CN101864420B - Expression vector for efficiently expressing exogenous gene of HEK293 cell - Google Patents
Expression vector for efficiently expressing exogenous gene of HEK293 cell Download PDFInfo
- Publication number
- CN101864420B CN101864420B CN2010101643683A CN201010164368A CN101864420B CN 101864420 B CN101864420 B CN 101864420B CN 2010101643683 A CN2010101643683 A CN 2010101643683A CN 201010164368 A CN201010164368 A CN 201010164368A CN 101864420 B CN101864420 B CN 101864420B
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence
- gene
- peptide
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for constructing a vector for efficiently expressing an exogenous gene in an HEK293 cell, which is used for constructing a nucleotide sequence of a transcription regulatory sequence of the carrier. The expressions of expressing exogenous gene EGFP, proUK and tPA by using the constructed efficient expression vector are 7, 5 and 2 times those of using a comparison vector respectively; and the expression vector combining with artificial transcription factors can promote the expression of the EGFP, and the expression can be improved by 15 times compared with PcDNA/3.1/EGFP.
Description
Technical field
The present invention relates to a kind of expression vector of the HEK293 of being used for cell high-efficient expression alien gene.Specifically utilize the transcription regulating nucleotide sequence of the house-keeping gene peptide elongation factor of HEK293 cell to promote foreign gene efficiently expressing in the HEK293 cell.
Background technology
The HEK293 cell is the immortal human embryonic kidney epithelial cell line that Graham etc. made up in 1977.Because of it has the functional study that good posttranslational modification ability is widely used in many people's source protein matter, it also is used as the packing host of virus widely simultaneously.In the cell engineering field, the HEK293 cell has also obtained application, for example produces human protein C.Thereby more peculiar enzymes help helping recombinant protein to be folded into correct conformation improving its BA in people's sourcesink chief cell.For example, there is α-2,6 sialytransferase in people's sourcesink chief cell; It carries out α-2 to albumen; 6 sialyl is modified, and can improve proteic BA, has α-2; TPA (tissue plasminogen activator, the tissue-type plasminogen activator) quality product of the oligose that 6 sialyls connect improves.In people's sourcesink chief cell, contain β 1,4-N-hydroxyacetylneuraminic acid transferase I II (GnTIII) modifies target protein, can prolong the transformation period of gp.With the monoclonal antibody that the host cell with this enzyme is produced, ADCC (antibody-dependentcell-mediated cytotoxicity, the cell-mediated CDCC that antibody relies on) is more effective for inducing, and can reduce the antibody consumption.Therefore being necessary to develop with the human archeocyte is host's expression of recombinant proteins system.
The power of promotor is directly connected to the expression level of foreign gene in host cell, for improving the efficient of transcribing of foreign gene, must select highly active promotor as much as possible for use.The CMV promotor that the most frequently used promotor is behaved in eukaryotic cell at present, it has host cell more widely, also is more intense promotor.But discover, exist the CpG island to cause reticent effect easily in this promotor; Only work in the cell cycle S phase, it is necessary therefore seeking than the better promotor of CMV.People are seeking always; The promotor of HS wide adaptability, Kalwy S expresses GFP with the mCMV promotor of mouse in the CHO-K1 cell, be people's 3 times of CMV promotor; But when the such albumen of expressing antibodies, the more weak CMV promotor of ability to express not as the people.Gershon TJ etc. have synthesized a core promoter that can increase genetic expression through the manual work design; Inside and outside research shows: it improves the expression level of reporter gene luciferase than CMV core promoter significance; This just provides another kind of thinking for seeking the high reactivity promotor, might create non-existent high-intensity manual activation of nature.The promotor that extensively exists in the cell has been cloned by ProBioGen company, and strength ratio CMV is strong; The acellular cycle relies on; Can resist gene silencing, stably express is more than 50 generations in cell, and cell endogenous promotor more helps the regulation and control of recombinant protein gene transcription probably.
The peptide elongation factor all are in high expression level at cell in the whole cycle; Do not receive the house-keeping gene that the cell cycle influences; Its locus sequence possibly contain the transcription regulating nucleotide sequence that some help genetic expression, with the trans-acting factor acting in conjunction of cell, promotes the high expression level of gene.We are according to the sequence of the report of Genbank; Cloned the regulating and controlling sequence of 5 ' end and the 3 ' end 4Kb of the peptide EF-1 of HEK293 cell; Be used for making up different expression vectors; With EGFP is reporter gene, and the expression level of EGFP is the highest when having confirmed to exist simultaneously the regulating and controlling sequence that the 5 ' end and 3 ' of peptide EF-1 holds, and is 7 times of control vector.Can improve with this carrier expression alien gene tPA and proUK in the HEK293 cell and to express 2-5 doubly.
The transcription regulating nucleotide sequence of peptide elongation factor combines with the manual transcription factor that we make up, and can improve 15 times of the expression of EGFP.
Summary of the invention
The purpose of this invention is to provide a kind of in the HEK293 cell carrier of efficiently expressing exogenous gene.
Another object of the present invention is to provide above-mentioned construction of carrier.
The 3rd purpose of the present invention is to provide the nucleotide sequence of the controlling element of this carrier, and it has SEQ No.1 and the described sequence of SEQ No.2 in the sequence table.
The 4th purpose of the present invention provides the Combination application of controlling element.
For realizing above-mentioned purpose, the present invention adopts following technical scheme:
Cultivate the HEK293 cell, extract genomic dna then, the 5 ' end and 3 ' of the peptide EF-1 of the method amplification people HEK293 cell through PCR is held the regulating and controlling sequence of 4kb; Various combination with regulating and controlling sequence; With EGFP is reporter gene, through the fluorescence intensity of cells were tested by flow cytometry EGFP, confirms the best of breed of carrier; Use foreign gene tPA and proUK (prourokinase, uPA) to verify its validity again.
A kind of expression vector that is used for HEK293 cell high-efficient expression alien gene, it has structure shown in Fig. 2 E.
The described expression vector that is used for HEK293 cell high-efficient expression alien gene; It is that pCDNA3.1 (+) is changed structure; Primer BGH1 (SEQ ID No.7) contains the XbaI enzyme cutting site; BGH2 (SEQ ID No.8) contains the BspEI restriction enzyme site, and FOR1 (SEQ ID No.9) contains the BspEI restriction enzyme site, and FOR2 (SEQ ID No.10) contains the XmaI restriction enzyme site; Method through PCR is a template with pCDNA3.1 (+); Amplify the segment of 200bp and 800bp respectively; The fragment that glue is cut 200bp with XbaI, BspEI enzyme respectively after reclaiming, the segment that BspEI, XmaI enzyme are cut 800bp, XbaI, XmaI enzyme are cut back glue and are reclaimed big segment; Again carrier is connected with the 800bp segment with 200bp, so far introduces the BspEI restriction enzyme site at the BGHPA place of pcDNA3.1 (+); Be connected into the EGFP reporter gene at the EcoRV place of the pcDNA3.1 (+) that changes structure and draw pcDNA3.1 (+)/EGFP carrier, utilize the peptide EF-1 gene 3 ' ending regulating sequence shown in peptide EF-1 gene 5 ' ending regulating sequence shown in the SEQID No.1 and the SEQ ID No.2 to substitute CMV promotor and BGHPA among replacement pcDNA3.1 (+)/EGFP.
A kind of method that makes up above-mentioned carrier has following steps:
(1) extracts the HEK293 genomic dna;
(2) utilize the 5 ' ending regulating sequence of the 4Kb of primer amplification peptide EF-1 shown in SEQ ID No.3 and the SEQ ID No.4, amplified production contains NheI and MluI restriction enzyme site, and 5 ' ending regulating sequence of said peptide EF-1 has sequence shown in the SEQ ID No.1;
(3) utilize the 3 ' ending regulating sequence of the 4Kb of primer amplification peptide EF-1 shown in SEQ ID No.5 and the SEQ ID No.6 again; 3 ' ending regulating sequence of said peptide EF-1 has sequence shown in the SEQ ID No.2, and amplified production contains XbaI and BspEI restriction enzyme site;
(4) pCDNA3.1 (+) is changed structure; Primer BGH1 (SEQ ID No.7) contains the XbaI enzyme cutting site; BGH2 (SEQ ID No.8) contains the BspEI restriction enzyme site, and FOR1 (SEQ ID No.9) contains the BspEI restriction enzyme site, and FOR2 (SEQ ID No.10) contains the XmaI restriction enzyme site; Method through PCR is a template with pCDNA3.1 (+); Amplify the segment of 200bp and 800bp respectively; The fragment that glue is cut 200bp with XbaI, BspEI enzyme respectively after reclaiming, the segment that BspEI, XmaI enzyme are cut 800bp, XbaI, XmaI enzyme are cut back glue and are reclaimed big segment; Again carrier is connected with the 800bp segment with 200bp, so far introduces the BspEI restriction enzyme site at the BGHPA place of pcDNA3.1 (+);
(5) be connected into the EGFP reporter gene at the EcoRV place that step (4) changes the pcDNA3.1 (+) of structure and draw pcDNA3.1 (+)/EGFP carrier;
(6) utilize the peptide EF-1 gene 3 ' ending regulating sequence shown in peptide EF-1 gene 5 ' ending regulating sequence shown in the SEQ ID No.1 and the SEQ ID No.2 to substitute CMV promotor and BGHPA among replacement pcDNA3.1 (+)/EGFP.
Add manual transcription factor binding sequence 2UAS at the upper reaches of above-mentioned carrier.
The primer of the 5 ' terminal nucleotide sequence that a kind of said transcriptional control foreign gene that is used for increasing efficiently expresses at the HEK293 cell, said primer has sequence shown in SEQ ID No.3 and the SEQ ID No.4.
The primer of the 3 ' terminal nucleotide sequence that a kind of said transcriptional control foreign gene that is used for increasing efficiently expresses at the HEK293 cell, said primer has sequence shown in SEQ ID No.5 and the SEQ ID No.6.
Advantage of the present invention is: (1) the present invention is more suitable in the regulating and controlling sequence that the combination (2) of the transcriptional regulator of cell is obtained all stages in the cell cycle all being had vigor through the expression vector that molecular biology method acquisition HEK293 cell endogenous transcription regulating nucleotide sequence makes up, and promotes the gene of being regulated and control in the HEK293 cell, to efficiently express.
Below in conjunction with accompanying drawing and embodiment the present invention is described further.
Description of drawings
The PCR product of Fig. 1 people's peptide EF-1 gene transcription regulating and controlling sequence;
Fig. 2 contains the not homotactic vector construction of people's peptide EF-1, and (A is pcDNA3.1 (+)/EGFP carrier; B is the HEF/EGFP carrier; C is the PEF1/EGFP carrier; D is the cmvHEF3utr/EGFP carrier; E is the HEF53utr/EGFP carrier);
Fig. 3 expresses the carrier figure of proUK and tPA, and (A is the HEF53utr/proUK carrier; B is the HEF53utr/tPA carrier);
Fig. 4 people's peptide EF-1 gene transcription regulating and controlling sequence combines carrier, and (A is the PcDNA3.1/GVP4/Hygro carrier with the manual transcription factor sequence; B is the HEF53utr/EGFP carrier).
Embodiment
The clone of the gene transcription regulation sequence of embodiment 1 people's peptide EF-1.
1.HEK293 the extraction of cell genomic dna sequence
The HEK293 cell is cultured to the cell square vase with D/F substratum 5% serum and covers with trysinization.Press TAKARAGeneBall Genome preparation kit process specifications and extract the HEK293 cell genomic dna.
2. the clone of the gene transcription regulation sequence of people's peptide EF-1
According to the following primer of sequences Design of the report of Genbank, see shown in the SEQ ID No.3-6:
HuEF1(SEQ?ID?No.3)：5-ata?acgcgt?CCCAAAACAC?ATTTACGAGC?CTCAACATCGTTACTG-3
HuEF2(SEQ?ID?No.4)：5-ata?gctagc?TCA?CGACACCTGA?AATGGAAGAA?AAAAACTTTGAACC-3
HuEF3(SEQ?ID?No.5)：5-ata?tctaga?ATATTATCC?CTAATACCTG CCACCCCACTCTTAATCAGT?GG-3
HuEF4(SEQ?ID?No.6)：5-ata?tccgga?CATTAAAAAG?TAAGAGATTA?CTGATATATACAGGCTCACG-3
With the 5 ' ending regulating sequence of the 4kb of primer HuEF1 and HuEF2 amplification peptide EF-1, amplified production contains NheI and MluI restriction enzyme site; The sequence that comprises promotor and introne 1, the 3 ' ending regulating sequence of the 4kb of primer HuEF3 and HuEF4 amplification peptide EF-1, amplified production contains XbaI and BspEI restriction enzyme site.Adopt the LA Ta of precious biotech firm to remove archaeal dna polymerase.Amplification condition is 94 ℃ of 5min, 94 ℃ of 30sec, and 60 ℃ of 30sec, 72 ℃ of 4min, 30 circulations, 72 ℃ are extended 10min, and amplified production 1% agarose gel reclaims, and is connected with the T carrier.Enzyme is cut with sequencing result and is shown that the sequence that is obtained is correct sequence.
Embodiment 2 contains the not homotactic vector construction of people's peptide EF-1
1. pCDNA3.1 (+) is changed structure
Synthetic following primer:
BGH1(SEQ?ID?No.7)：5-TCGAGTCTAGAGGGCCCGTTTAAAC-3
BGH2(SEQ?ID?No.8)：5-ATATCCGGACTCAGAAGCCATAGAGCCCACC-3
FOR1(SEQ?ID?No.9)：5-ATATCCGGAGCGGAAAGAA?CCAGCTGGGG-3
FOR2(SEQ?ID?No.10)：5-TATACAAGCTCCCGGGAGCTTTTTGC-5
Primer BGH1 contains the XbaI enzyme cutting site, and BGH2 contains the BspEI restriction enzyme site, and FOR1 contains the BspEI restriction enzyme site, and FOR2 contains the XmaI restriction enzyme site.Method through PCR is a template with pCDNA3.1 (+); Amplify the segment of 200bp and 800bp respectively; The fragment that glue is cut 200bp with XbaI, BspEI enzyme respectively after reclaiming, the segment that BspEI, XmaI enzyme are cut 800bp, XbaI, XmaI enzyme are cut back glue and are reclaimed big segment; Again carrier is connected with the 800bp segment with 200bp, so far introduces the BspEI restriction enzyme site at the BGHPA place of pcDNA3.1 (+).
2. the structure that contains EGFP reporter gene different carriers
EcoRV place at pcDNA3.1 (+) is connected into the EGFP reporter gene; Called after pcDNA3.1 (+)/EGFP (structure shown in Fig. 2 A); As control vector; Use the PEF1 promotor (from invitrogen) of 1.7kb to replace the CMV promotor among pcDNA3.1 (+)/EGFP then; The carrier called after PEF1/EGFP (structure shown in Fig. 2 C) that makes up is with the CMV promotor among HEF-alpha promotor replacement pcDNA3.1 (+)/EGFP of 4kb, the carrier called after HEF/EGFP (structure shown in Fig. 2 B) of structure; HEF-alpha gene 3 ' end with 4kb is replaced the BGHPA among pcDNA3.1 (+)/EGFP through XbaI and BsPEI; Called after cmvHEF3utr/EGFP (structure shown in Fig. 2 D) uses 5 ' and 3 ' ending regulating sequence of HEF-alpha gene to replace CMV promotor and BGHPA among pcDNA3.1 (+)/EGFP, called after HEF53utr/EGFP (structure shown in Fig. 2 E) simultaneously.
The mensuration of embodiment 3 carrier transfection HEK293 cells and reporter gene EGFP luciferase expression intensity
Transfection previous day, the HEK293 cell is with 7.5 * 10
5Cell bed board 6 orifice plates, the cell incubated overnight is with expression vector pcDNA3.1/EGFP and pcDNAPEF/EGFP, pcDNA HEF5UTR/EGFP, pcDNAHEF5UTR/EGFP/HEF3UTR, pcDNACMV/EGFP/HEF3UTR; By etc. the mol ratio transfection advance in the HEK293 cell, transfection reagent is used Lipofectamine
TM2000, working method is undertaken by the reagent specification sheets.
After the transfection 24 hours, use trypsin digestion cell, a hole 6 orifice plates are seeded to a plate 24 orifice plates, treat cell attachment behind the 24h after, substratum is changed to and contains microbiotic G418 0.3mg/ml.3-4d changes a not good liquor.Treat that after 2 weeks positive colony grows.Trysinization is collected positive cell, the centrifugal 5min of 2000r/min; Use the PBS suspension cell, make blank, measure the EGFP fluorescence intensity with the flow cytometer BDFACS Calibur of Clonetech company with the HEK293 cell of non-transfection; TCS is set at 100000, and the result sees table 1.
The fluorescence intensity unit that table 1 different carriers is expressed
The gene transcription regulation sequence of the peptide EF-1 of embodiment 4 personnel selections is expressed proUK and tPA
The fluorescence intensity that shows carrier HEF53utr/EGFP expression EGFP through embodiment 3 is the strongest; The gene 5 ' and 3 ' the ending regulating sequence expression alien gene better effects if in 293 cells that show the peptide EF-1 of personnel selection are further verified the effect of this carrier with foreign gene proUK and tPA.
On HEF53utr/EGFP,, constitute carrier HEF53utr/proUK (structure shown in Fig. 3 A), HEF53utr/tPA (structure shown in Fig. 3 B) through NheI and XhoI restriction enzyme site with proUK and tPA gene replacement EGFP gene.Carrier with the SalI linearizing after, use liposome Lipofectamine
TM2000 transfection HEK293 cells, 0.3mg/ml G418 screens positive cell, and the external scleroproein agar plate solusphere method of 2 weeks back employing detects proUK and tPA extracorporeal fiber protein dissolution activity.The result sees the following form 2
Table 2 vector expression proUK and tPA result
The gene transcription regulation sequence of the peptide EF-1 of embodiment 5 personnel selections combines to promote efficiently expressing of EGFP with manual transcription factor
The upper reaches at the expression vector HEF53utr/EGFP of embodiment 3 add manual transcription factor binding sequence 2UAS, and (see article: Li Shichong etc., manual transcription factor promotes foreign gene efficiently expressing in Chinese hamster ovary celI with the carrier PcDNA3.1/GVP4/Hygro (structure shown in Fig. 4 A) that expresses manual transcription factor; The biotechnology journal; 2007, vol.23 (1): 21-26) cotransfection, with antibiotic neomycin, the two screenings of Totomycin; After fortnight; Clone cell relatively can improve 15 times and 2 times of expression with stream measuring EGFP expression intensity with PcDNA3.1/EGFP and HEF53utr/EGFP (structure shown in Fig. 4 B), and the result sees table 3.
Table 3 manual transcription factor combines the fluorescence intensity unit of expression with carrier
Sequence table
< 110>Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A
< 120>a kind of expression vector that is used for HEK293 cell high-efficient expression alien gene
<130>
<160>10
<170>PatentIn?version?3.5
<210>1
<211>4093
<212>DNA
< 213>artificial sequence
<400>1
cccaaaacac?atttacgagc?ctcaacatcg?ttactgttac?cgctttaaca?tttaaggcag 60
taaaaagcat?actggatctc?tgtaaaggcg?taggggtgcg?gggaatccgt?tatgattatg 120
ttgaaaacat?agggtctggg?gaaaaaggga?tttaaaataa?gaagaaaaag?aagacttggg 180
acttaaaaag?tcttttagag?gccagctcac?ggtgacaaaa?accgaccctc?accccgagcc 240
acgtgaggtt?ttctgcttcc?tcccaggccc?ttccttccgc?agtcagaagg?cggaagaaaa 300
gttacctcaa?ggtggggcga?gtggcagggc?ggaccctggc?gacctgacgc?tgcggaggct 360
cgagcggcgt?atccatacca?cccagctgtt?cgccgcggga?acccgccggc?ccgcaggtga 420
cccagcgctg?gaaaaacgcc?agcgacgtgg?cctggcgagc?tggcgcgggg?caaggaccac 480
ccgcgcccgc?cttgccgccc?cagcctccct?ccctaggaag?cagggtgcgc?cccggtgcgc 540
gcggggcttc?cccggaccgg?cgttccagtc?cctctccggc?ttccggccca?ccccggcccc 600
actgagagca?gaaatgtgat?ctctgccctg?agaaaatgct?cgtggccagt?gactacccct 660
aacgcacaat?aatatggctc?cgatgggctc?aaaggtattg?gttttttgtt?ttgttttgag 720
acaaggtctc?actcggtcgc?ccaggctgga?gtgcaattgc?gtgatcttga?ctcactgcaa 780
cctccgcttc?ccgggctcaa?gcgattctcc?tgcctcagcc?tcccaagtag?ctgggattac 840
aggcatgcgc?caccacgccc?ggctaatttt?gtattttcag?tagacagggt?ttcaccatgt 900
tggccaggct?ggtctcgaac?tcctggcctc?aaattatacg?tccgcctcgg?cctcccaagg 960
tgctggtatt?ataggcgtga?gccaccgcgc?ccggtccagt?gttggttctt?aaacgcgaga 1020
attgagatct?cccttcacct?aatgaaagtc?tcggccacta?tcgcaacatt?cagaacaccc 1080
agtctgtgtt?gcacaatatg?ttacttaggt?ataaatcaag?gattcatgta?attttgtcat 1140
tccttgcgtg?atattttaaa?aaacattctg?tgtaaggtat?ttataaagcg?tttactatta 1200
tccgcaatca?caggggcttg?aggaaaaact?ttgactgtgg?ccgggcaccg?tggctcacgc 1260
ctgtaatccc?agcactttgg?gagaccgagc?cgggtggatc?acttgaggtc?agcagttcga 1320
gaccagcctg?gccaacatgg?tgaaaccccc?gtctcttcta?aaaatacaaa?aatttgtggg 1380
gcgcgcttgt?agtcccagct?acttgggagg?ctgaggcagg?aggaatcgct?tgaactcggg 1440
aggcagagct?tgcagtgagc?cgagatcgcg?ccactgcact?ccagcctggg?caacagagta 1500
gaactccgtc?tcaaaaaaaa?aaaaaaaaaa?gaaagaaaga?aaaaaaagtg?gactgtgaaa 1560
actgaaagga?ctagaaaaac?tacactacaa?agatacagaa?accaagaaag?caccatagcg 1620
tttgccttca?actgcttccc?aacttgtttt?cctcttccaa?tttgattgtg?gtttcctctc 1680
cagaaggaac?tccacagtac?ttagcgttgg?ccacatagta?ggttctcaaa?tacttgttaa 1740
taaataagtt?tgttcgagaa?gctgggcaat?gatattctac?agctggaaga?agaaacataa 1800
tgatctagta?attagctcat?taaaaataaa?cgttcttctt?tcctcagagg?agcatttccc 1860
aaggcctgcc?ttgatagcca?tccaaaaagg?ccaagctcat?ccaatcttgc?cctagattta 1920
tgctaaaatg?cagttacaat?cgataggatg?acagaaaacg?acagcactta?tttaaatata 1980
ataggcactt?atttaaatag?gagaagctgt?gacttcatag?caagtgttgg?ggttaggaaa 2040
ctgggtggat?aaacttgctg?atgctgtaga?tcttagcctc?tacatgagat?catgtggaaa 2100
atctgaaagc?attttaggtt?ccttatgttt?gcaatcaaat?aactgtacac?cttttaattt 2160
aaaaagtacc?atgaggcaca?cacacacact?cgcaggaact?ttttggcgta?acaaaactag 2220
aattagatct?aaagctaact?gtaggactga?gtctattcta?aactgaaagc?ctggacatct 2280
ggagtaccag?ggggagatga?cgtgttacgg?gcttccataa?aagcagctgg?ctttgaatgg 2340
aaggagccaa?gaggccagca?caggagcgga?ttcgtcgctt?tcacggccat?cgagccgaac 2400
ctctcgcaag?tccgtgagcc?gttaaggagg?cccccagtcc?cgacccttcg?ccccaagccc 2460
ctcggggtcc?ccgggcctgg?tactccttgc?cacacgggag?gggcgcggaa?gccggggcgg 2520
aggaggagcc?aaccccgggc?tgggctgaga?cccgcagagg?aagacgctct?agggatttgt 2580
cccggactag?cgagatggca?aggctgagga?cgggaggctg?attgagaggc?gaaggtacac 2640
cctaatctca?atacaacctt?tggagctaag?ccagcaatgg?tagagggaag?attctgcacg 2700
tcccttccag?gcggcctccc?cgtcaccacc?ccccccaacc?cgccccgacc?ggagctgaga 2760
gtaattcata?caaaaggact?cgcccctgcc?ttggggaatc?ccagggaccg?tcgttaaact 2820
cccactaacg?tagaacccag?agatcgctgc?gttcccgccc?cctcacccgc?ccgctctcgt 2880
catcactgag?gtggagaaga?gcatgcgtga?ggctccggtg?cccgtcagtg?ggcagagcgc 2940
acatcgccca?cagtccccga?gaagttgggg?ggaggggtcg?gcaattgaac?cggtgcctag 3000
agaaggtggc?gcggggtaaa?ctgggaaagt?gatgtcgtgt?actggctccg?cctttttccc 3060
gagggtgggg?gagaaccgta?tataagtgca?gtagtcgccg?tgaacgttct?ttttcgcaac 3120
gggtttgccg?ccagaacaca?ggtaagtgcc?gtgtgtggtt?cccgcgggcc?tggcctcttt 3180
acgggttatg?gcccttgcgt?gccttgaatt?acttccacgc?ccctggctgc?agtacgtgat 3240
tcttgatccc?gagcttcggg?ttggaagtgg?gtgggagagt?tcgaggcctt?gcgcttaagg 3300
agccccttcg?cctcgtgctt?gagttgaggc?ctggcttggg?cgctggggcc?gccgcgtgcg 3360
aatctggtgg?caccttcgcg?cctgtctcgc?tgctttcgat?aagtctctag?ccatttaaaa 3420
tttttgatga?cctgctgcga?cgcttttttt?ctggcaagat?agtcttgtaa?atgcgggcca 3480
agatctgcac?actggtattt?cggtttttgg?ggccgcgggc?ggcgacgggg?cccgtgcgtc 3540
ccagcgcaca?tgttcggcga?ggcggggcct?gcgagcgcgg?ccaccgagaa?tcggacgggg 3600
gtagtctcaa?gctggccggc?ctgctctggt?gcctggcctc?gcgccgccgt?gtatcgcccc 3660
gccctgggcg?gcaaggctgg?cccggtcggc?accagttgcg?tgagcggaaa?gatggccgct 3720
tcccggccct?gctgcaggga?gctcaaaatg?gaggacgcgg?cgctcgggag?agcgggcggg 3780
tgagtcaccc?acacaaagga?aaagggcctt?tccgtcctca?gccgtcgctt?catgtgactc 3840
cacggagtac?cgggcgccgt?ccaggcacct?cgattagttc?tcgagctttt?ggagtacgtc 3900
gtctttaggt?tggggggagg?ggttttatgc?gatggagttt?ccccacactg?agtgggtgga 3960
gactgaagtt?aggccagctt?ggcacttgat?gtaattctcc?ttggaatttg?ccctttttga 4020
gtttggatct?tggttcattc?tcaagcctca?gacagtggtt?caaagttttt?ttcttccatt 4080
tcaggtgtcg?tga 4093
<210>2
<211>4018
<212>DNA
< 213>artificial sequence
<400>2
atattatccc?taatacctgc?caccccactc?ttaatcagtg?gtggaagaac?ggtctcagaa 60
ctgtttgttt?caattggcca?tttaagttta?gtagtaaaag?actggttaat?gataacaatg 120
catcgtaaaa?ccttcagaag?gaaaggagaa?tgttttgtgg?accactttgg?ttttcttttt 180
tgcgtgtggc?agttttaagt?tattagtttt?taaaatcagt?actttttaat?ggaaacaact 240
tgaccaaaaa?tttgtcacag?aattttgaga?cccattaaaa?aagttaaatg?agaaacctgt 300
gtgttccttt?ggtcaacacc?gagacattta?ggtgaaagac?atctaattct?ggttttacga 360
atctggaaac?ttcttgaaaa?tgtaattctt?gagttaacac?ttctgggtgg?agaatagggt 420
tgttttcccc?ccacataatt?ggaaggggaa?ggaatatcat?ttaaagctat?gggagggttg 480
ctttgattac?aacactggag?agaaatgcag?catgttgctg?attgcctgtc?actaaaacag 540
gccaaaaact?gagtccttgt?gttgcataga?aagcttcatg?ttgctaaacc?aatgttaagt 600
gaatctttgg?aaacaaaatg?tttccaaatt?actgggatgt?gcatgttgaa?acgtgggtta 660
aaatgactgg?gcagtgaaag?ttgactattt?gccatgacat?aagaaataag?tgtagtggct 720
agtgtacacc?ctatgagtgg?aagggtccat?tttgaagtca?gtggagtaag?ctttatgcca 780
gtttgatggt?ttcacaagtt?ctattgagtg?ctattcagaa?taggaacaag?gttctaatag 840
aaaaagatgg?caatttgaag?tagctataaa?attagactaa?tctacattgc?ttttctcctg 900
cagagtctaa?taccttttat?gctttgataa?ttagcagttt?gtctacttgg?tcactaggaa 960
tgaaactaca?tggtaatagg?cttaacaggt?gtaatagccc?acttactcct?gaatctttaa 1020
gcatttgtgc?atttgaaaaa?tgcttttcgc?gatcttcctg?ctgggattac?aggcatgagc 1080
cactgtgcct?gacctcccat?atgtaaaagt?gtctaaaggt?ttttttttgg?ttataaaagg 1140
aaaatttttg?cttaagtttg?aaggataggt?aaaattaaag?gacatgcttt?ctgtttgtgt 1200
gatggttttt?aaaaattttt?tttaagatgg?agttcttgtt?gcccaggcta?gaatgcaatg 1260
gcaaaatctc?actgcaatct?cctcctcctg?ggttcaagca?attctcctac?ttcagcctcc 1320
caagtagctg?ggattacagg?catgtgctaa?tttggtgttt?ttaatagaga?tgaggttttt 1380
ccatgttggt?caggctggtc?tcaaactcct?gaccttaggt?gatcgcctcg?gcctcctaaa 1440
gtgctggaat?tacaggcatg?agccaccatg?cctggccagg?acatgtgttc?ttaaggacat 1500
gctaagcagg?agttaaagca?gcccaagaga?taaggcctct?taaagtgact?ggcaatgtgt 1560
attgctcaag?attcaaaggt?acttgaattg?gccatagaca?agtctgtaat?gaagtgttat 1620
cgttttccct?catctgagtc?tgaattagat?aaaatgcctt?cccatcagcc?agtgctctga 1680
ggtatcaagt?ctaaattgaa?ctagagattt?ttgtccttag?tttctttgct?atctaatgtt 1740
tacacaagta?aatagtctaa?gatttgctgg?atgacagaaa?aaacaggtaa?ggcctttaat 1800
agatggccaa?tagatgccct?gataatgaaa?gttgacacct?gtaagattta?ccagtagaga 1860
attcttgaca?tgcaaggaag?caagatttaa?ctgaaaaatt?gttcccactg?gaagcaggaa 1920
tgagtcagtt?tacttgcata?tactgagatt?gagattaact?tcctgtgaaa?cccagtgtct 1980
tagacaactg?tggcttgagc?accacctgct?ggtattcatt?acaaacttgc?tcactacaat 2040
aaatgaattt?taagctttaa?gatgaagtgg?catttctttt?aacagttact?atgttggaat 2100
tggttacaaa?ttttggagtg?gatttcaaaa?gtgagagcta?acttcagttg?atttcaaggt 2160
agtgcttggc?tttttttgtt?tagacagggt?tttactcctg?ccctggttgg?agtggaagtt 2220
aacggctaac?tgcagtcctg?acttctgggc?ttaagtgatc?ttccctgaat?agcagggacc 2280
acaggttttt?gccaccacgc?ctggctaatt?tttgtatttt?gccatgttgc?caaggctggt 2340
caactcctgg?gctcaagtga?tctgcctgta?ctgtatcttt?cccagttaat?ctgatattta 2400
tcttttaaat?ctcagatgtg?ccagggcctc?ggcagtgact?caaggaagaa?cccatgtgct 2460
cttagtggga?cacgatttgt?tcagacctac?taacctcaac?ccagtttcag?ttctttatag 2520
tggagaatgt?tgacagttta?cactgacagg?ccacatttta?gcattgtgtt?atcttcatgg 2580
ttttttttct?tttgagatga?agttccaaac?ttagtaactt?accatttact?ttttagtgta 2640
attctaaaag?atttcattca?gctagaacta?ccctgatatt?taactgtcct?ttttctctta 2700
cctaattatt?ggcaattaaa?catttttgtc?atttactttg?ggactgtttt?tagcaggccc 2760
atggatctca?aggtttagtt?ttgtgggttc?tatgggagac?aatgacaatg?aagataaacg 2820
ttaatgttgc?aataattcta?agcaagggat?attagaaaat?gaagcaggcc?aggtcatggc 2880
tcacgcctgt?aattccacca?ttttgggagg?ctgaggtggg?gagatcacaa?ggtcaggagt 2940
tcagaccagc?cttgctaata?tgctgaaacc?ccatctctac?tgaaaataca?aaattagctg 3000
ggtgtggtgg?caggtgccta?tagttacgag?gctgagccaa?gatcacacca?ctgcactcca 3060
gcctgggcga?cagagaaaga?cttcatctca?aaaaaaaaaa?aaaaaaaaaa?gcaaaaggct 3120
gggcgcagtg?cctcgaatcc?tagcactttg?ggaggctgag?gcgagaagat?ctgctaaata 3180
caaaagaaaa?gcaaggtgtg?gtagcacatg?cctatagtcc?caactgaggc?tgaggcagga 3240
gaatcccttt?agcttggaag?gtgggggttg?cggtgagcca?agatcttgcc?agggcactcc 3300
agcctgggtg?acagggcaag?actgtctcaa?aaaataaaga?tgccgggtgc?agtggctcac 3360
gcctgtaatc?ccagcacttt?gggaggccga?ggtgggcgga?tcacaaggtc?aggagatcga 3420
gaccatcctg?gctaaaacgg?tgaagccccc?gtttctacta?aaaataaaaa?ttagccgggc 3480
atggtggtgg?gcgcctgtag?tcccagctac?tcgggaggct?gaggcaggag?aacagcatca 3540
acccgggagg?cggagtttgc?actgagccga?gattgcgcca?ctgcactcca?gcctggacga 3600
caaagtgcga?cttcgtctca?aaaaagtata?tatataataa?taaaaattag?ctgggcatgg 3660
tcgtacacac?ctgtagtccc?aagctactct?ggggggttca?ggcaggagga?tcgcttcatc 3720
ctgggaggct?gaggctgcag?tgagctatga?tggtgctatg?tactccagcc?tcggcaacag 3780
tgagaccccg?tctcctaggt?tcaagcaatt?ctgcctcagc?ctcctgagta?gctaggacca 3840
caggtgccca?ccaccacacc?tgcctaattt?ttgtattttc?agtagagacc?gggttttacc 3900
atgttggtca?ggctggtctc?caactcctga?cctcaggtgg?tctgcccgtc?ttggcctccc 3960
aaagtgctgg?ggttacaggc?gtgagcctgt?atatatcagt?aatctcttac?tttttaat 4018
<210>3
<211>45
<212>DNA
< 213>artificial sequence
<400>3
ataacgcgtc?ccaaaacaca?tttacgagcc?tcaacatcgt?tactg 45
<210>4
<211>46
<212>DNA
< 213>artificial sequence
<400>4
atagctagct?cacgacacct?gaaatggaag?aaaaaaactt?tgaacc 46
<210>5
<211>50
<212>DNA
< 213>artificial sequence
<400>5
atatctagaa?tattatccct?aatacctgcc?accccactct?taatcagtgg 50
<210>6
<211>49
<212>DNA
< 213>artificial sequence
<400>6
atatccggac?attaaaaagt?aagagattac?tgatatatac?aggctcacg 49
<210>7
<211>25
<212>DNA
< 213>artificial sequence
<400>7
tcgagtctag?agggcccgtt?taaac 25
<210>8
<211>31
<212>DNA
< 213>artificial sequence
<400>8
atatccggac?tcagaagcca?tagagcccac?c 31
<210>9
<211>29
<212>DNA
< 213>artificial sequence
<400>9
atatccggag?cggaaagaac?cagctgggg 29
<210>10
<211>26
<212>DNA
< 213>artificial sequence
<400>10
tatacaagct?cccgggagct?ttttgc 26
Claims (6)
1. 5 ' terminal nucleotide sequence that the transcriptional control foreign gene efficiently expresses in the HEK293 cell, it is shown in SEQ ID No.1 in the sequence table.
2. the gene 5 ' end of people's peptide EF-1 and 3 ' end transcription regulating nucleotide sequence make up the efficient expression vector that makes up, the gene 5 ' terminal nucleotide sequence of said peptide EF-1, and it is shown in SEQ ID No.1 in the sequence table; Gene 3 ' the terminal nucleotide sequence of said peptide EF-1, it is shown in SEQ ID No.2 in the sequence table;
Its structure is shown in Fig. 2 E;
It is that pCDNA3.1 (+) is changed structure, and primer BGH1 SEQ ID No.7 contains the XbaI enzyme cutting site, and BGH2SEQ ID No.8 contains the BspEI restriction enzyme site, and FOR1 SEQ ID No.9 contains the BspEI restriction enzyme site, and FOR2SEQ ID No.10 contains the XmaI restriction enzyme site; Method through PCR is a template with pCDNA3.1 (+); Amplify the segment of 200bp and 800bp respectively; The fragment that glue is cut 200bp with XbaI, BspEI enzyme respectively after reclaiming, the segment that BspEI, XmaI enzyme are cut 800bp, XbaI, XmaI enzyme are cut back glue and are reclaimed big segment; Again carrier is connected with the 800bp segment with 200bp, so far introduces the BspEI restriction enzyme site at the BGHPA place of pcDNA3.1 (+); Be connected into the EGFP reporter gene at the EcoRV place of the pcDNA3.1 (+) that changes structure and draw pcDNA3.1 (+)/EGFP carrier, utilize the peptide EF-1 gene 3 ' ending regulating sequence shown in peptide EF-1 gene 5 ' ending regulating sequence shown in the SEQID No.1 and the SEQID No.2 to substitute CMV promotor and BGHPA among replacement pcDNA3.1 (+)/EGFP.
3. carrier according to claim 2 is characterized in that, adds manual transcription factor binding sequence 2UAS at the upper reaches of the said carrier of claim 2, and said carrier structure is shown in Fig. 4 B.
4. method that makes up the said carrier of claim 2 is characterized in that concrete steps are following:
(1) extracts the HEK293 genomic dna;
(2) utilize the 5 ' ending regulating sequence of the 4Kb of primer amplification peptide EF-1 shown in SEQ ID No.3 and the SEQ ID No.4, amplified production contains NheI and MluI restriction enzyme site, and 5 ' ending regulating sequence of said peptide EF-1 is shown in SEQ ID No.1;
(3) utilize the 3 ' ending regulating sequence of the 4Kb of primer amplification peptide EF-1 shown in SEQ ID No.5 and the SEQ ID No.6 again, 3 ' ending regulating sequence of said peptide EF-1 is shown in SEQ ID No.2, and amplified production contains XbaI and BspEI restriction enzyme site;
(4) pCDNA3.1 (+) is changed structure, primer BGH1SEQ ID No.7 contains the XbaI enzyme cutting site, and BGH2SEQ ID No.8 contains the BspEI restriction enzyme site, and FOR1SEQ ID No.9 contains the BspEI restriction enzyme site, and FOR2SEQ ID No.10 contains the XmaI restriction enzyme site; Method through PCR is a template with pCDNA3.1 (+); Amplify the segment of 200bp and 800bp respectively; The fragment that glue is cut 200bp with XbaI, BspEI enzyme respectively after reclaiming, the segment that BspEI, XmaI enzyme are cut 800bp, XbaI, XmaI enzyme are cut back glue and are reclaimed big segment; Again carrier is connected with the 800bp segment with 200bp, so far introduces the BspEI restriction enzyme site at the BGHPA place of pcDNA3.1 (+);
(5) be connected into the EGFP reporter gene at the EcoRV place that step (4) changes the pcDNA3.1 (+) of structure and draw pcDNA3.1 (+)/EGFP carrier;
(6) utilize the peptide EF-1 gene 3 ' ending regulating sequence shown in peptide EF-1 gene 5 ' ending regulating sequence shown in the SEQ ID No.1 and the SEQ ID No.2 to substitute CMV promotor and BGHPA among replacement pcDNA3.1 (+)/EGFP.
5. method according to claim 4 is characterized in that, adds manual transcription factor binding sequence 2UAS at the carrier upper reaches that the said step of claim 4 (6) prepares, and said carrier structure is shown in Fig. 4 B.
6. the primer of the 5 ' terminal nucleotide sequence that efficiently expresses at the HEK293 cell of the said transcriptional control foreign gene of claim 1 that is used for increasing is characterized in that said primer sequence is shown in SEQ ID No.3 and SEQID No.4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101643683A CN101864420B (en) | 2009-05-06 | 2010-05-06 | Expression vector for efficiently expressing exogenous gene of HEK293 cell |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910083174.8 | 2009-05-06 | ||
| CN200910083174 | 2009-05-06 | ||
| CN2010101643683A CN101864420B (en) | 2009-05-06 | 2010-05-06 | Expression vector for efficiently expressing exogenous gene of HEK293 cell |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101864420A CN101864420A (en) | 2010-10-20 |
| CN101864420B true CN101864420B (en) | 2012-05-23 |
Family
ID=42956344
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101643683A Expired - Fee Related CN101864420B (en) | 2009-05-06 | 2010-05-06 | Expression vector for efficiently expressing exogenous gene of HEK293 cell |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101864420B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250952B (en) * | 2011-06-17 | 2016-01-20 | 中国人民解放军军事医学科学院生物工程研究所 | The carrier that mediate foreign gene is expressed at mammal cell with high efficient and application thereof |
| CN104862282A (en) * | 2015-06-16 | 2015-08-26 | 刘漪沦 | Method for inducing adipose tissue-derived mesenchymal stem cells into corneal epithelial-like cells |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1200235A (en) * | 1997-05-26 | 1998-12-02 | 赫彻斯特股份公司 | Purificn. of higher order transcription complexes from transgenic non-human animals |
| WO2008044869A1 (en) * | 2006-10-10 | 2008-04-17 | Viromed Co., Ltd. | Expression vectors with improved safety |
-
2010
- 2010-05-06 CN CN2010101643683A patent/CN101864420B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1200235A (en) * | 1997-05-26 | 1998-12-02 | 赫彻斯特股份公司 | Purificn. of higher order transcription complexes from transgenic non-human animals |
| WO2008044869A1 (en) * | 2006-10-10 | 2008-04-17 | Viromed Co., Ltd. | Expression vectors with improved safety |
Non-Patent Citations (1)
| Title |
|---|
| 来大志 等.应用人延伸因子1α亚基启动子和人工转录激活因子提高外源基因在CHO细胞中的表达.《生物化学与生物物理进展》.2004,第31卷(第2期),118-126. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101864420A (en) | 2010-10-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2016211118B2 (en) | Method for inducing targeted meiotic recombinations | |
| CN107429255B (en) | Methods for introducing multiple expression constructs into eukaryotic cells | |
| CN101517085B (en) | Regulatory nucleic acid elements | |
| JP6694386B2 (en) | Stabilized episome based on non-integrative lentiviral vector | |
| JPH04505104A (en) | Production of proteins using homologous recombination | |
| AU2008339985B2 (en) | Mammalian expression vector | |
| EA034039B1 (en) | Site-specific integration host cell, method of production and use thereof | |
| EP1694850A2 (en) | Plasmid system for multigene expression | |
| AU2007277863A1 (en) | Human artificial chromosome (HAC) vector, and human cell pharmaceutical comprising human artificial chromosome (HAC) vector | |
| CN102459586B (en) | Expression vector for establishing hyper-producing cells, and hyper-producing cells | |
| CN102648288A (en) | Inhibition-based high-throughput screen strategy for cell clones | |
| CN101120093B (en) | Vectors comprising novel regulatory elements | |
| WO2010006415A1 (en) | Mammalian cell expression vectors and utilization | |
| JPH06506356A (en) | Method for selecting recombinant host cells that express desired proteins at high levels | |
| JP2014036671A (en) | Expression vector, transfection system, and method of use thereof | |
| CN113278635A (en) | Sequence combination for promoting cyclic RNA cyclization and application thereof | |
| KR101385223B1 (en) | Expression vector for Animal Cell | |
| WO2016003368A1 (en) | Optimized vectors for the production of recombinant proteins | |
| KR20170132784A (en) | Eukaryotic expression vectors containing regulatory elements of the globin gene cluster | |
| JPH05503015A (en) | mammalian expression vector | |
| CN101864420B (en) | Expression vector for efficiently expressing exogenous gene of HEK293 cell | |
| CN104093834A (en) | Expression cassette | |
| CN1216990C (en) | Plant promoter and gene expression with the use of the same | |
| CN104975018B (en) | A kind of novel enhanced is sub and its applies | |
| CN109402096B (en) | AID enzyme mutant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120523 Termination date: 20150506 |
|
| EXPY | Termination of patent right or utility model |