CN101812426A - Method for constructing colibacillus strain for producing tryptophan and constructed strain - Google Patents
Method for constructing colibacillus strain for producing tryptophan and constructed strain Download PDFInfo
- Publication number
- CN101812426A CN101812426A CN 201010137994 CN201010137994A CN101812426A CN 101812426 A CN101812426 A CN 101812426A CN 201010137994 CN201010137994 CN 201010137994 CN 201010137994 A CN201010137994 A CN 201010137994A CN 101812426 A CN101812426 A CN 101812426A
- Authority
- CN
- China
- Prior art keywords
- tryptophane
- gene
- tryptophan
- strain
- colibacillus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a method for constructing a colibacillus strain for producing tryptophan, which comprises the following steps: knocking out tryptophanase gene of colibacillus, and expressing 3-deoxidized-D-arabia-heptulose-7-phosphate synthase and anthranilate synthetase genes free from the control of tryptophan feedback inhibition by utilizing a temperature control carrier, thereby obtaining a high-yield tryptophan colibacillus strain.
Description
Technical field
The present invention relates to the construction process of recombinant bacterial strain of fermentative production tryptophane and the engineering strain that obtains with this method.
Background technology
Tryptophane be white or off-white color to yellowish crystalline powder, odorless or little smelly has bitter taste slightly.289 ℃ of decomposition, slightly soluble in water is insoluble to ethanol, dissolves in diluted acid or diluted alkaline.Tryptophane is important amino acid, is a kind of indispensable amino acid of human body and animal, with grow relevant.Medicine, food and feed additive have been widely used in.
At present mainly with the Production by Microorganism Fermentation tryptophane.This method is to be carbon source with saccharide raw materials such as glucose, utilizes to produce the tryptophane bacterial classification and produce tryptophane.Along with the application of recombinant DNA technology in Microbial Breeding, produce the screening of bacterial strain and the raising of acid yield provides reliable guidance for good tryptophane, make the microorganism direct fermentation produce the industrialized preparing process that tryptophane becomes a kind of cheapness.
After the intestinal bacteria central metabolic pathway, by the synthetic three kinds of die aromatischen Aminosaeurens of shikimic acid pathways metabolism, they are respectively tryptophane (tyr), tyrosine (trp) and phenylalanine (phe).The tryptophane biosynthetic pathway mainly comprises common pathway and two parts of branch's approach, common pathway generates chorismic acid (CHA) from the Arabic ketoheptose of 3-deoxidation-2--7-phosphoric acid (DAHP) through shikimic acid, and branch's approach generates tryptophane by chorismic acid through anthranilic acid.In the common pathway, the reaction that DAHP synthetic enzyme (DS) catalysis erythrose-4-phosphate (E4P) and phosphoenolpyruvic acid (PEP) condensation generate DAHP is the rate-limiting step of shikimic acid pathway, the synthetic regulation and control that are subjected to transcriptional level and product inhibitory enzyme vigor effect of enzyme.DS has three kinds of isozyme, and by the Arabic ketoheptose of 3-deoxidation-2--7-phosphate synthase aroG, aroF and aroH coding, the activity of enzyme then is subjected to phe, tyr, trp feedback inhibition respectively respectively.Wherein be subjected to the aroG of phenylalanine feedback regulation to account for 80% of DAHP synthetic enzyme vigor, be subjected to the aroF of tyrosine feedback regulation to account for 20% of DAHP synthetic enzyme vigor, aroG is synthetic above-mentioned three kinds of most important synthetic enzyme of die aromatischen Aminosaeuren precursor substance DAHP.And low (the Johannes Bongaerts of responsible tryptophane synthetic aroH content, etc.Metalolic engineering for microbial production of aromatic amino acids and derived compounds[J] .Metabolic Engieering, 2001.10,3 (4): 289-300.).The deficiency of DAHP synthetic enzyme can't realize the high yield of tryptophane.In the technology of former production tryptophane, do not have overexpression DS.
When high density phenylalanine, tyrosine and tryptophane existed, aroG also was subjected to the inhibition of part.Pass through genetic engineering technique, after drawing aroG encoding gene 146asp → Asn, the feedback inhibition effect obviously weakens (Yoshimi Kikuchi, Etc.Mutational analysis ofthe feedback sites of phenylalanine-sensitive 3-deoxy-D-arabino-heptulosonate-7-phosophate synthase Escherichia coli[J] .Applied and Enviromental Microbiology, 1997.2,63 (2): 761-762.).Owing to also have the reverse feedback regulation mechanism of phenylalanine branch approach, behind the overexpression aroG enzyme gene, do not cause the excessive synthetic of phenylalanine.The anthranilate synthase (AS) of trpED coding is biosynthetic second key enzyme of tryptophane in branch's approach, and the synthetic transcription repression that is subjected to of enzyme is regulated and control, and the activity of enzyme is regulated and control by feedback inhibition.In the intestinal bacteria, the transcription repression regulation and control are carried out in the expression of key gene implemented by trpR albumen, after tryptophane combines, trpR albumen transcription repression aroH, tryptophan operon and mtr gene.Under the effect of the tryptophanase (tryptophanase) that TnaA encodes, tryptophane is broken down into indoles.In order to improve tryptophane output, knocked out the tnaA gene, blocked tryptophane katabolism, after transforming through these, engineering bacteria tryptophane output has had significant raising.On this basis, by the antagonism aroG gene of feedback inhibition and trpE, D gene tandem expression on middle copy plasmid, further remove the bottleneck in the tryptophane route of synthesis, engineering bacteria tryptophane output further increases.
The production tryptophane coli strain that makes up with German goldschmidt chemical corporation (Degussa) is a representative (Chinese patent: use producing tryptophane from colibacillus, publication number: CN 1156180A), encoding part defective tryptophane aminoacyl-tRNA synthetic enzyme is the bacterium that sets out, and have a plasmid of the tryptophan operon of the anthranilate synthase that is not subjected to the tryptophane feedback inhibition, make up and produce the tryptophane coli strain, but method does not relate to the raising combination colour propylhomoserin precursor 3-deoxidation-Arabic ketoheptose of 2--7-phosphoric acid, and the measure of removing this precursor synergistic effect of tryptophane feedback inhibition.
Summary of the invention
The present invention seeks to overcome the insufficient production shortcoming of combination colour propylhomoserin precursor substance in the present tryptophane production technique, a kind of construction process of coli strain of novel production tryptophane is provided.
Technical scheme of the present invention is to adopt Protocols in Molecular Biology, after knocking out tryptophane lytic enzyme-tryptophan gene, utilize the temperature control carrier again, express the synthetic tryptophan metabolism key gene that is not subjected to the tryptophane feedback regulation, be 3-deoxidation-D-Arab-ketoheptose-7-phosphate synthase (DS, aroG) and anthranilic acid synthase gene (AS TrpED), obtains the purpose of high yield tryptophane.The pathways metabolism of its production tryptophane as shown in Figure 1.Overcome with goldschmidt chemical corporation and produce technical deficiency in the patented technology that tryptophane is representative, promptly do not have overexpression DAHP enzyme gene, cause the relative deficiency of combination colour propylhomoserin precursor substance DAHP, thereby influence the output of tryptophane.This deficiency improves in the present invention.
The present invention is when making up bacterial strain, the method that is used for knocking out tryptophan gene is, amplification contains the tetracycline resistance gene fragment of promotor and terminator sequence, the PCR product of purifying is transformed DH5 α competent cell, and containing the 16-24h that grows on the culture plate of tsiklomitsin, select positive colony, the intestinal bacteria that knock out for tryptophan gene.Also can adopt other genetic engineering means to realize knocking out the purpose of tryptophan gene.
Method of the present invention, the wherein said 3-deoxidation-D-Arab-ketoheptose-7-phosphate synthase gene aroG that not regulated and control by the tryptophane feedback inhibition is the gene behind 146asp → Asn rite-directed mutagenesis, its nucleotide sequence is seen shown in the SEQ ID No.1.It can be cloned from bacillus coli DH 5 alpha, obtains by rite-directed mutagenesis again.
Method of the present invention, wherein said anthranilic acid synthase gene TrpED can come from the various feedback resistant mutants of having reported, as, Aliba et al., Canadian Patent 1182409, Tribe and Pittard. (1979). or Applied andEnvironmental Microbiol.38:181-190, Aiba et al. (1982). or Applied andEnvironmental Microbiol.43:289-297.The nucleotide sequence of a kind of known anthranilic acid synthase gene TrpED that is not subjected to tryptophane feedback inhibition regulation and control is shown in SEQ ID No.2, and the AS vigor of its mutant suppresses to be lower than 5%.
The present invention realizes that the method for plasmid stability is to use and has kalamycin resistance gene on the plasmid.Because the kalamycin resistance gene expression product works, be difficult for causing kantlex degraded in the substratum in thalline.Therefore keep the relatively stable of kantlex concentration in the substratum, realize stablizing the genetic stability of plasmid.
The coli strain of the production tryptophane that the present invention makes up is stable in the 10L fermentation cylinder for fermentation, and process is easily controlled, and tryptophane concentration can reach about 23.7g/L in the 45 hours secondary fermentation liquid of fermenting.Improve the output of fermentative production tryptophane greatly, had very high industrial application value.
Description of drawings
Fig. 1 is the pathways metabolism of producing tryptophane from colibacillus, wherein: PEP: phosphoenolpyruvic acid; DS:3-deoxidation-D-Arab-heptanone acid-7-phosphate synthase; DAHP:3-deoxidation-D-Arab-heptanone acid-7-phosphoric acid; AS: anthranilate synthase (trpE, trpD); TnaA: tryptophanase;
Fig. 2 is the structure of pFYF000 plasmid in the embodiment of the invention;
Fig. 3 is the structure of pFYF001 plasmid in the embodiment of the invention;
Fig. 4 is a tryptophane fermentation yield (g/L) in the embodiment of the invention.
Embodiment
Below in conjunction with drawings and Examples, the specific embodiment of the present invention is described in further detail.Following examples are used to illustrate the present invention, but are not used for limiting the scope of the invention.
Embodiment 1: the clone of anti-tryptophane feedback inhibition AS gene
Adopt Applied and Environmental Microbiol.38:181-190, the feedback resistant mutants of Aiba etal. (1982) report, be incubated at (composition adds 1% agar powder in addition with table 1) 24-50h on the base plate substratum of the 5-fluoro-tryptophane that contains proper concn (0.5-3mM), select a bigger 700-1500 bacterium colony containing tryptophane of proper concn (1-5mM) and 5-fluorotryptophan (0.5-2mM), treat OD for cultivating respectively in the substratum of substrate
600When value is 0.6-1.0, collect thalline respectively, ultrasonic cryogenic pulverization thalline, centrifuging and taking supernatant.Under the situation that contains high density tryptophane (12-17 grams per liter), measure the AS vigor respectively.In the clone that these are selected, identify and screen to show that when the high density tryptophane exists the AS vigor suppresses to be lower than 5% clone.Based on the 5 ' tgaacaaaattagagaataaca (shown in SEQ ID No.3) of coding AS gene and the gene order of 3 ' atgatgcaaaccgttttagcga (shown in SEQ ID No.4) non-coding region, design pcr amplification primer, upstream primer F 5 '-cgcggatccaggaggtacttgttttaatctcttattgt-3 ' (shown in SEQ IDNo.5), contain BamHI restriction enzyme site and SD sequence (line place), downstream primer R 5 '-cggaattctcgctaaaacggtttgcatcat-3 ' (shown in SEQ ID No.6) (EcoRI restriction enzyme site) amplification non-homogeneous dimer encoding gene of AS (TrpE and TrpD) fragment, this PCR fragment called after TrpED simultaneously, sequence is shown in SEQ ID No.2.
The e. coli strains preparation that embodiment 2 tryptophan genes knock out
Utilize polymerase chain reaction,PCR technology (PCR), amplification contains tetracycline resistance gene fragment (containing promotor and terminator sequence), and this fragment 5 ' and 3 ' end contain the intestinal bacteria tryptophan gene fragment of 60-80bp.
With plasmid pBR322 is template, forward primer 5 '-atgaaggattatgtaatggaaaactttaaa catctccctg aaccgttccg cattcgtgtt attgagccag ttctcatgtt tgacagcttatcatcgataagc-3 ' (shown in SEQ ID No.7), reverse primer are 5 '-tcggttcgtacgtaaaggttaatcctttaa tattcgccgcgttct ctttc acatgtttaa aggcttcaatatggcggacg cgatggatat gttctgccaa-3 ' (shown in SEQ ID No.8).PCR is reflected in the 50 μ L cumulative volumes and carries out, and reaction conditions is 94 ℃ of sex change 5min, 94 ℃ of sex change 50s then, and 58 ℃ of annealing 1min, 72 ℃ are extended 3min, after totally 30 circulations, extend 10min in 72 ℃ again.The product of the above-mentioned PCR reaction of the PCR product purification test kit purifying that utilizes vast Tyke, Beijing to produce.
Utilize the PCR product of above-mentioned purifying to transform DH5 α competent cell, and, select positive colony containing the 16-24h that grows on the culture plate of tsiklomitsin.Extract positive colony, pcr analysis and gene order checking, checking determines that positive colony is the intestinal bacteria that tryptophan gene knocks out.
Embodiment 3 utilizes the temperature control promotor, construction expression DS gene and AS genophore
1, the structure of carrier pFYF000
Utilize molecular biological basic fundamental reconstructed vector pBV220 (giving birth to the worker), the displacement becoming of acillin resistant gene kalamycin resistance gene, the carrier called after pFYF000 after the reconstruction available from Shanghai.Press the molecular biology ordinary method, with reference to " molecular cloning ", the schema that makes up this carrier is seen Fig. 2.
2, the carrier pFYF001 of construction expression DS gene and AS gene
Adopt the tandem expression method, gene aroG and TrpED are subjected to the expression regulation of temperature control promotor.Obtain aroG mutator gene (upstream comprises the SD sequence) by QuikChange rite-directed mutagenesis test kit (available from Stratagene company), cut with the EcoRI enzyme through BamHI and to be connected the pUC18 carrier, transformed into escherichia coli screening positive clone, extract plasmid and carry out HindIII and the BamHI enzyme is cut, the TrpED gene that connection is cut through same enzyme, transformed into escherichia coli screening positive clone, extract plasmid once more and carry out HindIII and the EcoRI enzyme is cut, connect the pFYF000 plasmid, screening positive clone makes up pFYF001.The aroG encoding gene has become 146asp → Asn (complete sequence is shown in SEQ ID No.1), realizes removing the feedback inhibition of high density tryptophane to aroG gene encoding production enzymic activity.The carrier called after pFYF001 that builds.See Fig. 3.
Embodiment 4 fermentative production tryptophanes
1, produces the structure and the fermentative production tryptophane of tryptophane coli strain
With the carrier pFYF001 that builds, with CaCl
2Method transforms the e. coli strains that the tryptophan gene among the embodiment 2 is knocked out, and is coated with on the flat board that contains kantlex (35-80 μ g/L) to cultivate down in 37 ℃, selects positive colony.Unconverted intestinal bacteria are containing on the flat board of kantlex and can not grow.
2, Escherichia coli fermentation is produced tryptophane
Above-mentioned positive colony intestinal bacteria are inoculated in the seed culture medium that contains 300mL, and substratum sees Table 1.Under 30 ℃, cultivate on the shaking table of 200rpm, treat OD
600When value reaches 1.0-1.2.Seed culture fluid with gained is inoculated in 30 ℃ of cultivations of 10 liters of fermentor tanks again, and fermention medium sees Table 2.Add 18% ammoniacal liquor control pH by stream, dissolved oxygen is controlled between the 20-40%, and stirring velocity is controlled at 250-500rpm.Stream adds glucose during the fermentation, and the glucose concn in the control substratum is between 0.1-0.2%.Work as OD
600When value reached 50-60, regulating leavening temperature was 37 ℃, continued stream and added glucose, and the fermention medium glucose concn is controlled between the 0.1-0.2%.Ferment and finish after 45 hours, and measure tryptophane concentration in the fermentation with the high performance liquid chromatograph device, the tryptophane concentration of mensuration reaches the 23.7g/L fermented liquid.
Table 1 seed culture based component
| Composition | Content | Composition | Content |
| Trisodium citrate H 2O | ??0.2g/L | ?MgSO 4·7H 2O | ??0.4g/L |
| ?(NH 4) 2SO 4 | ??1.5g/L | ?KH 2PO 4 | ??1g/L |
| ?KCl | ??0.25g/L | Vitamin | ??5mg/L |
| Kantlex | ??35μg/L | Trace element (seeing Table 3) | ??2mL/L |
| Glucose | ??4g/L | Yeast extract | ??1.2g/L |
Table 2 fermentation culture based component
| Composition | Content | Composition | Content |
| ??MgSO 4·7H 2O | ??3g/L | Trisodium citrate H 2O | ??2g/L |
| ??(NH 4) 2SO 4 | ??8.5g/L | ?KH 2PO 4 | ??1g/L |
| ??FeSO 47H 2O | ??1.3g/L | ?K 2SO 4 | ??2.1g/L |
| Glucose | ??30g/L | Trace element (seeing Table 3) | ??4mg/L |
| Kantlex | ??10μg/L |
The micro-composition of table 3
| Composition | Content | Composition | Content |
| ??Na 2MoO 4·H 2O | ??0.15g/L | ??ZnSO 4·7H 2O | ??0.25g/L |
| ??KAl(SO 4) 2·12H 2O | ??0.2g/L | ??CuSO 4·5H 2O | ??0.3g/L |
| ??CoCl 2·6H 2O | ??0.7g/L | ??MnCl 2·7H 2O | ??1.2g/L |
| ??H 3BO 3 | ??2.0g/L | ??FeSO 47H 2O | ??0.13g/L |
The above only is a preferred implementation of the present invention; should be pointed out that for those skilled in the art, under the prerequisite that does not break away from the technology of the present invention principle; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.
Sequence table
＜110〉Anhui Fengyuan Fermentation Technology Engineering Research Co., Ltd.
＜120〉construction process of the coli strain of production tryptophane and the bacterial strain of structure
<130>KHP10112325.5
<160>8
<170>PatentIn?version?3.5
<210>1
<211>1053
<212>DNA
<213>aroG
<400>1
atgaattatc?agaacgacga?tttacgcatc?aaagaaatca?aagagttact?tcctcctgtc?????60
gcattgctgg?aaaaattccc?cgctactgaa?aatgccgcga?atacggttgc?ccatgcccga????120
aaagcgatcc?ataagatcct?gaaaggtaat?gatgatcgcc?tgttggttgt?gattggccca????180
tgctcaattc?atgatcctgt?cgcggcaaaa?gagtatgcca?ctcgcttgct?ggcgctgcgt????240
gaagagctga?aagatgagct?ggaaatcgta?atgcgcgtct?attttgaaaa?gccgcgtacc????300
acggtgggct?ggaaagggct?gattaacgat?ccgcatatgg?ataatagctt?ccagatcaac????360
gacggtctgc?gtatagcccg?taaattgctg?cttgatatta?acgacagcgg?tctgccagcg????420
gcaggtgagt?ttctcaatat?gatcacccca?caatatctcg?ctgacctgat?gagctggggc????480
gcaattggcg?cacgtaccac?cgaatcgcag?gtgcaccgcg?aactggcatc?agggctttct????540
tgtccggtcg?gcttcaaaaa?tggcaccgac?ggtacgatta?aagtggctat?cgatgccatt????600
aatgccgccg?gtgcgccgca?ctgcttcctg?tccgtaacga?aatgggggca?ttcggcgatt????660
gtgaatacca?gcggtaacgg?cgattgccat?atcattctgc?gcggcggtaa?agagcctaac????720
tacagcgcga?agcacgttgc?tgaagtgaaa?gaagggctga?acaaagcagg?cctgccagca????780
caggtgatga?tcgatttcag?ccatgctaac?tcgtccaaac?aattcaaaaa?gcagatggat????840
gtttgtgctg?acgtttgcca?gcagattgcc?ggtggcgaaa?aggccattat?tggcgtgatg????900
gtggaaagcc?atctggtgga?aggcaatcag?agcctcgaga?gcggggagcc?gctggcctac????960
ggtaagagca?tcaccgatgc?ctgcatcggc?tgggaagata?ccgatgctct?gttacgtcaa???1020
ctggcgaatg?cagtaaaagc?gcgtcgcggg?taa????????????????????????????????1053
<210>2
<211>3158
<212>DNA
<213>trpED
<400>2
atgcaaacac?aaaaaccgac?tctcgaactg?ctaacctgcg?aaggcgctta?tcgcgacaat?????60
cccaccgcgc?tttttcacca?gttgtgtggg?gatcgtccgg?caacgctgct?gctggaatcc????120
gcagatatcg?acagcaaaga?tgatttaaaa?agcctgctgc?tggtagacag?tgcgctgcgc????180
attacagctt?taggtgacac?tgtcacaatc?caggcacttt?ccggcaacgg?cgaagccctc????240
ctggcactac?tggataacgc?cctgcctgcg?ggtgtggaaa?gtgaacaatc?accaaactgc????300
cgtgtgctgc?gcttcccccc?tgtcagtcca?ctgctggatg?aagacgcccg?cttatgctcc????360
ctttcggttt?ttgacgcttt?ccgtttattg?cagaatctgt?tgaatgtacc?gaaggaagaa????420
cgagaagcca?tgttcttcag?cggcctgttc?tcttatgacc?ttgtggcggg?atttgaagat????480
ttaccgcaac?tgtcagcgga?aaataactgc?cctgatttct?gtttttatct?cgctgaaacg????540
ctgatggtga?ttgaccatca?gaaaaaaagc?acccgtattc?aggccagcct?gtttgctccg????600
aatgaagaag?aaaaacaacg?tctcactgct?cgcctgaacg?aactacgtca?gcaactgacc????660
gaagccgcgc?cgccgctgcc?agtggtttcc?gtgccgcata?tgcgttgtga?atgtaatcag????720
agcgatgaag?agttcggtgg?cgtagtgcgt?ttgttgcaaa?aagcgattcg?cgctggagaa????780
attttccagg?tggtgccatc?tcgccgtttc?tctctgccct?gcccgtcacc?gctggcggcc????840
tattacgtgc?tgaaaaagag?taatcccagc?ccgtacatgt?tttttatgca?ggataatgat????900
ttcaccctat?ttggcgcgtc?gccggaaagc?tcgctcaagt?atgatgccac?cagccgccag????960
attgagatct?acccgattgc?cggaacacgc?ccacgcggtc?gtcgcgccga?tggttcactg???1020
gacagagatc?tcgacagccg?tattgaactg?gaaatgcgta?ccgatcataa?agagctgtct???1080
gaacatctga?tgctggttga?tctcgcccgt?aatgatctgg?cacgcatttg?cacccccggc???1140
agccgctacg?tcgccgatct?caccaaagtt?gaccgttatt?cctatgtgat?gcacctcgtc???1200
tctcgcgtag?tcggcgaact?gcgtcacgat?cttgacgccc?tgcacgctta?tcgcgcctgt???1260
atgaatatgg?ggacgttaag?cggtgcgccg?aaagtacgcg?ctatgcagtt?aattgccgag???1320
gcggaaggtc?gtcgccgcgg?cagctacggc?ggcgcggtag?gttatttcac?cgcgcatggc???1380
gatctcgaca?cctgcattgt?gatccgctcg?gcgctggtgg?aaaacggtat?cgccaccgtg???1440
caagcgggtg?ctggtgtagt?ccttgattct?gttccgcagt?cggaagccga?cgaaacccgt???1500
aacaaagccc?gcgctgtact?gcgcgctatt?gccaccgcgc?atcatgcaca?ggagactttc???1560
tgatggctga?cattctgctg?ctcgataata?tcgactcttt?tacgtacaac?ctggcagatc???1620
agttgcgcag?caatgggcat?aacgtggtga?tttaccgcaa?ccatataccg?gcgcaaacct???1680
taattgaacg?cttggcgacc?atgagtaatc?cggtgctgat?gctttctcct?ggccccggtg???1740
tgccgagcga?agccggttgt?atgccggaac?tcctcacccg?cttgcgtggc?aagctgccca???1800
ttattggcat?ttgcctcgga?catcaggcga?ttgtcgaagc?ttacgggggc?tatgtcggtc????1860
aggcgggcga?aattctccac?ggtaaagcct?ccagcattga?acatgacggt?caggcgatgt????1920
ttgccggatt?aacaaacccg?ctgccggtgg?cgcgttatca?ctcgctggtt?ggcagtaaca????1980
ttccggccgg?tttaaccatc?aacgcccatt?ttaatggcat?ggtgatggca?gtacgtcacg????2040
atgcggatcg?cgtttgtgga?ttccagttcc?atccggaatc?cattctcacc?acccagggcg????2100
ctcgcctgct?ggaacaaacg?ctggcctggg?cgcagcataa?actagagcca?gccaacacgc????2160
tgcaaccgat?tctggaaaaa?ctgtatcagg?cgcagacgct?tagccaacaa?gaaagccacc????2220
agctgttttc?agcggtggtg?cgtggcgagc?tgaagccgga?acaactggcg?gcggcgctgg????2280
tgagcatgaa?aattcgcggt?gagcacccga?acgagatcgc?cggggcagca?accgcgctac????2340
tggaaaacgc?agcgccgttc?ccgcgcccgg?attatctgtt?tgctgatatc?gtcggtactg????2400
gcggtgacgg?cagcaacagt?atcaatattt?ctaccgccag?tgcgtttgtc?gccgcggcct????2460
gtgggctgaa?agtggcgaaa?cacggcaacc?gtagcgtctc?cagtaaatct?ggttcgtccg????2520
atctgctggc?ggcgttcggt?attaatcttg?atatgaacgc?cgataaatcg?cgccaggcgc????2580
tggatgagtt?aggtgtatgt?ttcctctttg?cgccgaagta?tcacaccgga?ttccgccacg????2640
cgatgccggt?tcgccagcaa?ctgaaaaccc?gcaccctgtt?caatgtgctg?gggccattga????2700
ttaacccggc?gcatccgccg?ctggcgttaa?ttggtgttta?tagtccggaa?ctggtgctgc????2760
cgattgccga?aaccttgcgc?gtgctggggt?atcaacgcgc?ggcggtggtg?cacagcggcg????2820
ggatggatga?agtttcatta?cacgcgccga?caatcgttgc?cgaactgcat?gacggcgaaa????2880
ttaaaagcta?tcagctcacc?gcagaagact?ttggcctgac?accctaccac?caggagcaac????2940
tggcaggcgg?aacaccggaa?gaaaaccgtg?acattttaac?acgtttgtta?caaggtaaag????3000
gcgacgccgc?ccatgaagca?gccgtcgctg?cgaacgtcgc?catgttaatg?cgcctgcatg????3060
gccatgaaga?tctgcaagcc?aatgcgcaaa?ccgttcttga?ggtactgcgc?agtggttccg????3120
cttacgacag?agtcaccgca?ctggcggcac?gagggtaa????????????????????????????3158
<210>3
<211>22
<212>DNA
＜213〉AS 5 ' end non-coding region
<400>3
tgaacaaaat?tagagaataa?ca????????????????????22
<210>4
<211>22
<212>DNA
＜213〉AS 3 ' end non-coding region
<400>4
atgatgcaaa?ccgttttagc?ga?????????????????????22
<210>5
<211>38
<212>DNA
＜213〉artificial sequence
<400>5
cgcggatcca?ggaggtactt?gttttaatct?cttattgt????38
<210>6
<211>30
<212>DNA
＜213〉artificial sequence
<400>6
cggaattctc?gctaaaacgg?tttgcatcat?????????????30
<210>7
<211>102
<212>DNA
＜213〉artificial sequence
<400>7
atgaaggatt?atgtaatgga?aaactttaaa?catctccctg?aaccgttccg?cattcgtgtt????60
attgagccag?ttctcatgtt?tgacagctta?tcatcgataa?gc??????????????????????102
<210>8
<211>100
<212>DNA
＜213〉artificial sequence
<400>8
tcggttcgta?cgtaaaggtt?aatcctttaa?tattcgccgc?gttctctttc?acatgtttaa????60
aggcttcaat?atggcggacg?cgatggatat?gttctgccaa?????????????????????????100
Claims (6)
1. construction process of producing the coli strain of tryptophane, it comprises step:
Knock out colibacillary tryptophan gene;
Utilize the temperature control carrier, express 3-deoxidation-D-Arab-ketoheptose-7-phosphate synthase gene and the anthranilic acid synthase gene that is not subjected to the regulation and control of tryptophane feedback inhibition, obtain the coli strain of high yield tryptophane.
2. the method for claim 1, it is characterized in that, the method that knocks out tryptophan gene is: amplification contains the tetracycline resistance gene fragment of promotor and terminator sequence, PCR product with purifying transforms DH5 α competent cell, containing the 16-24h that grows on the culture plate of tsiklomitsin, select the positive colony that tryptophan gene knocks out.
3. method as claimed in claim 1 or 2 is characterized in that, the wherein said 3-deoxidation-D-Arab-ketoheptose-7-phosphate synthase gene that not regulated and control by the tryptophane feedback inhibition is the rite-directed mutagenesis gene of 146asp → Asn.
4. as each described method of claim 1-3, it is characterized in that the nucleotide sequence of wherein said anthranilic acid synthase gene is shown in SEQ ID No.2.
5. the coli strain that makes up of each described method of claim 1-4.
6. the application of the described bacterial strain of claim 5 in the fermentative production tryptophane.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010137994 CN101812426B (en) | 2010-04-02 | 2010-04-02 | Method for constructing colibacillus strain for producing tryptophan and constructed strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010137994 CN101812426B (en) | 2010-04-02 | 2010-04-02 | Method for constructing colibacillus strain for producing tryptophan and constructed strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101812426A true CN101812426A (en) | 2010-08-25 |
| CN101812426B CN101812426B (en) | 2013-03-20 |
Family
ID=42619793
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010137994 Active CN101812426B (en) | 2010-04-02 | 2010-04-02 | Method for constructing colibacillus strain for producing tryptophan and constructed strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101812426B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104651291A (en) * | 2015-02-10 | 2015-05-27 | 中国科学院天津工业生物技术研究所 | Recombinant strain for producing phenol and application of strain |
| CN111235079A (en) * | 2019-08-09 | 2020-06-05 | 山东汇冠康博生物科技有限公司 | Method for screening escherichia coli with high tryptophan yield |
| CN114729340A (en) * | 2021-01-29 | 2022-07-08 | Cj第一制糖株式会社 | Novel DAHP synthase variants and methods of producing L-lysine using the same |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1926232A (en) * | 2003-12-15 | 2007-03-07 | Cj株式会社 | E.coli mutant containing mutant genes related with tryptophan biosynthesis and production method of tryptophan by using the same |
-
2010
- 2010-04-02 CN CN 201010137994 patent/CN101812426B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1926232A (en) * | 2003-12-15 | 2007-03-07 | Cj株式会社 | E.coli mutant containing mutant genes related with tryptophan biosynthesis and production method of tryptophan by using the same |
Non-Patent Citations (2)
| Title |
|---|
| 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》 19970228 YOSHIMI KIKUCHI，ET AL Mutational Analysis of the Feedback Sites of Phenylalanine-Sensitive3-Deoxy-D-arabino-Heptulosonate-7-PhosphateSynthase of Escherichia coli 761-762 1-6 第63卷, 第2期 2 * |
| 《生物工程学报》 20080531 于金龙，等 大肠杆菌色氨酸生物合成途径关键酶的调控研究 844－850 1－6 第24卷, 第5期 2 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104651291A (en) * | 2015-02-10 | 2015-05-27 | 中国科学院天津工业生物技术研究所 | Recombinant strain for producing phenol and application of strain |
| CN111235079A (en) * | 2019-08-09 | 2020-06-05 | 山东汇冠康博生物科技有限公司 | Method for screening escherichia coli with high tryptophan yield |
| CN114729340A (en) * | 2021-01-29 | 2022-07-08 | Cj第一制糖株式会社 | Novel DAHP synthase variants and methods of producing L-lysine using the same |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101812426B (en) | 2013-03-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101814888B1 (en) | 5-aminolevulinic acid high-yield bacterial strain, preparation method and uses thereof | |
| ES2314076T3 (en) | CORINEFORM BACTERIES THAT PRODUCE CHEMICAL COMPOUNDS II. | |
| CN102453691B (en) | Escherichia coli engineering bacteria capable of realizing high yield of L-tryptophan | |
| SK279854B6 (en) | Microorganisms for the production of tryptophan, process for producing the same, and their use | |
| CN108913642B (en) | Escherichia coli genetic engineering bacteria and application thereof in synchronous production of L-tryptophan and L-valine through fermentation | |
| CN105296456B (en) | A kind of stability-enhanced glutamic acid decarboxylase enzyme mutant of pH and its application | |
| KR102035844B1 (en) | Recombinant coryneform microorganism to produce L-tryptophan and method for producing L-tryptophan using the same | |
| CN102994439A (en) | Escherichia coli recombinant strain producing shikimic acid, and construction method and application thereof | |
| CN110418843A (en) | The method that Novel L-tryptophan exports albumen and produces L-Trp using it | |
| CN104379729A (en) | Useful microorganism, and method for producing desired substance | |
| CN113549588B (en) | Genetically engineered bacterium for producing 5-hydroxytryptophan and construction method and application thereof | |
| CN101307301A (en) | L-tryptophan genetic engineering bacterium and process for producing L-tryptophan | |
| WO2022174597A1 (en) | Genetically engineered bacterium for producing l-sarcosine, construction method therefor and use thereof | |
| CN104995298A (en) | Method for producing phenol from renewable resources by fermentation | |
| JP2022547432A (en) | Use of transporter gene in Escherichia coli to improve L-tryptophan production efficiency | |
| CN109294966A (en) | A kind of the Corynebacterium glutamicum recombinant bacterium and its construction method of high yield L-Leu | |
| EP3023493B1 (en) | A modified ornithine decarboxylase protein and a use thereof | |
| KR20000052825A (en) | Microbial preparation of substances from aromatic metabolism/i | |
| CN114752589B (en) | Glutamic acid decarboxylase mutant and application thereof in production of gamma-aminobutyric acid | |
| CN101812426B (en) | Method for constructing colibacillus strain for producing tryptophan and constructed strain | |
| CN104928226A (en) | Recombined corynebacterium glutamicum and application of corynebacterium glutamicum to 5-aminolevulinic acid production | |
| CN105143440B (en) | Microorganism with L-Trp productivity and the method using the micro-organisms L-Trp | |
| CN103114069A (en) | Bacterium for fermenting L-tryptophan from mixed saccharum and fermentation method thereof | |
| CN103215198B (en) | Recombinant corynebacterium crematum is utilized to take glucose as the method for substrate one-step synthesis method γ-aminobutyric acid | |
| CN106520652B (en) | One plant of Corynebacterium glutamicum and its key gene for synthesizing tryptophan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |