CN101812515A - Detection method of nucleic acid mutation - Google Patents
Detection method of nucleic acid mutation Download PDFInfo
- Publication number
- CN101812515A CN101812515A CN200910254471A CN200910254471A CN101812515A CN 101812515 A CN101812515 A CN 101812515A CN 200910254471 A CN200910254471 A CN 200910254471A CN 200910254471 A CN200910254471 A CN 200910254471A CN 101812515 A CN101812515 A CN 101812515A
- Authority
- CN
- China
- Prior art keywords
- probe
- nucleic acid
- public
- identification
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention provides a detection method of nucleic acid mutation, which belongs to the technical field of molecular biology and comprises the following steps: (1) selecting a nucleic acid sample to be detected; (2) designing a probe; (3) amplifying PCR (Polymerase Chain Reaction); (4) preparing an oligonucleotide gene chip; and (5) detecting. The invention mainly solves the technical problems that the traditional detection method of the nucleic acid mutation has low resolution caused by non-specific hybridization, complicated detection process and high cost. The invention has the advantages of strong detection specificity, high accuracy of detection, low false positive, high-flux detectability and the like.
Description
Technical field
The invention belongs to technical field of molecular biology, be specifically related to a kind of detection method of nucleic acid mutation.
Background technology
Transgenation is meant that the change that base pair is formed or put in order takes place the genomic dna molecule on structure function, mainly comprise the replacement of base and the disappearance or the insertion of small segment, and it is one of major reason that causes the genotype disease.And polymorphism is meant that the dna sequence dna that has accumulated during evolution changes in the crowd.Transgenation and polymorphism analysis especially have important effect in genotype medical diagnosis on disease and pathological study in biomedical research.
The method of measuring transgenation is a lot, and the most classical detection in Gene Mutation technology is a making nucleic acid molecular hybridization.Traditional making nucleic acid molecular hybridization method has blot hybridization on the film (as Southern trace, Northern trace) and cell in-situ hybridization etc.Because the high degree of specificity of making nucleic acid molecular hybridization and the high sensitivity of detection, its application plays important pushing effect to molecular biological fast development.But traditional making nucleic acid molecular hybridization method operating process is numerous and diverse, and particularly probe is often used the radioactive substance mark, easily human body is damaged.
After round pcr in 1985 comes out, because it has powerful DNA amplification in vitro ability, combine with the making nucleic acid molecular hybridization technology, its susceptibility and specificity are all strengthened greatly.Therefore the detection in Gene Mutation technology has obtained development rapidly, constantly derives many new detection meanss and technology.Many methods in them are suitable for the detection of point mutation, also are applied to detect SNPs.The detection method that is usually used in the PCR-based technology at present comprises: the method that detects known mutations and SNPs has allele specific oligonucleotide hybridization (ASO), ligase chain reaction (LCR), TagMan technology, the restricted length polymorphism analysis of polymerize chain reaction (PCR-RFLP), short series connection repeat length polymorphism (STR) etc.; The method that detects unknown mutation has single strand conformation polymorphism (SSCP), heteroduplex polymorphism analysis (HPA), MALDI-TOF mass spectroscopy (matrix assisted laserdesorptionion Ization time of flight mass spectrometry), denaturing gradient gel electrophoresis (DGGE), enzymatic cutting mispairing (EMC), two deoxidation finger print method (ddF) and dna sequencing method etc.Whether exist though these methods can detect sudden change, most methods be can not determine the type of sudden change and can only be detected the part of SNP; While most methods such as agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis, high performance liquid chromatography etc. need detection means ability analysis and judgement results such as PCR aftertreatment, and the result judges more complicated.In addition, above-mentioned most of detection technique complex disposal process once can only detect small amount of sample, are difficult to satisfy the needs of automatization.
The dna sequencing method is the most basic a kind of method that detects sudden change, though can accurately determine the position and the character of sudden change, at present time-consuming based on the sequencing technologies of gel electrophoresis, automatic sequencer order-checking cost height has limited its application in practice.
Biological micro-array (or claiming biochip) technology is quick, the high-throughout testing tool that occurs in recent years, it utilizes the microarray technology, (cell, protein and DNA etc.) are arranged on the solid-phase matrix with thousands of biological components, predetermined substance reaction on detected component and the matrix in the biological sample is introduced corresponding signal (as fluorescence) then and is reached purpose to biological sample analysis.The biological micro-array technology can be finished some traditional biological analysis means with speed as quickly as possible in the little spatial dimension of trying one's best.
At present, there be multiple method and relevant patented technology to be used for detection in Gene Mutation (detecting) and nucleic acid sequencing analysis as SNPs based on the DNA chip, as with based on nucleic acid hybridization reaction, single base extension, allele-specific primers extends and ligation, primer ligation (Weiguo Cao, Clinical andApplied Immunology Reviews 22001:33-43), restriction enzyme reaction, SNP flux distribution system (SNPStreamassay (Orchid Cellmark/Beckman Coulter)) such as Beckman company has appearred on the basis of principles such as padlock probe reaction, the multiple locus specificity of the GoldenGate of Yi Lumingna company extends amplification classification system (GoldenGate genotyping assay (Illumina)), the high full Genome Atlas analytical system of people (GeneChip Human Mapping assays (Affymetrix)) that flies company, the Infinium gene type system of Yi Lumingna company (Infinium genotypingassay (Illumina)), high drug metabolism enzyme and the transporter target gene classification system (Targeted Genotyping System for drug metabolizing enzymes and transports (DMETs) analysis (Affymetrix)) that flies company waits (as the SNPs) detection platform of suddenling change, in addition at relevant patented technology such as US 5427930, US 6479242, WO9300447, US 5871921, US 6858412, in US 5866337 grades relevant detection in Gene Mutation (detecting as SNPs) and nucleic acid sequencing analysis also introduced to some extent.
Based on the chip technology of direct nucleic acid hybridization reaction, its non-specific hybridization causes resolving power not high, easily produces false positive results; And most of chip detection platforms all need very expensive chip detecting equipment and correlation analysis software just can carry out high throughput testing.
Summary of the invention
The object of the present invention is to provide a kind of nucleic acid mutation detection method, the detection method non-specific hybridization that has solved existing nucleic acid mutation cause resolving power not high, easily produce false-positive detected result, testing process complexity, cost technical problems of high.
The technical solution that the present invention is directed to above-mentioned technical problem is as follows:
A kind of detection method of nucleic acid mutation, its special character is, may further comprise the steps:
1) chooses the determined nucleic acid sample;
2) design of probe
2.1) determine to be directed to identification probe P1, identification probe P1 ' and the public probe P2 in determined nucleic acid pattern detection site: described identification probe P1, discern probe P1 ' and public probe P2 and contain the sequence complementary sequence with both sides, base to be measured site a: H1 respectively, H1 ', H2; The base sequence of the 5 ' end of identification probe P1 and identification probe P1 ' is two universal amplification sequence: A4 and A4 '; The base sequence of the 3 ' end of public probe P2 is and universal amplification sequence complementary sequence: A3, the base sequence at the middle part of public probe P2 be one with the mutational site of sample of nucleic acid Tag sequence one to one;
2.2) with step 2.1) and in identification probe P1 and public probe P2 connect into a probe, or identification probe P1 ' connects into a linking probe with public probe P2, or identification probe P1, identification probe F1 ' connect into a linking probe with public probe P2 through reaction respectively;
3) pcr amplification: with step 2.2) described linking probe carries out pcr amplification respectively;
4) preparation oligonucleotide gene chip;
5) detect: the pcr amplification product of step 3) gained with after hybridization buffer mixes, is hybridized detection afterwards with the oligonucleotide gene chip of step 4) gained, obtain detected result.
The above step 2.2) specific implementation method is:
2.2.1) with step 2.1) and in identification probe P1, identification probe P1 ', public probe P2 respectively with step 1) in the determined nucleic acid sample be 60～69 ℃ of annealing hybridization 2～10min down in temperature;
2.2.2) under the effect of dna ligase, by phosphodiester bond will with public probe P2, maybe will discern probe P1 ' and public probe P2, maybe will discern probe P1, discern probe P1 ' and connect into a linking probe with public probe P2 together.
Above-described identification probe P1 and identification probe P1 ' all are directed to wild-type or mutant allele.
Above-described step 3) is to use three universal amplification primer CA3, A4 and A4 ' to step 2.2.2) in linking probe increase respectively; 5 ' the end of the A4 of described universal amplification primer and A4 ' is the fluorescence molecule Cy3 or the Cy5 of mark.
The specific implementation method of above-described step 4) is:
4.1) use the sheet base of aldehyde radicalization, and put the corresponding Tag sequence in SNP site to be detected on system and the public probe P2 respectively at the specific site of this sheet base;
4.2) with step 4.1) the sheet base of gained seals, cleans, dries preservation, oligonucleotide gene chip.
Above-described step 5) was carried out in hybrid heater the hybridization of oligonucleotide gene chip, specifically is to be under 52 ~ 60 ℃ in temperature, with 60 ~ 100 rev/mins (rpm) hybridization 2 ~ 6 hours; And the oligonucleotide gene chip after will hybridizing cleans the back drying in order to detecting; With temperature is that 60 ℃, rotating speed are that 60 rev/mins (rpm) hybridization 4h is advisable.
Detection for the oligonucleotide gene chip after the hybridization in the above step 5) may further comprise the steps:
5.1) with the fluorescent scanning instrument oligonucleotide gene chip is scanned;
5.2) determine the genotype of the SNP of correspondence with it according to the fluorescent signal of specific site on the oligonucleotide gene chip; When specific site was Cy3 or Cy5 type fluorescent signal, then the SNP genotype was homozygous wildtype or homozygous mutation type; When specific site was Cy3 and Cy5 mixing fluorescent signal, then the SNP genotype was a heterozygote wild and sudden change.
Determined nucleic acid sample in the above step 1) is animals and plants chromosomal DNA, target nucleic acid pcr amplification product, Mitochondrial DNA, cDNA, bacterium or viral DNA or RNA.
Advantage of the present invention is as follows:
1) testing process is easy fast: the detection method of nucleic acid mutation provided by the invention has realized finishing the detection reaction in all SNP to be detected sites in a reaction tubes.
2) high specificity: identification probe P1, identification probe P1 ', the specific identification determined nucleic acid of public probe P2 sample template in the detection method of the nucleic acid mutation that provides of the present invention, detected result high specificity.
3) accuracy rate height, false positive is low: adopt biochip test, the accuracy rate height, false positive rate is low.
4) high-throughout detectivity: the design of synthetic, amplimer of the design of distinctive detection probes and gene chip in the detection method of nucleic acid mutation provided by the invention makes that the allelotrope for nucleic acid mutation has high-throughout detectivity.
5) cost is low: the detection of gene chip does not need special-purpose chip detecting equipment and relevant analysis software in the detection method of nucleic acid mutation provided by the invention, therefore can save the detection cost of nucleic acid mutation.
Description of drawings
Fig. 1 is the structural representation of detection probes of the present invention (identification probe P1, identification probe P1 ' and public probe P2);
Fig. 2 is a probe ligation schematic flow sheet of the present invention, and wherein Fig. 2 A is detection probes and determined nucleic acid sample hybridization synoptic diagram, and Fig. 2 B is the detection probes connection diagram, and Fig. 2 C is a linking probe amplification synoptic diagram;
Fig. 3 is an oligonucleotide gene chip structural representation of the present invention;
Fig. 4 detects the oligonucleotide gene chip scanning result synoptic diagram of nucleic acid mutation for one embodiment of the invention.
Embodiment
Principle of the present invention is, based on the general oligonucleotide gene chip, by designing identification probe P1, identification probe P1 ' and the public probe P2 realization high throughput testing to base to be measured or mutational site.After probe and determined nucleic acid sample annealing hybridization, under the effect of dna ligase, finish identification probe P1 and public probe P2 or identification probe P1 ' with public probe P2 or discern probe P1, discern probe P1 ' respectively with being connected of public probe P2, after the introducing through universal amplification primer and fluorescent signal, with the general oligonucleotide gene chip hybridization.And the specific site on the general oligonucleotide gene chip is all put to be shaped on public probe P2 and is gone up corresponding Tag sequence.Chip is cleaned in the hybridization back, determines site to be measured base type or mutational site genotype with the Two Colour Fluorescence scanner scanning and according to the fluorescent signal analysis of specific site on the chip.
Specific implementation step of the present invention is:
1) choose the determined nucleic acid sample, this determined nucleic acid sample can be to be among animals and plants chromosomal DNA, target nucleic acid pcr amplification product, Mitochondrial DNA, cDNA, bacterium or viral DNA or the RNA any one.
2) design of probe
2.1) determine identification probe P1, discern probe P1 ' and public probe P2; Wherein discern probe P1 and all can be directed to wild-type allele or mutant allele with identification probe P1 '.Following identification probe P1 is directed to wild-type allele, and identification probe P1 ' is directed to mutant allele.
Referring to Fig. 1, for certain base to be measured site, the method of design that detects required probe is: with three linear probes promptly discern probe P1, identification probe P1 ' and public probe P2 detect sample of nucleic acid to be measured, designed oligonucleotide sequence is described in detail as follows:
The oligonucleotide sequence of identification probe P1 of the present invention is made up of H1 and A4 two portions, and wherein 5 ' the A4 that holds at identification probe P1 is one section general oligonucleotide sequence about 20nt, is used for probe is carried out symmetry or asymmetric PCR amplification; The H1 of the 3 ' end of identification probe P1 be about one section 20nt with the determined nucleic acid sample on the sequence of nucleic acid array complementation of base to be measured site one side, 3 ' holds last base to be the base complementrity pairing corresponding with the mutational site wild-type allele.The oligonucleotide sequence of the identification probe P1 ' that the present invention is designed is made up of H1 ' and A4 ' two portions, wherein 5 ' the A4 ' that holds at identification probe P1 ' is one section general oligonucleotide sequence about 20nt, is used for probe is carried out symmetry or asymmetric PCR amplification; The H1 ' of the 3 ' end of identification probe P1 ' be about one section 20nt with sample of nucleic acid on the sequence of nucleic acid array complementation of base to be measured site one side, 3 ' holds last base to be the base complementrity pairing corresponding with the mutational site mutant allele.The oligonucleotide sequence of public probe P2 is by H2, and Tag and A3 three parts are formed, and wherein 3 ' the A3 that holds at public probe P2 is one section general oligonucleotide sequence about 20nt, is used for probe is carried out symmetry or asymmetric PCR amplification; The H2 of the 5 ' end of public probe P2 be about one section 20nt with sample of nucleic acid on the sequence of nucleic acid array complementation of base to be measured site one side, the base sequence that the centre of public probe P2 is about 20 is and mutational site Tag sequence one to one.
2.2) with step 2.1) and in identification probe P1 and public probe P2 connect into a probe, or identification probe P1 ' connects into a linking probe with public probe P2, or identification probe P1, identification probe P1 ' connect into a linking probe with public probe P2 through reaction respectively:
2.2.1) with step 2.1) and in identification probe P1, identification probe P1 ', public probe P2 respectively with step 1) in the determined nucleic acid sample be 60～69 ℃ of annealing hybridization 2～10min down in temperature;
Referring to Fig. 2 A, 60～69 ℃ of hybridization 2 ~ 10min that anneal of probe that detection is required and sample of nucleic acid; After probe and the determined nucleic acid sample annealing hybridization, identification probe P1 or identification probe P1 ' and public probe P2 mutually the adjacency pair fire on the sequence of both sides, mutational site, and have only when on 3 ' the end base of identification probe P1 or identification probe P1 ' and the sample of nucleic acid during base complementrity pairing of SNP to be checked site, identification probe P1 and/or identification probe P1 ' and public probe P2 could incise at both sides, SNP site formation strand.
2.2.2) under the effect of dna ligase, to discern probe P1 and public probe P2 by phosphodiester bond, maybe will discern probe P1 ' and public probe P2, maybe will discern probe P1, discern probe P1 ' and connect into a linking probe with public probe P2 together, referring to Fig. 2 B.
3) pcr amplification: with step 2.2) described two probes carry out pcr amplification respectively;
For the amplification detection signal, need respectively to the linking probe in the reaction system carry out being used for after symmetry or the asymmetric PCR amplification with the general oligonucleotide gene chip on the corresponding zone hybridize.Referring to Fig. 2 C, the amplification procedure of probe is a template with the linking probe, and with three universal primer CA3, A4, A4 ' are amplimer, and all probes of finishing connection are carried out symmetry or asymmetric amplification.Because 5 ' end at A4 and A4 ' has fluorescence molecule cy3 and cy5 mark respectively, so all ends at the linking probe of homozygous wildtype all have the cy3 mark, and all ends at the linking probe of homozygous mutation type all have the cy5 mark.
4) preparation oligonucleotide gene chip:
4.1) use the sheet base of aldehyde radicalization, and put the corresponding Tag sequence in SNP site to be detected on system and the public probe P2 respectively at the specific site of this sheet base, referring to Fig. 3.The corresponding sequence of Tag sequence on the specific site point of every oligonucleotide gene chip system and public probe P2 is used for this specific base to be measured site is discerned and located.
4.2) with step 4.1) the sheet base of gained seals, cleans, dries preservation, oligonucleotide gene chip.
5) detect: with the pcr amplification product of step 3) gained with after hybridization buffer mixes, with the oligonucleotide gene chip of step 4) gained in hybrid heater, in temperature is under 52 ~ 60 ℃, with 60 ~ 100 rev/mins (rpm) hybridization 2 ~ 6 hours, and the oligonucleotide gene chip after will hybridizing cleans the back drying, detect then and obtain detected result, concrete detection method is:
5.1) with the fluorescent scanning instrument oligonucleotide gene chip is scanned;
5.2) determine the genotype of the SNP of correspondence with it according to the fluorescent signal of specific site on the oligonucleotide gene chip; When specific site was Cy3 or Cy5 type fluorescent signal, then the SNP genotype was homozygous wildtype or homozygous mutation type; When specific site was Cy3 and Cy5 mixing fluorescent signal, then the SNP genotype was a heterozygote wild and sudden change.
Below will sport example and describe the concrete performing step of the present invention in detail with the L858R on the human cloning genome EGFR gene Exon21:
(1) chooses human cloning genome EGFR gene Exon21 as the determined nucleic acid sample.
(2) design of probe: the nucleotide sequence of required identification probe P1, identification probe P1 ' and public probe P2 is as follows:
P1：
P1’：
P2：
Identification probe P1, identification probe P1 ' and public probe P2 respectively with human cloning genome EGFR gene Exon21 annealing hybridization after, under the effect of dna ligase, finish identification probe P1 and public probe P2 or discern being connected or discerning probe P1 and discern being connected of probe P1 ' and public probe P2 of probe P1 ' and public probe P2.Concrete reaction system is formulated as follows: the human cloning genome EGFR gene Exon21 that gets 1 μ l; Get the identification probe P1 of 50fmol respectively, identification probe P1 ' and public probe P2, each adds 10*Taq ligase enzyme reaction solution (10*Taq Ligase buffer) 1.5 μ l, 0.5U Taq ligase enzyme (0.5U Taq Ligase), the Tris damping fluid is supplied 15 μ l, under following reaction conditions, react: 94 ℃ of 30s, 67 ℃ of 3min, 15 circulations; 98 ℃, 15min.
(3) pcr amplification: amplimer A4, the sequence of A4 ' and CA3 is as follows:
A4
5’CY3-GGGTTCGTGGTAGAGCGTCGGAGT
A4’
5’CY5-GGGTTCGTGGTAGAGCGTCGGAGT
CA3
AGACAATAGTTGCTTACACTGCA
Concrete amplification system is as follows, gets the linking probe 3.5 μ l of step (2) gained, adds amplimer A4, each 2.5 μ mol of A4 ' and CA3,2 * Taq PCR reaction mixture (2 * Taq PCR mastermix), 7.5 μ l, dH
2O complements to 15 μ l, according to carrying out pcr amplification with following condition: 95 ℃, 2min; 95 ℃, 20s, 69 ℃, 40s, 72 ℃, 20s, 15 circulations; 72 ℃, 4min, 4 ℃ of preservations.The purpose clip size is about 120bp.
(4) preparation oligonucleotide gene chip: use the sheet base of aldehyde radicalization, and after the specific site of this sheet base is put the corresponding Tag sequence in SNP site to be detected on system and the public probe P2 respectively, this Tag sequence specifically:
tag?sequence
NH2-AGTCGCTTAATTACTCCGGATGG
The sheet base of gained is sealed, cleans, dries preservation, get oligonucleotide gene chip.
(5) detect: the pcr amplification product of the gained of step (3) is mixed with hybridization buffer, under 60 ℃, hybridize 4h with 60 rev/mins (rpm) with corresponding chip area.Hybridization finishes, and dries after cleaning.With the fluorescent scanning instrument oligonucleotide gene chip after hybridizing is scanned, carry out interpretation of result according to scintigram.
Referring to Fig. 4, the distribution of an array is shown in (a) on the oligonucleotide gene chip, and scanning result is as (b), (c), (d) shown in, by scanning result as can be known, (b), (c), (d) mutation type that detects under three kinds of situations is respectively the heterozygote of wild-type, mutant, wild and sudden change.
Claims (8)
1. the detection method of a nucleic acid mutation is characterized in that, may further comprise the steps:
1) chooses the determined nucleic acid sample;
2) design of probe
2.1) determine to be directed to identification probe P1, identification probe P1 ' and the public probe P2 in determined nucleic acid pattern detection site: described identification probe P1, discern probe P1 ' and public probe P2 and contain the sequence complementary sequence with both sides, base to be measured site a: H1 respectively, H1 ', H2; The base sequence of the 5 ' end of identification probe P1 and identification probe P1 ' is two universal amplification sequence: A4 and A4 '; The base sequence of the 3 ' end of public probe P2 is and universal amplification sequence complementary sequence: A3, the base sequence at the middle part of public probe P2 be one with the mutational site of sample of nucleic acid Tag sequence one to one;
2.2) with step 2.1) and in identification probe P1 and public probe P2 connect into a probe, or identification probe P1 ' connects into a linking probe with public probe P2, or identification probe P1, identification probe P1 ' connect into a linking probe with public probe P2 through reaction respectively;
3) pcr amplification: with step 2.2) described linking probe carries out pcr amplification respectively;
4) preparation oligonucleotide gene chip;
5) detect: the pcr amplification product of step 3) gained with after hybridization buffer mixes, is hybridized detection afterwards with the oligonucleotide gene chip of step 4) gained, obtain detected result.
2. the detection method of nucleic acid mutation according to claim 1 is characterized in that, described step 2.2) the specific implementation method be:
2.2.1) with step 2.1) and in identification probe P1, identification probe P1 ', public probe P2 respectively with step 1) in the determined nucleic acid sample be 60～69 ℃ of annealing hybridization 2～10min down in temperature;
2.2.2) under the effect of dna ligase, will discern probe P1 and public probe P2 by phosphodiester bond, maybe will discern probe P1 ' and public probe P2, maybe will discern probe P1, discern probe P1 ' and connect into a linking probe with public probe P2 together.
3. the detection method of nucleic acid mutation according to claim 1 and 2 is characterized in that, described identification probe P1 and identification probe P1 ' all are directed to wild-type or mutant allele.
4. the detection method of nucleic acid mutation according to claim 3 is characterized in that, described step 3) is to use three universal amplification primer CA3, A4 and A4 ' to step 2.2.2) in linking probe increase respectively; 5 ' the end of the A4 of described universal amplification primer and A4 ' is the fluorescence molecule Cy3 or the Cy5 of mark.
5. the detection method of nucleic acid mutation according to claim 4 is characterized in that, the specific implementation method of described step 4) is:
4.1) use the sheet base of aldehyde radicalization, and put the corresponding Tag sequence in SNP site to be detected on system and the public probe P2 respectively at the specific site of this sheet base;
4.2) with step 4.1) the sheet base of gained seals, cleans, dries preservation, oligonucleotide gene chip.
6. the detection method of nucleic acid mutation according to claim 5 is characterized in that, described step 5) is carried out in hybrid heater the hybridization of oligonucleotide gene chip, specifically is to be under 52 ~ 60 ℃ in temperature, with 60 ~ 100 rev/mins (rpm) hybridization 2 ~ 6 hours; And the oligonucleotide gene chip after will hybridizing cleans the back drying in order to detecting.
7. the detection method of nucleic acid mutation according to claim 6 is characterized in that, the detection for the oligonucleotide gene chip after the hybridization in the step 5) may further comprise the steps:
5.1) with the fluorescent scanning instrument oligonucleotide gene chip is scanned;
5.2) determine the genotype of the SNP of correspondence with it according to the fluorescent signal of specific site on the oligonucleotide gene chip; When specific site was Cy3 or Cy5 type fluorescent signal, then the SNP genotype was homozygous wildtype or homozygous mutation type; When specific site was Cy3 and Cy5 mixing fluorescent signal, then the SNP genotype was a heterozygote wild and sudden change.
8. the detection method of nucleic acid mutation according to claim 7 is characterized in that, the determined nucleic acid sample in the described step 1) is animals and plants chromosomal DNA, target nucleic acid pcr amplification product, Mitochondrial DNA, cDNA, bacterium or viral DNA or RNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910254471A CN101812515A (en) | 2009-12-24 | 2009-12-24 | Detection method of nucleic acid mutation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910254471A CN101812515A (en) | 2009-12-24 | 2009-12-24 | Detection method of nucleic acid mutation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101812515A true CN101812515A (en) | 2010-08-25 |
Family
ID=42619882
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910254471A Pending CN101812515A (en) | 2009-12-24 | 2009-12-24 | Detection method of nucleic acid mutation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101812515A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110343745A (en) * | 2019-06-09 | 2019-10-18 | 陈超 | A kind of super quick detection kit of EGFR/L858R mutation |
| CN113186340A (en) * | 2021-03-02 | 2021-07-30 | 江苏海洋大学 | Primer group for rapidly detecting S gene point mutation of fragmented new coronavirus and application |
-
2009
- 2009-12-24 CN CN200910254471A patent/CN101812515A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110343745A (en) * | 2019-06-09 | 2019-10-18 | 陈超 | A kind of super quick detection kit of EGFR/L858R mutation |
| CN113186340A (en) * | 2021-03-02 | 2021-07-30 | 江苏海洋大学 | Primer group for rapidly detecting S gene point mutation of fragmented new coronavirus and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101586150B (en) | Detection probe, general oligonucleotide chip and nucleic acid detection method and application thereof | |
| US20050191636A1 (en) | Detection of STRP, such as fragile X syndrome | |
| CN104372093A (en) | SNP (single-nucleotide polymorphism) detection method based on high-flux sequencing | |
| JP2006520206A (en) | Probe, biochip and method of using them | |
| WO2000009751A1 (en) | Diagnostic methods using serial testing of polymorphic loci | |
| CN108998505A (en) | A kind of gene polymorphism sites detection technique and its kit | |
| CN105624296A (en) | Universal fluorescent hairpin primers for detecting gene polymorphism on basis of ARMS (amplification refractory mutation system) fluorescent PCR (polymerase chain reaction) process | |
| KR101890350B1 (en) | SNP maker for predicting meat quality of pig and use thereof | |
| CN101177702B (en) | Mitochondrial diseases MELAS and MERRF syndrome related mtDNA mutation site detecting gene chip and detecting method | |
| CN106319079B (en) | Method for detecting 22q11.2 copy number loss | |
| CN102399900B (en) | Gene polymorphism detection method and kit | |
| CN101985659A (en) | Kit for testing schizophrenia related gene and preparation method thereof | |
| CN107937493B (en) | Hairpin modified primer for allele PCR | |
| JPWO2007055255A1 (en) | Method for amplifying a plurality of nucleic acid sequences for identification | |
| JP5319148B2 (en) | Method and array for detecting mutations in target nucleic acid | |
| JP5900908B2 (en) | Single nucleotide repeat polymorphism analysis method and single nucleotide polymorphism analysis method | |
| CN101548010A (en) | Method of determining the haplotype of multiple allelic genes | |
| CN101812515A (en) | Detection method of nucleic acid mutation | |
| AU2005314732B2 (en) | Method for identifying gene with varying expression levels | |
| US10665327B2 (en) | High-throughput hybridization and reading method for biochips and system thereof | |
| JP2009232707A (en) | Method for detecting single nucleotide polymorphism and probe-immobilized carrier | |
| Al-Haggar | Evolving molecular methods for detection of mutations | |
| CN1982470A (en) | Technology for inspecting target-gene sequence and known point mutation simultaneously | |
| TWI570242B (en) | Method of double allele specific pcr for snp microarray | |
| CN102191329A (en) | Kit for detecting genes related to severe depressions and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20100825 |