CN101812429B - Mouse cardiac muscle progenitor cell and preparation method thereof - Google Patents

Abstract

The invention discloses a mouse cardiac muscle progenitor cell and a preparation method thereof. The mouse cardiac muscle progenitor cell expresses a cardiac muscle progenitor cell mark ISL1 and a mouse cardiac muscle cell line early stage mark Tbx5. The preparation method comprises the following steps: firstly, separating mouse cardiac muscle cells of embryo culture for 15.5 days; infecting immortalizing plasmids SSR#69 for immortalizing the mouse cardiac muscle cells; obtaining immortalized monoclonal cardiac muscle cells by an antibiotic sieving method and an unlimited dilution method; then, sieving the cardiac muscle cells expressing ISL1 and Tbx5 from the immortalized monoclonal cardiac muscle cells; and obtaining the mouse cardiac muscle progenitor cells. The mouse cardiac muscle progenitor cells are reversible immortalized cells, can realize immortalization, have no risk for causing tumor and causing virus infection, belong to ideal tools for researching the influence on the multiplication and differentiation factors of the cardiac muscle progenitor cells under the condition of damaged adult muscle progenitor cells. The invention has good application prospects.

Description

Mouse cardiac muscle progenitor cell and preparation method thereof

Technical field

The present invention relates to a kind of progenitor cell, particularly a kind of mouse cardiac muscle progenitor cell (cardiac progenitor cell, CP), also relate to the preparation method of this cardiac muscle progenitor cell.

Background technology

It is one of great difficult problem of current medical science to reduce mortality ratio that heart disease is carried out to effectively treatment.Myocardial Regeneration is limited in one's ability, once sustain damage, functional myocardial cell's death or apoptosis will inevitably occur, affects the normal function of heart, finally causes chronic heart failure (chronic heart failure, CHF).Use the conventional medicament therapy to comprise receptor blocking agent, Zinc metallopeptidase Zace1 (ACE) inhibitor, aldosterone antagonist and diuretic(s) etc.; although can protect to a certain extent cardiac muscle; delay the process of heart disease; but can't make functional myocardial cell's regeneration; be difficult to fundamentally reverse the development process of CHF; after heart stalk, the mortality ratio of heart failure patient is still between 8～10%, then admission rate is between 6～8%.And cardiac transplantation is also limited because of donor, the reason such as immunological rejection, be difficult to large-scale promotion clinically in addition.

What allow now cardiologist and heart failure patient see dawn is the relevant research that utilizes Transplanted cells Regeneration and Repair damaged myocardium of rising in recent years, it has tempting prospect in theory, and its feasibility and effect are also confirmed by some experimentation on animals.Nearly more than ten years, Chinese scholars was being done a large amount of research work aspect the seed cell of screening Transplanted cells, filters out two class seed cells: become somatocyte and stem cell.But find simultaneously, with the Effects of Stem Cell Transplantation on Myocardial Infarction Patients of marrow and embryonic origin, remain in deficiency, after injection transplantation stem cell in direct cardiac muscle, owing to transplanting complicated component, under the inducing of myocardium microenvironment, stem cell still shows the polytropism of the differentiation such as Cardiocytes and tumour cell, and bring thus a series of complication of transplant, as micro-infarct, irregular pulse, calcification and tumour etc., its reason may be that myocardium microenvironment and the myocardium microenvironment in embryo development procedure after myocardial damage and the regulatory gene of being correlated with are not quite similar, the stem cell of these virgin states can not be by normal regulation in the microenvironment of Mature myocardium damage, and, after intravascular transplanting stem cell, by the phenomenon of going back to the nest of cell, find to only have the cell of only a few to rest on heart, to heart function, improve very micro-.Therefore, we need to mobilize the cardiac muscle progenitor cell that heart itself exists to carry out compensatory damaged myocardium function.But how could effectively mobilize? what is the mechanism of its mobilization? in order to address this problem, and finally realize in laboratory animal and application clinically, at first we must obtain these cardiac muscle progenitor cells, study its characteristic, then the further factor of its propagation of analyzing influence and differentiation.

Summary of the invention

In view of this, one of purpose of the present invention is to provide a kind of mouse cardiac muscle progenitor cell that derives from heart tissue, and for research affects, cardiac muscle progenitor cell is bred under the adult cardiomyocytes damage situations and the factor of breaking up provides desirable instrument; Two of purpose is to provide the preparation method of described mouse cardiac muscle progenitor cell.

For achieving the above object, the present invention adopts following technical scheme:

1, mouse cardiac muscle progenitor cell, it expresses cardiac muscle progenitor cell mark ISL1 and the myocardial cell is early sign thing Tbx5.

Further, also to express the myocardial cell be early sign thing Nkx2.5 to described cardiac muscle progenitor cell;

Further, described cardiac muscle progenitor cell is also expressed stem cell markers Oct3/4, Nanog and Sox2;

Further, described cardiac muscle progenitor cell is also expressed cardiac muscle progenitor cell mark Sca-1 and c-kit;

Further, described cardiac muscle progenitor cell express alpha-MyHC after inducing differentiation;

Further, described cardiac muscle progenitor cell is in inducing atomization, cardiac muscle progenitor cell mark ISL1 and myocardial cell are that early sign thing Nkx2.5 and Tbx5 expression are on a declining curve, myocardial cell's structural protein mark α-MyHC, α-actin and cTnT express in rising trend, and skeletal muscle mark MyoD and unstriated muscle mark SM-MHC do not express;

Further, described cardiac muscle progenitor cell is the Reversible immortalization cell;

Further, described cardiac muscle progenitor cell derives from the embryo heart tissue.

2, the preparation method of described mouse cardiac muscle progenitor cell comprises the following steps:

A, separation and Culture embryo's mouse cardiac myocytes of 15.5 days;

B, by step a gained infection of cardiac myocytes immortalization plasmid SSR#69 and immortalization, by the mono-clonal myocardial cell of antibiotic-screening method and being immortalized of infinite dilution method;

C, filter out from the mono-clonal myocardial cell of step b gained immortalization and express cardiac muscle progenitor cell mark ISL1 and the myocardial cell is the myocardial cell of early sign thing Nkx2.5 and Tbx5, obtain mouse cardiac muscle progenitor cell.

Beneficial effect of the present invention is: mouse has up to 90% homology and both cardiovascular systemss very similar on gene to the people, it is research object that the present invention selects mouse heart and myocardial cell, set up a kind of cardiac muscle progenitor cell that derives from heart tissue, this cardiac muscle progenitor cell is the Reversible immortalization cell, can be returned to the primary cell state before immortalization after knocking out immutalizing gene, thereby make the cell can infinite multiplication, again without tumorigenesis and the danger that causes virus infection, that research affects cardiac muscle progenitor cell breed and break up the ideal tools of factor under the adult cardiomyocytes damage situations, good application prospect is arranged.

The accompanying drawing explanation

In order to make the purpose, technical solutions and advantages of the present invention clearer, below in conjunction with accompanying drawing, the present invention is described in further detail, wherein:

The form that Fig. 1 is Cardiac Cells In Vitro (amplifying 200 times);

The mono-clonal growing state that Fig. 2 is the immortalization myocardial cell (amplifying 300 times);

Fig. 3 is that RT-PCR detects the expression sequential (agarose gel electrophoresis figure) of specific heart gene in the heart development process;

Fig. 4 is that RT-PCR detects the expression sequential (goal gene relative expression quantity statistical graph) of specific heart gene in the heart development process;

Fig. 5 is RT-PCR screening cardiac muscle progenitor cell (agarose gel electrophoresis figure); 1～5,5A and 6～19 is respectively the immortalization myocardial cell and clones CP15-1～5, CP15-5A and CP15-6～19, and H9 is H9C2, and P19 is P19CL6;

Fig. 6 is RT-PCR screening cardiac muscle progenitor cell (goal gene relative expression quantity statistical graph); 1～5,5A and 6～19 is respectively the immortalization myocardial cell and clones CP15-1～5, CP15-5A and CP15-6～19;

Fig. 7 is that all-trans-retinoic acid (ATRA) is induced MyHC-GLuc screening active ingredients cardiac muscle progenitor cell; * mean P<0.05;

Fig. 8 is that RT-PCR and ATRA induce MyHC-GLuc screening active ingredients cardiac muscle progenitor cell (GTG figure);

Fig. 9 is that immunofluorescence detects ISL1 and the expression (amplify 200 times) of c-kit in the two positive colonies of ISL1/Tbx5;

Figure 10 is the expression that Western Blot detects SV40T in cardiac muscle progenitor cell;

Figure 11 is the cardiac muscle progenitor cell growth curve;

Figure 12 is the MyHC-GLuc activity that dexamethasone (Dex) is induced the differentiation cardiac muscle progenitor cell; * mean P<0.05;

The Virus Infection that Figure 13 is cardiac muscle progenitor cell;

Figure 14 is that cardiac muscle progenitor cell infects respectively the luciferase imaging in nude mouse after AdRFP and AdR-cre;

Figure 15 is that cardiac muscle progenitor cell infects respectively the luciferase imaging (average signal strength statistical graph) in nude mouse after AdRFP and AdR-cre;

Figure 16 is that Dex induces cardiac muscle progenitor cell differentiation (amplifying 200 times);

Figure 17 is that real-time quantitative PCR detects the expression that Dex induces the myocardium development related gene of differentiation cardiac muscle progenitor cell;

Figure 18 is that immunofluorescence detects the cTnT expression that Dex induces the differentiation cardiac muscle progenitor cell.

Embodiment

Hereinafter with reference to accompanying drawing, the preferred embodiments of the present invention are described in detail.Should be appreciated that preferred embodiment is only for the present invention is described, rather than in order to limit the scope of the invention.

The main experiment material of using in preferred embodiment:

(1) animal: the healthy CD1 mouse of pregnant 15.5 days and the healthy immune deficiency BALB/c nude mice in 6～8 week age, the SPF level, by Univ Chicago USA's animal center, provided, feed in the sterile laminar flow Animal House of strict sterilization, envrionment temperature maintains 25 ℃, atmospheric moisture is 60%～70%, and feed and water is ad lib after sterilization.

(2) bacterium and cell strain: intestinal bacteria DH10B is purchased from U.S. invitrogen company.Mouse teratocarcinoma cell strain P19CL6 and rat cardiomyocyte strain H9C2 are purchased from U.S. typical case DSMZ (ATCC), and mouse sarcoplast strain C2C12, human embryonic kidney cell's strain HEK293 and human colon cancer cell strain HCT116 are provided by molecular weight tumor research department, Chicago University medical center.

(3) plasmid: immortalization plasmid SSR#69 and plasmid pAmpho are provided by molecular weight tumor research department, Chicago University medical center.The promoter plasmid MyHC-GLuc that carries promoter gene α-MyHC (myoglobulin heavy chain α) and reporter gene GLuc (secretor type luciferase) builds (Gao-Hui Zhu.Differentiation.2009 Jun26.PMID:19560855) by the contriver in previous work, method is as follows: design the fragment of following primer amplification α-the 4th exon upstream 5.5kb of MyHC gene according to the upper α logined of geneseq database (GenBank)-MyHC gene order (accession number is NM_001091601), primer sequence is as follows: F:agg ggatcctgcaaggtcacacaagag (underscore is partly the BamHI restriction enzyme site), R:ccg ctcgaggtcactcaaactcttatgggggag (underscore is partly the XhoI restriction enzyme site), the plasmid that contains α-MyHC gene of take carries out PCR as template, and the PCR reaction conditions is: 96 ℃ of denaturations 45 seconds, then 30 seconds, 70 ℃ of 20 seconds, 55 ℃ annealing of 92 ℃ of sex change extend 45 seconds, and totally 28 circulations, last 70 ℃ are extended 5 minutes, the PCR product is after agarose gel electrophoresis is identified, cut glue and reclaim purifying, carry out double digestion with restriction enzyme BamHI and XhoI, with the plasmid pBGLuc (the molecular weight tumor research department provides by the Chicago University medical center) through same double digestion, under the effect of T4 DNA ligase, be connected again, connect the product electricity and be transformed into the large enterobacteria DH10B of competence, the LB plate screening positive colony that contains kantlex for converted product, by bacterium colony PCR, digestion with restriction enzyme and determined dna sequence are identified positive colony, obtain promoter plasmid MyHC-GLuc.This plasmid and myocyte are broken up to irrelevant control plasmid TOP-Luc transfection C2C12 cell respectively, with the DMEM inducing culture that contains the horse serum that massfraction is 2% or carry out inducing culture with Dex as inductor, by the GLuc reading, find that this plasmid has muscle specific, and its activity can effectively be activated in myocyte's atomization, express alpha-MyHC in cell differentiation procedure, it will start the expression of reporter gene GLuc, therefore can weigh by the expression amount of measuring GLuc in cell culture supernatant the expression of α-MyHC in cell, the dynamic process that furthermore clear-cells breaks up.

(4) adenovirus: the recombinant adenovirus AdRFP that carries red fluorescent protein (RFP) gene is provided by molecular weight tumor research department, Chicago University medical center with the recombinant adenovirus AdR-cre that carries recombinase Cre gene.

(5) reagent: DMEM substratum, trypsinase, microbiotic (penicillin, penbritin, Streptomycin sulphate and Totomycin), RNA extracts reagent Trizol, random six poly-primer Hexamer, the Superscrip reversed transcriptive enzyme, RNA enzyme inhibitors RNasin, SDS-PAGE albumen sample-loading buffer, DNA molecular amount standard, lipofectamine Lipofactamine and Western Blot related reagent are purchased from U.S. invitrogen company, and foetal calf serum (FBS) and ultrapure water are purchased from U.S. Gibico company, and the PCR primer is synthetic by American I DT company, dNTP, the Taq archaeal dna polymerase, dimethyl sulfoxide (DMSO) (DMSO), Realtime PCR test kit, the Gluc detection kit is purchased from U.S. NEB company, agarose, Ethidum Eremide (EB) and polybrene (Polybrene) are purchased from U.S. Sigma company, glue reclaims purification column purchased from U.S. Millipore company, cell lysis buffer solution and plasmid a small amount of extraction agent box are purchased from U.S. Promega company, immunofluorescence antibody is purchased from Britain Abcam company, and avidin (Avdin)/vitamin H (Biotin) closed reagent box is purchased from U.S. VECTOR company.Concentration is phosphate buffered saline buffer (PBS) autogamy that 0.1mol/L, pH are 7.2～7.4: take NaCl 9.0g, Na ₂hPO ₄12H ₂o 6.0g and NaH ₂pO ₄2H ₂o0.4g, after making to dissolve fully with distilled water, regulate pH to 7.2～7.4, then be settled to 1000ml with distilled water, packing, and 1.05kPa autoclaving 20min, 4 ℃ save backup.

(6) instrument: CO ₂incubator (Thermo Forma 3110 types) and Bechtop are purchased from U.S. Thermo FisherScientific company, inverted microscope and gel imaging instrument are purchased from Japanese Olympus company, the fluorescence inverted microscope is purchased from Japanese Nikon company, PCR instrument (Gene Cycler ^tM) purchased from U.S. Bio-Rad company, spectrophotometer, chemoluminescence and fluor tester are purchased from U.S. Beckman company.

The experimental technique of unreceipted actual conditions in preferred embodiment, usually according to normal condition, the molecular cloning experiment guide (third edition for example, J. the work such as Pehanorm Brooker, Huang Peitang Deng Yi， Science Press, 2002) described in condition, or the condition of advising according to manufacturer.

1, myocardial cell's separation and Culture

Healthy CD1 mouse CO by pregnant 15.5 days ₂after sucking execution, take out the mice embryonic heart, put and fill in the Tissue Culture Dish of PBS that 25ml is chilled to 4 ℃ in advance, chopping piping and druming repeatedly, add the trypsin solution that the 2ml massfraction is 0.25%, 37 ℃ digest 5 minutes, standing rear transfer supernatant liquor spends the night and fills in the Tissue Culture Dish of 15mlDMEM perfect medium to the collagen solution that is 1% through massfraction is coated, the residue heart tissue adds the trypsin solution that the 2ml massfraction is 0.25% again, 37 ℃ digest 5 minutes, standing rear transfer supernatant liquor is to same Tissue Culture Dish, at 37 ℃, the CO that volume fraction is 5% ₂with under the condition of saturated humidity, cultivate 1 hour, then cell culture fluid is transferred in the coated Tissue Culture Dish spent the night of another collagen solution that is 1% through massfraction and continues to cultivate, change fresh DMEM perfect medium after 24 hours, remove the hemocyte suspended.

As shown in Figure 1, the myocardial cell is into the fiber-like form to the form of Cardiac Cells In Vitro, and cell constantly breeds, single or agglomerating the beating of visible cell.

2, myocardial cell's immortalization

2.0 μ g SSR#69,1.0 μ g pAmpho, 15 μ l Lipofectamine and the blank substratum of 250 μ l DMEM are mixed, under room temperature standing 30 minutes, make transfection mixture, HEK293 is inoculated in Tissue Culture Flask to the CO that is 5% at 37 ℃, volume fraction with the DMEM perfect medium with 60% density ₂with under the condition of saturated humidity, cultivate, after cell attachment, absorb substratum, with the blank substratum washing of 3ml DMEM 1 time, add the blank substratum of 2.5ml DMEM, hatch 5～10 minutes, add again above-mentioned transfection mixture, hatch the fresh DMEM perfect medium of replacing after 4 hours, the 36th hour sucking-off substratum, the filter that is 0.2 μ m with aperture filters, filtrate transfers to transfection myocardial cell in myocardial cell's culturing bottle, change fresh DMEM perfect medium after 12 hours, the Totomycin solution screening immortalization myocardial cell who adds 0.1mg/ml after 24 hours, screening time is 2 weeks.

3, immortalization myocardial cell mono-clonal

Application infinite dilution method, be inoculated into 96 orifice plates by the immortalization myocardial cell who filters out, and stops dilution during only containing 1 cell to every hole, hole of 1/3 in 96 orifice plates, the CO that is 5% at 37 ℃, volume fraction with the DMEM perfect medium of the Totomycin that contains 0.1mg/ml ₂with continue screening and culturing under the condition of saturated humidity, when Growth of Cells reaches 1/3 hole area substantially, use tryptic digestion, the Tissue Culture Flask of 24 orifice plates, 6 orifice plates, 25ml and the Tissue Culture Dish of 100mm successively go down to posterity, last frozen standby, carry out screening and culturing at the frozen front DMEM perfect medium of the Totomycin that contains 0.1mg/ml that all uses, obtain altogether 20 immortalization myocardial cell clones, called after CP15-1～5, CP15-5A and CP15-6～19 respectively.

Immortalization myocardial cell's mono-clonal growing state as shown in Figure 2, visible individual cells growth in the 3rd day after inoculation, visible cell division in the 5th day forms 2～3 cells, occurs 1 little cell clone group in the time of the 10th day, and in the time of the 15th day, cell clone group reaches 1/3 hole area substantially.

4, RT-PCR screening cardiac muscle progenitor cell

Because isolation and identification method and the mark of the cardiac muscle progenitor cell of bibliographical information are had nothing in common with each other, therefore, extract embryo 13.5 days (E13.5) and 18.5 days (E18.5) at first respectively, latter 1 day (D1), 3 days (D3), 7 days (D7) and 14 days (D14) are born, and the healthy CD1 mouse heart total tissue RNA of birth rear 8 weeks (adult), adopt RT-PCR to detect the expression sequential of specific heart gene in the heart development process, with identify the early stage of myocardial cell and late period mark.

Concrete grammar is as follows: get the frozen heart tissue of 50mg, add 1ml Trizol, fully after homogenate, add 360 μ l chloroforms, fully after concussion, 14000rpm low-temperature centrifugation 20 minutes, get supernatant liquor, add 670 μ l Virahols and 5 μ l glycogens (Gly), fully after concussion, 14000rpm low-temperature centrifugation 15 minutes, abandon supernatant liquor, add the ethanolic soln that 600 μ l massfractions are 70%, fully after concussion, 14000rpm low-temperature centrifugation 5 minutes, abandon supernatant liquor, dry, add 50 μ l to go endotoxic distilled water to make to dissolve, obtain the heart tissue total rna solution,-80 ℃ save backup.Sequences Design PCR primer (primer sequence is in Table 1) according to the upper mouse heart specific gene of logining of GenBank.The RT reaction method is: the Hexamer solution 2 μ l of 0.5 μ g/ μ l and heart tissue total rna solution 10 μ l are mixed, and 70 ℃ are reacted 5 minutes, make the Hexamer-RNA mixture; The dNTPs solution 1 μ l of dithiothreitol (DTT) solution 2 μ l, the 10mmol/L of 5 * damping fluid, 2 μ l, 0.1mol/L, RNasin 0.2 μ l and distilled water 1.6 μ l being mixed, make the RT reaction mixture on ice; Hexamer-RNA mixture, RT reaction mixture and reversed transcriptive enzyme 0.25 μ l are mixed, 37 ℃ of reactions 60 minutes, 95 ℃ of reactions 1 minute, be cDNA by the RNA reverse transcription, then to be diluted to cumulative volume with distilled water be 100 μ l ,-20 ℃ save backup.The PCR reaction system is: by the dNTPs solution 2.4 μ l of 10 * damping fluid, 2.0 μ l, 10mmol/L, DMSO 1.2 μ l, each 0.4 μ l of the primers F of 330ng/ μ l/R solution, cDNA template (RT reaction product) 10 μ l, Taq archaeal dna polymerase 0.2 μ l and distilled water 3.5 μ l mix, and cumulative volume is 20 μ l; Reaction conditions is: 95 ℃ of denaturations 2 minutes; 40 seconds, 72 ℃ extensions of 20 seconds, 68 ℃ annealing of 92 ℃ of sex change are 30 seconds again, totally 12 circulations, and 1 annealing temperature of every circulation reduces by 1 ℃; 40 seconds, 72 ℃ extensions of 20 seconds, 56 ℃ annealing of 92 ℃ of sex change are 30 seconds again, totally 21～32 circulations; Last 72 ℃ are extended 5 minutes.The PCR product carries out the agarose gel electrophoresis that massfraction is 1%, the imaging of gel imaging instrument is preserved, the Bio-Rad image analysis system is measured optical density(OD) (OD) value of each DNA band, and result be take to the GAPDH gene proofreaied and correct as internal reference, goal gene relative expression quantity=goal gene OD value/GAPDH gene OD value.

The PCR primer of table 1 mouse heart specific gene

RT-PCR detection specific heart gene is in the expression sequential in the heart development process as shown in Fig. 3～4, and visible ISL1 expresses the commitment at myocardial cell E13.5 specifically, during E18.5, almost can't detect; C-kit is at E13.5 in the growth course that becomes systemic heart, and expression amount reduces gradually, and the expression trend of Sca-1 is contrary with c-kit, is the trend raise gradually; Cardiac muscle is early_expressed genes Nkx2.5 with the reaching maturity and reduce gradually of heart, and gap junction protein Cx43 is without considerable change trend, and late structural proteins α-MyHC, α-actin and cTnT reach maturity with heart and increase gradually.

According to above-mentioned detected result and in conjunction with bibliographical information, choose progenitor cell marker thing ISL1, myocardial cell that specificity is higher and be mark Nkx2.5 and the Tbx5 leading indicator as the screening cardiac muscle progenitor cell; Whether stem cell markers Oct3/4, Nanog have the marker gene of stem cell self for detection of separated cell with Sox2; Other progenitor cell marker thing and myocardial cell are that mark is for the auxiliary measurement cell residing Myocardial development stage.According to These parameters, adopt RT-PCR to screen cardiac muscle progenitor cell from 20 immortalization myocardial cells clones, and be usually used in studying the P19CL6 of Myocardial development and H9C2 in contrast with bibliographical information.The concrete grammar of RT-PCR is the same, and the PCR primer sequence is in Table 2.

The PCR primer of myocardial cell's marker gene of table 2 heart development different steps

RT-PCR screening cardiac muscle progenitor cell is as shown in Fig. 5～6 and Fig. 8, and stem cell markers Oct3/4, Nanog and Sox2 basically express in 20 immortalization myocardial cell clones and P19CL6, but do not express (Fig. 5 A) in H9C2; Specificity cardiac muscle progenitor cell mark ISL1 expresses in CP15-5A, CP15-9, CP15-10, CP15-13, CP15-18 and P19CL6, high expression level in CP15-9 particularly, non-specific cardiac muscle progenitor cell mark Sca1 and c-kit also express in most of immortalization myocardial cell clones, but ISL1, Sca1 and c-kit still do not express (Fig. 5 B) in H9C2; The myocardial cell is that early sign thing Nkx2.5, GATA4, Tbx5, Hand2 and Flk-1 all have expression in various degree in CP15-5A, CP15-9, CP15-10, CP15-13, CP15-18 and P19CL6, wherein the Tbx5 expression amount is higher and difference is more obvious, but the relatively low Hand2 of expression specificity only in H9C2, other marks are almost without expressing (Fig. 5 C); Relatively low and the no significant difference of myocardial cell's structural protein mark α-MyHC, Actc1, cTnI and ANF expression amount in 20 immortalization myocardial cells clone and P19CL6, and cTnI high expression level (Fig. 5 D) in H9C2.

5, ATRA induces MyHC-GLuc screening active ingredients cardiac muscle progenitor cell

Myosin (MyHC) is the important structure integral part of Muscle contraction unit, the wherein existence of α-MyHC and express specificity in a organized way, and therefore, the existence of α-MyHC has the important hints meaning to the muscle cell atomization.

2 μ g MyHC-GLuc, 15 μ l Lipofactamine and the blank substratum of 500 μ l DMEM are mixed, place under room temperature 10～30 minutes, make transfection mixture, respectively the clone of 20 immortalization myocardial cells in exponential phase of growth is inoculated in Tissue Culture Flask to the CO that is 5% at 37 ℃, volume fraction with the DMEM perfect medium with 60～80% density ₂with under the condition of saturated humidity, cultivate, after cell attachment, absorb substratum, with the blank substratum washing of 3.0ml DMEM 1 time, add 2.5ml DMEM perfect medium, hatch 10 minutes, add again above-mentioned transfection mixture, hatch after 4 hours and be replaced by the DMEM perfect medium, after 12 hours, add the ATRA solution that final concentration is 0.5 μ mol/L to induce differentiation, activate the MyHC-GLuc activity, respectively at inducing the rear the 3rd, 6, within 12 and 18 days, draw 20 μ l cell culture supernatants, detect the expression amount of GLuc by the GLuc detection kit, according to the test kit specification sheets, operate.

ATRA induces MyHC-GLuc screening active ingredients cardiac muscle progenitor cell (Fig. 7 has only listed through RT-PCR and detected the data for ISL1/Tbx5 two positive colony CP15-5A, CP15-9, CP15-10, CP15-13 and CP15-18 and 3 ISL1/Tbx5 jack to jack adapter sex clone CP15-2, CP15-3 and CP15-19) as shown in Fig. 7～8, visible ATRA can induce the MyHC-GLuc activity of the two positive colonies of ISL1/Tbx5 effectively, particularly in the time of the 18th day (p<0.05).

6, immunofluorescence detects ISL1 and the expression of c-kit in the two positive colonies of ISL1/Tbx5

In order further to verify the RT-PCR result, adopt immuno-fluorescence assay ISL1 and the c-kit expression in ISL1/Tbx5 two positive colony CP15-5A, CP15-9, CP15-10, CP15-13 and CP15-18, in contrast with 2 ISL1/Tbx5 jack to jack adapter sex clone CP15-12 and CP15-17 simultaneously.

Concrete grammar is as follows: the immortalization myocardial cell in exponential phase of growth clone is inoculated into and cultivates in chamber slide system with 60～80% density, the CO that is 5% at 37 ℃, volume fraction with the DMEM perfect medium ₂with under the condition of saturated humidity, cultivate, after cell attachment, absorb substratum, get the chamber slide, with PBS washing 1 time, cold acetone is fixed 10 minutes, under room temperature, drying is 10 minutes, PBS washing 1 time, by volume fraction, be that the 5% and two anti-serum that belong to source together seal 20 minutes, PBS washing 1 time, add anti-ISL1 monoclonal antibody or anti-c-kit monoclonal antibody (extent of dilution is 1: 200), establish primary antibodie control group (monoclonal antibody that adds IgG hypotype of the same race) simultaneously, under room temperature, hatch 60 minutes or 4 ℃ of overnight incubation, PBS washing 3 times, corresponding two anti-(extent of dilution is 1: 200) that add again DyLight 594 (green fluorescence) mark, under room temperature, hatch 30 minutes, PBS washing 3 times, mounting, put the fluorescence microscopy Microscopic observation.

Immunofluorescence detection ISL1 and the c-kit expression in the two positive colonies of ISL1/Tbx5 as shown in Figure 9, a little less than ISL1 expresses and expresses in CP15-13 the most by force in CP15-9, the primary antibodie control group is not almost expressed, and control group is expressed weak (Fig. 9 A); C-kit, except almost not expressing in the primary antibodie control group, all has expression in all the other each groups, especially in CP15-9 and CP15-13, expresses strong (Fig. 9 B); Consistent with the RT-PCR result.

Comprehensive above-mentioned RT-PCR result, ATRA induce the active result of MyHC-GLuc and immunofluorescence result, filter out 4 clone CP15-5A, CP15-9, CP15-10 and CP15-18 with cardiac muscle progenitor cell characteristic.

7, Western Blot detects the recoverability of cardiac muscle progenitor cell

Contain the SV40T immutalizing gene in the SSR#69 structure, and the action target spot LoxP that has added respectively recombinase Cre before and after the SV40T gene, when having Cre to exist, the SV40T gene can be acted on 2 LoxP sites by Cre and excise, thereby makes immortalized cells be returned to the normal growth state.

CP15-9 and CP15-10 are infected respectively to AdR-Cre, and collecting cell cracking total protein after 48 hours, detect the expression of SV40T with Western Blot, observe the recoverability of cardiac muscle progenitor cell.Concrete grammar is as follows: total protein is mixed with SDS-PAGE albumen sample-loading buffer, water-bath is boiled 10 minutes, loading is carried out SDS-PAGE, after electrophoresis finishes, by the protein electrotransfer to pvdf membrane, the skim-milk solution room temperature lower seal that is 1% with massfraction is closed 1～2 hour, add again anti-SV40T monoclonal antibody (to be diluted with the TBST that contains the skim-milk that massfraction is 1%, extent of dilution is 1: 500), 4 ℃ of overnight incubation, TBST washing 3 times, colour developing, the imaging of gel imaging instrument is preserved, and result be take to β-actin is proofreaied and correct as internal reference.

In Western Blot detection cardiac muscle progenitor cell, as shown in figure 10, visible Cre can effectively remove the SV40T gene, reduces its expression in cardiac muscle progenitor cell in the expression of SV40T, thereby makes the state before cardiac muscle progenitor cell returns to immortalization.

8, the impact of immutalizing gene on cardiac muscle progenitor cell propagation and differentiation

CP15-5A, CP15-9, CP15-10 and CP15-18 are infected respectively to AdRFP and AdR-Cre, within the 1st, 2,3,4,5 and 6 days, carry out cell counting after infecting, observe the impact of the existence of SV40T gene on cardiac muscle progenitor cell propagation.As shown in figure 11, visible Ad-RFP group is consistent with the growth tendency of AdR-Cre group for the cardiac muscle progenitor cell growth curve, but the cell proliferation of Ad-Cre group is slower, shows that the existence of SV40T gene can improve the multiplication capacity of cardiac muscle progenitor cell.

By after CP15-9 transfection MyHC-GLuc, infect respectively again Ad-RFP and AdR-Cre, induce differentiation with the Dex solution of 0.5 μ mol/L, activate the MyHC-GLuc activity, within the 3rd, 6,9 and 12 days after inducing, draw 20 μ l cell culture supernatants, detect the expression amount of GLuc by the GLuc detection kit, according to the operation of test kit specification sheets, observe the impact of the existence of SV40T gene on the cardiac muscle progenitor cell differentiation.When the active detection of MyHC-GLuc, for the cell concentration of balanced Ad-RFP group with the AdR-Cre group, application cell cracking total protein concentration carrys out stdn GLuc reading.Dex induce the differentiation cardiac muscle progenitor cell the MyHC-GLuc activity as shown in figure 12, with respect to the blank group, Dex can effectively induce the MyHC-GLuc active (p<0.05) of differentiation cardiac muscle progenitor cell, and blank group and Dex induce in group AdR-Cre little on the impact of MyHC-GLuc activity, show that the existence of SV40T gene is less on the impact of cardiac muscle progenitor cell differentiation.

9, the tumorigenicity of cardiac muscle progenitor cell detects

By plasmid pSEB-Luc and pAmpho cotransfection HEK293, the CO that is 5% at 37 ℃, volume fraction ₂with under the condition of saturated humidity, cultivate, start to collect virus liquid after 36 hours, within every 12 hours, collect 1 time, collect altogether 3 times, after every ml virus liquid adds the polybrene of 6 μ l2mg/ml, divide 4 subinfection CP15-9 or CP15-10, each effect 4～8 hours, each between with fresh DMEM perfect medium cultivation 8～12 hours, after last 1 subinfection, add the blasticidin of 2.0 μ g/ml to screen 1 week, form cell strain CP15-9* or the CP15-10* of stably express luciferase, then it is frozen standby to go down to posterity; Cultivate CP15-9* or CP15-10* with the DMEM perfect medium, when growing to 80% fusion, infects respectively cell attachment Ad-RFP and AdR-Cre, change fresh DMEM perfect medium after 12 hours, within the 48th hour, put the fluorescence microscopy Microscopic observation, the cell infection rate is substantially in 60～80% left and right (as shown in figure 13), use tryptic digestion, collecting cell, centrifugal 5 minutes of 1000rpm, abandon supernatant liquor, cell precipitation, with after the PBS washing that contains phosphatidylserine, is resuspended in 50 μ l PBS, puts on ice and saves backup; By 1 * 10 ⁶the individual cell through above-mentioned processing is transplanted to nude mice by subcutaneous, within the 1st, 3 and 7 days, carries out the luciferase imaging after transplanting, and carries out signal strength analysis.

Cardiac muscle progenitor cell infects respectively after Ad-RFP and AdR-Cre in the luciferase imaging in nude mouse as shown in Figure 14～15, after visible transplanting, extend in time, the luciferase signal of Ad-RFP group and AdR-Cre group weakens gradually and finally disappears, early, the cardiac muscle progenitor cell of transplanting does not form tumour to the blackout of AdR-Cre group in nude mouse.

10, Dex induces the differentiation of cardiac muscle progenitor cell

CP15-5A, CP15-9, CP15-10 and CP15-18 are induced to differentiation with the Dex solution of 0.5 μ mol/L respectively, putting observation of cell form under bright field microscope in the time of the 14th day changes, as shown in figure 16, CP15-5A, CP15-9 and CP15-10 induce differentiation after 14 days at Dex, it is roomy that cellular form becomes, between cell, queueing discipline is tight, and the CP15-18 cellular form is elongated, and fasciculation is arranged.

11, real-time quantitative PCR detects the expression that Dex induces the myocardium development related gene of differentiation cardiac muscle progenitor cell

CP15-5A, CP15-9, CP15-10 and CP15-18 are induced to differentiation with the Dex solution of 0.5 μ mol/L respectively, extract cell total rna when the 7th day and the 11st day, obtain cDNA by RT, the real-time quantitative PCR that carries out again myocardium development related gene detects (primer sequence is in Table 3), and result be take to GAPDH is proofreaied and correct as internal reference.

The PCR primer of the myocardium development related gene of table 3

Real-time quantitative PCR detect Dex induce the differentiation cardiac muscle progenitor cell myocardium development related gene expression as shown in figure 16, totally it seems, with blank group (not adding Dex), compare, CP15-9 and CP15-10 induce in atomization at Dex, early gene ISL1, Nkx2.5 and Tbx5 express on a declining curve, late gene α-MyHC, α-actin and cTnT express in rising trend, and skeletal muscle marker gene MyoD and unstriated muscle marker gene SM-MHC express hardly; And, in CP15-5A and CP15-18, nothing is variation tendency fixedly.

12, immunofluorescence detects the cTnT expression that Dex induces the differentiation cardiac muscle progenitor cell

CP15-5A, CP15-9, CP15-10 and CP15-18 are induced to differentiation with the Dex solution of 0.5 μ mol/L respectively, and fixed cell in the time of the 14th day, adopt the expression of immuno-fluorescence assay myocardial cell structural protein cTnT.Result as shown in figure 18, is compared with blank group (not adding Dex) as seen, and cTnT induces the expression in the differentiation cardiac muscle progenitor cell stronger, wherein relatively strong with the expression of CP15-9 and CP15-10 again at Dex, and has form to change.

Generally speaking, preferred embodiment is the first separation and Culture embryo mouse cardiac myocytes of 15.5 days, make it infect immortalization plasmid SSR#69 and immortalization, mono-clonal myocardial cell by antibiotic-screening and being immortalized of infinite dilution method, induce the MyHC-GLuc activity according to genetic expression sequential and ATRA in the Myocardial development process again, and immunofluorescence technique checking, filter out 4 clone CP15-5A with cardiac muscle progenitor cell characteristic, CP15-9, CP15-10 and CP15-18, in further real-time quantitative PCR and immunofluorescence screening process, find that CP15-9 and CP15-10 induce in atomization at Dex, early gene ISL1, Nkx2.5 and Tbx5 express gradually and reduce, late gene α-MyHC, α-actin and cTnT express obviously and raise, and skeletal muscle and unstriated muscle gene are expressed hardly, for more excellent clone.Result of study also shows, 4 cardiac muscle progenitor cell mono-clonals that preferred embodiment filters out are the Reversible immortalization cell, can be returned to the primary cell state before immortalization after knocking out immutalizing gene, thereby make the cell can infinite multiplication, again without tumorigenesis and the danger that causes virus infection, be that research affects cardiac muscle progenitor cell breed and break up the ideal tools of factor under the adult cardiomyocytes damage situations, good application prospect is arranged.

Finally explanation is, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although by with reference to the preferred embodiments of the present invention, invention has been described, but those of ordinary skill in the art is to be understood that, can make various changes to it in the form and details, and not depart from the spirit and scope of the present invention that appended claims limits.

Sequence table

<110 > Children's Hospital Attached to Chongqing Medical Univ.

<120 > mouse cardiac muscle progenitor cell and preparation method thereof

<160>40

<210>1

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of ISL1 gene

<400>1

aaggacaaga?aacgcagcat 20

<210>2

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of ISL1 gene

<400>2

ccatcatgtc?tctccggact 20

<210>3

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of Sca-1 gene

<400>3

cctggagccc?tctagtgatg 20

<210>4

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of Sca-1 gene

<400>4

gagcagcaat?ccacaacaaa 20

<210>5

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of c-kit gene

<400>5

gggctagcca?gagacatcag 20

<210>6

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of c-kit gene

<400>6

aggagaagag?ctcccagagg 20

<210>7

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of Nkx2.5 gene

<400>7

gagcctggta?gggaaagagc 20

<210>8

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of Nkx2.5 gene

<400>8

ggtgggtgtg?aaatctgagg 20

<210>9

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of Cx43 gene

<400>9

cctcaacatg?gcatttcctt 20

<210>10

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of Cx43 gene

<400>10

tccacaccta?gagggtcagg 20

<210>11

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of α-MyHC gene

<400>11

gaggaccagg?ccaatgagta 20

<210>12

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of α-MyHC gene

<400>12

gctgggtgta?ggagagcttg 20

<210>13

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of α-actin gene

<400>13

ctgacagagg?caccactgaa 20

<210>14

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of α-actin gene

<400>14

catctccaga?gtccagcaca 20

<210>15

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of cTnT gene

<400>15

ctgagacaga?ggaggccaac 20

<210>16

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of cTnT gene

<400>16

accaagttgg?gcatgaagag 20

<210>17

<211>18

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of Oct3/4 gene

<400>17

ctgggcgttc?tctttgga 18

<210>18

<211>18

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of Oct3/4 gene

<400>18

ggcttcctcc?acccactt 18

<210>19

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of Nanog gene

<400>19

aagtacctca?gcctccagca 20

<210>20

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of Nanog gene

<400>20

gtgctgagcc?cttctgaatc 20

<210>21

<211>18

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of Sox2 gene

<400>21

ccggggagat?acatgctg 18

<210>22

<211>18

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of Sox2 gene

<400>22

gaacccgact?gggaacct 18

<210>23

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of GATA4 gene

<400>23

tctcccagga?acatcaaacc 20

<210>24

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of GATA4 gene

<400>24

gtgtgaaggg?gtgaaaagga 20

<210>25

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of Tbx5 gene

<400>25

cgctgtgact?tcgtaccaga 20

<210>26

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of Tbx5 gene

<400>26

actttgcatc?cgagacatcc 20

<210>27

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of Hand2 gene

<400>27

ctacttccac?ggctggctta 20

<210>28

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of Hand2 gene

<400>28

ccataatggg?agtggtccag 20

<210>29

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of Flk-1 gene

<400>29

ggcggtggtg?acagtatctt 20

<210>30

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of Flk-1 gene

<400>30

gtcactgaca?gaggcgatga 20

<210>31

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of Actc1 gene

<400>31

ccctggattt?tgagaacgag 20

<210>32

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of Actc1 gene

<400>32

gagtctctgg?acagcggaag 20

<210>33

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of cTnI gene

<400>33

ctgcaggaga?tgattgacga 20

<210>34

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of cTnI gene

<400>34

tgtagccatc?agcgtttttg 20

<210>35

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of ANF gene

<400>35

gggggtagga?ttgacaggat 20

<210>36

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of ANF gene

<400>36

ggatcttttg?cgatctgctc 20

<210>37

<211>18

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of MyoD gene

<400>37

tggcagcgag?cactacag 18

<210>38

<211>18

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of MyoD gene

<400>38

gcggtgtcgt?agccattc 18

<210>39

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primers F of SM-MHC gene

<400>39

gcagaaggct?cagaccaaag 20

<210>40

<211>20

<212>DNA

<213 > artificial sequence

<220>

<223 > the PCR primer R of SM-MHC gene

<400>40

tatccagaat?gcccaggaag 20

Claims (1)

1. the preparation method of mouse cardiac muscle progenitor cell is characterized in that: comprise the following steps:

A, separation and Culture embryo's mouse cardiac myocytes of 15.5 days;

B, by step a gained infection of cardiac myocytes immortalization plasmid SSR#69 and immortalization, by the mono-clonal myocardial cell of antibiotic-screening method and being immortalized of infinite dilution method;

C, according to genetic expression sequential and ATRA in the Myocardial development process, induce the MyHC-GLuc activity, and immunofluorescence technique checking, filter out the clone with cardiac muscle progenitor cell characteristic, it expresses cardiac muscle progenitor cell mark ISL1 and the myocardial cell is early sign thing Tbx5, also expressing the myocardial cell is early sign thing Nkx2.5, stem cell markers Oct3/4, Nanog and Sox2, and cardiac muscle progenitor cell mark Sca-1 and c-kit, and after inducing differentiation express alpha-MyHC; In further real-time quantitative PCR and immunofluorescence screening process, being chosen at Dex, to induce atomization Myocardial progenitor cell marker thing ISL1 and myocardial cell to be that early sign thing Nkx2.5 and Tbx5 express on a declining curve, myocardial cell's structural protein mark α-MyHC, α-actin and cTnT express in rising trend, and the clone that skeletal muscle mark MyoD and unstriated muscle mark SM-MHC express hardly is more excellent clone; Concrete grammar is as follows:

RT-PCR screens cardiac muscle progenitor cell: choose progenitor cell marker thing ISL1, the myocardial cell is mark Nkx2.5 and the Tbx5 leading indicator as the screening cardiac muscle progenitor cell, stem cell markers Oct3/4, whether Nanog has the marker gene of stem cell self for detection of separated cell with Sox2, other progenitor cell marker thing and myocardial cell are mark Sca1, c-kit, GATA4, Hand2, Flk-1, α-MyHC, α-actin, cTnI and ANF are for the auxiliary measurement residing Myocardial development stage of cell, according to These parameters, adopt RT-PCR to screen cardiac muscle progenitor cell from the mono-clonal myocardial cell of step b gained immortalization, and with the P19CL6 that is usually used in studying Myocardial development and H9C2 in contrast, described ISL1, Sca1, c-kit, Nkx2.5, α-MyHC, Oct3/4, Nanog, Sox2, GATA4, Tbx5, Hand2, Flk-1, α-actin, the PCR primer sequence of cTnI and ANF is respectively as SEQ ID No.1～2, SEQ ID No.3～4, SEQ ID No.5～6, SEQ ID No.7～8, SEQ ID No.11～12, SEQ ID No.17～18, SEQ ID No.19～20, SEQ ID No.21～22, SEQ ID No.23～24, SEQ ID No.25～26, SEQ ID No.27～28, SEQ ID No.29～30, SEQ ID No.31～32, shown in SEQ ID No.33～34 and SEQ ID No.35～36,

ATRA induces MyHC-GLuc screening active ingredients cardiac muscle progenitor cell: 2 μ g MyHC-GLuc, 15 μ l Lipofactamine and the blank substratum of 500 μ l DMEM are mixed, place under room temperature 10～30 minutes, make transfection mixture, respectively the mono-clonal myocardial cell in the step b of exponential phase of growth gained immortalization is inoculated in Tissue Culture Flask to the CO that is 5% at 37 ℃, volume fraction with the DMEM perfect medium with 60～80% density ₂with under the condition of saturated humidity, cultivate, after cell attachment, absorb substratum, with the blank substratum washing of 3.0ml DMEM 1 time, add 2.5ml DMEM perfect medium, hatch 10 minutes, add again above-mentioned transfection mixture, hatch after 4 hours and be replaced by the DMEM perfect medium, after 12 hours, add the ATRA solution that final concentration is 0.5 μ mol/L to induce differentiation, activate the MyHC-GLuc activity, respectively at inducing the rear the 3rd, 6, within 12 and 18 days, draw 20 μ l cell culture supernatants, detect the expression amount of GLuc by the GLuc detection kit, according to the test kit specification sheets, operate,

Immunofluorescence detects ISL1 and the expression of c-kit in the two positive colonies of ISL1/Tbx5: further verify the RT-PCR result, adopt immuno-fluorescence assay ISL1 and the c-kit expression in the two positive colonies of ISL1/Tbx5, in contrast with the sex clone of 2 ISL1/Tbx5 jack to jack adapters simultaneously;

Real-time quantitative PCR detects the expression that Dex induces the myocardium development related gene of differentiation cardiac muscle progenitor cell: the clone with cardiac muscle progenitor cell characteristic that will filter out induces differentiation with the Dex solution of 0.5 μ mol/L respectively, extract cell total rna when the 7th day and the 11st day, obtain cDNA by RT, the real-time quantitative PCR that carries out again myocardium development related gene ISL1, Nkx2.5, α-MyHC, α-actin, cTnT, Tbx5, MyoD and SM-MHC detects, and result be take to GAPDH is proofreaied and correct as internal reference; The PCR primer sequence of described ISL1, Nkx2.5, α-MyHC, α-actin, cTnT, Tbx5, MyoD and SM-MHC is respectively as shown in SEQ ID No.1～2, SEQ ID No.7～8, SEQ ID No.11～12, SEQ IDNo.13～14, SEQ ID No.15～16, SEQ ID No.25～26, SEQ ID No.37～38 and SEQ ID No.39～40;

Immunofluorescence detects Dex and induces the cTnT of differentiation cardiac muscle progenitor cell to express: the clone with cardiac muscle progenitor cell characteristic that will filter out induces differentiation with the Dex solution of 0.5 μ mol/L respectively, fixed cell in the time of the 14th day, adopt the expression of immuno-fluorescence assay myocardial cell structural protein cTnT.

Images