CN101838663B - Colibacillus-corynebacterium shuttle constitutive expression carrier and construction method thereof - Google Patents
Colibacillus-corynebacterium shuttle constitutive expression carrier and construction method thereof Download PDFInfo
- Publication number
- CN101838663B CN101838663B CN 200910260991 CN200910260991A CN101838663B CN 101838663 B CN101838663 B CN 101838663B CN 200910260991 CN200910260991 CN 200910260991 CN 200910260991 A CN200910260991 A CN 200910260991A CN 101838663 B CN101838663 B CN 101838663B
- Authority
- CN
- China
- Prior art keywords
- pdxw
- corynebacterium
- tac
- colibacillus
- expression carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a colibacillus-corynebacterium shuttle constitutive expression carrier and a construction method thereof, which belong to the technical field of gene engineering. In the invention, the expression carrier pDXW-10 can be reproduced in colibacillus and corynebacterium, exists in the colibacillus and the corynebacterium stably and contains a tac-M promoter with a transcription initiation function and a terminator rrnBT1T2 with a transcription termination function in both the colibacillus and the corynebacterium; the expression carrier pDXW-10 contains a resistance gene for marking resistance marking kanamycin used for selecting a corynebacterium transformant; and the expression carrier pDXW-10 contains multiple cloning sites L-MCS containing 11 single restriction enzyme tangent points. In the corynebacterium, the carrier has moderate level for expressing foreign proteins and is especially suitable for the research of the metabolic engineering of the corynebacterium.
Description
Technical field
A kind of Colibacillus-corynebacterium shuttle constitutive expression carrier and construction process thereof belong to the microbiological genetic engineering field.
Background technology
Coryneform bacteria is a class gram-positive microorganism, belongs to have moderate to the actinomycetes of high GC content.(Kinoshita etc. since people separate corynebacterium glutamicum to produce Pidolidone first, nineteen fifty-seven), coryneform three main representatives: corynebacterium glutamicum, brevibacterium flavum, and brevibacterium lactofermentum, be widely used in producing amino acid.Here particularly point out, find to only have very little difference (Liebl etc., 1991) between these three different plant species by the DNA-DNA hybrid experiment.
A large amount of about corynebacterium glutamicum physiology owing to having added up, biological chemistry and genetics knowledge (Eggeling and Bott, 2005; Burkovski, 2008), metabolic engineering has replaced classical random mutation, becomes the main policies of coryneform bacteria strain improvement.
Can be applicable to the structure of coryneform carrier system, is to produce the metabolic engineering improvement of bacterial strain and the basis of coryneform bacteria fundamental research.At present, there have been some can be applied to coryneform expression vector (Eggeling and Bott, 2005).According to different coryneform bacteria replicons, we are divided into four groups to these expression vectors.First group comprises pEKEx1 and pXMJ19, and its replicon is from plasmid pBL1; Second group comprises pVWEx1 and pZ8-1, and its replicon is from plasmid pHM1519; The 3rd group comprises pECTAC-K99, pECTAC-XK99E, and pECTAC-XC99E and pECTAC-XT99A, its replicon is from plasmid pHM1519; The 4th group comprises pAPE12, and its replicon is from plasmid pNG2.All these carriers have two shortcomings: the one, and less single restriction enzyme restriction enzyme site is contained at the place in multiple clone site, and another is that gene is at lacI
qControl under carry out abduction delivering, and expression amount is low.
When the application metabolic engineering carries out strain improvement, we will often want coexpression from a plurality of genes of same biosynthesizing or degradation pathway.The polygene large fragment DNA that carries many restriction enzymes may not be cloned into the multiple clone site place (Radmacher etc., 2002) that contains less single restriction enzyme restriction enzyme site.In addition, in coryneform bacteria, the transcriptional activity of tac promotor lower (Liebl etc., 1992; Billman-Jacobe etc., 1995; Salim etc., 1997; Xu etc., 2009), cause the exogenous gene expression amount that is inserted on carrier lower, this has limited the production of target meta-bolites in the engineering bacteria.In addition, the expression vector in already present coryneform bacteria is mostly inducible expression vector, need in process of production to add inductor IPTG, and IPTG is quite expensive, is unsuitable for being used as the Inducer of gene expression of scale operation purpose product; Lactose can be used for substituting IPTG and be applied to large-scale production as inductor, and for the overwhelming majority's corynebacterium strain, lactose all can not enter (Brabetz etc., 1991) in its cell, and this has also limited the application of inducible expression system in coryneform bacteria.In the present invention, we have built novel clubbed bacillus expression vector, and new carrier has the promotor tac-M of medium tenacity, have improved the point of contact number of multiple clone site, and the gene of insertion carries out constitutive expression.As an example application, we successfully use the cat gene of having expressed coding paraxin acyltransferase (CAT) in brevibacterium flavum.
Summary of the invention
The purpose of this invention is to provide a kind of Colibacillus-corynebacterium shuttle constitutive expression carrier.
Expression vector provided by the invention comprises selection markers and terminator, it is characterized in that promotor is derive from after coryneform transformation tac promotor tac-M and be positioned at the multiple clone site L-MCS of synthetic thereafter, called after pDXW-10.
Expression vector provided by the invention is characterized in that its nucleotides sequence classifies as: SEQ ID NO:1.
Expression vector pDXW-10 contains a tac-M promotor that has stronger transcripting starting function in coryneform bacteria, from 79 to 18.
Expression vector pDXW-10 contains the terminator rrnBT1T2 that has the Transcription Termination function in intestinal bacteria and coryneform bacteria, and from 8075 to 8032 respectively, and from 7900 to 7873.
Expression vector pDXW-10 contains the resistance marker kantlex mark resistant gene that is useful on the selection of coryneform bacteria transformant, from 413 to 1228;
Expression vector pDXW-10 contains makes plasmid can copy the also rep fragment of stable existence in the coryneform bacteria host, from 1635 to 4320.
Expression vector pDXW-10 contains the 74bp multiple clone site L-MCS of the synthetic that is useful on clone's foreign gene, from 8349 to 8275, comprises following 11 single restriction enzyme point of contact EcoRI, NheI, SacI, NcoI, NotI, XhoI, BglII, SacII, AflII, PstI and HindIII, its nucleotides sequence classify gaattcgcta gcgagctccc atgggcggcc gcctcgaggg taccagatct ccgcggctta agctgcagaa gctt as.
Expression vector pDXW-10 provided by the invention, { Escherichia coli JM109(pDXW-10) } have been preserved in Chinese Typical Representative culture collection center, are called for short CCTCC, deposit number CCTCC NO:M 209276, preservation date on November 19th, 2009.
Another object of the present invention is to provide the construction process of expression vector pDXW-10.
For solving the problems of the technologies described above, technical scheme of the present invention is:
The first step: use 2 kinds of different restriction enzyme cutting multiple clone site L-MCS fragments, and be connected to the pDXW-6(Xu et al. of same double digestion, 2009) on, replace the original multiple clone site of pDXW-6, consequent plasmid is pDXW-9;
Second step: by overlapping pcr, the tac promotor on pDXW-9 is carried out rite-directed mutagenesis obtain promotor tac-M;
The 3rd step: the fragment that contains the tac-M promotor of using 2 kinds of different restriction enzyme cuttings to obtain, plasmid pDXW-9 is cut with same restriction enzyme is two, purifying reclaims large fragment, the fragment that will contain the tac-M promotor is connected with the large fragment of recovery, and consequent plasmid is pDXW-10.
The concrete construction process of expression vector pDXW-10 is as follows:
At first, DNA fragmentation 5 ' gaattcgcta gcgagctccc atgggcggcc gcctcgaggg taccagatct ccgcggctta agctgcagaa gctt 3 ' of the 74bp multiple clone site L-MCS of synthetic, it includes 11 single restriction enzyme point of contacts: EcoRI, NheI, SacI, NcoI, NotI, XhoI, BglII, SacII, AflII, PstI and HindIII; With EcoRI and the two multiple clone site L-MCS fragments of cutting 74bp of HindIII, and be connected to same with on EcoRI and the two pDXW-6 that cut of HindIII, replace the original multiple clone site of pDXW-6, L-MCS and both wings thereof to this structure plasmid check order, to verify that the L-MCS exact connect ion is to pDXW-6, the plasmid size that builds is 8351bp, and called after pDXW-9;
Then, by overlapping pcr, the tac promotor on pDXW-9 is carried out rite-directed mutagenesis.Overlapping PCR bag expands continuous two-wheeled PCR reaction.Carry out simultaneously two reactions in the first round.First reaction is, take plasmid pDXW-9 as template, with forward primer tac-F and reverse primer tac-mid-R, carries out the pcr amplification that 5 ' end of the 967bp of the upper ScaI-SalI fragment of plasmid pDXW-9 is divided; Reaction system is 50 μ l, comprises 10 μ l 5 * PrimerSTAR buffer (Mg
2+Plus), 4 μ l dNTP mixtures (each 2.5mM), 1 μ l plasmid template pDXW-9 (100ng/ μ l), 1 μ l forward primer tac-F (20 μ M), 1 μ l comprises the reverse primer tac-mid-R (20 μ M) in mutational site, 0.5 μ l PrimeSTAR
TMHS DNA Polymerase; Response procedures: 94 ℃ of denaturations minute; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 15 seconds, 72 ℃ were extended 60 seconds, 35 circulations; 72 ℃ were extended 10 minutes again; 10 ℃ of preservations.Second reaction be, take plasmid pDXW-9 as template, with forward primer tac-mid-F and reverse primer tac-R, carries out the pcr amplification that 3 ' end of the 1532bp of the upper ScaI-SalI fragment of plasmid pDXW-9 is divided.Reaction system is 50 μ l, comprises 10 μ l 5 * PrimerSTAR buffer (Mg
2+Plus), 4 μ l dNTP mixtures (each 2.5mM), 1 μ l plasmid template pDXW-9 (100ng/ μ l), 1 μ l comprise the forward primer tac-mid-F (20 μ M) in mutational site, 1 μ l reverse primer tac-R (20 μ M), 0.5 μ l PrimeSTAR
TMHS DNA Polymerase; Response procedures: 94 ℃ of denaturations minute; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 15 seconds, 72 ℃ were extended 100 seconds, 35 circulations; 72 ℃ were extended 10 minutes again; 10 ℃ of preservations.With above-mentioned PCR gained two fragment purifications, wait mole number to add the PCR reaction system, carry out second and take turns the PCR reaction.Reaction system is 50 μ l, comprises 10 μ l 5 * PrimerSTAR buffer (Mg
2+Plus), 4 μ l dNTP mixtures (each 2.5mM), 5 ' end fragment of 1 μ l 967bp, 3 ' end fragment of 1 μ l 1532bp, 1 μ l forward primer tac-F (20 μ M), 1 μ l reverse primer tac-R (20 μ M), 0.5 μ l PrimeSTAR
TMHS DNA Polymerase; Response procedures: 94 ℃ of denaturations minute; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 15 seconds, 72 ℃ were extended 150 seconds, 35 circulations; 72 ℃ were extended 10 minutes again; 10 ℃ of preservations.The overlapping PCR product of 2477bp is cloned on the pGEM-T carrier, and checks order.Sequencing result shows-10 region sequence gctcgtataat of the original prolongation of the tac promotor on the ScaI-SalI fragment, is tgtggtaccat by successful rite-directed mutagenesis, and renames the promotor into tac-M.
At last, the ScaI-SalI fragment of the 2477bp that contains the tac-M promotor that obtains is cut with ScaI and SalI pair; Plasmid pDXW-9 is cut with ScaI and SalI are two equally, purifying reclaims the ScaI-SalI large fragment, and the ScaI-SalI fragment of the 2477bp that contains the tac-M promotor that it and overlapping pcr are obtained is two cuts product and be connected, and consequent plasmid size is still 8351bp, called after pDXW-10.Above-described amplimer, amplification condition see embodiment 1 for details.
Beneficial effect of the present invention:
1, expression vector of the present invention all can stable existence in intestinal bacteria and coryneform bacteria.
2, expression vector of the present invention, its L-MCS comprise nearly 11 single restriction enzyme point of contacts, can effectively clone large fragment DNA.
3, expression vector of the present invention, foreign gene carry out constitutive expression in coryneform bacteria.
4, expression vector pDXW-10 of the present invention, its tac-M promotor active medium tenacity in coryneform bacteria is particularly useful for the metabolic engineering research that coryneform bacteria is produced secondary metabolite.
Description of drawings
The structure of Fig. 1 expression vector pDXW-10.
Fig. 2 tac promotor rite-directed mutagenesis.
The physical map of Fig. 3 expression vector pDXW-10.
Fig. 4 CAT protein expression SDS-PAGE collection of illustrative plates.
Embodiment
The structure of embodiment 1 expression vector pDXW-10
The building process of expression vector pDXW-10 such as Fig. 1 are shown in 2.
At first, DNA fragmentation 5 ' gaattcgcta gcgagctccc atgggcggcc gcctcgaggg taccagatct ccgcggctta agctgcagaa gctt 3 ' of the 74bp multiple clone site L-MCS of synthetic, it includes 11 single restriction enzyme point of contacts: EcoRI, NheI, SacI, NcoI, NotI, XhoI, BglII, SacII, AflII, PstI and HindIII; With EcoRI and the two multiple clone site MCS fragments of cutting 74bp of HindIII, and be connected to same with on EcoRI and the two pDXW-6 that cut of HindIII, replace the original multiple clone site of pDXW-6, L-MCS and both wings thereof to this structure plasmid check order, to verify that the MCS exact connect ion is to pDXW-6, the plasmid size that builds is 8351bp, and called after pDXW-9(Fig. 1);
Then, by overlapping pcr, the tac promotor on pDXW-9 is carried out rite-directed mutagenesis (Fig. 2).Overlapping PCR bag expands continuous two-wheeled PCR reaction.Carry out simultaneously two reactions in the first round.First reaction is, take plasmid pDXW-9 as template, with forward primer tac-F and reverse primer tac-mid-R, carries out the pcr amplification that 5 ' end of the 967bp of the upper ScaI-SalI fragment of plasmid pDXW-9 is divided; Reaction system is 50 μ l, comprises 10 μ l 5 * PrimerSTAR buffer (Mg
2+Plus), 4 μ l dNTP mixtures (each 2.5mM), 1 μ l plasmid template pDXW-9 (100ng/ μ l), 1 μ l forward primer tac-F (20 μ M), 1 μ l comprises the reverse primer tac-mid-R (20 μ M) in mutational site, 0.5 μ l PrimeSTAR
TMHS DNA Polymerase; Response procedures: 94 ℃ of denaturations minute; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 15 seconds, 72 ℃ were extended 60 seconds, 35 circulations; 72 ℃ were extended 10 minutes again; 10 ℃ of preservations.Second reaction be, take plasmid pDXW-9 as template, with forward primer tac-mid-F and reverse primer tac-R, carries out the pcr amplification that 3 ' end of the 1532bp of the upper ScaI-SalI fragment of plasmid pDXW-9 is divided.Reaction system is 50 μ l, comprises 10 μ l 5 * PrimerSTAR buffer (Mg
2+Plus), 4 μ l dNTP mixtures (each 2.5mM), 1 μ l plasmid template pDXW-9 (100ng/ μ l), 1 μ l comprise the forward primer tac-mid-F (20 μ M) in mutational site, 1 μ l reverse primer tac-R (20 μ M), 0.5 μ l PrimeSTAR
TMHS DNA Polymerase; Response procedures: 94 ℃ of denaturations minute; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 15 seconds, 72 ℃ were extended 100 seconds, 35 circulations; 72 ℃ were extended 10 minutes again; 10 ℃ of preservations.With above-mentioned PCR gained two fragment purifications, wait mole number to add the PCR reaction system, carry out second and take turns the PCR reaction.Reaction system is 50 μ l, comprises 10 μ l 5 * PrimerSTAR buffer (Mg
2+Plus), 4 μ l dNTP mixtures (each 2.5mM), 5 ' end fragment of 1 μ l 967bp, 3 ' end fragment of 1 μ l 1532bp, 1 μ l forward primer tac-F (20 μ M), 1 μ l reverse primer tac-R (20 μ M), 0.5 μ l PrimeSTAR
TMHS DNA Polymerase; Response procedures: 94 ℃ of denaturations minute; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 15 seconds, 72 ℃ were extended 150 seconds, 35 circulations; 72 ℃ were extended 10 minutes again; 10 ℃ of preservations.The overlapping PCR product of 2477bp is cloned on the pGEM-T carrier, and checks order.Sequencing result shows-10 region sequence gctcgtataat of the original prolongation of the tac promotor on the ScaI-SalI fragment, is tgtggtaccat by successful rite-directed mutagenesis, and renames the promotor into tac-M.
At last, the ScaI-SalI fragment of the 2477bp that contains the tac-M promotor that obtains is cut with ScaI and SalI pair; Plasmid pDXW-9 is cut with ScaI and SalI are two equally, purifying reclaims the ScaI-SalI large fragment, and the ScaI-SalI fragment of the 2477bp that contains the tac-M promotor that it and overlapping pcr are obtained is two cuts product and be connected, consequent plasmid size is still 8351bp, called after pDXW-10(Fig. 1).
The primer sequence that uses in building process is as follows:
tac-F：ggtgagtact?caaccaagtc?attctg
tac-mid-R：aattaatcat?cgtgtggtac?catgtgtgga?attgtgagcg?g
tac-mid-F：atggtaccac?acgatgatta?attgtcaaca?gctcatttca?gaatat
tac-R：ggcatcggtc?gacgctctcc?cttatg
The physical map of expression vector pDXW-10 is seen Fig. 3.
The applicability evaluation of embodiment 2 plasmid pDXW-10 in brevibacterium flavum
In order to prove the operability of pDXW-10, we express the cat gene in brevibacterium flavum.Take business-like plasmid pACYC184 as template, be primer with primer cat-F and the cat-R of SD sequence, by the open reading frame of pcr amplification 660bp vhb gene, 5 of amplified production ' and 3 ' end introduce limiting enzyme EcoRI and HindIII restriction enzyme site.The pcr amplification reaction system is 50 μ l, comprises 10 μ l 5 * PrimerSTAR buffer (Mg
2+Plus), 4 μ l dNTP mixtures (each 2.5mM), 1 μ l plasmid template pACYC184 (100ng/ μ l), 1 μ l forward primer cat-F (20 μ M), 1 μ l reverse primer cat-R (20 μ M), 0.5 μ l PrimeSTAR
TMHS DNA Polymerase; Response procedures: 94 ℃ of denaturations minute; 94 ℃ of sex change 30 seconds, 54 ℃ of annealing 15 seconds, 72 ℃ were extended 45 seconds, 35 circulations; 72 ℃ were extended 10 minutes again; 10 ℃ of preservations.The PCR product is cut with NheI and HindIII are two, and is connected to same pDXW-10 after cutting with NheI and HindIII pair, the recombinant plasmid pDXW-10-cat of generation.
The brevibacterium flavum of 1mL incubated overnight (Brevibacterium flavum ATCC 14067) is inoculated in the LBG substratum of 30mL, brevibacterium flavum B.flavum(pDXW-10) and brevibacterium flavum B.flavum(pDXW-10-cat) be inoculated into respectively in the 30mL LBG substratum that replenishes kantlex.It is 1.5 o'clock that above-mentioned 30mL culture grows in the 600nm optical density(OD), and centrifugal cell harvesting also is suspended in 5mL Tris-HCl damping fluid (100mM, pH7.8).With Constant Cell Disruption Systems (Constant Systems, Daventry, UK), under the 20KPSI condition, smudge cells, the centrifugal cell debris of removing, crude extract is used for the Analysis on Biological Activity of SDS-PAGE and CAT albumen.Brevibacterium flavum B.flavum, B.flavum(pDXW-10) and B.flavum(pDXW-10-cat) cell pyrolysis liquid carry out respectively SDS-PAGE and analyze (Ausubel et al., 1995).Result shows, B.flavum(pDXW-10-cat) sample exists a clear but lighter specific protein leukorrhea, and its molecular weight is about 25kD, this and according to the CAT molecular weight consistent (Fig. 4) of aminoacid sequence prediction.At control sample B.flavum and B.flavum(pDXW-10) in, do not present specific CAT protein band.
For the further expression of proof cat gene, we use the method for Shaw (1975) etc., respectively above-mentioned 3 bacterial strain crude extracts have been carried out the biological activity assay of CAT.Measurement result shows, at control strain B.flavum and B.flavum(pDXW-10) crude extract in the CAT activity do not detected; At bacterial strain B.flavum(pDXW-10-cat) the CAT vigor is 4.852U/mL.Analyze and can reach a conclusion in conjunction with SDS-PAGE collection of illustrative plates and CAT determination of activity numerical value: the cat gene of insertion vector pDXW-10 has carried out moderate expression in brevibacterium flavum, and carrier pDXW-10 is a fabric shuttle-type constitutive expression carrier that is very suitable for metabolic engineering research.
The primer sequence that uses during amplification cat is as follows:
cat-F：aactagctagcgaaaggacatgaacgatggagaaaaaaatcactggatat
cat-R：actaagcttttacgccccgccctgccact
Claims (1)
1. Colibacillus-corynebacterium shuttle constitutive expression carrier, comprise selection markers and terminator, it is characterized in that promotor is the tac promotor tac-M after sudden change, and be positioned at the multiple clone site L-MCS of synthetic thereafter, its nucleotide sequence is as shown in SEQ ID NO:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910260991 CN101838663B (en) | 2009-12-18 | 2009-12-18 | Colibacillus-corynebacterium shuttle constitutive expression carrier and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910260991 CN101838663B (en) | 2009-12-18 | 2009-12-18 | Colibacillus-corynebacterium shuttle constitutive expression carrier and construction method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101838663A CN101838663A (en) | 2010-09-22 |
| CN101838663B true CN101838663B (en) | 2013-05-22 |
Family
ID=42742339
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910260991 Active CN101838663B (en) | 2009-12-18 | 2009-12-18 | Colibacillus-corynebacterium shuttle constitutive expression carrier and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101838663B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101985631B (en) * | 2010-02-10 | 2012-05-30 | 江南大学 | Corynebacterium promoter detection vector and construction method and application thereof |
| CN103555779B (en) * | 2013-08-01 | 2015-08-19 | 江南大学 | A kind of method of fermentative production γ-aminobutyric acid |
| CN103834679B (en) * | 2014-02-20 | 2016-08-17 | 江南大学 | A kind of it is independent of the corynebacterium expression system that antibiotic is selection pressure |
| US11639512B2 (en) | 2017-03-21 | 2023-05-02 | Wuhan Grand Hoyo Co., Ltd. | Corynebacterium constitutive expression vector promoter screened on the basis of transcriptome sequencing, screening method thereof, and applications thereof |
| CN111019966B (en) * | 2019-12-26 | 2023-01-24 | 华南农业大学 | Expression plasmid with higher replication capacity of corynebacteria and construction method thereof |
| CN110951767B (en) * | 2019-12-27 | 2020-11-03 | 华农（肇庆）生物产业技术研究院有限公司 | Corynebacterium and escherichia coli double-expression vector with high copy capacity and construction method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1288060A (en) * | 1999-08-12 | 2001-03-21 | 味之素株式会社 | Reproduced freely particles in bar shaped bacteria |
| CN1748031A (en) * | 2003-02-05 | 2006-03-15 | 底古萨股份公司 | Bacteria and process for producing chemical compounds by said bacteria |
| WO2008033001A1 (en) * | 2006-09-15 | 2008-03-20 | Cj Cheiljedang Corporation | A corynebacteria having enhanced l-lysine productivity and a method of producing l-lysine using the same |
| CN102010862A (en) * | 2004-12-16 | 2011-04-13 | Cj第一制糖株式会社 | Promoter nucleic acid, expression cassette comprising the same, vector and host cell, and method for expressing a gene using the cell |
-
2009
- 2009-12-18 CN CN 200910260991 patent/CN101838663B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1288060A (en) * | 1999-08-12 | 2001-03-21 | 味之素株式会社 | Reproduced freely particles in bar shaped bacteria |
| CN1748031A (en) * | 2003-02-05 | 2006-03-15 | 底古萨股份公司 | Bacteria and process for producing chemical compounds by said bacteria |
| CN102010862A (en) * | 2004-12-16 | 2011-04-13 | Cj第一制糖株式会社 | Promoter nucleic acid, expression cassette comprising the same, vector and host cell, and method for expressing a gene using the cell |
| WO2008033001A1 (en) * | 2006-09-15 | 2008-03-20 | Cj Cheiljedang Corporation | A corynebacteria having enhanced l-lysine productivity and a method of producing l-lysine using the same |
Non-Patent Citations (2)
| Title |
|---|
| Jae Eun Paik 等.Isolation of transcription initiation signals from corynebacterium ammoniagenes and comparison of their gene expression levels in C.ammoniagenes and Escherichia coli..《Biotechnology letters》.2003,第25卷(第16期),1311-1316. * |
| Miroslav patek 等.Promoters of corynebacterium glutamicum.《Journal of biotechnology》.2003,第104卷(第1-3期),311-323. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101838663A (en) | 2010-09-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ueda et al. | Two distinct mechanisms cause heterogeneity of 16S rRNA | |
| CN101838663B (en) | Colibacillus-corynebacterium shuttle constitutive expression carrier and construction method thereof | |
| Jakoby et al. | Construction and application of new Corynebacterium glutamicum vectors | |
| Barabesi et al. | Bacillus subtilis gene cluster involved in calcium carbonate biomineralization | |
| Dartois et al. | Characterization of a novel member of the DegS-DegU regulon affected by salt stress in Bacillus subtilis | |
| Aravalli et al. | Shuttle vectors for hyperthermophilic archaea | |
| Homuth et al. | Post‐transcriptional regulation of the Bacillus subtilis dnaK operon | |
| Hoffmann et al. | Facilitation of direct conditional knockout of essential genes in Bacillus licheniformis DSM13 by comparative genetic analysis and manipulation of genetic competence | |
| CN104087610B (en) | Shuttle vector and construction process thereof and application | |
| Carrasco et al. | Heterocyst-specific excision of the Anabaena sp. strain PCC 7120 hupL element requires xisC | |
| JP2019519242A (en) | Method for generating a bacterial hemoglobin library and its use | |
| KR20210133323A (en) | Recombinant microorganism for improved production of fine chemicals | |
| Reid et al. | The genes controlling sucrose utilization in Clostridium beijerinckii NCIMB 8052 constitute an operon | |
| Barreiro et al. | Transcriptional analysis of the groES-groEL1, groEL2, and dnaK genes in Corynebacterium glutamicum: characterization of heat shock-induced promoters | |
| CN103409446A (en) | Corynebacterium gene continuous knockout system, as well as construction method and application thereof | |
| Kunitake et al. | Agrobacterium tumefaciens-mediated transformation of Aspergillus aculeatus for insertional mutagenesis | |
| Cohen-Kupiec et al. | Function and regulation of glnA in the methanogenic archaeon Methanococcus maripaludis | |
| Lee et al. | Aspergillus oryzae strains with a large deletion of the aflatoxin biosynthetic homologous gene cluster differentiated by chromosomal breakage | |
| CN113462583A (en) | Corynebacterium glutamicum producing amino acid and method for producing amino acid using the same | |
| Heck et al. | Effect of the pufQ‐pufB intercistronic region on puf mRNA stability in Rhodobacter capsulatus | |
| JP5030579B2 (en) | Expression vector for Rhodococcus bacteria | |
| Palacín et al. | SipY is the Streptomyces lividans type I signal peptidase exerting a major effect on protein secretion | |
| Barriuso-Iglesias et al. | Transcriptional analysis of the F0F1 ATPase operon of Corynebacterium glutamicum ATCC 13032 reveals strong induction by alkaline pH | |
| KR20220150328A (en) | Methods of producing constitutive bacterial promoters conferring low to medium expression | |
| Moch et al. | Transcription of the nfrA-ywcH operon from Bacillus subtilis is specifically induced in response to heat |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP02 | Change in the address of a patent holder | ||
| CP02 | Change in the address of a patent holder |
Address after: No. 258 Wuxing Jiayuan, Liangxi District, Wuxi City, Jiangsu Province Patentee after: Jiangnan University Address before: 214122 Jiangsu province Wuxi Li Lake Road No. 1800, Jiangnan University State Key Laboratory of food science and technology Patentee before: Jiangnan University |