞 等.养殖大菱鲆中一种球形病毒的分离及超微观察.《环境与健康学术研究讨论会论文摘要集》.2007,全文. * |
Also Published As
Publication number | Publication date |
---|---|
CN101864435A (en) | 2010-10-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Biacchesi et al. | Recovery of NV knockout infectious hematopoietic necrosis virus expressing foreign genes | |
Guo et al. | The NS16 protein of aquareovirus-C is a fusion-associated small transmembrane (FAST) protein, and its activity can be enhanced by the nonstructural protein NS26 | |
Vennema et al. | Genomic organization and expression of the 3′ end of the canine and feline enteric coronaviruses | |
DK181370B1 (en) | Primer, method and diagnostic kit for use in the detection of the presence of lumpfish flavivirus | |
CA2796178C (en) | Nucleic acid sequences of fish cardiomyopathy syndrome virus and the use thereof | |
CN103539842A (en) | Recombinant protein coded by grass carp reovirus (GCRV) type-II S10 gene, polyclonal antibody prepared from recombinant protein and application of recombinant protein | |
Schütze et al. | Identification of the non-virion (NV) protein of fish rhabdoviruses viral haemorrhagic septicaemia virus and infectious haematopoietic necrosis virus | |
Yu et al. | Identification of a novel membrane-associated protein from the S7 segment of grass carp reovirus | |
CN109321535A (en) | A kind of heat-staple newcastle disease virus attenuated vaccine Candidate Strain | |
Huang et al. | Cloning and characterization of a surface antigen CiSA-32.6 from Cryptocaryon irritans | |
CN104211817B (en) | A kind of hydrophobin inactivation protein vaccine, its preparation method and application | |
CN114524862B (en) | Construction and application of avian influenza (H5 + H7) trivalent DNA vaccine | |
CN103184225B (en) | Taenia multiceps antigen gene and recombinant protein and application thereof | |
CN101864435B (en) | Turbot reovirus whole genome and application thereof | |
CN102690327A (en) | Enterovirus 71 neutralized epitope polypeptide and application thereof | |
CN103539839A (en) | Neutralizing epitope peptide of enterovirus 71-type VP2 antigen and application thereof | |
Chen et al. | Development and evaluation of nucleoprotein-based rapid detection test for Siniperca chuatsi rhabdovirus | |
CN101607081B (en) | brucella vaccine and method for preparing antigen protein used for same | |
CN115521942B (en) | Construction method and application of BVDV epitope gene vaccine | |
CN108017714B (en) | Monoclonal antibody of II-type carp herpesvirus ORF92 protein and application thereof | |
CN108866242A (en) | For identifying the half Nest RT-PCR serotype specific primer and kit of different serotypes infectious bronchitis virus live vaccine | |
CN107827986B (en) | Pig O/Mya98 and O/PanAsia type foot-and-mouth disease gene engineering inactivated vaccine | |
CN110376385B (en) | Preparation method and application of protein antigen for expressing QX type infectious bronchitis virus S1 by genetic engineering | |
CN114805524B (en) | Japanese blood fluke antigen protein rSjScP92 and application thereof | |
CN115043922B (en) | Japanese blood fluke antigen protein rSjScP57 and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120404 Termination date: 20190427 |