CN101812433A - Use of hevea brasiliensis invertase and coding gene thereof - Google Patents

Abstract

The invention discloses hevea brasiliensis invertase, a coding gene thereof and the use of the hevea brasiliensis invertase and the coding gene. The protein is a protein having an amino acid residue sequence SEQ ID No.1 in a sequence table, or a protein which has an amino acid residue sequence which is obtained by substituting and/or losing and/or adding one or several amino acid residues in the amino acid residue sequence SEQ ID No.1 in the sequence table, has the function of the invertase and is derived from the protein having the amino acid residue sequence SEQ ID No.1. The protein has the activity of the invertase and has saccharose degrading activity. After being transferred into a plant or a microorganism, the protein can improve the saccharose utilization rate of the plant or microorganism, thereby improving plant or microorganism yield.

Description

The application of a kind of hevea brasiliensis invertase and encoding gene thereof

Technical field

The present invention relates to a kind of hevea brasiliensis invertase and encoding gene thereof and application.

Background technology

Invertase (beta-D-fructofuranose glycosides enzyme) catalysis sucrose irreversibly is degraded to glucose and fructose.In higher plant, invertase is a medium sized gene family, comprises tens to twenties genes.According to the Subcellular Localization difference, invertase is divided into cell walls, vacuole and kytoplasm three classes.Difference according to the suitableeest enzyme pH value alive, invertase can be divided into acid and neutrality/alkaline two classes again, wherein cell walls and vacuole invertase belong to acid invertase (Ac-Inv), the suitableeest enzyme pH value alive is 4.5～5.0, the suitableeest enzyme of kytoplasm invertase pH value alive is 7.0～8.0, belongs to neutrality/alkaline invertase (N/A-Inv).

Many studies confirm that, plant invertase wide participation phloem loading and unloading, the adjusting of growing, biology and abiotic stress are replied, and play the core regulating and controlling effect in photosynthate assimilation carbon distributes, and are the key enzymes of decision crop economy output.The research of early stage invertase concentrates on the Ac-Inv, and less to the research of N/A-Inv.In recent years, the research of relevant N/A-Inv was on the increase, and many bioprocesss that studies confirm that this class saccharase at some heavy demand monose or hexose are as playing a significant role in production capacity and the biosynthesizing.People such as Wang (2000) point out, the carbohydrate that N/A-Inv may participate in controlling in the sweet potato cell under the lack of water condition distributes and energy generation (WangHL, Lee PD, Chen WL, Huang DJ, Su JC.2000.Osmotic stress-induced changes of sucrosemetabolism in cultured sweet potato cells.J Exp Bot 51:1991-1999); People such as Fernandes (2004) find, under condition of salt stress, N/A-Inv enzymic activity and the glucose consumption of spending lupine in vain have increased simultaneously, infer the sustainable supply that can ensure ATP and NAD (P) H like this, be to avoid or repair necessary (the Fernandes FM of salt marsh injury, Arrabaca MC, Carbalho LMM.2004.Sucrose metabolism in Lupinusalbus L.under salt stress.Biol Plant 48:317-319); In peach, infer the sugared content of activity in the control fruit of N/A-Inv, and (the Nonis A that plays a significant role in the fruit development, Ruperti B, Falchi R, Casatta E, Enferadi ST, Vizzotto be expression and regulation of aneutral invertase encoding gene from peach (Prunus persica) G.2007.Differential: evidence for a role in fruitdevelopment.Physiologia Plantarum 129:436-446.); Studies show that of people such as Kim (2007), under condition of salt stress, the sucrose degraded product may finally produce amino acid and glycinebetaine by the metabolism network of a complexity, and these materials are to participate in high-efficiency plant Premeabilisation of cells conditioning agent (the Kim JK that environment stress (as lack of water or cold coercing) is replied, Bamba T, Harada K, Fukusaki E, Kobayashi be profiling in Arabidopsis thaliana cell cultures after salt stress treatment.J.Exp.Bot.58:415-424 A.2007.Time-coursemetabolic); Discovering of people such as Vargas (2007), by the degraded of the catalytic sucrose of N/A-Inv may be that plant is to satisfy high energy demand and synthetic compound early response (the Vargas WA with reply a kind of ubiquity acknowledgement mechanism that poor environment was produced, Pontis HG, Salerno be expression of alkalineand neutral invertases in response to environmental stresses:characterization of an alkalineisoform as a stress-response enzyme in wheat leaves.Planta 226:1535-1545 G.2007.Differential).

Natural rubber (cis-1,4-polyisoprene, rubber hydrocarbon) is a kind of important industrial raw material and indispensable military project raw material, plays an important role in development of world economy.At present, Para rubber tree is the main source of natural rubber.The rubber biosynthesizing is to carry out in the cell (latex dust) in a kind of specialization, and is its main metabolic activity in cells, and rubber hydrocarbon accounts for more than 90% of its tenuigenin (latex) dry weight.(Tupy is of 2 J.1969.Stimulatoryeffects for people such as Tupy J, 4-dichlorophenoxyacetic acid and of 1-naphthylacetic acid on sucrose level, invertase activity and sucrose utilization in the latex of Hevea brasiliensis.Planta (Berl.) 88:144-153; Tupy is regulation of invertase activity in the latex of Heveabrasiliensis Muell.Arg:the effects of growth regulators bark wounding J.1973.The, and latex tapping.J.Exp.Bot.24:516-524; Tupy J.﹠amp; Primot is of carbohydrate metabolism byethylene in latex vessels of Hevea brasiliensis Muel.Arg.In relation to rubber production.Biologia Plantarum 18 L.1976.Control, 373-384; Tupy is aspects of sucrose transport andutilization in latex producing bark of Hevea brasiliensis (M ü ll.Arg.) .Biologia Plantarum 27 J.1985.Some, 51-64; Tupy is supply and utilization for latex production.In Physiology ofRubber Tree Latex (eds J.d ' Auzac, J.L.Jacob ﹠amp J.1989.Sucrose; H.Chrestin), pp.179-199.C.R.C.Press, Boca Raton, FL.) physiological and biochemical research for many years confirms: invertase is the metabolic rate-limiting enzyme of latex of panama rubber tree; This enzyme is positioned tenuigenin, and the suitableeest enzyme pH value alive is 7.25 ~ 7.40, belongs to neutrality/alkaline invertase; This enzymic activity is subjected to rubber output stimulant, and as ethrel and 2,4-D stimulates rise, is the key enzyme of decision latex (rubber) output.But, do not see any relevant report about rubber latex invertase gene clone and research.

Summary of the invention

The purpose of this invention is to provide a kind of invertase and encoding gene thereof and application.

Invertase provided by the present invention derives from the Para rubber tree (Heveabrasiliensis) of Euphorbiaceae genus hevea, and name is called HbNIN2, is following (a) or protein (b):

(a) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1.

(b) with the aminoacid sequence of sequence 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have the invertase function by sequence 1 deutero-protein.

Sequence 1 in the sequence table is made up of 557 amino-acid residues.

The replacement of described one or number several amino acid residues and/or disappearance and/or interpolation are meant replacement and/or disappearance and/or the interpolation that is no more than 10 amino-acid residues.

In order to make the HbNIN2 in (a) be convenient to purifying, proteinic N-terminal or C-terminal that can the aminoacid sequence shown in the sequence 1 is formed in by sequence table connect label as shown in table 1.

The sequence of table 1 label

Label	Residue	Sequence
			??Poly-Arg	5-6 (being generally 5)	??RRRRR

Label	Residue	Sequence
			??Poly-His	2-10 (being generally 6)	??HHHHHH
??FLAG	??8	??DYKDDDDK
			??Strep-tag?II	??8	??WSHPQFEK
??c-myc	??10	??EQKLISEEDL

Above-mentioned (b) but in the HbNIN2 synthetic, also can synthesize its encoding gene earlier, carry out biology again and express and to obtain.The encoding gene of HbNIN2 in above-mentioned (b) can be by the codon with one or several amino-acid residue of disappearance in the dna sequence dna shown in the sequence in the sequence table 2, and/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

The encoding gene of described invertase (HbNIN2) also belongs to protection scope of the present invention.

The encoding gene of described invertase (HbNIN2) is following 1) or 2) or 3) dna molecular:

1) dna molecular shown in the sequence 2 in the sequence table;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of the described invertase of encoding;

3) with sequence table in SEQ ID №: 2 nucleotide sequence has homology and the nucleotide sequence that proteins encoded has the invertase function more than 80%.

Sequence 2 in the sequence table is made up of 2146 Nucleotide.

Described stringent condition can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, under 65 ℃, hybridize and wash film.

The recombinant expression vector, expression cassette, transgenic cell line or the reorganization bacterium that contain described sucrose inversion enzyme coding gene all belong to protection scope of the present invention.

HbNIN2 of the present invention has sucrase activity, changes in plant or the microorganism, can improve it to the sucrose utilising efficiency, thereby improves output.

Description of drawings

Fig. 1 is the phylogenetic analysis of HbNIN2. willow (Populus trichocarpa) invertase PtVIN1, PtVIN2, PtVIN3, PtCIN3, PtCIN4, PtNIN9, the details of PtNIN10 and PtNIN12 are seen and are delivered document (Bocock PN, Morse AM, Dervinis C and Davis JM.2008.Evolution and diversity ofinvertase genes in Populus trichocarpa.Planta 227 (3): 565-76.)

Fig. 2 is the prokaryotic expression analysis of HbNIN2. band shown in the arrow is to be subjected to IPTG to induce the target protein of the back specifically expressing that is produced

Fig. 3 is the tissue specific expression analysis of HbNIN2 gene

Fig. 4 is the influence of rubber tapping to HbNIN2 genetic expression

Fig. 5 is the influence of dormin processing to HbNIN2 genetic expression

Fig. 6 is the influence of Whitfield's ointment processing to HbNIN2 genetic expression

Fig. 7 is the influence of ethrel processing to HbNIN2 genetic expression

Embodiment

Method described in the following embodiment if no special instructions, is ordinary method.

The acquisition of embodiment 1, invertase and encoding gene thereof and compliance test result thereof

We have cloned the full-length cDNA of latex of panama rubber tree invertase gene first, and have carried out sequential analysis and functional study.

1. the acquisition of invertase and encoding gene thereof

At the latex of panama rubber tree est sequence database that we set up, find the EST fragment of invertase gene, further utilize the rapid amplifying technology (RACE) of cDNA end, the final cDNA sequence that obtains to comprise complete reading frame.Concrete grammar is as follows:

＜1〉conservative fragments obtains

By searching for the good latex of panama rubber tree est sequence database of note that we set up, find the EST fragment of one section 800bp invertase gene up and down.According to the Genetyx software analysis, this EST fragment has comprised 3 ' complete end sequence, and 5 ' end sequence is still incomplete.

＜2〉5 ' end RACE

According to the EST fragment design 5 ' RACE primer (first round: 5 ' CCTTGCCTGTTTACCGAT3 ' of invertase gene; Second takes turns: 5 ' CTCCTCCCAGCGAGATTC3 '), universal primer QT, the sequence of Q0 and Q1 and RACE operating process reference literature (Dieffenbacher CW, moral Vicks VapoRub rein in GS.PCR technology experiment guide. and Huang Peitang translates. Beijing: Science Press, 1998:268 ~ 277).When carrying out 5 ' RACE, carry out cDNA first chain with Random primer reverse transcription and synthesize, reaction product utilizes terminal enzyme (DNA) TdT catalysis to add the polyA tail after ethanol sedimentation is removed unnecessary dNTP and primer.First round amplification is ground 7-33-97 with the Para rubber tree heat of tailing, and (Rubber Institute, Chinese Academy of Agricultural Science cultivates, Rubber Institute, Chinese Academy of Agricultural Science has seedling to sell for a long time) the first chain cDNA is template, use primer QT, Q0 and first round primer (5 '-CCTTGCCTGTTTACCGAT-3 '), final concentration is respectively 0.04 μ mol/L, 0.4 μ mol/L and 0.4 μ mol/L, carries out pcr amplification in 25 μ l reaction systems.Amplification program is: at first, 94 ℃ of sex change 5min, 50 ℃ of annealing 2min, 72 ℃ are extended 40min; Then, 94 ℃ of sex change 1min, 54 ℃ of annealing 1min, 72 ℃ are extended 1min, totally 30 circulations; At last, 72 ℃ are extended 10min.After 100 times of the PCR product dilutions, get 1 μ l cut back as template, the Q1 and second that uses final concentration to be 0.4 μ mol/L takes turns primer (5 '-CTCCTCCCAGCGAGATTC-3 ') and carries out second and take turns nested amplification, and the pcr amplification program is: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, 56 ℃ of annealing 1min, 72 ℃ are extended 1min, totally 30 circulations; 72 ℃ are extended 10min.Obtain the nucleotide fragments about two sections section 1400bp and 800bp.

According to the sequencing result analysis, having only 800bp size nucleotide fragments is the RACE amplification.But spliced sequence finds that after the BLAST of NCBI instrument carries out the homology comparison 5 ' end length is not enough, promptly designs the RACE primer (first round: AGTCAATATAAGCCTCATCC again between this 800bp sequence; Second takes turns: ACTTGGTATATGCACGCAGC) be PCR once more, amplification program is with 5 ' RACE.RACE obtains the nucleotide fragments about one section 850bp for the second time.

＜4〉HbNIN2 cDNA full-length clone

According to the cDNA part fragment of above-mentioned resulting Para rubber tree HbNIN2 gene, 5 ' end and 3 ' terminal sequence utilizes SECentral software to carry out sequence assembly, obtains the splicing sequence of HbNIN2 full length gene cDNA.According to the splicing sequence, respectively design a primer (2-1F (positive-sense strand primer): 5 '-ATTCATCGTCTCTTCGCCG-3 ' at 5 ' end and 3 ' end respectively; 2-2146R (antisense strand primer) 5 '-GTCCTTGGCGATGAAGATAA-3 ').The first chain cDNA that grinds 7-33-97 with Para rubber tree heat is a template, uses Taq plus polymerase to carry out pcr amplification, and the primer final concentration is 0.4 μ mol/L, and amplification program is: 94 ℃ of pre-sex change 3min; 94 ℃ of sex change 1min, 58 ℃ of annealing 1min, 72 ℃ are extended 2.5min, totally 30 circulations; 72 ℃ are extended 10min.The fragment cloning that this PCR is obtained checks order to the pMD18-T carrier, shows that through order-checking obtaining clip size is the cDNA full length sequence of 2146bp.The fragment of this acquisition is invertase gene HbNIN2 gene of the present invention, this fragment has the nucleotide sequence of sequence 1 in the sequence table, sequence 1 total length is 2146 Nucleotide (nt) in the sequence table, open reading frame (the ORF that to comprise a length be 1674 Nucleotide, from 5 of sequence 2 ' end 179-1852 position nucleotide sequence), 3 '-UTR (from 5 of sequence 2 ' end 1853-2146 position nucleotide sequence) of 5 ' of 178nt-UTR (from 5 of sequence 2 ' end 1-178 position nucleotide sequence) and 294nt, infer that length of coding is 557 amino acid (sequence 1 in the sequence table), molecular weight is the albumen of 63.6KDa, be invertase HbNIN2, with this invertase gene called after HbNIN2.With the above-mentioned pMD18-T recombinant vectors called after pMD18-HbNIN2 that contains the Nucleotide of sequence 2.

We select 8 (Bocock PN respectively from willow and Arabidopis thaliana, Morse AM, Dervinis C and DavisJM.2008.Evolution and diversity of invertase genes in Populus trichocarpa.Planta 227 (3): 565-76.) and the sucrose inversion enzyme amino acid sequence of 6 different classes of (acid and in/alkalescence), and two cyanobacterias (Anabaena sp.) (Vargas W, Cumino A, Salerno GL.2003.Cyanobacterialalkaline/neutral invertases.Origin of sucrose hydrolysis in the plant cytosol? Planta 216:951-960) sucrose inversion enzyme amino acid sequence is analyzed the phyletic evolution status of HbNIN2 as template.It is right to utilize Clustal X (version 1.81) software that these 17 invertase protein sequences are carried out multiple ratio, and uses TreeView[Win32] (version 1.6.6) constructing system evolutionary tree (Fig. 1).Can know on scheme and find out that these invertases can be divided into two clade, neutrality/alkaline invertase belongs to a clade, and acid (cell walls and vacuole) invertase forms the another one clade.HbNIN2 and plant neutrality/alkaline invertase is got together, and confirms that further it is a neutrality/alkaline invertase.Utilize different online software (Predotar, Target P and PSORT) analyzed the Subcellular Localization of this hevea brasiliensis invertase, the result shows that it may be positioned at cytosol, and promptly in the c-whey of latex, this shows that it is the encoding gene of the main invertase of latex metabolism.Table 2 is the prediction of HbNIN 2 Subcellular Localization.Simultaneously, comparative analysis two known plant invertases of cellular localization: the OsNIN1 (being positioned in the plastosome) of CINV1 of Arabidopis thaliana (being positioned in the cytosol) and paddy rice.

The prediction of table 2.HbNIN 2 Subcellular Localization

2. the activation analysis of prokaryotic expression and recombinant protein

Utilize pET28a (open a folding etc. use the research of pET system expression rhIFN-α 2b gene. the Chinese biological goods are learned magazine .2003. the 03rd phase) made up HbNIN2 Prokaryotic Expression carrier, concrete grammar is as follows:

＜1〉contains the acquisition of Para rubber tree HbNIN2 gene coding region recombinant vectors

By the coding region restriction enzyme digestion sites of Genetyx software analysis HbNIN2 gene, determine the restriction enzyme (NdeI and SalI) of two HbNIN2 gene coding regions modification usefulness.Design HbNIN2 gene coding region primer (2-N:5 '-C CATATGATGGATGGGACTAAAGAGG-3 ' (positive-sense strand primer, what underscore marked is the NdeI restriction enzyme site)), 2-S:5 '-C GTCGACTTAGCAAGTCCAAGAAGAA-3 ' (antisense strand primer, what underscore marked is the SalI restriction enzyme site); This primer has sequence in the sequence table to the fragment of amplification), be template with pMD18-HbNIN2, carry out pcr amplification, amplification program is: 95 ℃ of pre-sex change 3min; 94 ℃ of sex change 1min, 58 ℃ of annealing 1min, 72 ℃ are extended 2min, totally 30 circulations; 72 ℃ are extended 10min.

Amplification obtains the product of 1674bp, and order-checking shows that this fragment has the 179-1852 position nucleotide sequence of sequence 2 in the sequence table.This fragment used with pMD18-T be connected, obtain the pMD-HbNIN2 recombinant plasmid, confirm the exactness of extension increasing sequence through order-checking.In 37 ℃ of water-baths, with NdeI and the two recombinant plasmids of cutting of SalI, electrophoresis reclaims the purpose band about 1680bp.This purpose fragment is inserted between the NdeI and SalI restriction endonuclease sites of pET28a plasmid, obtain recombinant vectors, recombinant vectors is carried out the enzyme evaluation of cutting and check order, evaluation is shown the recombinant vectors called after pET28a-HbNIN2 of the correct 179-1852 position nucleotide sequence that contains sequence 2 in the ordered list.

＜2〉expression of invertase of the present invention and its functional verification

Among the recombinant vectors pET28a-HbNIN2 importing E.coli BL21 (DE3) with acquisition (Lu Hai etc. the research of express recombinant protein in the e. coli bl21 (DE3). the 23rd the 6th phase of volume of the journal .2001 of Beijing Forestry University), obtain recombinant expressed bacterium, to identify that correct reorganization bacterium is cultured to OD600=0.4～0.6 in the LB substratum that contains 50 μ g/mL kantlex, add IPTG to final concentration be 1mM, 37 ℃ of following inducing culture 4h or 6h, same reorganization bacterium with the culture medium culturing that do not add IPTG is contrast, centrifugal collection thalline, tropina carries out the 12%SDS-PAGE electrophoresis detection.The result shows that this gene of HbNIN2 has been realized efficient heterogenous expression under IPTG induces, and the apparent molecular weight of expressing protein is close with theoretical molecular, approximately 64kDa (Fig. 2).

(concrete grammar is with reference to the TALON of Clontech company behind ni-sepharose purification for protein expressioning product

The resin product description), use ¹⁴C-mark sucrose carries out the sucrase activity analysis, concrete grammar reference (Vargas WA, Pontis HG, Salerno be expression of alkaline and neutral invertases inresponse to environmental stresses:characterization of an alkaline isoform as astress-response enzyme in wheat leaves.Planta 226:1535-1545 G.2007.Differential) carry out:

Get 5 μ l ¹⁴(than vigor is 5 * 10 to the sucrose of C mark (specific activity 0.2 μ Ci/ μ l) ⁶Cpm/ μ mol), adding final concentration is the potassium phosphate buffer (pH7.5) of 200mM, adds 2 μ g again through containing of ni-sepharose purification of histidine-tagged invertase recombinant protein, and cumulative volume is 50 μ l reaction systems.After reacting different time (0min, 10min, 30min, 60min) under 30 ℃ of water bath condition, 100 ℃ of 2min termination reactions.Reaction product is through mixed bed ion exchange post desalination, and different sugars separates and evaluation through chromatography, and measures with liquid scintillation instrument ¹⁴The flicker value (cpm) of the different sugars of C mark (sucrose, glucose and fructose).

In in the reaction system of pH7.5, behind the processing 10min, just can significantly detect sucrose degraded product glucose and fructose; And, with the prolongation of the time of processing, ¹⁴The amount of C-sucrose constantly reduces, and ¹⁴C-glucose and ¹⁴The amount of C-fructose constantly increases, and shows that expressed recombinant protein has tangible sucrose degrading activity, so the functional invertase of this HbNIN2 genes encoding that we cloned.

3. expression study

＜1〉checking is expressed by the function of organization of HbNIN2 gene

With Para rubber tree heat grind 7-33-97 blade, bark and latex RNA at random the cDNA of reverse transcription be template, carry out real-time fluorescence quantitative PCR with the HbNIN1 gene specific primer, according to each self-corresponding Qr value (Qr=E ^{Ct (18S-rRNA)-Ct (HbNIN1)}, E-constant 10; The cycle number that fluorescent signal in each reaction tubes of Ct-is experienced when arriving the thresholding of setting) size multiply by identical multiple simultaneously, promptly obtains relative expression's abundance of different treatment.The result shows: HbNIN2 mainly expresses (Fig. 3) in latex, blade compare with the expression abundance in the bark will be low many, show that it has tangible tissue expression specificity, and may be the encoding gene of latex regeneration invertase.

＜2〉rubber tapping influences the HbNIN2 expression of gene

Rubber tapping can stimulate latex production, and to cut in the rubber tree this effect more obvious not opening.It is low not open the latex dust metabolic activity that cuts in the tree stem portion bark, and along with the increase of rubber tapping number of times, latex dust sucrose absorbs and quickens, and metabolic activity strengthens, and final latex output has also increased.Not opening this specific character of cutting tree makes it become the ideal material identifying and study the latex regeneration associated genes.

With do not open cut latex RNA that Para rubber tree heat grinds different cuttves of 7-33-97 time at random the cDNA of reverse transcription be template, with HbNIN2 gene specific primer (rINV2-F2:GAAGAGAGGCAAACAAACAAG (positive-sense strand primer, the 1845-1874 position Nucleotide of sequence 2 in the corresponding sequence table), rINV2-R2:CGAAAGCAAACATTTCTCACTTTAC (antisense strand primer, the 1921-1945 position Nucleotide of sequence 2 in the corresponding sequence table)) carry out real-time fluorescence quantitative PCR, the same step of interpretation of result＜1 〉.The result as shown in Figure 4, the result shows that rubber tapping influences the HbNIN2 expression of gene---induce the expression of HbNIN2.

＜3〉hormone influences the HbNIN2 expression of gene

There is research to think, the genetic expression and the enzymatic activity of the adjustable invertase of some plant hormones, and this regulation and control may be brought into play central role (Tymowska-Lalanne Z.andKreis is plant invertases:physiology M.1998.The, biochemistry and molecular biology.Adv.Bot.Res.28:71-117) in some hormone regulating and controlling growth and development of plants.In rubber tree produced, using ethrel (ethene sustained release dosage) on secant or face can stimulate latex output, has become the indispensable integral part of modern tapping system.

Six kind of plant hormone (or growth regulators are chosen in this research, ethrel, dormin, Whitfield's ointment, phytokinin, Plant hormones regulators,gibberellins and jasmonic), be applied to 1cm face place, rubber tree secant and secant top respectively and stimulate rubber tree (0h, 2h, 12h contain 24h individually).Real-time fluorescence quantitative PCR result demonstration (the same step of interpretation of result＜1 〉): in the six kind of plant hormones of being measured (or growth regulator), the HbNIN2 expression of gene significantly is subjected to dormin (ABA) and Whitfield's ointment (SA) to induce (Fig. 5,6); Simultaneously ethrel (ET) also has inducing action (Fig. 7) to the HbNIN2 expression of gene, but not as ABA and SA remarkable.In addition, other several hormones such as phytokinin (CTK), Plant hormones regulators,gibberellins (GA) and jasmonic (JA) do not have obvious influence to this hevea brasiliensis invertase gene.

4. conclusion

We have cloned the full-length cDNA of latex of panama rubber tree invertase gene first, and it is typical neutrality/alkaline invertase gene, and may be exactly the encoding gene that latex sucrose utilizes key enzyme; Gene expression analysis shows tentatively that also it may be the invertase gene of decision latex dust sucrose utilising efficiency.

This gene can be used as the important target gene of rubber tree transgenic breeding, be expected to rationally regulate the sucrose utilization and the assimilation carbon partition ratio of latex dust by regulating and control this expression of gene, and then coordinate nourishing and growing and rubber production of rubber tree, thereby the excavation rubber tree production potential of maximum potential.In addition, this gene can be used as the important function of gene resource, also may be applied in the high yield of other plant beyond the rubber tree or microorganism or adversity gene engineering.

Sequence table

<160>2

 

<210>1

<211>557

<212>PRT

＜213〉Hevea rubber (Hevea brasiliensis)

 

<400>1

Met?Asp?Gly?Thr?Lys?Glu?Val?Gly?Leu?Arg?Asn?Val?Ser?Ser?Thr?Cys

1???????????????5???????????????????10??????????????????15

Ser?Ile?Ser?Glu?Met?Asp?Asp?Phe?Asp?Leu?Ser?Arg?Leu?Leu?Asp?Lys

20??????????????????25??????????????????30

Pro?Arg?Leu?Asn?Ile?Glu?Arg?Gln?Arg?Ser?Phe?Asp?Glu?Arg?Ser?Leu

35??????????????????40??????????????????45

Ser?Glu?Leu?Ser?Ile?Gly?Leu?Thr?Arg?Gly?Gly?Leu?Asp?Tyr?Cys?Glu

50??????????????????55??????????????????60

Ile?Thr?Tyr?Ser?Pro?Gly?Gly?Arg?Ser?Gly?Leu?Asp?Thr?Pro?Val?Ser

65??????????????????70??????????????????75??????????????????80

Ser?Ala?Arg?Asn?Ser?Phe?Glu?Pro?His?Pro?Met?Val?Ala?Asp?Ala?Trp

85??????????????????90??????????????????95

Glu?Ala?Leu?Arg?Arg?Ser?Ile?Val?Tyr?Phe?Arg?Gly?Gln?Pro?Val?Gly

100?????????????????105?????????????????110

Thr?Ile?Ala?Ala?Ile?Asp?His?Ala?Ser?Glu?Glu?Val?Leu?Asn?Tyr?Asp

115?????????????????120?????????????????125

Gln?Val?Phe?Val?Arg?Asp?Phe?Val?Pro?Ser?Ala?Leu?Ala?Phe?Leu?Met

130?????????????????135?????????????????140

Asn?Gly?Glu?Pro?Glu?Ile?Val?Lys?Asn?Phe?Leu?Leu?Lys?Thr?Leu?His

145?????????????????150?????????????????155?????????????????160

Leu?Gln?Gly?Trp?Glu?Lys?Arg?Ile?Asp?Arg?Phe?Lys?Leu?Gly?Glu?Gly

165?????????????????170?????????????????175

Val?Met?Pro?Ala?Ser?Phe?Lys?Val?Leu?His?Asp?Pro?Val?Arg?Lys?Thr

180?????????????????185?????????????????190

Asp?Thr?Leu?Met?Ala?Asp?Phe?Gly?Glu?Ser?Ala?Ile?Gly?Arg?Val?Ala

195?????????????????200?????????????????205

Pro?Val?Asp?Ser?Gly?Phe?Trp?Trp?Ile?Ile?Leu?Leu?Arg?Ala?Tyr?Thr

210?????????????????215?????????????????220

Lys?Ser?Thr?Gly?Asp?Leu?Ser?Leu?Ala?Glu?Thr?Pro?Glu?Cys?Gln?Lys

225?????????????????230?????????????????235?????????????????240

Gly?Met?Arg?Leu?Ile?Leu?Thr?Leu?Cys?Leu?Ser?Glu?Gly?Phe?Asp?Thr

245?????????????????250?????????????????255

Phe?Pro?Thr?Leu?Leu?Cys?Ala?Asp?Gly?Cys?Ser?Met?Ile?Asp?Arg?Arg

260?????????????????265?????????????????270

Met?Gly?Ile?Tyr?Gly?Tyr?Pro?Ile?Glu?Ile?Gln?Ala?Leu?Phe?Phe?Met

275?????????????????280?????????????????285

Ala?Leu?Arg?Cys?Ala?Leu?Ser?Met?Leu?Lys?His?Asp?Thr?Glu?Gly?Lys

290?????????????????295?????????????????300

Glu?Cys?Ile?Glu?Arg?Ile?Val?Lys?Arg?Leu?His?Ala?Leu?Ser?Tyr?His

305?????????????????310?????????????????315?????????????????320

Ile?Arg?Ser?Tyr?Phe?Trp?Leu?Asp?Phe?Gln?Gln?Leu?Asn?Asp?Ile?Tyr

325?????????????????330?????????????????335

Arg?Tyr?Lys?Thr?Glu?Glu?Tyr?Ser?His?Thr?Ala?Val?Asn?Lys?Phe?Asn

340?????????????????345?????????????????350

Val?Ile?Pro?Asp?Ser?Ile?Pro?Asp?Trp?Val?Phe?Asp?Phe?Met?Pro?Thr

355?????????????????360?????????????????365

Arg?Gly?Gly?Tyr?Phe?Ile?Gly?Asn?Ile?Ser?Pro?Ala?Arg?Met?Asp?Phe

370?????????????????375?????????????????380

Arg?Trp?Phe?Ala?Leu?Gly?Asn?Cys?Val?Ala?Ile?Leu?Ser?Ser?Leu?Ala

385?????????????????390?????????????????395?????????????????400

Thr?Pro?Glu?Gln?Ser?Met?Ala?Ile?Met?Asp?Leu?Ile?Glu?Ser?Arg?Trp

405?????????????????410?????????????????415

Glu?Glu?Leu?Val?Gly?Glu?Met?Pro?Leu?Lys?Ile?Ala?Tyr?Pro?Ala?Ile

420?????????????????425?????????????????430

Glu?Ser?His?Asp?Trp?Arg?Ile?Val?Thr?Gly?Cys?Asp?Pro?Lys?Asn?Thr

435?????????????????440?????????????????445

Arg?Trp?Ser?Tyr?His?Asn?Gly?Gly?Ser?Trp?Pro?Val?Leu?Leu?Trp?Leu

450?????????????????455?????????????????460

Leu?Thr?Ala?Ala?Cys?Ile?Lys?Thr?Gly?Arg?Pro?Gln?Ile?Ala?Arg?Arg

465?????????????????470?????????????????475?????????????????480

Ala?Ile?Asp?Leu?Ala?Glu?Thr?Arg?Leu?Leu?Lys?Asp?Ser?Trp?Pro?Glu

485?????????????????490?????????????????495

Tyr?Tyr?Asp?Gly?Lys?Leu?Gly?Lys?Phe?Ile?Gly?Lys?Gln?Ala?Arg?Lys

500?????????????????505?????????????????510

Tyr?Gln?Thr?Trp?Ser?Ile?Ala?Gly?Tyr?Leu?Val?Ala?Lys?Met?Met?Leu

515?????????????????520?????????????????525

Glu?Asp?Pro?Ser?His?Leu?Gly?Met?Ile?Ser?Leu?Glu?Glu?Asp?Lys?Gln

530?????????????????535?????????????????540

Met?Lys?Pro?Val?Ile?Lys?Arg?Ser?Ser?Ser?Trp?Thr?Cys

545?????????????????550?????????????????555

 

<210>2

<211>2146

<212>DNA

＜213〉Hevea rubber (Hevea brasiliensis)

 

<400>2

attcatcgtc?tcttcgccga?ccatacaccg?gcgaaatcgc?tctttggttc?ccgccagggg??????60

cgctctttct?cctcgccatt?tttatgctct?gcaaagcatc?cttaaagctg?gacatcttct?????120

cattggtgat?agaaccaagt?agttggtgca?attttcaagg?atagaaagat?ataaacatat?????180

ggatgggact?aaagaggtgg?gacttaggaa?tgtgagctca?acatgttcaa?tctctgaaat?????240

ggacgatttt?gatctctctc?gcctactgga?caagccgagg?ctgaacattg?agaggcagag?????300

atcatttgat?gagaggtcac?tcagtgagct?ctcaattggg?ctcaccagag?gcggtcttga?????360

ttactgtgag?atcacttatt?cccctggagg?caggtcagga?ttagacacgc?cagtctcatc?????420

agctcgcaac?tcttttgagc?cacacccaat?ggtggctgat?gcctgggaag?cactaagacg?????480

gtccatagtg?tacttcagag?gccaaccggt?tggcacaatt?gctgcaattg?accatgcctc?????540

agaggaggtt?ttgaactatg?atcaggtttt?tgttcgagat?tttgtgccta?gtgccctggc?????600

ttttctgatg?aatggtgagc?ctgagatagt?taagaacttc?cttttgaaga?cactacatct?????660

tcaagggtgg?gaaaagagaa?tagatagatt?caagctcggg?gaaggggtaa?tgccagctag?????720

ctttaaagtt?cttcacgatc?ctgttcggaa?aacagatact?cttatggcag?attttggtga?????780

gagtgcaatt?ggaagagtgg?ctcctgttga?ctctggtttc?tggtggatca?ttctgctgcg?????840

tgcatatacc?aagtctactg?gagatttgtc?tctggcagag?actccagagt?gtcaaaaggg?????900

gatgaggctt?atattgactc?tgtgcttgtc?agaggggttt?gatacattcc?caacccttct?????960

ttgtgctgat?ggatgctcta?tgattgatcg?cagaatgggc?atttacggtt?atcctattga????1020

aattcaagca?ctttttttta?tggcattaag?gtgtgccttg?tcaatgttga?aacatgatac????1080

agaaggaaaa?gaatgtattg?agagaattgt?gaaacgtttg?catgctttga?gctatcacat????1140

tcgaagttac?ttctggttag?actttcaaca?actaaatgat?atatacagat?ataaaactga????1200

ggagtactca?cacactgcag?taaataagtt?caatgttatt?cctgattcaa?tcccagattg????1260

ggtatttgat?tttatgccta?cacgtggtgg?ctattttatc?ggcaatatta?gtcctgcaag????1320

gatggacttt?cgatggtttg?ctttaggtaa?ttgtgttgcc?attctctcgt?ctcttgcaac????1380

tccggagcaa?tcaatggcta?tcatggatct?tatagaatct?cgctgggagg?agctggttgg????1440

agaaatgcct?ttgaaaatag?cttatcctgc?aatagaaagc?catgactggc?gaatagtaac????1500

tggttgtgat?cccaagaaca?cgagatggag?ttatcataat?ggaggatctt?ggccagtgct????1560

tttatggctg?ctaactgctg?catgcatcaa?aactggacga?ccgcaaattg?caagacgtgc????1620

aattgatctt?gctgagaccc?gtctgctgaa?agatagctgg?cctgaatatt?acgatgggaa????1680

acttgggaaa?tttatcggta?aacaggcaag?gaaataccag?acgtggtcga?ttgctgggta????1740

cttggtggca?aagatgatgc?tggaggatcc?ttcacatttg?ggaatgattt?ccctggaaga????1800

ggacaaacaa?atgaagccag?tgattaagag?atcttcttct?tggacttgct?gatgaagaga????1860

ggcaaacaaa?caagcaagca?agcaggataa?gtagcagaaa?aaatagtagg?aaaagaaaac????1920

gtaaagtgag?aaatgtttgg?tttcgttata?cagcattatt?ctttgccgtt?tgttgttgta????1980

ggtctgattt?gaaagtgtgg?ttgtgtacaa?tagcttctgc?taagaactac?tgtcttgctt????2040

ttcaaataag?agaaacattt?gaatggcaat?ttggaaatgc?catccttagt?ttatgttagc????2100

ttttgacagc?aaaaatggaa?taagatttat?cttcatcgcc?aaggac???????????????????2146

Claims (9)

1. a protein is following 1) or 2) protein:

1) by the SEQ ID in the sequence table

The protein that 1 amino acid residue sequence is formed;

2) with the SEQ ID in the sequence table 1 amino acid residue sequence through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have the invertase correlation function by SEQ ID №: 1 deutero-protein.

2. protein according to claim 1 is characterized in that: described protein is invertase.

3. claim 1 or 2 described proteinic encoding genes.

4. encoding gene according to claim 3 is characterized in that: the nucleotide sequence of described encoding gene is following 1), 2) or 3):

1) SEQ ID in the sequence table 2 nucleotide sequence;

2) can be with 1 under stringent condition) nucleotide sequence of described dna sequence dna hybridization.

3) with sequence table in SEQ ID

2 nucleotide sequence has a homology more than 80% and proteins encoded has the nucleotide sequence with the invertase function.

5. the recombinant expression vector, transgenic cell line or the transgenosis reorganization bacterium that contain claim 3 or 4 described encoding genes

6. claim 1 or 2 described protein and encoding gene thereof the application in the recombinant microorganism of cultivating the raising of sucrose utilization ratio.

7. application according to claim 6 is characterized in that: described recombinant microorganism is intestinal bacteria.

8. claim 3 or 4 described encoding genes are in the application of the transgenosis rubber seeds of cultivating the output raising.

9. claim 1 or 2 described protein and encoding gene thereof the application in degraded sucrose.

Images