CN101812534A - PCR primer and sequencing primer for pyrosequencing and detecting HBV lamivudine-resistant mutational site - Google Patents
PCR primer and sequencing primer for pyrosequencing and detecting HBV lamivudine-resistant mutational site Download PDFInfo
- Publication number
- CN101812534A CN101812534A CN200910024425A CN200910024425A CN101812534A CN 101812534 A CN101812534 A CN 101812534A CN 200910024425 A CN200910024425 A CN 200910024425A CN 200910024425 A CN200910024425 A CN 200910024425A CN 101812534 A CN101812534 A CN 101812534A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequencing
- sequence
- pyrosequencing
- sequencing primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a PCR and sequencing primer for pyrosequencing and detecting HBV lamivudine-resistant mutational site. The sequences of the primers are as follows: 1. the sequence of upstream primer is 5'TATTCCCATCCCATCATC3'; 2. the sequence of downstream primer is 5'CCCAACWYCCAATTACATATCCC3'; and 3. the sequence of sequencing primer 1 used for detecting rtV173L is 5'GCTTTCGCAARATWCC3', the sequence of sequencing primer 2 used for detecting rtL180M and rtA181V/T is 5'AGTGGGCCTCAGTCCGTTTC3', and the sequence of sequencing primer 3 used for detecting rtS202G/I and rtM204V/I is 5'CCAYTGTBTGGCTTTC3'.
Description
Technical field
The present invention is that a kind of suitable tetra-sodium sequence measurement detects PCR primer and the sequencing primer that the HBV rummy is decided resistant mutational site greatly.
Background technology
The tetra-sodium sequencing technologies is a Novel DNA sequencing technologies.Under the synergy of archaeal dna polymerase, ATP sulfurylase, luciferase and 4 kinds of enzymes of apyrase, each dNTP polymerization and first order fluorescence signal on the dna single chain are discharged coupling to get up, by detecting the release and the intensity of fluorescence, reach the purpose of The real time measure dna sequence dna.
Hepatitis B virus (HBV) is a double chain DNA molecule, is made up of 3200 left and right sides base pairs (bp), according to the homology of HBV gene order, HBV can be divided into A, B, C, D, E, F, G, H8 kind genotype.The HBV genome is by S, C, and P, X4 open reading frame formed, and the HBV variation can occur in any one zone of its 4 reading frames, and common genovariation has preceding c district, the variation of c gene promoter area is different and HBV polysaccharase (P) gene regions YMDD makes a variation etc.Hepatitis B virus is a kind of virus of easy height variation, because of RNA polymerase and reversed transcriptive enzyme shortage correct functioning, the variation of one or more Nucleotide can take place in its reverse transcription reproduction process.HBV-DNA can natural variation in chronic persistent infection process, also can under immune pressure, morph, even at the drug-induced lower variation of various antiviral therapies.The generation of HBV variation can cause that the biological characteristics of hepatitis B virus changes, medicine is produced antagonism, finally causes hepatitis to be reaccessed.Lamivudine is a kind of nucleoside analog, has been widely used in chronic viral hepatitis B patient's antiviral therapy, can suppress the HBV reverse transcriptase activity, stop viral nucleic acid duplicate but life-time service can cause the sudden change of HBV P gene regions origination point and cause resistance.
The detection method of hepatitis B virus medicament-resistant mutation comprises direct sequencing, gene chips, PCRmnh-ELISA method etc.Contrast these methods, the tetra-sodium sequencing has its special advantages, and the tetra-sodium order-checking has high-throughput, and is easy and simple to handle, characteristics such as detection sensitivity height.In the process of tetra-sodium order-checking, to the purpose fragment well increase and treat location point determine it is the key of whole Success in Experiment.
Summary of the invention
The object of the present invention is to provide and be applicable to that tetra-sodium detects PCR primer and sequencing primer that the HBV rummy is decided medicament-resistant mutation greatly.
Based on above purpose, the present invention by the following technical solutions:
The segmental PCR primer sequence of the purpose that is used to increase comprises:
Upstream primer: 5 ' TATTCCCATCCCATCATC3 '
Downstream primer: 5 ' CCCAACWYCCAATTACATATCCC3 '
The sequencing primer that is used to detect resistant mutational site comprises:
Sequencing primer1:5 ' GCTTTCGCAARATWCC3 '; (being used to detect rtV173L)
Sequencing primer 2:5 ' AGTGGGCCTCAGTCCGTTTC3 '; (be used to detect rtL180M, rtA181V/T)
Sequencing primer 3:5 ' CCAYTGTBTGGCTTTC3 ' (is used to detect rtS202G/I, rtM204V/I)
Of the present invention specifically is that principle is, the purpose fragment of utilizing pcr amplification to go out to detect, pass through archaeal dna polymerase, the ATP sulfurylase, luciferase and apyrase synergy discharge coupling with each dNTP polymerization and first order fluorescence signal on the dna single chain and get up, by detecting the release and the intensity of fluorescence, reach the purpose of real-time detection dna sequence dna, compare with standard sequence again, obtain a result.
Description of drawings
Utilize PCR primer pair and sequencing primer to carry out pyrosequencing and detecting HBV DNA rtV173L mutational site sequencer map.
See accompanying drawing 1
Embodiment
1, PCR primer design: by each genotype of HBV is carried out sequence comparing analysis, select to contain the gene high conserved region territory, P district of lamivudine-resistant mutational site, design many to primer.Optimum primer is:
Upstream primer: 5 ' TATTCCCATCCCATCATC3 '
Downstream primer: 5 ' CCCAACWYCCAATTACATATCCC3 '
2, preceding 10 left and right sides bases of lamivudine-resistant mutational site are chosen in the sequencing primer design, and the design sequencing primer is as follows:
Sequencing primer1:5 ' GCTTTCGCAARATWCC3 '; (being used to detect rtV173L)
Sequencing primer 2:5 ' AGTGGGCCTCAGTCCGTTTC3 '; (be used to detect rtL180M, rtA181V/T)
Sequencing primer 3:5 ' CCAYTGTBTGGCTTTC3 ' (is used to detect rtS202G/I, rtM204V/I)
3, the optimization of reaction system: patient's serum is stored in-20 ℃ as sample to be checked after the packing.
3.1 the optimization of PCR primer concentration: under the situation that other condition is identical in reaction system, the concentration of PCR primer is done the multiple proportions serial dilution from 0.1 μ M to 1.6 μ M respectively, result's analysis has by experiment determined that PCR primer optimum concn is 0.25 μ M
Utilize above-mentioned primer to carry out the foundation of reaction system, determine that finally the PCR reaction system is 50 μ M.
4, the PCR reaction conditions is as follows:
95 ℃ of 2min, 1 circulation; 95 ℃ of 10sec, 52 ℃ of 15sec, 72 ℃ of 20sec, 40 circulations; 72 ℃ of 2min, 1 circulation.
5, operate the computer according to the sequenator specification sheets and be provided with and operate.
6, the detected result analysis:
Directly read sequence on the sequencer map, compare with standard sequence, if sample contains the lamivudine resistance sudden change, sequence on the sequencer map and standard sequence can be inconsistent.
The invention has the advantages that:
(1) PCR primer amplification purpose fragment provided by the invention is run glued fruit and is shown, the band of HBVDNA fragment that is low to moderate 10000 copy/ml is bright, and PCR primer amplification efficient height provided by the invention is described.
(2) negative sample that does not contain the purpose fragment does not have band, illustrates that PCR primer specificity provided by the invention is good
(3) from sequencer map, sequencing primer provided by the invention can well detect mutational site to be measured, and is highly sensitive.
Claims (2)
1. the primer sequence of the HBV dna fragmentation that is used to increase is characterized in that described primer upstream primer sequence is 5 ' TATTCCCATCCCATCATC3 ', and the downstream primer sequence is 5 ' CCCAACWYCCAATTACATATCCC3 '.
2. be used for the sequencing primer sequence of pyrosequencing and detecting HBV lamivudine-resistant medicine sudden change, it is characterized in that described primer sequence is: sequencing primer1:5 ' GCTTTCGCAARATWCC3 '; (being used to detect rtV173L) sequencingprimer 2:5 ' AGTGGGCCTCAGTCCGTTTC3 '; (being used to detect rtL 180M, rtA 181V/T), sequencingprimer 3:5 ' CCAYTGTBTGGCTTTC3 ' (was used to detect rtS202G/I, rtM204V/I).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910024425A CN101812534B (en) | 2009-02-24 | 2009-02-24 | PCR primer and sequencing primer for pyrosequencing and detecting HBV lamivudine-resistant mutational site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910024425A CN101812534B (en) | 2009-02-24 | 2009-02-24 | PCR primer and sequencing primer for pyrosequencing and detecting HBV lamivudine-resistant mutational site |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101812534A true CN101812534A (en) | 2010-08-25 |
| CN101812534B CN101812534B (en) | 2012-10-24 |
Family
ID=42619902
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910024425A Active CN101812534B (en) | 2009-02-24 | 2009-02-24 | PCR primer and sequencing primer for pyrosequencing and detecting HBV lamivudine-resistant mutational site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101812534B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914625A (en) * | 2010-08-30 | 2010-12-15 | 河北医科大学 | Kit and method for determining sex by detecting enamel protein gene with pyrosequencing method |
| CN112557364A (en) * | 2020-12-11 | 2021-03-26 | 天津市职业大学 | Intelligent indoor air quality virus detection system and detection method |
-
2009
- 2009-02-24 CN CN200910024425A patent/CN101812534B/en active Active
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914625A (en) * | 2010-08-30 | 2010-12-15 | 河北医科大学 | Kit and method for determining sex by detecting enamel protein gene with pyrosequencing method |
| CN101914625B (en) * | 2010-08-30 | 2012-08-29 | 河北医科大学 | Kit and method for determining sex by detecting enamel protein gene with pyrosequencing method |
| CN112557364A (en) * | 2020-12-11 | 2021-03-26 | 天津市职业大学 | Intelligent indoor air quality virus detection system and detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101812534B (en) | 2012-10-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2776673T3 (en) | Methods and uses for molecular tags | |
| CN102181575A (en) | Primers and method for detecting drug resistance mutation site of hepatitis B virus | |
| CN104450963B (en) | A kind of HBV DNA digital pcrs immue quantitative detection reagent box and its application | |
| Innings et al. | Multiplex real-time PCR targeting the RNase P RNA gene for detection and identification of Candida species in blood | |
| Besse et al. | Genotyping and resistance profile of hepatitis C (HCV) genotypes 1–6 by sequencing the NS3 protease region using a single optimized sensitive method | |
| US20180073087A1 (en) | Qualitative and absolute quantification kit for detecting hepatitis b virus cccdna | |
| JP2020092721A (en) | Dual probe assay for detection of target nucleic acid | |
| CN102140534A (en) | Detection method of nucleotide mutational site of hepatitis B virus gene | |
| EA008388B1 (en) | Amplification-hybridisation method for detecting and typing human papillomavirus | |
| US9617606B2 (en) | Oligonucleotide for HIV detection, HIV detection kit, and HIV detection method | |
| CN102317474A (en) | Oligonucleotide probes and primers for detection of hepatitis b virus | |
| CN101812537B (en) | Method and reagent kit for simultaneously detecting resistance site of three nucleotide analogues of hepatitis B virus | |
| Bayliss et al. | Advances in the molecular diagnosis of hepatitis B infection: providing insight into the next generation of disease | |
| EP3129507A1 (en) | Methods and kits for determining a personalized treatment regimen for a subject suffering from a pathologic disorder | |
| CN101812534B (en) | PCR primer and sequencing primer for pyrosequencing and detecting HBV lamivudine-resistant mutational site | |
| CN102876813B (en) | Real-time fluorescence RT-HDA (Reverse Transcriptase-Helicase-Dependent Isothermal Amplification) kit and primer for detecting avian influenza virus | |
| CN103540676B (en) | Kit for detecting mutations of A-G at 1555th site and C-T at 1494th site of mitochondrial gene | |
| CN103088151B (en) | Kit for hepatitis B virus four-color fluorescence quantitative PCR (polymerase chain reaction) assay and application | |
| CN108603226A (en) | The quantitative measurment of hepatitis B virus C CCDNA | |
| CN102286644A (en) | Kit for genotyping hepatitis C virus (HCV) | |
| CN102912038B (en) | RT-HDA kit and primer for detecting avian influenza virus | |
| CN110914459A (en) | Assays for detecting Hepatitis B Virus (HBV) | |
| CN102115796A (en) | HBV (hepatitis B virus) fluorescence quantitative PCR (Polymerase Chain Reaction) detection kit containing internal reference | |
| Kim et al. | A CRISPR/Cas12 trans-cleavage reporter enabling label-free colorimetric detection of SARS-CoV-2 and its variants | |
| CN105296601A (en) | PCR-SBT (PCR-sequence-based typing) method and reagent for human blood platelet alloantigen system genotyping |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP03 | Change of name, title or address |
Address after: 225300 building R19, road, Taizhou hi tech Development Zone, Zhejiang Province, China Patentee after: JIANGSU MOLE BIOSCIENCE CO., LTD. Address before: 225300, R19 building, No. 1, drug City Avenue, Taizhou, Jiangsu Patentee before: JIANGSU MOLE BIOSCIENCE CO., LTD. |