CN101818203A - Methylated quantitative detection method of GSH2 (glutathione 2) gene - Google Patents
Methylated quantitative detection method of GSH2 (glutathione 2) gene Download PDFInfo
- Publication number
- CN101818203A CN101818203A CN201010157486A CN201010157486A CN101818203A CN 101818203 A CN101818203 A CN 101818203A CN 201010157486 A CN201010157486 A CN 201010157486A CN 201010157486 A CN201010157486 A CN 201010157486A CN 101818203 A CN101818203 A CN 101818203A
- Authority
- CN
- China
- Prior art keywords
- gsh2
- gene
- actb
- methylation
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention belongs to the technical field of biomedical sciences. Abnormal methylation of genes participates in the development of tumors. The invention aims at overcoming the defects of a methylation-sensitive restrictive endonuclease method, a bisulfite sequencing method and a methylation-specific PCR (Polymerase Chain Reaction) method and provides a methylated quantitative detection method of a GSH2 (glutathione 2) gene, which has simple and convenient operation and high senibilitiy. The method comprises the following steps of: taking pancreatic cancer tissues, extracting DNA and preparing an ACTB (Actin, Beta) standard curve sample, and preparing a GSH2 (Glutathione 2) standard curve sample by utilizing a full methylation template; extracting DNA of tissues to be detected, and carrying out chemical modification; designing methylation primers and probes aiming at CPG islands at a human GSH2 gene promoter region, designing BSP (Bisulfite) primers and probes aiming at CPG islands at a human reference gene ACTB promoter region, carrying out real-time quantitive PCR on DNA after bisulfite treatment by adopting a Taqman-MGB real-time quantitive PCR method, and calculating a quantitive value of the GSH2 gene methylation degree. The method is rapid, accurate and high in sensitivity.
Description
Technical field
The invention belongs to field of biomedicine technology, specifically, relate to a kind of detection method of nucleic acid, refer more particularly to the method that the GSH2 gene methylation detects.
Background technology
The generation of malignant tumour development is a plurality of gene interactions, interactional process, the CpG island methylate be unusually this gradually the one-tenth process important mechanisms of development takes place, it comprises two types of hyper-methylation and undermethylations.According to the literature, in carcinoma of the pancreas tissue or pancreatic juice, detect a plurality of carcinoma of the pancreas genes involved generation abnormal methylation, and it is very low that methylated ratio takes place in healthy tissues, so the detection that methylates by the carcinoma of the pancreas genes involved reaches the purpose of early diagnosis carcinoma of the pancreas.Abnormal methylation (Virmani AK, et al.ClinCancer Res 2001 such as gene P16; 7:584-9), MUC2 (Ho JJ, et al.Int J Oncol 2003; 22:273-9), RASSF1A (Dammann R, et al.Oncogene 2003; 22:3806-12; ), SOCS-1 (Fukushima N, et al.Br J Cancer 2003; 89:338-43; ), ppENK (Fukushima N, et al.Am J Pathol 2002; 160:1573-81), NPTX2 (Sato N, et al.Cancer Res, 2003,63:3735-3742), SOD2 (Hurt, E.M., S.B.Thomas, et al.2007.Br J Cancer 97 (8): 1116-23.), ECT2 (Zhang, M.L., S.Lu, et al.2008.Hepatobiliary Pancreat Dis Int 7 (5): 533-8.), SFRP (Bu, X.M., C.H.Zhao, et al.2008.World J Gastroenterol 14 (21): 3421-4.), CCND2, SOCS1, THBS1, PLAU, and VHL (Melnikov, A.A., D.Scholtens, et al.2009.J Surg Oncol 99 (2): 119-22.), hTERT (Kumari, A., R.Srinivasan, et al.2009.Ann Surg Oncol 16 (4): 1051-9.) etc.Early stage, we carried out the examination of full genomic methylation chip, the unusual hyper-methylation of discovery GSH2 in carcinoma of the pancreas, and this gene methylates rate apparently higher than cancer beside organism at cancerous tissue, in view of the hyper-methylation of GSH2 just with the substantial connection of carcinoma of the pancreas, impel us to set up the methylate quantitative detecting method of degree of a kind of new GSH2, this method can help to further investigate the pathogenesis and the diagnoses and treatment of digestive tract tumor.
The detection method of DNA is a lot of at present, and it is three kinds that use in the most general method that the susceptibility that wherein methylates restriction enzyme enzyme process, bisulfite processing back pcr amplification product cloning and sequencing detection (BSP) and bisulfite are handled back methylation status of PTEN promoter detection (MSP).
The susceptibility that methylates restriction enzyme enzyme process is classical methylation analysis method, mainly can not cut methylated dna sequence dna according to some restriction enzymes.Because in eukaryotic DNA or mammalian DNA, the cytosine(Cyt) that has only CG to link to each other can be methylated, therefore, the restriction enzyme that comprises the CG sequence in restriction enzyme site will encounter problems.Employed two the classical enzymes of this method are to being HPa II-Msp I (CCGG) and Sma I-XmaI (CCCGGG).Because second pair of restriction enzyme recognition sequence is very rare, so generally all use HPa II-Msp I (CCGG).Two enzymes are all discerned the CCGG sequence, and when wherein cytosine methylation, HPaII can not cut it, utilize this attribute of HpaII-Msp I to handle DNA, this just makes that HPa II-Msp I can be as the instrument of quick methylation analysis, carry out Southern or pcr amplification separated product subsequently, clear and definite methylation state.There is following shortcoming in this method:
(1) because CG is not limited only in the CCGG sequence, therefore the CG in non-this sequence will be left in the basket; When (2) having only detection and transcribing the methylation state in relevant key site, the result of this detection method is just meaningful; (3) comparatively speaking, the Southern method is complicated, and needs the amount of sample big; (4) exist the false-positive problem that the enzyme incomplete digestion causes; (5) be not suitable for mixing sample.
Bisulfite is handled back pcr amplification product cloning and sequencing and is detected (BSP method), be to make according to bisulfite methylated cytosine(Cyt) (C) deaminizating does not take place among the DNA to be transformed into uridylic (U), and methylated cytosine(Cyt) remains unchanged.Genomic dna designs the fragment of the BSP primer and the purpose that increases behind sulfiting, uridylic this moment (U) all changes into thymus pyrimidine (T), the PCR product is checked order just can judge whether the CpG site methylates at last.The advantage of this method is that reliability and tolerance range are all very high, can detect the methylation state in each CpG site in the purpose fragment, and shortcoming is to need a large amount of cloning and sequencings, and process is comparatively loaded down with trivial details, and expense is also than higher.
Bisulfite is handled the back methylation status of PTEN promoter and is detected (MSP method), hydrosulphite can the oxidation removal genomic dna in the amino of cytosine(Cyt), all the other cytosine(Cyt)s all can be changed into uridylic except that m5C in this reaction.Then these target sequences are increased with special primer, through the DNA of amplification, all uridylics all are converted into detectable thymus pyrimidine, have only m5C to be amplified with the cytosine(Cyt) form.This method is the at present employed the most frequently used method of m5C of analyzing in given genome target sequence.Can detect the situation that methylates in each CpG site.Based on this principle, develop hydrosulphite deaminize the reaction after, fast method in conjunction with pcr amplification detects m5C, be called methylation specific PCR (MSP), this MSP method utilization, specially designed primer at the methylated and non-sequence that methylates, thus methylating or the non-target sequence that methylates of specific amplified obtained.Be widely applied to the detection that methylates of CpG island at present.This method scope of application is very wide, can detect comprise known, near the methylation status PCR primer and the CpG double-core former times acid sequence of restriction enzyme digestion scope.MSP is a present most widely used CpG island methylation detecting method, and the ratio that can detect is the millesimal fragment that methylates.Reliable MSP, key is primer, its design of primers need two known, comprise the zone in a plurality of exhaustive methylations or non-methylated CpG site, but it is few to have a CpG island of above-mentioned feature, has limited the use of MSP.Whether there is following shortcoming in this method: (1) this method can only be done qualitative examination, promptly can only clearly exist to methylate; If require quantitatively, then need further to detect with other method; (2), need the condition and the cycle number of strict control PCR reaction if will distinguish methylate primer and non-the different of primer extension product amount that methylate.
Still there is not at present the relevant quantitative detecting method of GSH2 gene methylation.
Summary of the invention
The objective of the invention is to for overcoming the shortcoming of above-mentioned the whole bag of tricks, thereby a kind of easy and simple to handle, quantitative detecting method that susceptibility is high at GSH2 gene methylation degree is provided.
For achieving the above object, the present invention is based on the basic detection method of quantitative PCR, adopt following technical scheme to implement GSH2 gene methylation detection by quantitative, comprise the steps: 1. according to the previous carcinoma of the pancreas chip results that methylates, the target sequence of selected GSH2 gene test.Choose+1201bp serves as to detect target sequence to+1587bp (counting 0 with transcription initiation site), as shown in Figure 1, and design amplification GSH2 methylate BSP, MSP and the taqman-MGB detection probes of sequence.Simultaneously, selected reference gene ACTB detects target sequence and designs corresponding amplimer and the taqman-MGB detection probes.2. preparation standard product.Adopt standard substance sequence after synthetic or gene recombination biosynthetic means obtain represent the bisulfite processing of GSH2 gene methylation target sequence (be GSH2 methylate standard substance), simultaneously, acquisition reference gene ACTB detects the standard substance sequence (being reference gene ACTB standard substance) after the target sequence bisulfite is handled.3. design the detection by quantitative reaction: treat the inspection sample DNA and carry out bisulfite processing (adopting QIAGEN EpiTect Bisufite kit test kit), handle product and take out two equal portions: portion carries out methylated MSP amplification of GSH2 and taqman-MGB probe in detecting, the GSH2 that the detects different gradient concentrations simultaneously standard substance that methylate, the establishing criteria curve carries out absolute quantitation to the methylate copy number of sequence of GSH2; Another part carries out pcr amplification and the taqman-MGB probe in detecting of reference gene ACTB, the ACTB that the detects different gradient concentrations simultaneously standard substance that methylate, the establishing criteria curve carries out absolute quantitation to the copy number of ACTB, and the copy number of ACTB is equivalent to drop into total genome copy number of detection.The GSH2 of above-mentioned acquisition methylates sequence copy numbers divided by the copy number of ACTB, and this ratio is the quantitative values of GSH2 gene methylation degree among a certain test sample DNA, and index promptly methylates.
Among the present invention, DNA to be measured takes from individual specimen, and described sample can be selected from tissue, body fluid and movement, specifically comprises biopsy, the long-pending cell of puncture fluid, urine, ight soil, periphery whole blood, periphery serum/slurry, pancreatic juice etc.
Technical scheme of the present invention is easy and simple to handle, the susceptibility height, and accuracy is strong, abnormal methylation degree that can quantitative assay GSH2 gene.
Description of drawings
Fig. 1: primer and probe design scheme synoptic diagram during the GSH2 gene methylation detects
Wherein bend arrow and show GSH2 genetic transcription initiation site (counting 0bp with this), GSH2 has two exons ,+1236bp～+ 1587bp be the BSP amplified fragments ,+1201bp～+ 1315bp is the MSP amplified fragments.
Fig. 2 is a BSP clone bacterium liquid order-checking curve
Wherein A is reference gene ACTB standard substance sequences; B is the GSH2 standard substance sequence that methylates.
Fig. 3 is a standard substance quantitative PCR detection amplification curve
Wherein A is that different concns gradient ACTB standard substance amplification curve B is the typical curve of different concns gradient ACTB amplification Ct value-copy number; C is that different concns gradient G SH2 standard substance amplification curve D is the typical curve of different concns gradient G SH2 amplification Ct value-copy number.
Fig. 4 organizes HE dyeing Photomicrograph
Wherein A is that carcinoma of the pancreas is organized HE dyeing; B is the HE of cancer beside organism dyeing.
Fig. 5 is carcinoma of the pancreas tissue and the cancer beside organism quantitative PCR detection amplification curve that methylates
Wherein A is the amplification curve of ACTB; B is the amplification curve of GSH2.
Embodiment
Below in conjunction with drawings and Examples the present invention is described in detail, but embodiments of the invention only are used to the present invention is described and are not used in restriction protection scope of the present invention.
Embodiment 1: the methylate degree of detection by quantitative GSH2 gene (GeneID:170825) in the Pancreas cancer patients clinical sample
Main agents and instrument source: QIAGEN EpiTect Bisufite KitTM test kit, pMD18-T Vector, EX-taq enzyme are bought in precious biotechnology (Dalian) company limited, ABITaqman Gene Expression Master Mix buys in u.s.a. applied biosystem company, ABI 7500Real Time PCR instrument is bought in u.s.a. applied biosystem company, and primer is synthetic by Shanghai biotechnology Services Co., Ltd.
Operation steps:
One, utilizes gene amplification and biological engineering method preparation standard product
1. extracting genome DNA
Phenol/chloroform method extracting DNA routinely.
(1) gets the 50mg pancreatic tissue and put into the 5ml centrifuge tube, add the 700ul lysis buffer and make homogenate.
(2) add Proteinase K to final concentration 100ug/ml, 55 ℃ are spent the night, to solution limpid till.
(3) add RNase to final concentration 20ug/ml, 37 ℃ of incubation 30min.
(4) add the saturated phenol of equal-volume, light and slow reversing mixing 10min, the centrifugal 10min of 13000rpm under the room temperature sucts and goes into clearly in another clean 1.5ml centrifuge tube.
(5) repeating step (4) is limpid until the sucking-off supernatant.
(6) in supernatant, add equal-volume phenol chloroform, light and slow reversing mixing 10min, the centrifugal 10min of 13000rpm under the room temperature sucts and goes into clearly in another clean 1.5ml centrifuge tube.
(7) in supernatant, add the equal-volume chloroform, light and slow reversing mixing 10min, the centrifugal 10min of 13000rpm under the room temperature sucts and goes into clearly in another clean 1.5ml centrifuge tube.
(8) add the equal-volume Virahol in supernatant, light and slow reversing mixing is placed in-20 ℃ of refrigerators and precipitates 20-30min.13000rpm low-temperature centrifugation 10min removes supernatant then.
(9) add 1ml70% ethanol, 13000rpm low-temperature centrifugation 10min removes supernatant.
(10) use deionized water 150-200ul dissolution precipitation after the seasoning ,-20 ℃ store for future use.
2.DNA concentration determination
Use the long ultraviolet scanning spectrophotometer of NanoDrop ND-1000 all-wave and measure concentration.
3. sulphite transforms
With reference to QIAGEN EptiTect Bisulfite KitTM specification sheets, extractive DNA is carried out sulfiting.
(1) in 0.2ml EP pipe, prepares 85ul Bisulfite Mix, 35ul DNA ProtectBuffer, 500ng DNA, moisturizing to the 140ul system
(2) on the PCR instrument, adopt 99 ℃ of sex change 5min of following program reaction, 60 ℃ hatch 25min, 99 ℃ of sex change 5min, 60 ℃ hatch 85min, 99 ℃ of sex change 5min, 60 ℃ hatch 175min.
(3) reaction finishes the taking-up of 0.2ml EP pipe, and reaction solution is transferred in the 1.5ml EP pipe
(4) add the freshly prepared BL damping fluid of 560ul, vortex oscillation
(5) mixed solution is added in the centrifugal adsorption column, put collection tube, the centrifugal 1min of maximum speed of revolution, abandon liquid in the collection tube
(6) add the 500ulBW elutriant in centrifugal adsorption column, the centrifugal 1min of maximum speed of revolution abandons liquid in the collection tube
(7) repeating step (6) once
(8) add 500ul BD damping fluid in centrifugal adsorption column, room temperature leaves standstill 15min
(9) the centrifugal 1min of maximum speed of revolution abandons liquid in the collection tube
(10) centrifugal adsorption column is positioned in the new collection tube, the maximum speed of revolution sky gets rid of 1min
(11) centrifugal adsorption column is positioned over clean 1.5ml EP pipe, adds the 20ul deionized water to base for post matter, 12000rpm/min eluted dna ,-20 ℃ of preservations
4.BSP amplification and detection
4.1BSP reaction
(1) design ACTB-BSP primer and probe
ACTB?BF：5’TGGTGATGGAGGAGGTTTAGTAAGT 3’(SEQ?IDNO：1)
ACTB?BR：5’AACCAATAAAACCTACTCCTCCCTTAA?3’(SEQ?IDNO：2)
ACTB-probe：FAM-TTTGTTATTGTGTGTTGGGTG-MGB(FAM-SEQID?NO：3-MGB)
Expanding fragment length: 133bp, this sequence is shown in GeneID:60.
(2) design GSH2-BSP primer
GSH2BF：5′GTTTAAAGGGAGGYGATTAGATAG?3′(SEQ?ID?NO：4)
GSH2BR：5′TTCTCTCTCCAACTCCAAAAATTA?3′(SEQ?ID?NO：5)
Expanding fragment length: 351bp, this sequence is shown in GeneID:170825.
Reaction system is 25 μ l, and reaction conditions is: 95 ℃ of pre-sex change 10min; 95 ℃ sex change 30s.53.3 ℃ annealing is extended 30s, totally 40 circulations for 30s.72 ℃.2.0% agarose gel electrophoresis has been determined the product exactness.
Extension increasing sequence is as follows:
Above-mentioned section also is the standard substance sequence, and single underscore represents to design the sequence of BSP amplimer.The sequence that square frame indicates in this amplified fragments is the sequence of design MSP amplimer, the sequence that double underline indicates is target sequence (the MSP expanding fragment length 114bp of MGB probe in detecting, the BSP expanding fragment length is 351bp, two some coincidences of sequence, the standard substance sequence is 386bp).
4.2T carrier connects and transforms
Behind the PCR product purification, connect by the specification sheets of pMD18-T Vector, use electric shocking method (molecular cloning experiment guide third edition Page 1296) to be converted into E.coli DH5 α then.
4.3 bacterium liquid order-checking
Dna sequencing is accepted by invitrogen company and is finished.
4.4 sequencing result
The expection base sequence is that the CpG site all methylates in the former sequence, and it remains unchanged behind sulfiting, and independent C all is converted into T, the cloning and sequencing result shows, it is consistent with the expection base sequence, picks out the standard substance clone of HHP1 and ACTIN according to this respectively, as shown in Figure 2.
5. the preparation of standard substance
With the little extraction reagent kit of the common plasmid of Axygen (centrifugal column type) the standard substance clone who picks out is carried out plasmid extraction.
(1) gets the centrifugal 1min of bacterium liquid 12000 * g of 1ml overnight incubation in the LB substratum, abandon most supernatant.
(2) add the BufferS1 suspension bacterial precipitation that 250ul contains RNaseA, suspending needs evenly not leave little bacterium piece.
(3) add 250ul BufferS2, gentleness also fully spins upside down the abundant cracking of thalline when mixing for 4-6 time, until forming bright solution.
(4) add 350ul BufferS3, gentle also fully spinning upside down mixed the centrifugal 10min of 12000 * g 6-8 time.
(5) draw the centrifugal supernatant in the step (4) and transfer in the preparation pipe (test kit provides) the centrifugal 1min of 12000 * g.Abandon filtrate.
(6) will prepare pipe and put back centrifuge tube, add 500ul BufferW1, the centrifugal 1min of 12000 * g.Abandon filtrate.
(7) will prepare pipe and put back centrifuge tube, add 700ul BufferW2, the centrifugal 1min of 12000 * g.Abandon filtrate; With same method more once, abandon filtrate with 700ul BufferW2 washing.
(8) will prepare pipe and put back in the 2ml centrifuge tube, the centrifugal 1min of 12000 * g.
(9) will prepare pipe and move in the new 1.5ml centrifuge tube, central authorities add the 60-80ul deionized water at the preparation periosteum, and room temperature leaves standstill 1min, the centrifugal 1min of 12000 * g ,-20 ℃ of preservations.
The standard substance copy number converts: copy number=(quality/molecular weight) * 6.02 * 10
23
Standard substance plasmid molecular weight 1ng plasmid copy number
(dalton 3.3 * 10 in pMD18-GSH2 2805bp * 650
8
/bp)
(dalton 3.23 * 10 in pMD18-ACTIN 2825bp * 650
8
/bp)
Standard substance are diluted to 5 * 10 successively
7Copy/μ l, 5 * 10
6Copy/μ l, 5 * 10
5Copy H shellfish/μ l, 5 * 10
4Copy/μ l, 5 * 10
3Copy/μ l, 5 * 10
2Copy/μ l, 5 * 10
1Copy/μ l.
Two, to the GSH2 standard substance detection by quantitative that methylates
1. design of primers
Design MSP primer and probe in BSP amplified fragments upstream and downstream
GSH2MF：5′GTTTTCGATGCGTAGGATGC?3′(SEQ?ID?NO：7)
GSH2MR：5′ACGTTTTTAACTAAACCTACGCGC?3′(SEQ?ID?NO：8)
Expanding fragment length: 351bp, this sequence is shown in GeneID:170825.
2. real-time quantitative PCR reaction
The standard substance 2 μ l that get each concentration gradient respectively (promptly form the copy number gradient: 10
8, 10
7, 10
6, 10
5, 10
4, 10
3, 10
2, 10
1, 0), utilization MGB probe method is carried out quantitative amplification, reaction system 25 μ l, reaction conditions is: 95 ℃ of pre-sex change 10min; 95 ℃ sex change 15s.60 ℃ annealing 10min. totally 50 circulations.Its amplification curve and typical curve are as shown in Figure 3.
Three, to the ACTIN standard substance carry out detection by quantitative,
1. design of primers
ACTB?BF：5’TGGTGATGGAGGAGGTTTAGTAAGT 3’
ACTB?BR：5’AACCAATAAAACCTACTCCTCCCTTAA?3’
ACTB-probe：FAM-TTTGTTATTGTGTGTTGGGTG-MGB
Expanding fragment length: 133bp, this sequence is shown in GeneID:60.
2. real-time quantitative PCR reaction
The standard substance 2 μ l that get each concentration gradient respectively (promptly form the copy number gradient: 10
8, 10
7, 10
6, 10
5, 10
4, 10
3, 10
2, 10
1, 0), utilization MGB probe method is carried out quantitative amplification, reaction system 25 μ l, reaction conditions is: 95 ℃ of pre-sex change 10min; 95 ℃ sex change 15s.60 ℃ annealing 10min. totally 50 circulations.Its amplification curve and typical curve are as shown in Figure 3.
Four, patient's clinical sample is carried out GSH2 gene methylation detection by quantitative
1. sample collection
1.1 pancreas cancer cell strain: available from Chinese Academy of Sciences's Shanghai cell pancreas cancer cell strain PaTu8988 and ASPC.
1.2 carcinoma of the pancreas tissue and cancer beside organism: take from attached Changhai hospital of in April, 2009 The 2nd Army Medical College pancreas surgical resection sample 2 examples, after the excision focus, cut each 1 of the other healthy tissues of primary tumo(u)r and incisxal edge cancer rapidly with sharp cutter, be frozen in the liquid nitrogen immediately and preserve, the time of drawing materials is no more than 10min.All carcinoma of the pancreas confirm to be conduit source property through H-E dyeing pathology, and representative slice HE dyes as shown in Figure 4, and carries out roughing out with frozen section.
1.3 normal people's white corpuscle: take from the new inpatient of in April, 2009 The 2nd Army Medical College attached Changhai hospital Digestive System Department, on an empty stomach extract peripheric venous blood 1.5ml, it is frozen to be stored in the EDTA anticoagulant tube-40 ℃ of refrigerators.
1.4 normal pancreatic tissue: take from normal pancreatic tissue in the frozen postmortem sample in attached Changhai hospital of The 2nd Army Medical College Digestive System Department laboratory.
2. sample gene group DNA extraction, DNA concentration determination and bisulfite transform, and method is the same.
3.GSH2 gene methylation detection by quantitative
Handle taking-up two equal portions the after product from bisulfite: portion carries out methylated MSP amplification of GSH2 and taqman-MGB probe in detecting, the GSH2 that the detects different gradient concentrations simultaneously standard substance that methylate, the establishing criteria curve carries out absolute quantitation to the methylate copy number of sequence of GSH2; Another part carries out pcr amplification and the taqman-MGB probe in detecting of reference gene ACTB, the ACTB that the detects different gradient concentrations simultaneously standard substance that methylate, the establishing criteria curve carries out absolute quantitation to the copy number of ACTB, and the copy number of ACTB is equivalent to drop into total genome copy number of detection.The GSH2 of above-mentioned acquisition methylates sequence copy numbers divided by the copy number of ACTB, and this ratio is the quantitative values of GSH2 gene methylation degree among a certain test sample DNA, and index promptly methylates.Primer, reaction system and reaction conditions detect with standard substance.Amplification curve that sample segment detects and used typical curve are as shown in Figure 5.Detection by quantitative result is as shown in table 1.
The quantitative values that form 1GSH2 gene methylation degree detects in different samples
(index M that promptly methylates I)
Embodiment confirms that the different degree of methylating of the GSH2 gene in pancreas cancer cell strain, carcinoma of the pancreas tissue, cancer beside organism, normal people's white corpuscle, the normal pancreatic tissue can carry out detection by quantitative according to the present invention.
By the foregoing description as can be known, dna methylation of the present invention detects and has advantage fast and accurately.Though above embodiment has only carried out the detection by quantitative of GSH2 gene methylation degree in carcinoma of the pancreas tissue, cancer beside organism, cell strain, normal people's white corpuscle and normal pancreatic tissue, technical scheme of the present invention is verified, but according to of the present invention open, pancreatic juice, ight soil, serum, the pancreas puncture thing etc. that also can gather the patient are dna sample, and this is conspicuous for a person skilled in the art.
SEQUENCE?LISTING
＜110〉Second Military Medical University, PLA
＜120〉GSH2 gene methylation quantitative detection method
＜130〉specification sheets, claims
<160>8
<170>PatentIn?version?3.1
<210>1
<211>25
<212>DNA
＜213〉artificial sequence
<400>1
tggtgatgga?ggaggtttag?taagt 25
<210>2
<211>27
<212>DNA
＜213〉artificial sequence
<400>2
aaccaataaa?acctactcct?cccttaa 27
<210>3
<211>21
<212>DNA
＜213〉artificial sequence
<400>3
tttgttattg?tgtgttgggt?g 21
<210>4
<211>24
<212>DNA
＜213〉artificial sequence
<400>4
gtttaaaggg?aggygattag?atag 24
<210>5
<211>24
<212>DNA
＜213〉artificial sequence
<400>5
ttctctctcc?aactccaaaa?atta 24
<210>6
<211>386
<212>DNA
＜213〉artificial sequence
<400>6
acgtttttgg?ctaagcctgc?gcgcttctcc?gcttggctca?aagggaggcg?atcagatagt 60
gcaagccccc?atccctcttt?aatcctgtga?cttcgcatcc?tgcgcatcga?agacctttat 120
ttgctttgca?cgtctctttt?cttccccgct?aagcaaccac?gtgccttgaa?atgggaaagg 180
gatacagatg?ttcggctggg?cttccccggg?tgggtccctg?aaatgcgtcc?tggttagcac 240
atggggtggg?agcaccttgc?ccgagcctta?cctctctacc?ctctcttcgc?cggtccgcag 300
gaggctctga?cgccagccag?gtacccaatg?gcaagaggat?gaggacggcg?ttcactagca 360
cgcaactcct?ggagctggag?agagaa 386
<210>7
<211>20
<212>DNA
＜213〉artificial sequence
<400>7
gttttcgatg?cgtaggatgc 20
<210>8
<211>24
<212>DNA
＜213〉artificial sequence
<400>8
acgtttttaa?ctaaacctac?gcgc 24
Claims (2)
1. a GSH2 gene methylation quantitative detection method is characterized in that this method comprises the steps:
A, sample process to be checked: treat sample DNA originally with QIAGEN EpiTect Bisufite KitTM test kit and carry out the bisulfite processing, as amplification template;
B, prepare the standard substance of ACTB reference gene and the standard substance of GSH2 target gene respectively:
Design and synthesize the BSP primer of ACTB reference gene:
ACTB?BF：5′TGGTGATGGAGGAGGTTTAGTAAGT?3′(SEQ?IDNO：1)
ACTB?BR：5′AACCAATAAAACCTACTCCTCCCTTAA?3′(SEQ?IDNO：2)
Design and synthesize the BSP primer of GSH2 target gene:
GSH2BF：5′GTTTAAAGGGAGGYGATTAGATAG?3′(SEQ?ID?NO：4)
GSH2BR：5′TTCTCTCTCCAACTCCAAAAATTA?3′(SEQ?ID?NO：5)
The ACTB reference gene carries out the condition of BSP reaction: 95 ℃ of pre-sex change 10min; 95 ℃ sex change 30s.60 ℃ annealing is extended 30s, totally 40 circulations for 30s.72 ℃;
The GSH2 target gene carries out the condition of BSP reaction: 95 ℃ of pre-sex change 10min; 95 ℃ sex change 30s.53.3 ℃ annealing is extended 30s, totally 40 circulations for 30s.72 ℃;
The PCR product carries out purifying, connect into pMD 18-T Vector, electric shocking method is converted into E.coli DH5 α, engineering bacteria then, and the correct reorganization bacterium of checking order is increased, use test kit extracting and purifying plasmid, prepare the standard substance of ACTB reference gene and the standard substance of GSH2 target gene respectively; The standard substance sequence is shown in SEQ ID NO:6.
C, at BSP amplified fragments upstream and downstream design MSP primer and probe GSH2MF:5 ' GTTTTCGATGCGTAGGATGC 3 ' (SEQ ID NO:7) GSH2MR:5 ' ACGTTTTTAACTAAACCTACGCGC 3 ' (SEQ ID NO:8)
The detection by quantitative of D, GSH2 gene methylation:
Design and synthesize the probe of ACTB and the probe of GSH2:
ACTB probe: FAM-TTTGTTATTGTGTGTTGGGTG-MGB
GSH2 probe: FAM-ATCCCTCTTTAATCCT-MGB
The sample DNA to be checked that the counterweight sulfiting is crossed carries out real-time fluorescence quantitative PCR respectively, condition is: 1. 2. 95 ℃ of 15s of 95 ℃ of 10min, 70 ℃ of 15s, 60 ℃ of 1min, totally 50 circulations simultaneously; Detect the copy number of ACTB and GSH2 gene; The copy number of GSH2 gene is the quantitative values of GSH2 gene methylation degree in the sample to be checked divided by the copy number of ACTB gene in the sample DNA to be checked.
2. a kind of GSH2 gene methylation quantitative detection method according to claim 1 is characterized in that sample to be checked wherein is pancreatic juice, whole blood, serum, ight soil or pancreas puncture thing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010157486A CN101818203A (en) | 2010-04-27 | 2010-04-27 | Methylated quantitative detection method of GSH2 (glutathione 2) gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010157486A CN101818203A (en) | 2010-04-27 | 2010-04-27 | Methylated quantitative detection method of GSH2 (glutathione 2) gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101818203A true CN101818203A (en) | 2010-09-01 |
Family
ID=42653477
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010157486A Pending CN101818203A (en) | 2010-04-27 | 2010-04-27 | Methylated quantitative detection method of GSH2 (glutathione 2) gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101818203A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107841549A (en) * | 2017-07-19 | 2018-03-27 | 深圳市南山区慢性病防治院 | A kind of serine hydroxymethylase gene promoter zone methylation degree detecting kit and assay method |
| CN111635940A (en) * | 2020-06-03 | 2020-09-08 | 王思贤 | Kit and pharmaceutical composition for cervical cancer detection, screening, typing, diagnosis or prognosis evaluation |
| CN113981046A (en) * | 2021-11-05 | 2022-01-28 | 朱运峰 | DNA methylation detection method based on quantitative PCR technology and kit thereof |
-
2010
- 2010-04-27 CN CN201010157486A patent/CN101818203A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107841549A (en) * | 2017-07-19 | 2018-03-27 | 深圳市南山区慢性病防治院 | A kind of serine hydroxymethylase gene promoter zone methylation degree detecting kit and assay method |
| CN111635940A (en) * | 2020-06-03 | 2020-09-08 | 王思贤 | Kit and pharmaceutical composition for cervical cancer detection, screening, typing, diagnosis or prognosis evaluation |
| CN111635940B (en) * | 2020-06-03 | 2023-01-31 | 王思贤 | Kit and pharmaceutical composition for cervical cancer detection, screening, typing, diagnosis or prognosis evaluation |
| CN113981046A (en) * | 2021-11-05 | 2022-01-28 | 朱运峰 | DNA methylation detection method based on quantitative PCR technology and kit thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sherwood et al. | Characteristics, properties, and potential applications of circulating cell-free dna in clinical diagnostics: a focus on transplantation | |
| CN107034296B (en) | A kind of composition and its application for early stage of lung cancer non-invasive screening | |
| EP3249051B1 (en) | Use of methylation sites in y chromosome as prostate cancer diagnosis marker | |
| CN101967515A (en) | Methylation quantitative detection method of PCDH8 gene | |
| CN106011292A (en) | Kit for detecting methylation of lung cancer-associated gene SHOX2 (short stature homebox2) | |
| CN101613749A (en) | The PAPOLB gene methylation quantitative detection method | |
| EP3998354A1 (en) | Genetic marker combination and application thereof | |
| CN101818202A (en) | Method for screening new internal reference molecules suitable for cervical tissue micro RNA real-time fluorescence quantitative PCR research | |
| CN107779504B (en) | MicroRNA molecular marker for colorectal cancer and application thereof | |
| CN101855348A (en) | Gene associated with liver cancer, and method for determination of the risk of acquiring liver cancer | |
| CN101967514A (en) | Lrrc55 gene methylation quantitative detection method | |
| CN105506133A (en) | Composition, kit and method for detecting SEPT9 gene methylation | |
| CN109055564B (en) | CircRNA marker for diagnosis and prognosis evaluation of chronic lymphocytic leukemia | |
| CN107586842A (en) | A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment | |
| EP4144859A1 (en) | Tumor detection reagent and kit | |
| CN101818203A (en) | Methylated quantitative detection method of GSH2 (glutathione 2) gene | |
| CN112410432B (en) | Application of LINC02474 as colorectal cancer diagnosis marker and treatment target | |
| CN111424085B (en) | Application of tRNA source fragment in preparation of breast cancer diagnostic reagent | |
| CN101285758A (en) | Gene methylation quantitative determination method | |
| CN108660213B (en) | Application of reagent for detecting three non-coding RNAs and kit | |
| CN106939354B (en) | Application of miRNA-4530 as lung cancer diagnosis marker | |
| CN101665835A (en) | Quantitative detection method of HPP1 gene methylation | |
| CN109913544B (en) | Real-time fluorescent quantitative PCR kit for auxiliary diagnosis of tuberculous pleurisy and application thereof | |
| CN101671728B (en) | Method for detecting expression quantity of carcinoembryonic antigen mRNA and special kit thereof | |
| CN108823308B (en) | Application of reagent for detecting circMAN1A2 and LOC284454 and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20100901 |