CN101837134A - Chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA and preparation method and application thereof - Google Patents
Chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA and preparation method and application thereof Download PDFInfo
- Publication number
- CN101837134A CN101837134A CN 201010160423 CN201010160423A CN101837134A CN 101837134 A CN101837134 A CN 101837134A CN 201010160423 CN201010160423 CN 201010160423 CN 201010160423 A CN201010160423 A CN 201010160423A CN 101837134 A CN101837134 A CN 101837134A
- Authority
- CN
- China
- Prior art keywords
- bcr
- abl
- sea
- pires
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA and a preparation method and an application thereof, the DNA vaccine contains a pIRES plasmid, a BCR/ABL gene and an SEA gene, wherein, the BCR/ABL gene and the SEA gene are respectively positioned on multi-clone sites at two sides of an IRES element on the pIRES plasmid; nucleotide sequences of the BCR/ABL gene and the SEA gene are shown in SEQ ID No.1 and SEQ ID No.2; the DNA vaccine can express BCR/ABL protein and SEA protein; the DNA vaccine can express BCR/ABL protein and SEA protein in eukaryocyte; when being injected into mice, the DNA vaccine can stimulate organism to generate specificity CD8+T cells aiming at CML cells, accompanying increased secretion of a cell factor, thus eradicating minimal residual disease in the bodies of patients, therefore the invention can be applied to prepare drugs for treating chronic myeloid leukemia.
Description
Technical field
The invention belongs to neoplastic hematologic disorder immunization therapy technical field, particularly a kind of chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA and its production and application.
Background technology
At present, (Chronic myelogenous leukemia, treatment CML) mainly contains traditional chemotherapy, IFN-α and tyrosine kinase inhibitor targeted therapy etc. for chronic myelocytic leukemia.Though these Therapeutic Method can improve patient's life quality to a great extent, patient's prognosis has also had bigger improvement, and (minimal residual disease MRD) but is difficult to be eradicated by existing therapeutic scheme the microresidual disease of tumor.Though hematopoietic stem cell transplantation can be eradicated MRD, derived from bone marrow is few, and it is low to join the type success rate, and high transplanting expense and serious transplanting related complication have limited the popularization of this therapy.Owing to all exist in many leukaemic's bodies because the formed fusion gene of chromosome translocation utilizes fusion gene to become the target that numerous research worker are pursued as the target spot of inducing producing specificity leukemia treatment.Because the albumen of vivoexpression not necessarily has the native conformation consistent with albumen in the body, and foreign protein enters the interior back of body to induce humoral immune reaction, dna vaccination then can overcome these defectives effectively, induces humoral immunization and cellular immunization simultaneously.Being aided with the special dna vaccination treatment of CML after conventional therapy finishes is to be hopeful one of method of eradicating MRD.
The BCR/ABL fusion gene is the CML morbidity and uses the effective molecular basis of tyrosine kinase inhibitor imatinib mesylate treatment, is a special leukemia antigen.But express the cell inducing T cell clone property propagation of BCR/ABL fusion gene, point out this intracellular fusion rotein can be processed and offer cell surface by the MHC molecule, therefore can utilize BCR/ABL fusion rotein or fusion gene to induce body to produce specific immune response, perhaps induce the specific CTL of body generation, reach the purpose of immunization therapy at BCR/ABL.Ji etc. discover dna vaccination that the genetic fragment of merging point that utilize to cross over the BCR/ABL fusion gene makes up can be in the mice body inducing producing specificity immanoprotection action.Utilizing the BCR/ABL fusion gene to prepare dna vaccination is one of the method that is hopeful to eradicate the MRD of CML.
But the independent immunological effect that polypeptide vaccine produced a little less than, seeking suitable immunological adjuvant becomes clinical practice and uses the emphasis place that must solve.Superantigen can combine with the MHC-II quasi-molecule and the TCRV β district CDR3 exterior lateral area on antigen presenting cell surface, and does not relate to the identification of TCRV β district CDR3 and TCR α, and the unique way of this activated T cell can produce extremely strong immunne response.It mainly is that (Staphylococcal Enterotoxin A, SEA) etc., the t cell activation function that SEA is powerful makes it become the adjuvant of CML immunization therapy to staphylococcus aureus toxin A that the superantigen on research basis is arranged at present.
At present still do not have final conclusion, how to filter out and have best immunogenic BCR/ABL genetic fragment and be still the key problem that this type of institute faces for the selection of preparation BCR/ABL gene vaccine specificity genes of interest.
Summary of the invention
The shortcoming that primary and foremost purpose of the present invention is to overcome prior art provides a kind of chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA with not enough.This dna vaccination BCR/ABL-pIRES-SEA can express BCR/ABL and the proteic plasmid of SEA simultaneously in eukaryotic cell.
Another object of the present invention is to provide the preparation method of above-mentioned chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA.
A further object of the present invention is to provide the application of above-mentioned chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA.The described dna vaccination that is used for the chronic myelocytic leukemia specific immunity treatment is a kind ofly can express BCR/ABL albumen and the proteic dna vaccination of SEA simultaneously at eukaryotic cell, it can induce the specific CTL of CML patient's body generation at the CML cell, thereby remove the intravital microresidual disease of patient, reach the purpose of curing CML.
Purpose of the present invention realizes by following technical proposals: a kind of chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA, contain pIRES plasmid, BCR/ABL gene and SEA gene, BCR/ABL gene and SEA gene lay respectively on the multiple clone site of the IRES elements on either side on the pIRES plasmid; Wherein, the pIRES plasmid is gyp plasmid, contain multiple clone site A (MCS A), multiple clone site B (MCS B) and IRES element, MCS A and MCS B lay respectively at the both sides of IRES element, the BCR/ABL gene can be positioned on MCS A or the MCS B, and the SEA gene can be positioned on MCS A or the MCS B;
The nucleotide sequence of described BCR/ABL gene (size is 336bp) is as follows:
CCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCA
AGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTG
GCCAGTGGAGATAACACTCTAAGCATAACTAAAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAA
ATG is an atg start codon, and TAG is a termination codon;
The nucleotide sequence of described SEA gene (size is 774bp) is as follows:
TGGTAGCGAGAAAAGCGAAGAAATAAATGAAAAAGATTTGCGAAAAAAGTCTGAATTGCAGGGAACAG
CTTTAGGCAATCTTAAACAAATCTATTATTACAATGAAAAAGCTAAAACTGAAAATAAAGAGAGTCAC
GATCAATTTTTACAGCATACTATATTGTTTAAAGGCTTTTTTACAGATCATTCGTGGTATAACGATTT
ATTAGTAGATTTTGATTCAAAGGATATTGTTGATAAATATAAAGGGAAAAAAGTAGACTTGTATGGTG
CTTATTATGGTTATCAATGTGCGGGTGGTACACCAAACAAAACAGCTTGTATGTATGGTGGTGTAACG
TTACATGATAATAATCGATTGACCGAAGAGAAAAAAGTGCCGATCAATTTATGGCTAGACGGTAAACA
AAATACAGTACCTTTGGAAACGGTTAAAACGAATAAGAAAAATGTAACTGTTCAGGAGTTGGATCTTC
AAGCAAGACGTTATTTACAGGAAAAATATAATTTATATAACTCTGATGTTTTTGATGGGAAGGTTCAG
AGGGGATTAATCGTGTTTCATACTTCTACAGAACCTTCGGTTAATTACGATTTATTTGGTGCTCAAGG
ACAGTATTCAAATACACTATTAAGAATATATAGAGATAATAAAACGATTAACTCTGAAAACATGCATA
The preparation method of described chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA comprises the steps:
(1) the BCR/ABL gene is inserted among the multiple clone site A or multiple clone site B of pIRES plasmid, obtain the BCR/ABL-pIRES plasmid;
(2) the SEA gene is inserted in the multiple clone site of BCR/ABL-pIRES plasmid, SEA gene and BCR/ABL gene lay respectively at the both sides of IRES element, obtain chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA;
Described preparation method more preferably comprises the steps:
(1) extracts the RNA of leukemia cell line K562 cell by the synthetic cDNA of reverse transcription; With the cDNA that obtains is template, goes out size by primer B1 and B2 pcr amplification and is the BCR/ABL fragment of 354bp:
Described primer B1:
Described primer B2:
Described BCR/ABL fragment (354bp) is as follows:
TTCAAAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTT
GGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTAT
GATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAGGTGAAAAGCTCCGGGTCTTAGGCTA
TAATCACAATGGGGAATGGTGTGAAGCCCAAACCAAAAATGGCCAAGGCTGGGTCCCAAGCAACTACA
Wherein, runic ATG is a start codon;
Runic TAG is a termination codon;
Described CTCGAG is the XhoI restriction enzyme site in the square frame;
Described GAATTC is the EcoRI restriction enzyme site in the square frame;
(2) be template with staphylococcus aureus gene group DNA, go out size by primer S1 and S2 pcr amplification and be the SEA fragment of 827bp;
Described primer S1:
Described primer S2:
Described SEA fragment (size is 827bp) sequence is as follows:
GCCCTAACGTTGACAACAAGTCCACTTGTAAATGGTAGCGAGAAAAGCGAAGAAATAAATGAAAAAGA
TTTGCGAAAAAAGTCTGAATTGCAGGGAACAGCTTTAGGCAATCTTAAACAAATCTATTATTACAATG
AAAAAGCTAAAACTGAAAATAAAGAGAGTCACGATCAATTTTTACAGCATACTATATTGTTTAAAGGC
TTTTTTACAGATCATTCGTGGTATAACGATTTATTAGTAGATTTTGATTCAAAGGATATTGTTGATAA
ATATAAAGGGAAAAAAGTAGACTTGTATGGTGCTTATTATGGTTATCAATGTGCGGGTGGTACACCAA
ACAAAACAGCTTGTATGTATGGTGGTGTAACGTTACATGATAATAATCGATTGACCGAAGAGAAAAAA
GTGCCGATCAATTTATGGCTAGACGGTAAACAAAATACAGTACCTTTGGAAACGGTTAAAACGAATAA
GAAAAATGTAACTGTTCAGGAGTTGGATCTTCAAGCAAGACGTTATTTACAGGAAAAATATAATTTAT
ATAACTCTGATGTTTTTGATGGGAAGGTTCAGAGGGGATTAATCGTGTTTCATACTTCTACAGAACCT
TCGGTTAATTACGATTTATTTGGTGCTCAAGGACAGTATTCAAATACACTATTAAGAATATATAGAGA
Wherein, runic ATG is an atg start codon; Runic TAA is a termination codon;
Described TCTAGA is the XbaI enzyme cutting site in the square frame;
Described GTCGAC is the SalI restriction enzyme site in the square frame;
(3) respectively pIRES plasmid and the described BCR/ABL fragment of step (1) are carried out double digestion with XhoI enzyme and EcoRI enzyme, be connected with the pIRES plasmid by the BCR/ABL fragment of T4 dna ligase after again double digestion, the BCR/ABL fragment is inserted among the multiple clone site A of pIRES plasmid, obtains the BCR/ABL-pIRES plasmid;
(4) the BCR/ABL-pIRES plasmid that obtains of SEA fragment that respectively step (2) is obtained with XbaI enzyme and SalI enzyme and step (3) carries out double digestion, be connected with the BCR/ABL-pIRES plasmid by the SEA fragment of T4 dna ligase after then double digestion, the SEA fragment is inserted among the multiple clone site B of BCR/ABL-pIRES plasmid, obtains chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA.
Described step (1) pcr amplification reaction condition is: pre-94 ℃ of 30sec of degeneration, and 60 ℃ of 30sec anneal; Extend 72 ℃ of 30sec, carry out 30 circulations altogether; Pre-first degeneration is 94 ℃ of 4min, and last extends to 72 ℃ of 10min;
Described step (2) pcr amplification reaction condition is: 94 ℃ of pre-degeneration 4min at first, 94 ℃ of 1min then, 50 ℃ of 1min, 72 ℃ of 1min circulations 30 times, last 72 ℃ of overall elongation 10min.
Described chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA can be applicable to prepare the genomic medicine for the treatment of chronic myelocytic leukemia.
The present invention compares with prior art, has following advantage and beneficial effect:
(1) chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA of the present invention is one can expresses BCR/ABL and the proteic plasmid of SEA simultaneously in eukaryotic cell, this dna vaccination is expelled to expresses BCR/ABL and SEA albumen in the mice body, excitating organism produces the specific C D8+T cell at the CML cell, and, can reach the purpose of eradicating the intravital microresidual disease of patient with the cytokine secretion increase.This experimental result shows that the BCR/ABL fragment that the present invention clones is effective immune fragment, and the SEA gene can strengthen the segmental immunological effect of BCR/ABL effectively, and the dual-gene dna vaccination of BCR/ABL-pIRES-SEA can be applicable to prepare the medicine for the treatment of chronic myelocytic leukemia.
(2) the invention provides one can the anti-CML immunological effect of inducing producing specificity the dual-gene dna vaccination of BCR/ABL-pIRES-SEA, for the research and development of the dna vaccination of treatment CML provide important data and data.
(3) the present invention utilizes the common constructed dna vaccine of tumor associated antigen or tumour specific antigen and superantigen gene) can also use for reference for the institute of other treatment tumor dna vaccination.
(4) dna vaccination of the present invention can be removed the intravital microresidual disease of CML patient by the specific cell immunity and the humoral immune function that promote body, finally reaches the purpose of curing CML.
Description of drawings
Fig. 1 makes up flow chart for the BCR/ABL-pIRES-SEA double expression plasmid.
The BCR/ABL fragment figure that Fig. 2 obtains for pcr amplification;
Wherein: swimming lane 1 is 150bp DNA Marker;
The BCR/ABL fragment that swimming lane 2 and 3 obtains for pcr amplification.
The segmental electrophoresis detection figure of SEA that Fig. 3 obtains for pcr amplification;
Wherein: swimming lane 1 is 150bp DNAMarker;
The SEA fragment that swimming lane 2 and 3 obtains for pcr amplification.
Fig. 4 is BCR/ABL-pIRES recombiant plasmid enzyme action qualification result figure;
Wherein, swimming lane 1 is 1kb DNA marker;
Fig. 5 is BCR/ABL-pIRES-SEA recombiant plasmid enzyme action qualification result figure;
Wherein, swimming lane 1 is 1kb DNA marker;
Fig. 6 is SEA-pIRES recombiant plasmid double digestion qualification result figure;
Wherein, swimming lane 1 is 1kb DNA marker;
Fig. 7 carries out the product electrophoretogram that RT-PCR obtains for behind the BCR/ABL-pIRES-SEA recombiant plasmid transfection K293 cell;
Wherein, swimming lane 1 is for being template with blank group K562 cell cDNA, and S1 and S2 are the amplification that primer carries out;
Fig. 8 is the SDS-PAGE figure of protein expression behind the BCR/ABL-pIRES-SEA recombiant plasmid transfection K293 cell;
Wherein, swimming lane 1 positive contrast: SEA albumen;
Fig. 9 for behind flow cytometer the detects constructed plasmid immune mouse to CD4
+, CD8
+The figure of the influence of T cell subsets:
Wherein: A is a pIRES plasmid groups of immunized mice;
B is a BCR/ABL-pIRES plasmid groups of immunized mice;
C is a BCR/ABL-pIRES-SEA plasmid groups of immunized mice;
D is a SEA-pIRES plasmid groups of immunized mice;
E is the blank group, injecting normal saline mice group.
Figure 10 detects INF-γ changes of contents situation map in the mice serum of immunity back for the ELISA method.
The specific embodiment
The present invention is described in further detail below in conjunction with embodiment and accompanying drawing, but embodiments of the present invention are not limited thereto.
Embodiment 1:
Chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA construction of recombinant plasmid, as shown in Figure 1:
Utilize RT-PCR amplification BCR/ABL fragment, this fragment is inserted among the multiple clone site A of pIRES plasmid and constructs BCR/ABL-pIRES, from staphylococcus aureus gene group DNA, amplify the SEA gene by PCR then, this gene is inserted among the multiple clone site B of BCR/ABL-pIRES and makes up BCR/ABL-pIRES-SEA, after order-checking correctly, successfully made up the BCR/ABL-pIRES-SEA plasmid.
Concrete steps are as follows:
1 BCR/ABL-pIRES construction of recombinant plasmid
1.1 the segmental amplification of BCR/ABL
From leukemia cell line K562 cell (available from Shanghai Chinese Academy of Sciences cell bank), extract RNA, the cDNA that reverse transcription obtains is as template (RNA of K562 cell extracts and cDNA is synthetic all carries out according to a conventional method), carry out pcr amplification BCR/ABL fragment with forward primer B1, downstream primer B2, total reaction volume is 50 μ L, wherein contains 1 μ L cDNA, 0.5 μ L starDNA polymerase, each 1 μ L of upstream and downstream primer, dNTP8 μ L, 5xPCR Buffer10 μ L, ultra-pure water 32.5 μ L.Be reflected in the pcr amplification instrument and carry out, carry out 30 circulations altogether, 94 ℃ of 30sec (being 4min first); 60 ℃ of 30sec anneal; Extend 72 ℃ of 30sec (last is 10min), amplified production is with 1.5% agarose gel electrophoresis under 100 volts of voltages.Electrophoresis result as shown in Figure 2, the product clip size conforms to expected results, its size is 354bp, actual effectively fragment is 336bp.Amplification PCR products is labeled as BCR/ABL.
B1：
In the square frame
Be the XhoI restriction enzyme site;
B2：
In the square frame
Be the EcoRI restriction enzyme site.
1.2 pcr amplification SEA fragment
Bacterial genomes is extracted test kit (day root company limited) and is extracted staphylococcus aureus strain (ATCC13565, available from Nat'l Pharmaceutical ﹠ Biological Products Control Institute) genomic DNA, with staphylococcus aureus gene group DNA as template, with forward primer S1 and downstream primer S2 pcr amplification SEA fragment, the purpose fragment length of amplification is 827bp, and actual effectively fragment is 774bp.Total reaction volume is 50 μ L, wherein contains 1 μ L cDNA, 0.5 μ L starDNA polymerase, each 1 μ L of upstream and downstream primer, dNTP8 μ L, 5 * PCRBuffer10 μ L, ultra-pure water 32.5 μ L.Be reflected in the pcr amplification instrument and carry out.Reaction condition: 94 ℃ of pre-degeneration 4min at first, 94 ℃ of 1min then, 50 ℃ of 1min, 72 ℃ of 1min circulations 30 times, last 72 ℃ of overall elongation 10min.Amplified production is depressed at 100 voltaisms, detects with 1.5% agarose gel electrophoresis, the results are shown in Figure 3.
S1：
In the square frame
Be the XbaI enzyme cutting site;
S2：
In the square frame
Be the SalI restriction enzyme site;
1.3 enzyme action
E.Z.N.A. gel reclaims the segmental PCR product of test kit purification BCR/ABL.BCR/ABL fragment behind the purification and pIRES plasmid are carried out the double digestion processing with XhoI and EcoRI, and concrete reaction system sees Table 1.Reaction system vortex vibration mixing is placed in the PCR instrument, and 37 ℃ were reacted 5 hours.
Table 1BCR/ABL and SEA PCR product and pIRES plasmid double digestion reaction system
1.4 connect
The above-mentioned endonuclease reaction product of purification, the BCR/ABL gene behind the enzyme action utilizes the T4DNA ligase to carry out coupled reaction with the pIRES plasmid of handling through same enzyme action.System prepares behind the mixing 16 ℃ and spends the night, and connects 4 ℃ of preservations of product, transforms in the 24h as far as possible.The coupled reaction system is totally 10 μ L, comprising: 1 μ L10 * Buffer, 6 μ L PCR products, 1 μ L carrier, 1 μ L T4DNA ligase and 1 μ L aquesterilisa.
Through above-mentioned steps the gene BCR/ABL of amplification is inserted among the multiple clone site A of pIRES plasmid and constructs the BCR/ABL-pIRES recombiant plasmid.
1.5 conversion, Screening and Identification positive colony
After the conventional transformed into escherichia coli TOP10 of the BCR/ABL-pIRES recombiant plasmid competence (day root company limited) that builds, grow bacterium colony about 16 hours.Several single bacterium colonies of each culture dish random choose place 100 μ L LB culture fluid (Amp 100 μ g/mL) respectively, vortex concussion mixing.The culture fluid 1 μ L that gets the single bacterium colony of dissolving carries out PCR (amplification system and method are with 1.1) as template with corresponding primer B1, B2.Amplified production is depressed at 100 voltaisms with 1.5% agarose gel and is carried out electrophoresis.
1.6 extracting plasmid and enzyme action identifies
The escherichia coli of collecting amplification utilize plasmid extraction kit to extract the BCR/ABL-pIRES recombiant plasmid; The recombiant plasmid that extracts is carried out double digestion with XhoI and EcoRI respectively identify that the endonuclease reaction system is totally 10 μ L, comprising: 2 μ L, 10 * Buffer, 1 μ L XhoI, 1 μ L EcoRI and 6 μ L DNA.System prepares back vortex vibration mixing, places 37 ℃ of reactions of PCR instrument 12 hours then, and 100 volts of voltages of enzyme action product are identified with 1.5% agarose gel electrophoresis down.The BCR/ABL genetic fragment that from BCR/ABL-pIRES, scales off, size is 354bp, (electrophoresis result such as Fig. 4) conforms to expected results.
1.7 the recombiant plasmid sequence analysis is identified
After the BCR/ABL-pIRES recombiant plasmid that makes up is identified correctly through double digestion, also need to check order and insert the correctness of multiple clone site A (MCS A) sequence with checking, begin to prolong clockwise direction and adopt the double deoxidating chain end cessation method to carry out unidirectional order-checking from inserting segmental upstream, primer sequence is the handsome company limited universal primer in Shanghai.BCR/ABL-pIRES fusion gene sequence alignment among sequencing result and the Genbank, the BCR/ABL-pIRES gene order of the insertion in the recombiant plasmid is entirely true as can be known.
The 2BCR/ABL-pIRES-SEA construction of recombinant plasmid
2.1 enzyme action
E.Z.N.A. gel reclaims test kit purification SEA fragment PCR products, PCR product behind the purification and BCR/ABL-pIRES recombiant plasmid are carried out the double digestion processing with Xbal I and Sal I, the endonuclease reaction system is totally 30 μ L, comprise: 8 μ L, 10 * H Buffer, 2 μ L Xba I, 2 μ L Sal I, 10 μ L DNA and 8 μ L aquesterilisa.Reaction system vortex vibration mixing is placed in the PCR instrument, and 37 ℃ were reacted 5 hours.
2.2 connect
The above-mentioned endonuclease reaction product of purification.SEA PCR product behind the enzyme action utilizes the capable coupled reaction of T4DNA ligase with the BCR/ABL-pIRES recombiant plasmid of handling through same enzyme action.System prepares behind the mixing 16 ℃ and spends the night, and connects 4 ℃ of preservations of product, transforms in the 24h as far as possible.The coupled reaction system is totally 10 μ L, comprising: 1 μ L, 10 * Buffer, 6 μ L PCR products, 1 μ L carrier and 1 μ L T4DNA ligase.
Through above-mentioned steps the SEA gene of amplification is inserted among the multiple clone site B of pIRES plasmid and constructs the BCR/ABL-pIRES-SEA recombiant plasmid.
2.3 transform and the Screening and Identification positive colony
Method is with 1.4; The culture fluid 1 μ L that gets the single bacterium colony of dissolving carries out colony PCR amplification system and method same 2.1 with S1, S2 as primer as template.
2.4 conventional extraction plasmid and enzyme action are identified
The BCR/ABL-pIRES-SEA recombiant plasmid that extracts is carried out double digestion with Xba I and Sal I identify that the endonuclease reaction system is totally 10 μ L, comprising: 2 μ L, 10 * H Buffer, 1 μ L Xba I, 1 μ L Sal I and 6 μ L DNA.System prepares back vortex vibration mixing, places 37 ℃ of reactions of PCR instrument 12 hours then, and the enzyme action product is identified with 1.5% agarose gel electrophoresis.Electrophoresis result as shown in Figure 5, the SEA genetic fragment size that scales off from each recombiant plasmid is 827bp, conforms to expected results.
2.5 the recombiant plasmid order-checking is identified
Begin to prolong and counterclockwise carry out unidirectional order-checking from inserting segmental downstream, the sequencing primer sequence is the handsome company limited universal primer in Shanghai, and sequencing result shows that the SEA fragments sequence be inserted among the BCR/ABL-pIRES-SEA group plasmid multiple clone site B (MCS B) and the SEA sequence among the Genebank are on all four.
3.SEA-pIRES construction of recombinant plasmid
SEA is connected on the multiple clone site A of pIRES plasmid, the primer and S1, S2 are identical except that the enzyme action site is different, the SEA fragment that increases identical.
Used primer S3:
Used primer S4:
Described CTCGAG is the XhoI restriction enzyme site in the square frame;
Described GAATTC is the EcoRI restriction enzyme site in the square frame;
Method therefor is identical with the method that makes up the BCR/ABL-pIRES recombiant plasmid, the SEA genetic fragment that from SEA-pIRES, scales off, and size is 827bp, (electrophoresis result such as Fig. 6) conforms to expected results.Order-checking is identified entirely true.
Gene and protein expression behind the chronic myeloid leukemia DNA vaccine of research and establishment (the being the BCR/ABL-pIRES-SEA recombiant plasmid) transfecting eukaryotic cells
1 screens the suitable transfectional cell for the treatment of, utilizes Lipofectamine
TM2000 Kit (Invitrogen company) transfection human embryo kidney epithelium K293 cell (Shanghai cell institute of the Chinese Academy of Sciences).
Utilize Lipofectamine
TM2000 Kit transfection K293 cells are put into 5%CO with culture plate
2(37 ℃) are cultivated in the incubator, will contain the Opti-MEM of transfection reagent after 4～6 hours
The I culture medium is replaced by and is contained the DMEM culture medium that percent by volume is 10% hyclone, collects supernatant and cell after 48 hours.
2 RT-PCR detect
Cultivate 48 hours the total RNA of K293 cell extraction after collecting transfection, the synthetic cDNA of reverse transcription is as template, use primer B1 respectively, (B2 is used to increase the BCR/ABL fragment, 354bp) and S1, (the SEA fragment that is used to increase 827bp) is carried out pcr amplification to S2, and the PCR product is depressed electrophoresis with 1.5% agarose gel at 100 voltaisms.Determine BCR/ABL and SEA genetic transcription situation (the results are shown in Figure 7).This presentation of results BCR/ABL and SEA genetic transcription can in eukaryotic cell, transcribe horizontal expression.
3 translation skills detect the expression of exogenous plasmid in eukaryotic cell
Get cell pyrolysis liquid and detect BCR/ABL albumen and the proteic expression of SEA (the results are shown in Figure 8) by the SDS-polyacrylamide gel electrophoresis.This presentation of results BCR/ABL and SEA genetic transcription can be in eukaryotic cell expressing protein.
Behind the embodiment 3 research chronic myeloid leukemia DNA vaccine injection mouse muscles (BCR/ABL-pIRES-SEA recombiant plasmid), the gene of different times and protein expression and specific CTL effect etc.
The health in 30 6～8 weeks is sheerly male BALB/c mouse (SCXK Guangdong 20040011 is available from Zhongshan University's Experimental Animal Center) and is divided into 5 groups (6 every group) at random, and each mice is respectively at the 1st week, 2 weeks, each immunity of 4 weeks 1 time, totally 3 times.A organizes (P group): inject pIRES 200 μ g respectively in bilateral quadriceps femoris intramuscular at every turn; B organizes (B-P group): inject BCR/ABL-pIRES 200 μ g respectively in bilateral quadriceps femoris intramuscular at every turn; C organizes (B-P-S group): inject BCR/ABL-pIRES-SEA 200 μ g respectively in bilateral quadriceps femoris intramuscular at every turn; D organizes (S-P group): inject SEA-pIRES 200 μ g respectively in bilateral quadriceps femoris intramuscular at every turn; E organizes (N group): at every turn in bilateral quadriceps femoris intramuscular difference injecting normal saline 200 μ g.In the 6th weekend eyeball get blood, mice is put to death, isolate quadriceps femoris.The transcript and expression in mice skeletal with reverse transcriptional PCR (RT-PCR) and immunohistochemistry staining method's testing goal gene; The ELISA method detects INF-γ content in the mice serum; The CCK8 test kit detects mouse boosting cell specific CTL activity; Flow cytometry T lymphocyte CD 4, CD8 subgroup.
The result: (1) as seen finds to have in various degree lymphocytic infiltration in the routine paraffin wax of injected in mice position muscular tissue section (HE dyeing) in each group muscle gap, is to be dispersed in or bunch shape distribution of discontinuity.Can detect (RT-PCR and real-time quantitative PCR) among the RNA of mouse muscle tissue extraction to BCR/ABL gene and SEA expression of gene; (2) utilize mice CD4+, CD8 after each experimental group immunity of Flow cytometry
+T cell proliferation situation (streaming figure sees Fig. 9) shows BCR/ABL-pIRES-SEA immune group CD8
+The T cell has trend of rising; (3) mouse boosting cell is the effector lymphocyte: the K562 cell is a target cell, and imitating the target ratio is 40: 1, and vaccine group detects through the CCK8 test kit and shows that it has the specific cytotoxicity effect to the K562 cell, to the kill rate of K562 cell apparently higher than NB4 cell matched group; (4) the ELISA method detects in the mice serum INF-γ content and other organize apparent in view rising, and the statistical significance (see figure 10) is arranged.
Conclusion: chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA of the present invention is one can express BCR/ABL and the proteic plasmid of SEA simultaneously in eukaryotic cell, this dna vaccination is expelled to expresses BCR/ABL and SEA albumen in the mouse body, excitating organism produces the specific immune response at the CML cell, can reach the purpose of eradicating the intravital microresidual disease of patient.This experimental result shows that the BCR/ABL fragment that the present invention clones is effective immune fragment, and the SEA gene can strengthen the segmental immunological effect of BCR/ABL effectively, and the dual-gene dna vaccination of BCR/ABL-pIRES-SEA can be applicable to prepare the medicine for the treatment of chronic myelocytic leukemia.
The foregoing description is a preferred implementation of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
SEQUENCE?LISTING
＜110〉Ji'nan University
＜120〉chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA and its production and application
<130>1
<160>10
<170>PatentIn?version?3.2
<210>1
<211>336
<212>DNA
<213>artificial?sequence
<220>
＜223〉BCR/ABL gene
<400>1
atggggctct?atgggtttct?gaatgtcatc?gtccactcag?ccactggatt?taagcagagt 60
tcaaaagccc?ttcagcggcc?agtagcatct?gactttgagc?ctcagggtct?gagtgaagcc 120
gctcgttgga?actccaagga?aaaccttctc?gctggaccca?gtgaaaatga?ccccaacctt 180
ttcgttgcac?tgtatgattt?tgtggccagt?ggagataaca?ctctaagcat?aactaaaggt 240
gaaaagctcc?gggtcttagg?ctataatcac?aatggggaat?ggtgtgaagc?ccaaaccaaa 300
aatggccaag?gctgggtccc?aagcaactac?atctag 336
<210>2
<211>774
<212>DNA
<213>artificial?sequence
<220>
＜223〉SEA gene
<400>2
atgaaaaaaa?cagcatttac?attactttta?ttcattgccc?taacgttgac?aacaagtcca 60
cttgtaaatg?gtagcgagaa?aagcgaagaa?ataaatgaaa?aagatttgcg?aaaaaagtct 120
gaattgcagg?gaacagcttt?aggcaatctt?aaacaaatct?attattacaa?tgaaaaagct 180
aaaactgaaa?ataaagagag?tcacgatcaa?tttttacagc?atactatatt?gtttaaaggc 240
ttttttacag?atcattcgtg?gtataacgat?ttattagtag?attttgattc?aaaggatatt 300
gttgataaat?ataaagggaa?aaaagtagac?ttgtatggtg?cttattatgg?ttatcaatgt 360
gcgggtggta?caccaaacaa?aacagcttgt?atgtatggtg?gtgtaacgtt?acatgataat 420
aatcgattga?ccgaagagaa?aaaagtgccg?atcaatttat?ggctagacgg?taaacaaaat 480
acagtacctt?tggaaacggt?taaaacgaat?aagaaaaatg?taactgttca?ggagttggat 540
cttcaagcaa?gacgttattt?acaggaaaaa?tataatttat?ataactctga?tgtttttgat 600
gggaaggttc?agaggggatt?aatcgtgttt?catacttcta?cagaaccttc?ggttaattac 660
gatttatttg?gtgctcaagg?acagtattca?aatacactat?taagaatata?tagagataat 720
aaaacgatta?actctgaaaa?catgcatatt?gatatatatt?tatatacaag?ttaa 774
<210>3
<211>354
<212>DNA
<213>artificial?sequence
<220>
＜223〉BCR/ABL fragment
<400>3
attctcgaga?tggggctcta?tgggtttctg?aatgtcatcg?tccactcagc?cactggattt 60
aagcagagtt?caaaagccct?tcagcggcca?gtagcatctg?actttgagcc?tcagggtctg 120
agtgaagccg?ctcgttggaa?ctccaaggaa?aaccttctcg?ctggacccag?tgaaaatgac 180
cccaaccttt?tcgttgcact?gtatgatttt?gtggccagtg?gagataacac?tctaagcata 240
actaaaggtg?aaaagctccg?ggtcttaggc?tataatcaca?atggggaatg?gtgtgaagcc 300
caaaccaaaa?atggccaagg?ctgggtccca?agcaactaca?tctaggaatt?cggc 354
<210>4
<211>827
<212>DNA
<213>artificial?sequence
<220>
＜223〉SEA fragment
<400>4
gctctagaaa?ttatgcttta?gaggtgagca?aaatgaaaaa?aacagcattt?acattacttt 60
tattcattgc?cctaacgttg?acaacaagtc?cacttgtaaa?tggtagcgag?aaaagcgaag 120
aaataaatga?aaaagatttg?cgaaaaaagt?ctgaattgca?gggaacagct?ttaggcaatc 180
ttaaacaaat?ctattattac?aatgaaaaag?ctaaaactga?aaataaagag?agtcacgatc 240
aatttttaca?gcatactata?ttgtttaaag?gcttttttac?agatcattcg?tggtataacg 300
atttattagt?agattttgat?tcaaaggata?ttgttgataa?atataaaggg?aaaaaagtag 360
acttgtatgg?tgcttattat?ggttatcaat?gtgcgggtgg?tacaccaaac?aaaacagctt 420
gtatgtatgg?tggtgtaacg?ttacatgata?ataatcgatt?gaccgaagag?aaaaaagtgc 480
cgatcaattt?atggctagac?ggtaaacaaa?atacagtacc?tttggaaacg?gttaaaacga 540
ataagaaaaa?tgtaactgtt?caggagttgg?atcttcaagc?aagacgttat?ttacaggaaa 600
aatataattt?atataactct?gatgtttttg?atgggaaggt?tcagagggga?ttaatcgtgt 660
ttcatacttc?tacagaacct?tcggttaatt?acgatttatt?tggtgctcaa?ggacagtatt 720
caaatacact?attaagaata?tatagagata?ataaaacgat?taactctgaa?aacatgcata 780
ttgatatata?tttatataca?agttaaacat?ggtagttgag?tcgaccg 827
<210>5
<211>30
<212>DNA
<213>artificial?sequence
<220>
＜223〉primer B1
<400>5
attctcgaga?tggggctcta?tgggtttctg 30
<210>6
<211>30
<212>DNA
<213>artificial?sequence
<220>
＜223〉primer B2
<400>6
gccgaattcc?tagatgtagt?tgcttgggac 30
<210>7
<211>28
<212>DNA
<213>artificial?sequence
<220>
＜223〉primer S1
<400>7
gctctagaaa?ttatgcttta?gaggtgag 28
<210>8
<211>29
<212>DNA
<213>artificial?sequence
<220>
＜223〉primer S2
<400>8
cggtcgactc?aactaccatg?tttaacttg 29
<210>9
<211>28
<212>DNA
<213>artificial?sequence
<220>
＜223〉primer S3
<400>9
gcctcgagaa?ttatgcttta?gaggtgag 28
<210>10
<211>29
<212>DNA
<213>artificial?sequence
<220>
＜223〉primer S4
<400>10
cggaattctc?aactaccatg?tttaacttg 29
Claims (6)
1. chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA, it is characterized in that: described chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA contains pIRES plasmid, BCR/ABL gene and SEA gene, and BCR/ABL gene and SEA gene lay respectively on the multiple clone site of the IRES elements on either side on the pIRES plasmid;
The nucleotide sequence of described BCR/ABL gene is shown in SEQ ID No.1;
The nucleotide sequence of described SEA gene is shown in SEQ ID No.2.
2. the preparation method of the described chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA of claim 1 is characterized in that comprising the steps:
(1) the BCR/ABL gene is inserted among the multiple clone site A or multiple clone site B of pIRES plasmid, obtain the BCR/ABL-pIRES plasmid;
(2) the SEA gene is inserted in the multiple clone site of BCR/ABL-pIRES plasmid, SEA gene and BCR/ABL gene lay respectively at the both sides of IRES element, obtain chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA.
3. preparation method according to claim 2 is characterized in that comprising the steps:
(1) extracts the RNA of leukemia cell line K562 cell by the synthetic cDNA of reverse transcription; With the cDNA that obtains is template, carries out pcr amplification by primer B1 and B2, and obtaining length is the BCR/ABL fragment of 354bp;
Described primer B1:5 '-ATT
ATGGGGCTCTATGGGTTTCTG-3 ';
Described primer B2:5 '-GCC
CTAGATGTAGTTGCTTGGGAC-3 ';
The segmental nucleotide sequence of described BCR/ABL is shown in SEQ ID No.3;
Described CTCGAG is the XhoI restriction enzyme site in the square frame;
Described GAATTC is the EcoRI restriction enzyme site in the square frame;
(2) be template with staphylococcus aureus gene group DNA, carry out pcr amplification by primer S1 and S2, obtaining length is the SEA fragment of 827bp;
Described primer S1:5 '-GC
AATTATGCTTTAGAGGTGAG-3 ';
Described primer S2:5 '-CG
TCAACTACCATGTTTAACTTG-3 ';
The segmental nucleotide sequence of described SEA is shown in SEQ ID No.4;
Described TCTAGA is the XbaI enzyme cutting site in the square frame;
Described GTCGAC is the SalI restriction enzyme site in the square frame;
(3) respectively pIRES plasmid and the described BCR/ABL fragment of step (1) are carried out double digestion with XhoI enzyme and EcoRI enzyme, be connected with the pIRES plasmid by the BCR/ABL fragment of T4DNA ligase after again double digestion, the BCR/ABL fragment is inserted among the multiple clone site A of pIRES plasmid, obtains the BCR/ABL-pIRES plasmid;
(4) the BCR/ABL-pIRES plasmid that obtains of SEA fragment that respectively step (2) is obtained with XbaI enzyme and SalI enzyme and step (3) carries out double digestion, be connected with the BCR/ABL-pIRES plasmid by the SEA fragment of T4DNA ligase after then double digestion, the SEA fragment is inserted among the multiple clone site B of BCR/ABL-pIRES plasmid, obtains chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA.
4. preparation method according to claim 3 is characterized in that: the reaction condition of pcr amplification is described in the step (1): pre-94 ℃ of 30sec of degeneration, and 60 ℃ of 30sec anneal; Extend 72 ℃ of 30sec, carry out 30 circulations altogether; Pre-first degeneration is 94 ℃ of 4min, and last extends to 72 ℃ of 10min.
5. preparation method according to claim 3 is characterized in that: the reaction condition of pcr amplification is described in the step (2): 94 ℃ of pre-degeneration 4min at first, 94 ℃ of 1min then, 50 ℃ of 1min, 72 ℃ of 1min circulations 30 times, last 72 ℃ of overall elongation 10min.
6. the described chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA of claim 1 is applied to prepare the genomic medicine for the treatment of chronic myelocytic leukemia.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101604231A CN101837134B (en) | 2010-04-23 | 2010-04-23 | Chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101604231A CN101837134B (en) | 2010-04-23 | 2010-04-23 | Chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101837134A true CN101837134A (en) | 2010-09-22 |
| CN101837134B CN101837134B (en) | 2011-09-14 |
Family
ID=42740966
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101604231A Expired - Fee Related CN101837134B (en) | 2010-04-23 | 2010-04-23 | Chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101837134B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834450A (en) * | 2017-01-10 | 2017-06-13 | 武汉赛云博生物科技有限公司 | A kind of method for the detection of T cell Minimal Residual Disease of Leukemia |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101214381A (en) * | 2007-12-26 | 2008-07-09 | 暨南大学 | Acute promyelocytic leukemia DNA vaccine PML-RAR alpha-hGM-CSF and preparation and application thereof |
| CN101224307A (en) * | 2007-12-26 | 2008-07-23 | 暨南大学 | Acute progranulocyte leukemia DNA vaccine PML-RAR alpha 384-hIL-2 and preparing method and application thereof |
-
2010
- 2010-04-23 CN CN2010101604231A patent/CN101837134B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101214381A (en) * | 2007-12-26 | 2008-07-09 | 暨南大学 | Acute promyelocytic leukemia DNA vaccine PML-RAR alpha-hGM-CSF and preparation and application thereof |
| CN101224307A (en) * | 2007-12-26 | 2008-07-23 | 暨南大学 | Acute progranulocyte leukemia DNA vaccine PML-RAR alpha 384-hIL-2 and preparing method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 20090915 高珂 SEA联合PML-RARalpha多肽对TCRzeta链的影响以及SEA、BCR－ABL真核表达载体的构建 E072-41 第2009年卷, 第09期 2 * |
| 《医学分子生物学杂志》 20081231 黄梅娟 利用pIRES载体构建TCR独特型重组质粒 399-402 第5卷, 第5期 2 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834450A (en) * | 2017-01-10 | 2017-06-13 | 武汉赛云博生物科技有限公司 | A kind of method for the detection of T cell Minimal Residual Disease of Leukemia |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101837134B (en) | 2011-09-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107847577B (en) | Cancer vaccine comprising mRNA encoding M-like protein | |
| CN108138099A (en) | For the manufacturing device and method of the personalized immunotherapy based on delivery vector | |
| CN105246496A (en) | Salmonella-based vectors for cancer immunotherapy targeting Wilms' tumor gene WT-1 | |
| WO2019080538A1 (en) | Chimeric antigen receptor, nk cell modified by same, coding dna, mrna, expression vector, preparation method and application | |
| CN107073094A (en) | The recombinant listeria bacterium bacterial strain and its application method of expressing heterologous antigen coalescence protein | |
| CN104774270B (en) | A kind of gland cancer specificity EpCAM GM CSF gene recombinant fusion proteins and preparation method thereof | |
| CN111440244A (en) | Metastatic cancer vaccine targeting VEGFR2 | |
| CN112574997B (en) | Modified body of FBXW7 annular RNA and application of modified body in tumor medicaments and novel crown vaccines | |
| CN101837134B (en) | Chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA and preparation method and application thereof | |
| CN101015689A (en) | Tumour polypeptide vaccine based on angiotensin II | |
| CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
| CN101879317B (en) | Preparation method and application of Vibro harveyi and Vibrio parahaemolyticus bigeminy DNA vaccine | |
| CN108624607A (en) | Target the Chimeric antigen receptor of mesothelin and method and purposes to its dual modification | |
| Eslami et al. | Simultaneous immunisation with a Wilms’ tumour 1 epitope and its ubiquitin fusions results in enhanced cell mediated immunity and tumour rejection in C57BL/6 mice | |
| CN108359682B (en) | Edwardsiella tarda outer membrane protein PagC with immune protection effect | |
| CN112533630A (en) | Individualized vaccines for cancer | |
| CN101224307B (en) | Acute progranulocyte leukemia DNA vaccine PML-RAR alpha 384-hIL-2 and preparing method and application thereof | |
| CN109136182A (en) | A kind of polarization and the method and composition for expanding CD4+T cell and the application in the tumour for curing expression specificity antigen | |
| CN105343874A (en) | Prostate cancer nucleic acid vaccine | |
| CN107090425A (en) | Restructuring mGM-CSF and the genetic engineering bacterium of GRP6 fusion proteins a kind of structure | |
| WO2021101452A2 (en) | Method and system for identifying and validating shared candidate antigens and shared antigen-specific t lymphocyte pairs | |
| CN101850112A (en) | Novel recombinant vaccine used for preventing tuberculosis | |
| CN101837122A (en) | Genetic engineering composite peptide vaccine for inhibiting tumor angiogenesis and use thereof | |
| CN101947325B (en) | Vibrio paraheamolyticus bivalent DNA vaccine as well as preparation method and application thereof | |
| CN101214381A (en) | Acute promyelocytic leukemia DNA vaccine PML-RAR alpha-hGM-CSF and preparation and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110914 Termination date: 20140423 |