CN101855973A - Fungus strain irpex iacteus for producing laccase, and culturing method and application thereof - Google Patents
Fungus strain irpex iacteus for producing laccase, and culturing method and application thereof Download PDFInfo
- Publication number
- CN101855973A CN101855973A CN 201010124690 CN201010124690A CN101855973A CN 101855973 A CN101855973 A CN 101855973A CN 201010124690 CN201010124690 CN 201010124690 CN 201010124690 A CN201010124690 A CN 201010124690A CN 101855973 A CN101855973 A CN 101855973A
- Authority
- CN
- China
- Prior art keywords
- medium
- laccase
- wheat bran
- culture
- sdu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a novel fast-growing fungus strain irpex iacteus for producing laccase efficiently, and a culturing method and application thereof, and belongs to the technical field of biological engineering. The irpex iacteus sdu-5 is preserved in the China General Microbiological Culture Collection Center on December 28, 2009, and the preservation number is CGMCC NO.3548. The strain can produce the laccase economically and efficiently under the condition that an inducer is added into a liquid nutrient medium or no inducer is added into a solid fermentation nutrient medium.
Description
Technical field
The present invention relates to the efficient rapidly fungus strain irpex iacteus for producing laccase of a kind of new growth and cultural method and application, belong to technical field of bioengineering.
Background technology
Laccase is a kind of by the human protein of using the earliest.Laccase is a kind of glycoprotein, and the molecular weight of monomer differs in size from 50kD to 110kD, and sugar content probably accounts for 10%～45% of molecular weight and do not wait.The laccase of finding is mainly the tetramer at present, also has dimer and monomer laccase in addition, and also differs bigger on sequence homology.The convergent evolution of biosphere protein and laccase have Substratspezifitaet widely, make that the classification of laccase is not very clear and definite, exist a large amount of albumen with the similar activity of laccase.The purity that the structure that laccase has typical four copper ions makes people to absorb by the spectroscopy of laccase to define laccase and measure laccase.Four copper ions of laccase have been formed two activated centre T
1Copper ion is relevant with the oxidability of the substrate of laccase, T
2And two T
3Copper atom is formed the reduction center, can receive from T
1The electronics that the site obtains becomes water with oxygen reduction, and wherein three bronze medals bunch also are the essential distinctions of laccase and tyrosine oxidase (the oxidasic reduction of tyrosine center is two copper ions).Our ancestors just can utilize laccase to produce lacquerware before 6000.Laccase is distributed widely in the middle of animal, plant, fungi, the bacterium.At present people mainly concentrate in the middle of fungi and the bacterium the research of laccase.Laccase can utilize oxygen as electron donor direct oxidation aromatic compound and the lower non-phenol type compound of some redox potentials; Macromolecular substances such as can the oxidation redox potential under the mediation of amboceptor higher substrate of laccase and lignin simultaneously.The substrate scope that the discovery of amboceptor has greatly enlarged laccase has also enlarged simultaneously the range of application of laccase.Laccase has important application prospects in industries such as paper pulp papermaking, dye decolored, food processing, beverage processing, organic synthesis, clothes manufacturing, sensor manufacturing.
The searching of novel laccase enzyme always is a research focus, the output of fungal laccase is higher than bacterial laccase far away, but the fungi particularly growth fraction bacterium of wood-rotting fungi wants slow, laccase is the enzyme that needs in a kind of secondary metabolism, need thalline to enter after stationary phase during secretion, so the fermentation time of laccase is long.Can grow the fast bacterial strain of justacrine laccase of searching can shorten the incubation time of fungi effectively, reduces fermentation costs.Liquid fermentation often requires than higher the instrument and equipment of fermentation, and power consumption, needs fermentation costs such as inducer than higher.Solid fermentation can effectively shorten fermentation time, reduces fermentation costs, and the solid fermentation medium of white-rot fungi often all is agricultural product or industrial products waste material, and fermentation process does not need to add advantages such as inducer.The general fermentation period of solid fermentation is longer, generally needs about 20 days to one month, therefore seeks the bacterial strain that laccase production ability is strong rapidly of growing and can effectively reduce fermentation costs.
Present solid state fermentation method some report all at home and abroad of producing laccase.Raw material sources are more extensive, comprise corn, cotton, bagasse, wheat bran, stalk, sawdust, banana skin, grape stone, peanut skin etc., and their fermented mixture.The solid fermentation time concentrated on about one month, and fermentation period is longer, and great majority add trace element and derivant etc. during the fermentation.
Summary of the invention
The present invention is directed to the deficiencies in the prior art, a kind of new white rake teeth bacterium and cultural method and application with the quick growth of high yield laccase are provided, this strain growth is rapid, can utilize industrial waste xylose residue and wheat bran to produce laccase.
A kind of white rake teeth bacterium (Irpex lacteus) sdu-5, this bacterial strain has been preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on December 28th, 2009, the address: No. 3 Institute of Microorganism, Academia Sinica in Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, deposit number is: CGMCC No.3548.
The product laccase bacterium of the quick growth that the present invention relates to-Bai rake teeth bacterium (Irpex lacteus) sdu-5 separates a strain basidiomycetes that obtains from Shandong University by selective medium.This bacterial strain obtains by the selective medium separation after gathering fruit body, by with the collection of this laboratory and separate the product laccase bacterial strain that obtains and compare and find that this strain growth is rapid, can produce composing type laccase and induction type laccase, when carrying out solid state fermentation, not need to add any derivant with wheat bran and xylose residue.
The growth that the present invention relates to is rapid, and the bacterial strain-Bai rake teeth bacterium that can utilize industrial waste raw material xylose residue and wheat bran efficiently to produce laccase has following biological property:
A real layer body implosion is dentation after the bacterial strain maturation, and is poroid at early development.Upper surface white is to bristle cream-colored or faint yellow, that close life is arranged, and no endless belt has shallow rill, and the edge is homochromy.Aperture colourless look is to cream-colored, and there are corner angle in the aperture, hole between every millimeter at proximal edge place, and the span wall is thin, and the initial stage becomes irpiciform with regard to drastic crack.Bacterial context white is to light color, soft fibre matter, no endless belt.Basidiocarps is annual, and is open and flat to warp, cap 8～15 * 9～20mm, thick 1.5～3mm, surface white has elongated hair, the long 1～2mm of tube hole face yellowish white, the about 2/mm of the mouth of pipe, often split and be dentation. the simple barrier film of mycelia system two build generative hypha tools, diameter 3～4um, cystidium is remarkable.Mycelium can produce clamp connection on the top.Produce the spherical mycelium that can produce white under the enzyme medium concussion condition of culture at liquid.
(the internaltranscribed spacer of the transcribed spacer of white rake teeth bacterium (Irpex lacteus) the sdu-5 CGMCC No.3548 that the present invention relates to, ITS) nucleotide sequence (comprising the part of 18SDNA and 28SDNA and two spacer segment sequences between 5.8SDNA and the three) length is 696 bases, shown in sequence table SEQ ID No.1.
By (the National Center for Biotechnology Information of U.S. biotechnology information centre, NCBI) sequence homology analysis, the ITS nucleotide of the white rake teeth bacterium of bacterial strain of the present invention (Irepx lacteus) sdu-5 CGMCC No.3548 is compared by Blast, and comparison result shows that this bacterial strain belongs to white rake teeth bacterium.Sporophore shape analysis and mycelium morphology analysis in conjunction with this bacterial strain show that according to " fungi identification handbook " (Wei Jingchao work) this bacterial strain belongs to the white rake teeth bacterium in the fungi Basidiomycotina.This bacterial strain has been preserved to preserve with Chinese common micro-organisms culture presevation administrative center on December 28th, 2009: CGMCC No.3548.
The cultural method of a kind of white rake teeth bacterium (Irpex lacteus) sdu-5 is characterized in that concrete steps are as follows:
Get the white rake teeth bacterium sdu-5 bacterial strain that culture presevation is numbered CGMCC No.3548, this inoculation is activated 3～4 days to wheat bran leachate slant medium, temperature is 28～30 ℃; The white rake teeth bacterium sdu-5 that gets after the activation is inoculated in wheat bran liquid nutrient medium enlarged culture, and cultivation temperature is 28～30 ℃; Incubation time is 3～4 days, and the speed of concussion type shaking table is 80 rev/mins; To be inoculated in through the bacterium liquid of enlarged culture to optimize produces in the enzymatic synthesis medium or fermented and cultured in the solid fermentation medium.
The preparation method that described wheat bran leaches liquid nutrient medium is as follows: wheat bran 195～205g is added in the 1L water, boils to boil 30min six layers of filtered through gauze, natural pH, 121 ℃ of sterilization 20～30min.
The preparation method of described wheat bran leachate slant medium is as follows: wheat bran 195～205g is added in the 1L water, boils and boils 30min, and six layers of filtered through gauze are added 19.5～20.5g agar, natural pH, 121 ℃ of sterilization 20～30min.
The prescription that the enzymatic synthesis medium is produced in described optimization is: every liter of liquid nutrient medium contains: 9.5～10.5g glucose, 0.4～0.5gK
2HPO
4, 1.5～2.5g (NH
4)
2HPO
4, 0.3～0.5g NaH
2PO
4, 0.4～0.6g MgSO
47H
2O, 1.5～2.5g yeast extract, 0.001g ZnSO
4, 0.005g FeSO
47H
2O, 0.06g CaCl
2, 0.005g CuSO
45H
2O, 0.005g MnSO
4H
2O, veratryl alcohol 2～4mM, pH 5.5～6.5.
The condition of culture that the enzymatic synthesis medium is produced in described optimization is: 28～30 ℃ of cultivation temperature, 80 rev/mins of concussion type shaking table speed, incubation time 7～9 days.
The preparation method of described solid fermentation medium is: add behind 4 weight portion wheat brans and the abundant mixing of 6 weight portion xylose residues 6～8 times water in 120 ℃ the sterilization 30～50min be placed on 25～35 ℃ after 24 hours once more in 120 ℃ the sterilization 30～50min, promptly.
The condition of culture of described solid fermentation medium is: the shallow-layer solid state fermentation, cultivate humidity 45～75%, 20～28 ℃ of cultivation temperature, incubation time 10～12 days.
The application aborning of the white rake teeth bacterium of bacterial strain of the present invention (Irpex lacteus) sdu-5 CGMCC No.3548 laccase: warm tolerance laccase of the present invention is through being that the laccase of medium production can be applied to that papermaking, pulp processing, papermaking wastewater are handled, dyeing and printing sewage is handled and industries such as food, beverage and bio-sensing with wheat bran and xylose residue.
The reagent of preparing above-mentioned medium is the commercially available prod, and xylose residue is the industrial waste raw material, can be buied by xylose production enterprise.
Beneficial effect of the present invention is as follows:
1) white rake teeth bacterium (Irpex lacteus) sdu-5 can grow under liquid or solid culture situation fast, effectively reduces fermentation period, dwindles manufacturing cost.
2) cultured products is easily separated, and medium is removed culture through the lixiviate of 5～10 times of water normal temperature after 30 to 60 minutes, and leachate can be used for commercial use after ultrafiltration and concentration is lyophilized into powder.
3) white rake teeth bacterium (Irpex lacteus) sdu-5 can be able to produce higher laccase under as the situation of fermentation substrate with wheat bran and xylose residue, because culture medium raw material cheaply is easy to get, it is low that existing product laccase bacterium is cultivated cost, and can solve the waste material wheat bran and the xylose residue of agricultural byproducts processing preferably, be beneficial to the comprehensive utilization of resource.
Description of drawings
Fig. 1 is a PCR product electrophoresis detection collection of illustrative plates;
Fig. 2 produces the enzyme curve time;
Fig. 3 is the determining nucleic acid sequence collection of illustrative plates;
Embodiment
Embodiment 1 is the separation screening of growth product laccase bacterial strain fast:
1. medium:
Isolation medium: in 20% (200g) wheat bran, add 1L water, boil back 30min, 6 layers of filtered through gauze; Taking by weighing 2% (20g) agar strip adds in the 1000ml triangular flask; With filter wheat bran liquid pack in this triangular flask, add water and be settled to 1000ml; With wheat bran juice medium and clean 121 ℃ of moist heat sterilization 20min of culture dish, add penicillin and streptomycin to 200mg/L, fall dull and stereotyped; Standby.
High flux is grown fast and is produced the laccase selective medium: add 1L water in 10% (100g) wheat bran, boil back 30min, 6 layers of filtered through gauze; Taking by weighing 2% (20g) agar strip adds in the 1000ml triangular flask; With filter wheat bran liquid pack in this triangular flask, add water and be settled to 1000ml; With wheat bran juice medium and clean 121 ℃ of moist heat sterilization 20min of culture dish, add guaiacol to 200mg/L, fall dull and stereotyped standby.
Liquid produces the laccase selective medium: add 1L water in 10% (100g) wheat bran, boil back 30min, 6 layers of filtered through gauze; Divide and to install to that standby packing volume accounts for 1/10th of triangular flask volume in the triangular flask; Standby in 121 ℃ of moist heat sterilization 20min.
2. screening step:
(1) gets long matrix or the fungus sporophore that fungi is arranged, be inoculated on the separation and purification culture medium flat plate, cultivate 28 to 30 ℃ of cultivation temperature in the incubator with the pocket knife fritter of getting internally seldom of riving.The separation of fungi in the soil: preparation soil dilution: take by weighing soil sample 10 grams, put into the triangular flask of containing the 90ml sterile water and having bead, the about 20min of jolting makes the abundant mixing of soil sample and water, and cell is disperseed.Therefrom draw in the Boiling tube that the 1ml soil supension adds the 9ml sterile water fully mixing with a 1ml aseptic straw, from then on draw 1ml in the test tube with aseptic straw then and add in another test tube that fills the 9ml sterile water, mix, make 10 by that analogy
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6Different dilution soil.
Spread plate: three dull and stereotyped ground of above-mentioned purifying medium are write 10 with marking pen respectively
-2, 10
-4, 10
-6Three kinds of dilution factors, then with aseptic straw respectively by 10
-2, 10
-4, 10
-6Respectively getting 0.1ml in the three pipeclay earth dilutions checks the number to put into and finishes writing dilution flat board.The 0.1ml bacteria suspension is dropped in plating medium surface middle position carefully.The right hand takes the aseptic rod that is coated with to lie on the plating medium surface, and bacteria suspension is promoted lightly back and forth along straight line earlier, makes it to be evenly distributed, and changes direction then and promotes back and forth along another vertical line, and dull and stereotyped inward flange can change direction and be coated with several times.After the coating evenly, leave standstill 5～10min under the room temperature, make bacterium liquid adsorb into medium.
(2) observe the dull and stereotyped fungi growth situation that goes up every other day.The fungus colony that grows on the picking flat board is transferred on the other flat board, till the fungi that separates only grows a kind of bacterium colony of purifying, obtains nearly hundred strains of fungi altogether.
3. the scalping of growth product laccase bacterial strain fast: the growing ability of the reflection thalline that the growing ability of bacterium colony can be similar in the culture dish; Guaiacol is a kind of phenol type compound, can be produced red or wine-colored product by the laccase oxidation, the power of variable color can reflect the power of laccase production ability to a certain extent, selects growth rapidly from nearly hundred fungal strains, and the bacterial strain that variable color is darker carries out next step screening.
4. grow fast and produce the multiple sieve of laccase bacterial strain: get and grow in the above-mentioned bacterial strains rapidly, the bacterial strain that metachrosis is strong carries out the liquid fermentation checking.Find that bacterial strain sdu-5 has the laccase that growth also can produce composing type and induction type rapidly, is worth further studying.
The liquid fermentation activity determination method is ABTS[2,2 '-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid), 2,2 '-azine group-two-(3-ethyl benzo thiazoline quinoline-6-sulfonic acid) di-ammonium salts] method or DMP (2,6-Dimethoxyphenol, 2, the 6-syringol) its concrete operations of method are: ABTS (2,2 '-azine group-two-(3-ethyl benzo thiazoline quinoline-6-sulfonic acid) di-ammonium salts) substrate of method is ABTS (2,2 '-azine group-two-(3-ethyl benzo thiazoline quinoline-6-sulfonic acid) di-ammonium salts), its concentration is 1mM, reaction volume is 2ml, and buffer system is the acetic acid sodium-acetate buffer of 20mM, and the mensuration wavelength is 420nm, extinction coefficient is ε=36,000M
-1Cm
-1The substrate of DMP (2, the 6-syringol) method is DMP (2, the 6-syringol), and concentration of substrate is 10mM, and reaction volume is 2ml, and buffer system is the acetic acid sodium-acetate buffer of 20mM, and the mensuration wavelength is 470nm, and extinction coefficient is ε=49,600M
-1Cm
-1The large-scale instrument of using in the enzyme assay is the UV-3100 type UV, visible light all band spectrophotometer of Shimadzu.
Embodiment 2 is the evaluation of the white rake teeth bacterium of growth product laccase bacterial strain fast
1. morphology and Physiology and biochemistry are identified
At first with the fruit body that collects or through cultivate the fruit body that produces and spore shape and classification of fungi learn to do volume " a fungi identification handbook " (Wei Jingchao work) contrast this bacterial strain maturation of Preliminary Identification after a real layer of body implosion be dentation, and be poroid at early development.Upper surface white is to bristle cream-colored or faint yellow, that close life is arranged, and no endless belt has shallow rill, and the edge is homochromy.Aperture colourless look is to cream-colored, and there are corner angle in the aperture, and between every millimeter at proximal edge place one, the span wall is thin, and the initial stage becomes irpiciform with regard to drastic crack.Bacterial context white is to light color, soft fibre matter, no endless belt.Basidiocarps is annual, and is open and flat to warp, cap 8～15 * 9～20mm, thick 1.5～3mm surface white, elongated hair is arranged, the long 1～2mm of tube hole face yellowish white, the about 2/mm of the mouth of pipe, often split and be dentation. the simple barrier film of mycelia system two build generative hypha tools, diameter 3～4um, cystidium is remarkable.This bacterial strain should belong to white rake teeth bacterium, specifically also need molecular biological method to verify evaluation.
2.ITS sequence analysis
The extraction of genomic DNA, the thalline of growing in the wheat bran liquid nutrient medium (about 2～3 days) is used two-layer filtered through gauze, thalline is placed in the mortar of liquid nitrogen precooling to grind.Extracting genomic DNA, is the electrophoresis detection that 1% agarose gel electrophoresis carries out DNA with concentration then.Qualified after testing DNA carries out the pcr gene amplification, the primer that PCR adopts is ITS5: be positioned at 18sRNA sequence GGAAGTAAAAGTCGTAACAAGG (SEQ ID NO.2), ITS4: being positioned at the 28sRNA sequence is TCCTCCGCTTATTGATATGC (SEQ ID NO.3); Be connected to the PMD20-T plasmid transformation escherichia coli after the DNA electrophoresis detection (Fig. 1) that pcr amplification obtains, the thalline of conversion extracts plasmid and carries out the electrophoresis checking through after adding the screening of LA (the Luria-Bertani medium adds ampicillin) medium; Transform successful bacterial classification and serve the order-checking of Hai Yingjun company.Sequencing result as shown in Figure 3, its ordered sequence is SEQ ID No.1, all the other sequences are the partial sequence of plasmid vector.
The liquid fermentation of embodiment 3 white rake teeth bacterium laccases is measured
Synthetic medium lacks the part growth factor, and most thalline are grown slower on synthetic medium, and white rake teeth bacterium grow on above-mentioned medium rapidly, reaches maximum in the 8th day amount of growth and laccase output.Add veratryl alcohol as derivant after yield of enzyme can improve, illustrate that this bacterial strain can either produce the composing type laccase, can produce the induction type laccase again.Carbon source and nitrogenous source to medium carried out the selectivity test respectively.Carbon source has glucose, maltose, sodium oxalate, citric acid; Nitrogenous source has sulfate of ammoniac, sal-ammoniac, urea, sodium nitrate, DAP, and test finds that the optimum carbon source and the optimum nitrogen source of this liquid nutrient medium are respectively glucose and hydrogen sulfate two ammoniums.Be optimized after condition of culture is optimized and produce the enzymatic synthesis medium, composition is as follows:
Every liter of liquid nutrient medium contains: 9.5～10.5g glucose, 0.4～0.5g K
2HPO
4, 1.5～2.5g (NH
4)
2HPO
4, 0.3～0.5gNaH
2PO
4, 0.4～0.6g MgSO
47H
2O, 1.5～2.5g yeast extract, 0.001g ZnSO
4, 0.005g FeSO
47H
2O, 0.06g CaCl
2, 0.005g CuSO
45H
2O, 0.005g MnSO
4H
2O, veratryl alcohol 2～4mM, pH is 5.5～6.5;
It is as follows to optimize the optimal culture condition that produces the enzymatic synthesis medium:
The oscillation mode shaking table is cultivated, shaking speed 80r/min, 28～30 ℃ of cultivation temperature, incubation time 7～9 days.
The solid fermentation of embodiment 4 white rake teeth bacterium laccases
Choosing of solid fermentation thing: the industrial waste living beings and the more rich additive of nutriment of choosing the employing fermentation costs of solid fermentation thing, can effectively reduce fermentation costs, have to make full use of discarded object.In view of not only there had been the laccase of composing type in this bacterium but also had had the laccase of induction type, adopt industrial waste xylose residue (Yucheng, Shandong Long Li group) and waste paper-making lignin (Shandong Huatai Paper Co., Ltd.) and straw, maize straw, the poplar powder, bagasse, living beings such as wheat bran are mixed the water after fermentation of 6～8 times of interpolations.Tunning is afterwards centrifugal through 5 times water logging bubble extraction in 30 minutes to be that substrate is measured enzymic activity with DMP.
Through cultivate measuring, this bacterial strain can be with wheat bran and xylose residue as producing higher laccase under the situation of fermentation substrate.Through the part factorial experiment main product enzyme influence factor is screened, the mixed proportion of wheat bran and xylose residue and incubation time are to the yield effect maximum of laccase.Mixed proportion and incubation time to wheat bran and xylose residue are optimized, and produce the enzyme best results when mixed proportion is 4 weight portion wheat brans, 6 weight portion xylose residues, and it produces the enzyme Best Times is 10～12 days, as shown in Figure 2.Do not need to add metal copper ion and derivant in the incubation, cultured products is removed culture through the lixiviate of 5～10 times of water normal temperature after 30 to 60 minutes, and the enzyme powder of leachate after concentrated freeze-dried can be used in industrial papermaking, pulp modifying, papermaking wastewater processing, dyeing and printing sewage processing, food industry, beverage industry, apparel industry, the organic synthesis industry.
Through the solid fermentation condition after optimizing be: the water that adds 6～8 times behind 4 weight portion wheat brans and the abundant mixing of 6 weight portion xylose residues carries out the shallow-layer solid state fermentation, and cultivate humidity and be controlled at 45～75%, 20～28 ℃ of cultivation temperature, incubation time is 10～12 days.Cultured products is removed culture through the lixiviate of 5～10 times of water normal temperature after 30 to 60 minutes, leachate after ultrafiltration and concentration is lyophilized into powder enzyme activity greater than 3000U/g (DMP is as substrate).Incubation time effectively shortens about 10 days than the incubation time of the bolt bacterium AH28-2 that people such as Xiao Yazhong cultivate, and enzyme powder activity is lower slightly after the freeze-drying.Separating the bacterial strain that obtains with people such as Shi Xiaoyan, to compare fermentation time roughly consistent but enzymic activity is much higher than its fermenting enzyme activity.Solid fermentations such as external in addition useful banana skin grape stone can produce the laccase of enzymatic activity high, but raw material sources are compared xylose residue and the difficult collection of wheat bran, be difficult to large-scale culture, and its fermentation Best Times is about 22 days, than white rake teeth bacterium incubation time length about 10 days.
SEQUENCE?LISTING
＜110〉Shandong University
＜120〉a kind of fungus strain irpex iacteus for producing laccase and cultural method thereof and application
<160>3
<170>PatentIn?version?3.5
<210>1
<211>696
<212>DNA
<213>Irpex?lacteus?sdu-5
<400>1
ggaagtaaaa?gtcgtaacaa?ggtttccgta?ggtgaacctg?cggaaggatc?attatcgagt 60
tttgaacggg?ttgtagctgg?cctttcacga?ggcatgtgca?cgcctggctc?atccactctt 120
aacctctgtg?cactttatgt?aagagaaaaa?aatggtggaa?gcttccagga?tctcgcgaga 180
ggtcttcggt?tgaacaagcc?gtttttcttt?cttatgtttt?actacaaacg?cttcagttat 240
agaatgtcaa?ctgtgtataa?cacatttata?tacaactttc?agcaacggat?ctcttggctc 300
tcgcatcgat?gaagaacgca?gcgaaatgcg?ataagtaatg?tgaattgcag?aattcagtga 360
atcatcgaat?ctttgaacgc?accttgcact?ccttggtatt?ccgaggagta?tgcctgtttg 420
agtctcatgg?tattctcaac?ccctaaattt?ttgtaatgaa?ggtttagcgg?gcttggactt 480
ggaggttgtg?tcggcccttg?tcggtcgact?cctctgaaat?gcattagcgt?gaatcttacg 540
gatcgccttc?agtgtgataa?ttatctgcgc?tgtggtgttg?aagtatttat?ggtgttcatg 600
cttcgaccgt?cttcttgccg?agacaatcat?ttgacaatct?gagctcaaat?caggtaggac 660
tacccgctga?acttaagcat?atcaataagc?ggagga 696
<210>2
<211>22
<212>DNA
＜213〉synthetic
<400>2
ggaagtaaaa?gtcgtaacaa?gg 22
<210>3
<211>20
<212>DNA
＜213〉synthetic
<400>3
tcctccgctt?attgatatgc 20
Claims (9)
1. a white rake teeth bacterium (Irpex lacteus) sdu-5, this bacterial strain is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on December 28th, 2009, and deposit number is: CGMCC No.3548.
2. the cultural method of a white rake teeth bacterium as claimed in claim 1 (Irpex lacteus) sdu-5 is characterized in that concrete steps are as follows:
Get the white rake teeth bacterium sdu-5 bacterial strain that culture presevation is numbered CGMCC No.3548, this inoculation is activated 3～4 days to wheat bran leachate slant medium, temperature is 28～30 ℃; The white rake teeth bacterium sdu-5 that gets after the activation is inoculated in wheat bran liquid nutrient medium enlarged culture, and cultivation temperature is 28～30 ℃; Incubation time is 3～4 days, and the speed of concussion type shaking table is 80 rev/mins; To be inoculated in through the bacterium liquid of enlarged culture to optimize produces in the enzymatic synthesis medium or fermented and cultured in the solid fermentation medium.
3. cultural method as claimed in claim 2 is characterized in that, the preparation method that described wheat bran leaches liquid nutrient medium is as follows: wheat bran 195～205g is added in the 1L water, boils to boil 30min six layers of filtered through gauze, natural pH, 121 ℃ of sterilization 20～30min.
4. cultural method as claimed in claim 2 is characterized in that, the preparation method of described wheat bran leachate slant medium is as follows: wheat bran 195～205g is added in the 1L water, boil and boil 30min, six layers of filtered through gauze are added 19.5～20.5g agar, nature pH, 121 ℃ of sterilization 20～30min.
5. cultural method as claimed in claim 2 is characterized in that, the prescription that the enzymatic synthesis medium is produced in described optimization is: every liter of liquid nutrient medium contains: 9.5～10.5g glucose, 0.4～0.5g K
2HPO
4, 1.5～2.5g (NH
4)
2HPO
4, 0.3～0.5gNaH
2PO
4, 0.4～0.6g MgSO
47H
2O, 1.5～2.5g yeast extract, 0.001g ZnSO
4, 0.005g FeSO
47H
2O, 0.06g CaCl
2, 0.005g CuSO
45H
2O, 0.005g MnSO
4H
2O, veratryl alcohol 2～4mM, pH 5.5～6.5.
6. cultural method as claimed in claim 5 is characterized in that, the condition of culture that the enzymatic synthesis medium is produced in described optimization is: 28～30 ℃ of cultivation temperature, 80 rev/mins of concussion type shaking table speed, incubation time 7～9 days.
7. cultural method as claimed in claim 2, it is characterized in that, the preparation method of described solid fermentation medium is: add behind 4 weight portion wheat brans and the abundant mixing of 6 weight portion xylose residues 6～8 times water in 120 ℃ the sterilization 30～50min be placed on 25～35 ℃ after 24 hours once more in 120 ℃ the sterilization 30～50min, promptly.
8. cultural method as claimed in claim 7 is characterized in that, the condition of culture of described solid fermentation medium is: the shallow-layer solid state fermentation, cultivate humidity 45～75%, 20～28 ℃ of cultivation temperature, incubation time 10～12 days.
9. the described white rake teeth bacterium of claim 1 (Irpex lacteus) sdu-5 is applied to need to add in the industrial papermaking, pulp modifying, papermaking wastewater processing, dyeing and printing sewage processing, food industry, beverage industry, apparel industry, organic synthesis industry of laccase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101246903A CN101855973B (en) | 2010-03-16 | 2010-03-16 | Fungus strain irpex iacteus for producing laccase, and culturing method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101246903A CN101855973B (en) | 2010-03-16 | 2010-03-16 | Fungus strain irpex iacteus for producing laccase, and culturing method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101855973A true CN101855973A (en) | 2010-10-13 |
| CN101855973B CN101855973B (en) | 2012-02-08 |
Family
ID=42942318
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101246903A Expired - Fee Related CN101855973B (en) | 2010-03-16 | 2010-03-16 | Fungus strain irpex iacteus for producing laccase, and culturing method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101855973B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102690147A (en) * | 2012-06-06 | 2012-09-26 | 吉林大学 | Additive for liquid nutrient medium for Irpex lacteus fermentation |
| CN105754881A (en) * | 2016-05-06 | 2016-07-13 | 吉林农业大学 | Irpex lacteus capable of efficiently degrading lignin and application of irpex lacteus |
| CN108929865A (en) * | 2017-05-27 | 2018-12-04 | 北京林业大学 | A method of induction Produced from Pleurotus ostreatus accelerates to produce laccase |
| CN109843043A (en) * | 2017-06-14 | 2019-06-04 | 成长方案技术有限责任公司 | System and method for removing fluid from the pallet in assembly line growth cabin |
| KR20200062446A (en) * | 2018-11-26 | 2020-06-04 | 동의대학교 산학협력단 | Composition of decolorizationing of melanine |
| CN111961596A (en) * | 2020-08-25 | 2020-11-20 | 中南林业科技大学 | Rapex baichii capable of efficiently degrading lignin |
| CN116285405A (en) * | 2022-10-20 | 2023-06-23 | 南京高新工大生物技术研究院有限公司 | Edible fungus fermentation process for secreting laccase and application thereof |
-
2010
- 2010-03-16 CN CN2010101246903A patent/CN101855973B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| 《NCBI Genebank 数据库》 20071217 zhou H et al Irpex sp.HZ-13 8S ribosomal RNA gene,partial sequence 1－9 , 2 * |
| 《农产品加工》 20070515 范文霞等 漆酶的生产和应用研究进展 16-17页 9 , 第5期 2 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102690147A (en) * | 2012-06-06 | 2012-09-26 | 吉林大学 | Additive for liquid nutrient medium for Irpex lacteus fermentation |
| CN105754881A (en) * | 2016-05-06 | 2016-07-13 | 吉林农业大学 | Irpex lacteus capable of efficiently degrading lignin and application of irpex lacteus |
| CN105754881B (en) * | 2016-05-06 | 2019-04-02 | 吉林农业大学 | A kind of Irpex lacteus of degradable lignin and its application |
| CN108929865A (en) * | 2017-05-27 | 2018-12-04 | 北京林业大学 | A method of induction Produced from Pleurotus ostreatus accelerates to produce laccase |
| CN109843043A (en) * | 2017-06-14 | 2019-06-04 | 成长方案技术有限责任公司 | System and method for removing fluid from the pallet in assembly line growth cabin |
| KR20200062446A (en) * | 2018-11-26 | 2020-06-04 | 동의대학교 산학협력단 | Composition of decolorizationing of melanine |
| WO2020111450A1 (en) * | 2018-11-26 | 2020-06-04 | 동의대학교 산학협력단 | Composition for promoting bleaching of melanin |
| KR102167322B1 (en) | 2018-11-26 | 2020-10-20 | 동의대학교 산학협력단 | Composition of decolorizationing of melanine |
| CN111961596A (en) * | 2020-08-25 | 2020-11-20 | 中南林业科技大学 | Rapex baichii capable of efficiently degrading lignin |
| CN116285405A (en) * | 2022-10-20 | 2023-06-23 | 南京高新工大生物技术研究院有限公司 | Edible fungus fermentation process for secreting laccase and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101855973B (en) | 2012-02-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101855973B (en) | Fungus strain irpex iacteus for producing laccase, and culturing method and application thereof | |
| Oyeleke et al. | Cellulase and pectinase production potentials of Aspergillus niger isolated from corn cob | |
| CN101555461B (en) | Bacterial strain LT3 producing alkalescence cellulase and breeding method and initial optimization of cellulase production conditions thereof | |
| CN102559506A (en) | Penicillium oxalicum and application thereof | |
| Garg et al. | Effect of cultural factors on cellulase activity and protein production by Aspergillus terreus | |
| CN103305430B (en) | Laccase generation cerrena and application thereof | |
| CN101864366B (en) | Penicillium citrinum bacterial strain and application thereof | |
| CN104789492B (en) | Bacillus megaterium bacterial strain and its application | |
| CN105602853B (en) | One plant of angstrom of Mo Senluosashi bacterial strain and its application in Pu'er tea production | |
| CN105255745A (en) | Rhizopus for producing beta-glucosidase and method of producing enzyme through rhizopus fermentation | |
| CN104762229B (en) | A kind of bacillus subtilis strain and its application | |
| CN104805017A (en) | Plant endophytic fungus for generation of beta-glucosidase and application thereof | |
| CN104789491B (en) | Lichem bacillus strain and its application | |
| Chaudhary et al. | Thermophilic actinomycetes from hot water spring capable of producing enzymes of industrial importance | |
| CN101790937A (en) | Screening and culture preparing method of Russula.alutacea strain | |
| Garcia-Kirchner et al. | Mixed submerged fermentation with two filamentous fungi for cellulolytic and xylanolytic enzyme production | |
| CN101570745A (en) | Technology for preparing lactose enzyme | |
| Heng et al. | Effects of different parameters on cellulase production by Trichoderma harzianum TF2 using solid‐state fermentation (SSF) | |
| Sukara et al. | A one-step process for the production of single-cell protein and amyloglucosidase | |
| CN104726385B (en) | Bacterial strain and its application and preparation method with high-cellulose enzymatic activity | |
| CN102559511B (en) | Hypocrea for producing mesophile ethanol-tolerant beta-glucosidase highly and application of hypocrea | |
| CN104818220A (en) | Rhizopus oryzae strain JHSW01 obtained by screening rotten straws | |
| SU1643608A1 (en) | Strain of fungus allescheria terrestris producer of cellulases | |
| RU2303065C1 (en) | Mycelium fungi strain trichoderma longibrachiatum as cellulase, beta-glucanase and xylanase producer | |
| Nguyen et al. | Production of high cellulase yields from polypore fungi in solid-state fermentation using green tea waste |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120208 Termination date: 20150316 |
|
| EXPY | Termination of patent right or utility model |