CN101798349A - Anti-uPAR humanized antibody and coding gene thereof - Google Patents
Anti-uPAR humanized antibody and coding gene thereof Download PDFInfo
- Publication number
- CN101798349A CN101798349A CN200910242312A CN200910242312A CN101798349A CN 101798349 A CN101798349 A CN 101798349A CN 200910242312 A CN200910242312 A CN 200910242312A CN 200910242312 A CN200910242312 A CN 200910242312A CN 101798349 A CN101798349 A CN 101798349A
- Authority
- CN
- China
- Prior art keywords
- sequence
- antibody
- encoding
- ser
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses an anti-uPAR humanized antibody and a coding gene thereof. The amino acid sequence of the heavy chain variable region of the antibody is shown as the sequence 3 in a sequence table and that of the light chain variable region is shown as the sequence 1 in the sequence table. The experimental result proves that the antibody has good binding activity (the affinity is 1.49*10<-8>mol/L) and capability of inhibiting tumor cell growth and migration. The humanized antibody can better bind with uPAR, thereby ensuring the anti-tumor effect. In a method for preparing the antibody, the light chain and the heavy chain can be simultaneously expressed, the expression ratio of the light chain to the heavy chain is closer to 1:1, and the mutually matched double-chain antibodies with higher ratio are generated. In conclusion, the antibody and the preparation method thereof have extensive application prospects in the field of preventing and/or treating tumors.
Description
Technical field
The present invention relates to a kind of anti-uPAR humanized antibody and encoding gene thereof.
Background technology
(urokinase plasminogen activator receptor, uPAR) the mediation fibrinolytic system is being brought into play important effect in the infiltration of tumour with in shifting for urokinase type plasminogen activator (urokinase plasminogen activator) and urokinase type plasminogen activator receptor.Deep day by day along with uPA, the uPAR effect research in cancer, its clinical meaning comes into one's own very soon.Many experts think that uPA and uPAR are the features of malignant tumour, are consistent with the progress and the transfer of tumour.The expression that suppresses uPA and uPAR can reduce the invasion and attack and the transfer ability of kinds of tumors.Domestic and international many studies show that, can outside born of the same parents, realize the inhibition of approach that the uPAR signal transduction is led effectively by the combination of block ligand at the antibody of uPAR, to multiple by the uPAR overexpression or/and the caused human tumor that suddenlys change, especially squamous cell carcinoma of the head and neck, colorectal cancer, non-small cell type lung cancer etc. has curative effect preferably.
UPA is a kind of serine proteinase enzyme, and the assignment of genes gene mapping is in No. 10 karyomit(e), and its mRNA is 2.4kb, and molecular weight of albumen is 55000.UPA is the uPA (Pro-uPA) of strand non-activity when cell synthesizes and secrete, it is with after tumor cell surface specific receptors uPAR combines, Pro-uPA is activated and changes the uPA that activated two chains of A, B that connect with disulfide linkage are formed into, the A chain of uPA contains EGF sample functional zone, the original very high homology of this district and fibronectin and zymoplasm can mediate the combination of uPA and uPAR.The strand transmembrane glycoprotein that uPAR is made up of 313 amino-acid residues, the assignment of genes gene mapping is in No. 19 karyomit(e), and mRNA is 1.4kb, and relative molecular weight is 45000～55000.The uPAR structure comprises 3 homeodomains (D1, D2, D3), and wherein D1 contains and uPA bonded antigen decision family.UPAR activates uPA and is positioned cell surface provides the concentration of local mechanism that reaches cell and matrix junction between cell, and the enabling environment of the proteolysis of uPA mediation is provided for the tumour cell of expressing uPAR.
UPA and the infiltration and the transfer that can promote tumour after uPAR combines, but its concrete mechanism is still not exclusively clear.Generally believe at present, uPA is with after uPAR combines, can activate the plasmin system, make the multiple composition degraded of extracellular matrix and basilar membrane, cause the cascade reaction of protein cleavage, basilar membrane produces kitchen range and direct protein cleavage, thereby makes tumour cell penetrate the healthy tissues barrier, causes the infiltration and the transfer of tumour.Simultaneously, uPA with can also cause that cellular form changes, cytoskeleton is reinvented after uPAR combines and effect such as specificity Keratin sulfate phosphorylation.Ploug thinks that uPAR is usually raised, and interacts with multiple matrix metalloproteinase (MMP), is beneficial to proteolytic ferment degradation of cell epimatrix tumor-infiltrated and shift in the recombination event cause.Andreasen etc. think, uPA not only plays a role in tumor-infiltrated by the degradation of cell epimatrix, and in the tissue remodeling that tumour cell causes, play a role, can also cause the infiltration and the transfer of tumour by the mechanism that does not rely on fibrinolytic enzyme system, comprising multifactor interactions such as uPA, uPAR, extracellular matrix protein and somatomedins, this interaction allows this system in the tumor invasion transfer process, on time and space, reorganize, optionally degradation of cell epimatrix albumen.
Summary of the invention
An object of the present invention is to provide a kind of can with urokinase type plasminogen activator receptor bonded antibody and encoding gene thereof.
Antibody provided by the present invention, the aminoacid sequence of its variable region of heavy chain are shown in sequence in the sequence table 3, and the aminoacid sequence of its light chain is shown in sequence in the sequence table 1.
The encoding gene of the variable region of heavy chain of above-mentioned antibody is following 1), 2) or 3) shown in:
1) its nucleotide sequence is a dna molecular shown in the sequence 4 in the sequence table;
2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of the described variable region of heavy chain of encoding;
3) with sequence table in sequence 4 from 5 ' terminal 157-171bp and 261-283bp position Nucleotide has the dna molecular of the homology more than 70% and the described variable region of heavy chain of encoding;
The encoding gene of the light chain of above-mentioned antibody is following I), II) or III) shown in:
I) its nucleotide sequence is a dna molecular shown in the sequence 2 in the sequence table;
II) under stringent condition with I) the dna sequence dna hybridization that limits and the dna molecular of the described light chain of encoding;
III) with sequence table in sequence 2 from 5 ' terminal 160-184bp and 217-250bp position Nucleotide has the dna molecular of the homology more than 70% and the described light chain of encoding;
Described antibody is made up of heavy chain and light chain; Described heavy chain is made up of variable region of heavy chain and CH; The aminoacid sequence of described CH is shown in sequence in the sequence table 9; The encoding gene of described CH be following a), b) or c) shown in: a) its nucleotide sequence is a dna molecular shown in the sequence 10 in the sequence table;
B) under stringent condition with the dna sequence dna hybridization that a) limits and the dna molecular of the described CH of encoding;
C) and a) dna sequence dna that limits has the dna molecular of the homology more than 70% and the described CH of encoding.
Increase above-mentioned arbitrary described encoding gene total length or its any segmental primer to also belonging to protection scope of the present invention.
Described primer is right to being following primer:
1) primer sequence is shown in sequence in the sequence table 5, and another primer sequence of described primer centering is shown in sequence in the sequence table 6;
2) primer sequence is shown in sequence in the sequence table 7, and another primer sequence of described primer centering is shown in sequence in the sequence table 8.
The recombinant vectors, reorganization bacterium, transgenic cell line or the expression cassette that contain above-mentioned arbitrary described encoding gene also belong to protection scope of the present invention.
Another object of the present invention provides a kind of method for preparing above-mentioned antibody.
The method of the above-mentioned antibody of preparation provided by the present invention is that above-mentioned arbitrary described encoding gene is imported in the host cell, cultivates, and obtains described antibody.
In the described method, claim 2 or 3 described encoding genes are imported in the host cell by recombinant expression vector; Not only contain the above-mentioned encoding gene of stating the encoding gene of variable region of heavy chain but also containing above-mentioned light chain, and the encoding gene of the encoding gene of described variable region of heavy chain and described light chain is subjected to the regulation and control of same promotor in described recombinant vectors in the described recombinant expression vector.
Another object of the present invention provides a kind of inhibitor that suppresses urokinase type plasminogen activator receptor signal transduction pathway.
The inhibitor of antidiuresis kinases type plasminogen activator receptor signal transduction pathway provided by the present invention, its activeconstituents are above-mentioned antibody, above-mentioned arbitrary described encoding gene, above-mentioned arbitrary described recombinant vectors, above-mentioned arbitrary described reorganization bacterium, above-mentioned arbitrary described transgenic cell line and/or above-mentioned arbitrary described expression cassette.
Another object of the present invention provides a kind of inhibitor that suppresses tumor cell invasion.
The inhibitor of inhibition tumor cell invasion provided by the present invention, its activeconstituents are above-mentioned antibody, above-mentioned arbitrary described encoding gene, above-mentioned arbitrary described recombinant vectors, above-mentioned arbitrary described reorganization bacterium, above-mentioned arbitrary described transgenic cell line and/or above-mentioned arbitrary described expression cassette.
Another object of the present invention provides a kind of medicine that prevents and/or treats tumour.
The medicine that prevents and/or treats tumour provided by the present invention, its activeconstituents are above-mentioned antibody, above-mentioned arbitrary described encoding gene, above-mentioned arbitrary described recombinant vectors, above-mentioned arbitrary described reorganization bacterium, above-mentioned arbitrary described transgenic cell line and/or above-mentioned arbitrary described expression cassette.
Above-mentioned antibody, above-mentioned arbitrary described encoding gene, above-mentioned arbitrary described recombinant vectors, above-mentioned arbitrary described reorganization bacterium, above-mentioned arbitrary described transgenic cell line and/or the application of above-mentioned arbitrary described expression cassette in the inhibitor of preparation inhibition urokinase type plasminogen activator receptor signal transduction pathway also belong to protection scope of the present invention.
Above-mentioned antibody, above-mentioned arbitrary described encoding gene, above-mentioned arbitrary described recombinant vectors, above-mentioned arbitrary described reorganization bacterium, above-mentioned arbitrary described transgenic cell line and/or the application of above-mentioned arbitrary described expression cassette in the inhibitor of preparation inhibition tumor cell invasion also belong to protection scope of the present invention.
Above-mentioned antibody, above-mentioned arbitrary described encoding gene, above-mentioned arbitrary described recombinant vectors, above-mentioned arbitrary described reorganization bacterium, above-mentioned arbitrary described transgenic cell line and/or above-mentioned arbitrary described expression cassette also belong to protection scope of the present invention in the application that preparation prevents and/or treats in the tumour medicine.
Above-mentioned tumour specifically can be cervical cancer; Above-mentioned tumour cell specifically can be cervical cancer HeLa cell.
Experimental result confirms that antibody of the present invention has good binding activity, and (avidity is 1.49 * 10
-8Mol/L) and suppress the growth of tumour cell transfer ability.Humanized antibody of the present invention can better combine with uPAR, thereby has guaranteed its anti-tumour effect.The present invention prepares the method for antibody, can express light chain and heavy chain simultaneously, and the expression ratio that makes light chain and heavy chain produces the more double-stranded antibody of mutual coupling of height ratio more near 1: 1.To sum up, described antibody of the present invention and preparation method thereof will have broad application prospects preventing and/or treating fields of tumor.
Description of drawings
Fig. 1 is the agarose electrophoresis figure of light chain gene, heavy chain variable region gene pcr amplification product.
Fig. 2 is the structural representation of the pIRES expression vector of anti-uPAR humanized antibody.
Fig. 3 is that the reduced form SDS-PAGE of anti-uPAR humanized antibody detects.
Fig. 4 is that the avidity of anti-uPAR humanized antibody and uPAR detects figure.
Fig. 5 detects the antibody expression result for ELISA.
Fig. 6 is the immunoblotting assay result.
Embodiment
Employed experimental technique is ordinary method if no special instructions among the following embodiment.
Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.
The light chain encoding gene of embodiment 1, antibody and the acquisition of variable region of heavy chain encoding gene
According to computer simulation, be template with mouse monoclonal anti uPAR antibody, carry out humanization modified and synthetic sequence of light chain L2 of design and weight chain variabl area sequence S2Hb to its mouse source FR surface gene.The aminoacid sequence of light chain L2 is shown in sequence in the sequence table 1, and the nucleotide sequence of its encoding gene is shown in sequence in the sequence table 2; The aminoacid sequence of variable region of heavy chain S2Hb is shown in sequence in the sequence table 3, and the nucleotide sequence of its encoding gene is shown in sequence in the sequence table 4.The aminoacid sequence of CH is shown in sequence in the sequence table 9, and the coding gene sequence of CH is shown in sequence in the sequence table 10.
To 2L/2LR, adopt the method for overlapping extension PCR by primer, amplification obtains the coding gene sequence of light chain; To 2H/2HR, adopt the method for overlapping extension PCR by primer, amplification obtains the coding gene sequence of variable region of heavy chain.
Light chain (L) primer: 2L:CGGATCCGCT AGCCGCCACC ATGGACATCC AGATGACTCA GTCCCCATCTACTCTGTCTG CTTCCGT (sequence 5)
2LR:CG GAA TTC TCA GGAACT CCAGTAGCGC GAGAGGAAGC CTCGTACATC AGT (sequence 6)
Heavy chain (H) variable region primer:
2H:GTG TCT AGA GCC GCC ACC ATGGAGGTTC AGCTGGTTCA GTCCGGTGCT (sequence 7)
2HR:GTG GGA TCC ACT TAC CTGT CTTAGGCTCA ACCTTCTTGT CAACCTTAGT (sequence 8)
Each fragment that amplification is obtained is carried out agarose gel electrophoresis and is detected, detected result as shown in Figure 1, the result is big or small consistent with expection, L and H clip size are about 735bp and 770bp (Fig. 1, M. relative molecular mass standard respectively; A: swimming lane 2 is light chain gene product L2; B: swimming lane 2 is heavy chain variable region gene S2Hb);
The L2 and the S2Hb fragment that obtain are cloned into the pMD18-T carrier respectively, and transformed into escherichia coli DH5a chooses the clone, extracts plasmid and order-checking evaluation.The result shows that it is correct to obtain fragments sequence, and the recombinant vectors note that will contain correct L2 is made pMD18-T/L2, and the recombinant vectors note that will contain correct S2Hb is made pMD18-T/S2Hb.
The antibody note that light chain L2, variable region of heavy chain S2Hb, CH constitute is made Y2B.
The expression and purification of embodiment 2, antibody
One, the structure of recombinant expression vector:
The pIRES dual-expression vector is available from Clontech company, and catalog number is 631605; The pMD18-T expression vector is available from Takara Bio Company, and catalog number is: D504CA.
Carrier pIRES-Ant i-CD20 (" expression of CD 20 antagonizing Chimeric antibody and active the detection ", Chinese biological engineering magazine (china biotechnology), 2005,25 (7): 34-39.) (Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A).
Use corresponding restriction enzyme (Nhe I and EcoRI) enzyme to cut respectively recombinant vectors pMD18-T/L2 and pIRES dual-expression vector, behind the agarose gel electrophoresis, reclaim purifying purpose fragment; With light chain gene fragment L2 and carrier segments mixing, under the effect that connects reagent, 16 ℃ of reaction 12h.Transformed into escherichia coli DH5a chooses the clone, extracts plasmid and order-checking is identified, as a result in this recombinant expression vector the direction of insertion of gene correctly to reach insertion sequence correct, note is made recombinant expression vector pIRES/L2.
The clone has the pMD18-T carrier of weight chain constant area gene: cut pIRES-Anti-CD20 with BamH I and Not I enzyme, reclaim the CH fragment, clone the pMD18-T carrier of cutting with BamH I and Not I enzyme in also, order-checking is identified, is obtained the pMD18-T carrier that correct clone has weight chain constant area gene.
With recombinant expression vector pIRES/L2 is template, cuts with Xba I and Not I enzyme, reclaims the big fragment of carrier, and note is made fragment 1; With the clone pMD18-T carrier (being pMD18-T/S2Hb) of heavy chain variable region gene being arranged is template, cuts with XbaI and BamH I enzyme, reclaims the variable region of heavy chain fragment, and note is made fragment 2; With the clone pMD18-T carrier of weight chain constant area gene being arranged is template, cuts with BamH I and Not I enzyme, reclaims the CH fragment, and note is made fragment 3; Fragment 1,2 is connected with fragment 3, obtains recombinant vectors, transformed into escherichia coli DH5a chooses the clone, extracts plasmid and order-checking evaluation.The result shows that the structure of the recombinant expression vector that obtains is correct, and the direction of the gene of insertion and order are correct; The shared same promotor of the weight chain gene of antibody connects by the IRES sequence, has finally made up expression plasmid.Positive recombinant expression vector note is made pIRES-Anti-uPAR (Fig. 2).
Two, the expression of carrier conversion and antibody
293T cell (293T human embryo kidney (HEK) T cell) is available from American Type Culture Collecti's (American type culturecollection, ATCC claim the US mode bacterial classification to collect the center again), and catalog number is CRL-11268; Lipofectamine 2000 is available from Invitrogen company, and catalog number is 12566014; The HyQSFM4CHO substratum is available from HyClone company, and catalog number is SH30518.02; RProtein A chromatography column is available from available from GE Healthcare company, and catalog number is 17-5080-01.The DMEM substratum is available from Gibco company, and catalog number is 12100-046; The anti-people of goat-IgG-HRP antibody is available from Sigma company, and catalog number is 046K4801.
The 293T cell is pressed 1 * 10
6/ ml is inoculated in respectively in the culture dish that diameter is 10cm, and the DMEM substratum that contains 10% foetal calf serum is housed in the culture dish, 37 ℃, 5%CO
2Incubator is cultivated.Get the plasmid pIRES-Ant i-uPAR transfection 293T cell that obtains in the 5 μ g step 1, concrete operations are with reference to the reagent explanation of Lipofectamine 2000.Obtain reconstitution cell 293T-pIRES-Anti-uPAR.With reconstitution cell 293T-pIRES-Anti-uPAR serum-free DMEM culture medium culturing, sucking-off serum free medium behind cultivation 6～8h replaces the HyQSFM4CHO substratum.84h is cultivated in continuation altogether under the same terms, and 12h collects cell conditioned medium one time at interval, with the expression of ELISA method Preliminary detection antibody.Enlarge rotaring redyeing system, collecting cell culture supernatant 4～5L transfers pH to 6.0～7.0, with 0.45 μ m membrane filtration, uses rProtein A chromatography column antibody purification again, and concrete operations are referring to product description.
ELISA method: the double antibody sandwich method that is used to detect unknown antigen:
1. bag quilt: being cushioned liquid with 0.05M PH9.0 carbonate bag, antibody (one anti-be the anti-human IgG of goat) is diluted to protein content is 1～10 μ g/ml.Add 0.1ml in the reacting hole of each polystyrene board, 4 ℃ are spent the night.Discard solution in the hole next day, washes 3 times each 3 minutes with lavation buffer solution.(being called for short washing, down together).
2. application of sample: the sample 0.1ml to be checked that adds certain dilution in above-mentioned wrapped by reacting hole in, put 37 ℃ and hatched 1 hour.Washing then.(doing blank well simultaneously, negative control hole and positive control hole).
3. add enzyme labelled antibody (the two anti-anti-human IgG-HRP of goat (the anti-human IgG-horseradish peroxidase of goat) of being): in each reacting hole, add enzyme labelled antibody (extent of dilution after the titration) 0.1ml of fresh dilution.Hatched 0.5～1 hour washing for 37 ℃.
4. add substrate solution colour developing: in each reacting hole, add the tmb substrate solution 0.1ml of interim preparation, 37 ℃ 10～30 minutes.
5. termination reaction: in each reacting hole, add 2M sulfuric acid 0.05ml.
6. the result judges: can be on white background, and the result directly detects by an unaided eye: color is dark more in the reacting hole, and positive degree is strong more, and negative reaction is colourless or extremely shallow, according to the depth of be color, with "+", "-" number expression.Also can survey the OD value: on the ELISA detector, locate, survey each hole OD value with zeroing back, blank hole in 450nm (if with ABTS colour developing, then 410nm), if it is greater than 2.1 times of the negative control OD value of stipulating, promptly positive.
Reagent
(1) bag is cushioned liquid (PH9.60.05M carbonate buffer solution): Na
2CO
31.59 gram, NaHCO
32.93 gram, adding distil water is to 1000ml.
(2) lavation buffer solution (PH7.4PBS): 0.15M:KH
2PO
40.2 gram, Na
2HPO
412H
2The O2.9 gram, NaCl 8.0 grams, KCl 0.2 gram, Tween-200.05%0.5ml, adding distil water is to 1000ml.
(3) diluent: bovine serum albumin (BSA) 0.1 gram adds lavation buffer solution and is made into 5～10% uses to 100ml or with serum such as sheep blood serum, rabbit anteserum and washings.
(4) stop buffer (2M H
2SO4): distilled water 178.3ml dropwise adds the vitriol oil (98%) 21.7ml.
The result as shown in Figure 5, among Fig. 5, A1 is a blank, B1-B12 is a recombinant expression vector pIRES-Anti-uPAR transient transfection 293T cell, the Y2B antibody that different Tissue Culture Dishs are expressed.The result shows that the pIRES-Anti-uPAR of structure obtains to express at the 293T cell, obtains target protein Y2B antibody.Although different Tissue Culture Dish expression amounts are variant, factor such as cell state and carrier amount was relevant when this may be with transfection.
With rProtein A chromatography column antibody purification: purification media: HiTrap rProtein A FF, 5ml, available from GE company, catalog number (Cat.No.) 17-5079-01, working instructions see also the specification sheets that its company provides in detail.
Operation:
1) cleans, with 1M NaOH and ddH
2O is pipe blow-through successively, uses ddH again after little filter is boiled 10min with 0.1M NaOH
2O soaks 1～2min;
2) setting program connects rProtein A affinity column;
3) with 20mM binding buffer liquid (pH7.0) balance chromatography column;
4) cell conditioned medium that will prepare is with sample on the flow velocity of 1～2ml/min; Cell conditioned medium preparation: with 12000g centrifugal 15 minutes, take out supernatant, through the filtration sterilization of 0.22um nitrocellulose filter.
Use 1M elution buffer (pH3.0) wash-out target protein when 5) upward sample will finish;
6) collect albumen, (pH9.0) transfers to 7.0 with its pH with Trise alkali, electrophoresis detection;
7) set by step 1) pipe blow-through and little filter.
Sodium phosphate salt damping fluid (binding buffer liquid): as the binding buffer liquid of ProteinA purifying.Compound method is: get 1M Na
2HPO
457.7ml and 1M NaH
2PO
442.3ml mixing is the sodium phosphate salt damping fluid 100ml of 0.1M pH7.0, and is standby to 20Mm with distilled water diluting again.
Citric acid-sodium citrate damping fluid (elution buffer): as the elution buffer of ProteinA purifying.Compound method is: get 0.1M citric acid 186ml and 0.1M Trisodium Citrate 14ml mixing, be the citrate buffer 200ml of 0.1M pH3.0.
Get 15 μ l antibody purification Y2B respectively and on 12% gel, reduce the SDS-PAGE electrophoresis, with Coomassie brilliant blue R-250 dyeing.The result shows that the relative molecular mass of the heavy chain of purifying gained antibody is respectively 50 * 10
3, the relative molecular mass of light chain is 25 * 10
3(among Fig. 3, swimming lane 3 is the heavy chain and the light chain of antibody, and swimming lane 1 is an albumen relative molecular mass standard), consistent with expected results.
Rituxan (the medicine name: Mabthera) (popular name: the Rituximab injection liquid) available from Shanghai company limited of Roche Group, manufacturers: F.Hoffmann-La Roche Inc.
Immunoblotting assay experiment: get 15 μ l antibody purifications respectively and on 12% gel, reduce the SDS-PAGE electrophoresis, be transferred on the nitrocellulose filter, taking out film (contains 1 * PBST) of 5% skim-milk and seals 2h in room temperature with confining liquid, goat anti-human igg-HRP antibody with dilution in 1: 5000 is hatched 2h (room temperature) with it, uses 1 * PBST to wash film 3 times again.With the ECL colour developing, expose at last with X-ray film.The result as shown in Figure 6 (the 1st, standard substance Rituxan; The 3rd, Y2B antibody).The result shows that the Y2B antibody of acquisition can combine with goat anti-human igg's specificity.The molecular weight size is consistent with expected results.
The function of embodiment 3, antibody
One, Biacore detects humanized antibody Y2B and antigenic binding ability
UPAR albumen is available from R﹠amp; D Systems, catalog number is 807-UK-100.Sensor Chip CM5 is available from BD company, and catalog number is Br-1000-14; BD BioCoat
TMMatrigel
TMInvasionChamber is available from BD company, and catalog number is 354480.
Avidity with Biacore3000 measuring apparatus antibody Y2B and uPAR.Prepare the 10mmol/L NaAc dilution uPAR albumen of different pH values (4.0,4.5,50 and 5.5), on the CM5 chip, do pre-concentration, select the NaAc diluted protein of optimum pH.On the CM5 sensing chip, moving phase is HBS-EP (pH7.4) with the antibody purified covalent coupling, and flow velocity 20 μ l/min get the detection of five kinds of concentration of antibody (0,12.5,25,50 and 100nmol/L) and uPAR protein binding avidity.Avidity is calculated with Biacore3000 bundled software.
3 repetitions are established in experiment, and the result takes the mean.
The anti-uPAR humanized antibody Y2B of purifying is combined with antigen uPAR, and Biacore detects its binding ability, and the result shows that Y2B and antigenic avidity are 1.49 * 10
-8Mol/L (Fig. 4).
Two, tumor cell invasion experiment
The HeLa cell is available from American Type Culture Collecti's (American type culture collection, ATCC claim the US mode bacterial classification to collect the center again), and catalog number is CCL-2
TMHuman IgG is available from available from biotech company of Beijing fresh warp thread section, and catalog number is 30101;
With DMEM culture medium culturing HeLa cell.With serum-free DMEM aquation invasion and attack chamber (invasion chamber), hatch 2h (37 ℃, 5%CO
2).Abandon serum-free DMEM, the pore chamber in the invasion and attack chamber adds 750 μ l DMEM (containing 10% serum); In inserting (insert) chamber, add 475 μ l DMEM (containing 1% serum), then to HeLa cell (cell count＞10 that wherein add 25 μ l digestion
5/ 500 μ l), add negative control human IgG and humanized antibody Y2B at last respectively in inserting the chamber, each sample all has two multiple holes, and the antibody final concentration is 100ng/ml.After hatching 24h, wipe with aseptic cotton carrier failing to penetrate the cell of attacking the box basilar membrane; After cell fixation, dyeing, the room temperature that penetrates basilar membrane dried, the light microscopic counting.
Statistical procedures: under 100 power microscopes, calculate corresponding 3 groups of cell count that each inserts sample in the chamber.Use SPSS12.0 statistical software pair cell invasion and attack experimental data to carry out the t check, Y2B group and human IgG group are compared.If the result is that P＜0.05, two kind of treatment effect difference has statistical significance.
3 repetitions are established in experiment, and the result takes the mean.T check analysis result shows (table 1): the P value of human IgG group and Y2B group is less than 0.01, and anti-uPAR antibody Y2B compares with control group human IgG group, and significant difference has significant inhibitory effect to the HeLa invasion by tumor cells.
The t detected result of table 1, cell invasion experiment
Annotate: with the contrast of human IgG group,
*P＜0.01;
Sequence table
＜110〉Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A
＜120〉a kind of anti-uPAR humanized antibody and encoding gene thereof
<160>10
<210>1
<211>237
<212>PRT
＜213〉artificial sequence
<220>
<223>
<400>1
Val?Ser?Arg?Ala?Ala?Thr?Met?Asp?Phe?Gln?Val?Gln?Ile?Ile?Ser?Phe
1 5 10 15
Leu?Leu?Ile?Ser?Ala?Ser?Val?Ile?Met?Ser?Arg?Gly?Asp?Ile?Gln?Met
20 25 30
Thr?Gln?Ser?Pro?Ser?Thr?Leu?Ser?Ala?Ser?Val?Gly?Asp?Arg?Val?Thr
35 40 45
Ile?Thr?Cys?Arg?Ala?Ser?Ser?Ser?Val?Ser?Tyr?Ile?His?Trp?Tyr?Gln
50 55 60
Gln?Lys?Pro?Gly?Arg?Ala?Pro?Lys?Pro?Leu?Met?Tyr?Glu?Ala?Ser?Ser
65 70 75 80
Arg?Ala?Thr?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly?Ser?Gly?Ser?Gly?Thr
85 90 95
Glu?Tyr?Thr?Leu?Thr?Ile?Ser?Ser?Leu?Gln?Ser?Asp?Asp?Phe?Ala?Thr
100 105 110
Tyr?Tyr?Cys?Gln?Gln?Trp?Asn?Tyr?Pro?Phe?Thr?Phe?Gly?Gln?Gly?Thr
115 120 125
Lys?Leu?Glu?Ile?Lys?Arg?Thr?Val?Ala?Ala?Pro?Ser?Val?Phe?Ile?Phe
130 135 140
Pro?Pro?Ser?Asp?Glu?Gln?Leu?Lys?Ser?Gly?Thr?Ala?Ser?Val?Val?Cys
145 150 155 160
Leu?Leu?Asn?Asn?Phe?Tyr?Pro?Arg?Glu?Ala?Lys?Val?Gln?Trp?Lys?Val
165 170 175
Asp?Asn?Ala?Leu?Gln?Ser?Gly?Asn?Ser?Gln?Glu?Ser?Val?Thr?Glu?Gln
180 185 190
Asp?Ser?Lys?Asp?Ser?Thr?Tyr?Ser?Leu?Ser?Ser?Thr?Leu?Thr?Leu?Ser
195 200 205
Lys?Ala?Asp?Tyr?Glu?Lys?His?Lys?Leu?Tyr?Ala?Cys?Glu?Val?Thr?His
210 215 220
Gln?Gly?Leu?Ser?Ser?Pro?Val?Thr?Lys?Ser?Phe?Asn?Arg
225 230 235
<210>2
<211>711
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>2
gtgtctagag?ccgccaccat?ggattttcag?gtgcagatta?tcagcttcct?gctaatcagt 60
gctagcgtca?taatgtccag?aggagacatc?cagatgactc?agtccccatc?tactctgtct 120
gcttccgttg?gcgaccgtgt?taccatcact?tgccgtgctt?ctagctccgt?ttcttacatc 180
cactggtacc?agcaaaagcc?gggtcgtgct?ccgaagccac?tgatgtacga?ggcttcctct 240
cgcgctactg?gagttccatc?tcgcttctct?ggttccggtt?ctggcactga?gtacactctg 300
actatctcct?ctctgcagag?cgacgacttc?gctacttact?actgccagca?gtggaactac 360
ccattcactt?tcggacaggg?tactaagctg?gagatcaagc?gtactgttgc?tgctccatct 420
gttttcatct?tcccaccgtc?cgacgagcag?ctgaagtctg?gcactgcttc?tgttgtctgc 480
ctgctgaaca?atttctaccc?gcgcgaggct?aaggttcagt?ggaaggttga?caacgctctg 540
cagtccggta?actcccagga?gtctgttact?gagcaggact?ctaaggactc?tacttactct 600
ctgtcctcaa?ctctgactct?ctctaaggct?gactacgaga?agcacaagct?gtacgcttgc 660
gaggttactc?accagggtct?gtcctctcca?gttactaagt?ctttcaaccg?t 711
<210>3
<211>234
<212>PRT
＜213〉artificial sequence
<220>
<223>
<400>3
Val?Ser?Arg?Ala?Ala?Thr?Met?Gly?Trp?Ser?Leu?Ile?Leu?Leu?Phe?Leu
1 5 10 15
Val?Ala?Val?Ala?Thr?Arg?Val?Leu?Ser?Glu?Val?Gln?Leu?Val?Gln?Ser
20 25 30
Gly?Ala?Glu?Val?Lys?Lys?Pro?Gly?Ser?Ser?Val?Lys?Val?Ser?Cys?Lys
35 40 45
Ala?Ser?Gly?Tyr?Thr?Phe?Thr?Asp?Tyr?Tyr?Ile?His?Trp?Val?Arg?Gln
50 55 60
Ala?Pro?Gly?Gln?Gly?Leu?Glu?Trp?Ile?Gly?Trp?Ile?Phe?His?Gly?Ser
65 70 75 80
Asp?Asn?Thr?Glu?Tyr?Asn?Glu?Lys?Phe?Lys?Ser?Lys?Ala?Thr?Ile?Thr
85 90 95
Ala?Asp?Glu?Ser?Thr?Ser?Thr?Ala?Tyr?Met?Glu?Leu?Ser?Ser?Leu?Arg
100 105 110
Ser?Glu?Asp?Thr?Ala?Val?Phe?Tyr?Cys?Ala?Arg?Trp?Gly?Pro?His?Trp
115 120 125
Tyr?Phe?Asp?Ala?Trp?Gly?Arg?Gly?Thr?Leu?Val?Thr?Val?Ser?Pro?Ala
130 135 140
Ser?Thr?Lys?Gly?Pro?Ser?Val?Phe?Pro?Leu?Ala?Pro?Ser?Ser?Lys?Ser
145 150 155 160
Thr?Ser?Gly?Gly?Thr?Ala?Ala?Leu?Gly?Cys?Leu?Val?Lys?Asp?Tyr?Phe
165 170 175
Pro?Glu?Pro?Val?Thr?Val?Ser?Trp?Asn?Ser?Gly?Ala?Leu?Thr?Ser?Gly
180 185 190
Val?His?Thr?Phe?Pro?Ala?Val?Leu?Gln?Ser?Ser?Gly?Leu?Tyr?Ser?Leu
195 200 205
Ser?Ser?Val?Val?Thr?Val?Pro?Ser?Ser?Ser?Leu?Gly?Thr?Gln?Thr?Tyr
210 215 220
Ile?Cys?Asn?Val?Asn?His?Lys?Pro?Ser?Asn
225 230
<210>4
<211>702
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>4
gtgtctagag?ccgccaccat?gggttggagc?ctcatcttgc?tcttccttgt?cgctgttgct 60
acgcgtgtcc?tgtccgaggt?tcagctggtt?cagtccggtg?ctgaggttaa?gaagccaggt 120
tcctctgtta?aggtttcttg?caaggcttct?ggctacactt?tcaccgacta?ctacatccac 180
tgggttcgtc?aggctccagg?ccagggtctg?gagtggatcg?gttggatctt?ccacggttct 240
gacaacactg?agtacaacga?gaagttcaag?tctaaggcta?ctatcactgc?tgacgagtcc 300
acttctaccg?cttacatgga?gctgtcctct?ctgcgttccg?aggacactgc?tgttttctac 360
tgcgctcgtt?ggggtccaca?ctggtacttc?gacgcttggg?gtcgtggtac?tctggttact 420
gtttccccag?cttctaccaa?gggtccatcc?gttttcccac?tggctccgtc?ctctaagtct 480
actagcggcg?gtactgccgc?tctgggttgc?ctggttaagg?actacttccc?agagccagtt 540
actgtttcat?ggaactcagg?tgctctgact?tctggcgttc?acactttccc?tgctgttctg 600
cagtcctctg?gtctgtacag?cctgtcttcc?gttgtcactg?ttccgtccag?ctctctgggt 660
actcagacat?acatctgcaa?cgttaaccac?aagccatcca?ac 702
<210>5
<211>67
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>5
cggatccgct?agccgccacc?atggacatcc?agatgactca?gtccccatct?actctgtctg 60
cttccgt 67
<210>6
<211>50
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>6
cggaattctc?aggaactcca?gtagcgcgag?aggaagcctc?gtacatcagt 50
<210>7
<211>48
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>7
gtgtctagag?ccgccaccat?ggaggttcag?ctggttcagt?ccggtgct 48
<210>8
<211>49
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>8
gtgggatcca?cttacctgtc?ttaggctcaa?ccttcttgtc?aaccttagt 49
<210>9
<211>330
<212>PRT
＜213〉artificial sequence
<220>
<223>
<400>9
Ala?Ser?Thr?Lys?Gly?Pro?Ser?Val?Phe?Pro?Leu?Ala?Pro?Ser?Ser?Lys
1 5 10 15
Ser?Thr?Ser?Gly?Gly?Thr?Ala?Ala?Leu?Gly?Cys?Leu?Val?Lys?Asp?Tyr
20 25 30
Phe?Pro?Glu?Pro?Val?Thr?Val?Ser?Trp?Asn?Ser?Gly?Ala?Leu?Thr?Ser
35 40 45
Gly?Val?His?Thr?Phe?Pro?Ala?Val?Leu?Gln?Ser?Ser?Gly?Leu?Tyr?Ser
50 55 60
Leu?Ser?Ser?Val?Val?Thr?Val?Pro?Ser?Ser?Ser?Leu?Gly?Thr?Gln?Thr
65 70 75 80
Tyr?Ile?Cys?Asn?Val?Asn?His?Lys?Pro?Ser?Asn?Thr?Lys?Val?Asp?Lys
85 90 95
Lys?Ala?Glu?Pro?Lys?Ser?Cys?Asp?Lys?Thr?His?Thr?Cys?Pro?Pro?Cys
100 105 110
Pro?Ala?Pro?Glu?Leu?Leu?Gly?Gly?Pro?Ser?Val?Phe?Leu?Phe?Pro?Pro
115 120 125
Lys?Pro?Lys?Asp?Thr?Leu?Met?Ile?Ser?Arg?Thr?Pro?Glu?Val?Thr?Cys
130 135 140
Val?Val?Val?Asp?Val?Ser?His?Glu?Asp?Pro?Glu?Val?Lys?Phe?Asn?Trp
145 150 155 160
Tyr?Val?Asp?Gly?Val?Glu?Val?His?Asn?Ala?Lys?Thr?Lys?Pro?Arg?Glu
165 170 175
Glu?Gln?Tyr?Asn?Ser?Thr?Tyr?Arg?Val?Val?Ser?Val?Leu?Thr?Val?Leu
180 185 190
His?Gln?Asp?Trp?Leu?Asn?Gly?Lys?Glu?Tyr?Lys?Cys?Lys?Val?Ser?Asn
195 200 205
Lys?Ala?Leu?Pro?Ala?Pro?Ile?Glu?Lys?Thr?Ile?Ser?Lys?Ala?Lys?Gly
210 215 220
Gln?Pro?Arg?Glu?Pro?Gln?Val?Tyr?Thr?Leu?Pro?Pro?Ser?Arg?Asp?Glu
225 230 235 240
Leu?Thr?Lys?Asn?Gln?Val?Ser?Leu?Thr?Cys?Leu?Val?Lys?Gly?Phe?Tyr
245 250 255
Pro?Ser?Asp?Ile?Ala?Val?Glu?Trp?Glu?Ser?Asn?Gly?Gln?Pro?Glu?Asn
260 265 270
Asn?Tyr?Lys?Ala?Thr?Pro?Pro?Val?Leu?Asp?Ser?Asp?Gly?Ser?Phe?Phe
275 280 285
Leu?Tyr?Ser?Lys?Leu?Thr?Val?Asp?Lys?Ser?Arg?Trp?Gln?Gln?Gly?Asn
290 295 300
Val?Phe?Ser?Cys?Ser?Val?Met?His?Glu?Ala?Leu?His?Asn?His?Tyr?Thr
305 310 315 320
Gln?Lys?Ser?Leu?Ser?Leu?Ser?Pro?Gly?Lys
325 330
<210>10
<211>1795
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>10
gctagcacca?agggcccatc?ggtcttcccc?ctggcaccct?cctccaagag?cacctctggg 60
ggcacagcgg?ccctgggctg?cctggtcaag?gactacttcc?ccgaaccggt?gacggtgtcg 120
tggaactcag?gcgccctgac?cagcggcgtg?cacaccttcc?cggctgtcct?acagtcctca 180
ggactctact?ccctcagcag?cgtggtgaca?gtgccctcca?gcagcttggg?cacccagacc 240
tacatctgca?acgtgaatca?caagcccagc?aacaccaagg?tggacaagaa?agcaacaggt 300
aagtggatcc?ggagggaggg?tgtctgctgg?aagcaggctc?agcgctcctg?cctggacgca 360
tcccggctat?gcagccccag?tccagggcag?caaggcaggc?cccgtctgcc?tcttcacccg 420
gaggcctctg?cccgccccac?tcatgctcag?ggagagggtc?ttctggcttt?ttccccaggc 480
tctgggcagg?cacaggctag?gtgcccctaa?cccaggccct?gcacacaaag?gggcaggtgc 540
tgggctcaga?cctgccaaga?gccatatccg?ggaggaccct?gcccctgacc?taagcccacc 600
ccaaaggcca?aactctccac?tccctcagct?cggacacctt?ctctcctccc?agattccagt 660
aactcccaat?cttctctctg?cagagcccaa?atcttgtgac?aaaactcaca?catgcccacc 720
gtgcccaggt?aagccagccc?aggcctcgcc?ctccagctca?aggcgggaca?ggtgccctag 780
agtagcctgc?atccagggac?aggccccagc?cgggtgctga?cacgtccacc?tccatctctt 840
cctcagcacc?tgaactcctg?gggggaccgt?cagtcttcct?cttcccccca?aaacccaagg 900
acaccctcat?gatctcccgg?acccctgagg?tcacatgcgt?ggtggtggac?gtgagccacg 960
aagaccctga?ggtcaagttc?aactggtacg?tggacggcgt?ggaggtgcat?aatgccaaga 1020
caaagccgcg?ggaggagcag?tacaacagca?cgtaccgtgt?ggtcagcgtc?ctcaccgtcc 1080
tgcaccagga?ctggctgaat?ggcaaggagt?acaagtgcaa?ggtctccaac?aaagccctcc 1140
cagcccccat?cgagaaaacc?atctccaaag?ccaaaggtgg?gacccgtggg?gtgcgagggc 1200
cacatggaca?gaggccggct?cggcccaccc?tctgccctgg?gagtgaccgc?tgtaccaacc 1260
tctgtcccta?cagggcagcc?ccgagaacca?caggtgtaca?ccctgccccc?atcccgggat 1320
gagctgacca?agaaccaggt?cagcctgacc?tgcctggtca?aaggcttcta?tcccagcgac 1380
atcgccgtgg?agtgggagag?caatgggcag?ccggagaaca?actacaaggc?cacgcctccc 1440
gtgctggact?ccgacggctc?cttcttcctc?tacagcaagc?tcaccgtgga?caagagcagg 1500
tggcagcagg?ggaacgtctt?ctcatgctcc?gtgatgcatg?aggctctgca?caaccactac 1560
acgcagaaga?gcctctccct?gtctccgggt?aaatgagtgc?gacggccggc?aagcccccgc 1620
tccccgggct?ctcgcggtcg?cacgaggatg?cttggcacgt?accccgtgta?catacttccc 1680
gggcgcccag?catggaaata?aagcacccag?cgctgccctg?ggcccctgcg?agactgtgat 1740
ggttctttcc?acgggtcagg?ccgagtctga?ggcctgagtg?gcatgaggga?ggcag 1795
Claims (10)
1. antibody, the aminoacid sequence of its variable region of heavy chain is shown in sequence in the sequence table 3, and the aminoacid sequence of its light chain is shown in sequence in the sequence table 1.
2. the encoding gene of the described antibody of claim 1.
3. encoding gene according to claim 2 is characterized in that: the encoding gene of described variable region of heavy chain is following 1), 2) or 3) shown in:
1) its nucleotide sequence is a dna molecular shown in the sequence 4 in the sequence table;
2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of the described variable region of heavy chain of encoding;
3) with sequence table in sequence 4 from 5 ' terminal 157-171bp and 261-283bp position Nucleotide has the dna molecular of the homology more than 70% and the described variable region of heavy chain of encoding;
The encoding gene of described light chain is following I), II) or III) shown in:
I) its nucleotide sequence is a dna molecular shown in the sequence 2 in the sequence table;
II) under stringent condition with I) the dna sequence dna hybridization that limits and the dna molecular of the described light chain of encoding;
III) with sequence table in sequence 2 from 5 ' terminal 160-184bp and 217-250bp position Nucleotide has the dna molecular of the homology more than 70% and the described light chain of encoding;
Comprise CH in the described antibody; The aminoacid sequence of described CH is shown in sequence in the sequence table 9; The encoding gene of described CH be following a), b) or c) shown in:
A) its nucleotide sequence is a dna molecular shown in the sequence 10 in the sequence table;
B) under stringent condition with the dna sequence dna hybridization that a) limits and the dna molecular of the described CH of encoding;
C) and a) dna sequence dna that limits has the dna molecular of the homology more than 70% and the described CH of encoding.
4. amplification claim 2 or 3 described encoding gene total lengths or its any segmental primer are right.
5. primer according to claim 4 is right, it is characterized in that: described primer is right to being following primer:
1) primer sequence is shown in sequence in the sequence table 5, and another primer sequence of described primer centering is shown in sequence in the sequence table 6;
2) primer sequence is shown in sequence in the sequence table 7, and another primer sequence of described primer centering is shown in sequence in the sequence table 8.
6. the recombinant vectors, reorganization bacterium, transgenic cell line or the expression cassette that contain claim 2 or 3 described encoding genes.
7. a method for preparing the described antibody of claim 1 is that claim 2 or 3 described encoding genes are imported in the host cell, cultivates, and obtains described antibody.
8. method according to claim 7 is characterized in that: in the described method, by recombinant vectors claim 2 or 3 described encoding genes are imported in the host cell; Not only contain the encoding gene of claim 2 or 3 described variable region of heavy chain but also contain claim 2 or the encoding gene of 3 described light chains in the described recombinant vectors, and the encoding gene of the encoding gene of described variable region of heavy chain and described light chain is subjected to the regulation and control of same promotor in described recombinant vectors.
9. one kind is suppressed the inhibitor of urokinase type plasminogen activator receptor signal transduction pathway, a kind of inhibitor or a kind of medicine that prevents and/or treats tumour that suppresses tumor cell invasion, and its activeconstituents is the expression cassette described in transgenic cell line described in bacterium, the claim 6 and/or the claim 6 of recombinating described in recombinant vectors, the claim 6 described in antibody described in the claim 1, claim 2 or 3 described encoding genes, the claim 6.
10. the expression cassette described in transgenic cell line described in bacterium, the claim 6 or the claim 6 of recombinating described in recombinant vectors, the claim 6 described in antibody described in the claim 1, claim 2 or 3 described encoding genes, the claim 6 suppresses application in the inhibitor of urokinase type plasminogen activator receptor signal transduction pathway in preparation; The expression cassette described in transgenic cell line described in bacterium, the claim 6 or the claim 6 of recombinating described in recombinant vectors, the claim 6 described in antibody described in the claim 1, claim 2 or 3 described encoding genes, the claim 6 suppresses application in the inhibitor of tumor cell invasion in preparation; The expression cassette described in transgenic cell line described in bacterium, the claim 6 or the claim 6 of recombinating described in recombinant vectors, the claim 6 described in antibody described in the claim 1, claim 2 or 3 described encoding genes, the claim 6 prevents and/or treats application in the tumour medicine in preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102423122A CN101798349B (en) | 2009-12-09 | 2009-12-09 | Anti-uPAR humanized antibody and coding gene thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102423122A CN101798349B (en) | 2009-12-09 | 2009-12-09 | Anti-uPAR humanized antibody and coding gene thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101798349A true CN101798349A (en) | 2010-08-11 |
| CN101798349B CN101798349B (en) | 2012-07-04 |
Family
ID=42594206
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009102423122A Expired - Fee Related CN101798349B (en) | 2009-12-09 | 2009-12-09 | Anti-uPAR humanized antibody and coding gene thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101798349B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104334017A (en) * | 2012-04-27 | 2015-02-04 | 公益财团法人东京都医学综合研究所 | Urokinase-type plasminogen activator transgenic mouse |
| CN106565845A (en) * | 2016-11-14 | 2017-04-19 | 安徽大学 | Humanized antibody H5L5 resisting uPAR antigen and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1856155B1 (en) * | 2005-03-11 | 2011-08-24 | Wilex AG | Monoclonal antibodies and immunodetection assay specific for the chemotactic epitope of the urokinase-type plasminogen activator receptor |
| CA2647380A1 (en) * | 2006-03-21 | 2007-09-27 | David T. Weaver | Methods for humanizing antibodies and humanized antibodies made thereby |
| TW200813091A (en) * | 2006-04-10 | 2008-03-16 | Amgen Fremont Inc | Targeted binding agents directed to uPAR and uses thereof |
| CN1919874B (en) * | 2006-09-18 | 2010-09-08 | 中国人民解放军军事医学科学院生物工程研究所 | Antibody molecule ATF-Fc fusion albumen of antiurokinase type fibrinolysin activator receptor and use thereof |
-
2009
- 2009-12-09 CN CN2009102423122A patent/CN101798349B/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104334017A (en) * | 2012-04-27 | 2015-02-04 | 公益财团法人东京都医学综合研究所 | Urokinase-type plasminogen activator transgenic mouse |
| CN104334017B (en) * | 2012-04-27 | 2016-05-25 | 公益财团法人东京都医学综合研究所 | Urokinase type plasminogen activator transgenic mice |
| CN106565845A (en) * | 2016-11-14 | 2017-04-19 | 安徽大学 | Humanized antibody H5L5 resisting uPAR antigen and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101798349B (en) | 2012-07-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111788228B (en) | Anti-claudin 18.2 antibodies and uses thereof | |
| AU2017316473B2 (en) | Anti-Tim-3 antibodies | |
| EP2723377B1 (en) | Anti-axl antibodies and uses thereof | |
| US11718677B2 (en) | Antibodies that bind to AXL proteins | |
| CN107001472A (en) | There is specific binding molecule and application thereof to CD73 | |
| CN101875696B (en) | Antibody, and preparation method and application thereof | |
| CA2839508A1 (en) | Anti-axl antibodies and uses thereof | |
| CN101704891B (en) | Antibody for epidermal growth factor receptor, encoding gene thereof and application thereof | |
| CN112574310B (en) | anti-SIRP alpha antibodies and uses thereof | |
| EP3916016A1 (en) | Novel bispecific antibody molecule and bispecific antibody simultaneously combining pd-l1 and lag-3 | |
| US20240076390A1 (en) | Antibodies that bind to axl proteins | |
| CN101701039B (en) | Variable regions of light chains and heavy chains of FMU-EPCAM-2A9 monoclonal antibodies | |
| CN107001452A (en) | Anti- CK8 antibody for treating cancer | |
| CN101704892B (en) | Anti-uPAR humanized antibody, coding gene and application thereof | |
| CN101798348B (en) | Anti-uPAR humanized antibody and application thereof | |
| CN101798349B (en) | Anti-uPAR humanized antibody and coding gene thereof | |
| CN101875695B (en) | Antibody, and coding gene and application thereof | |
| CN102153650B (en) | Anti-EGFR (epidemic growth factor receptor) humanized antibody L2-H3 and coding gene and application thereof | |
| CN102153647B (en) | Anti-EGFR (epidemic growth factor receptor) humanized antibody L3-H3 and coding gene and application thereof | |
| CN102153648B (en) | EGFR (epidermal growth factor receptor)-inhibiting humanized antibody L4-H3 and encoding genes and application thereof | |
| CN102153649B (en) | Anti-epidemic growth factor receptor (EGFR) humanized antibody L1-H3 and coded gene and application thereof | |
| CN114907478A (en) | LAG-3 binding antibodies and uses thereof | |
| CN108610419A (en) | A kind of Humanized anti-HER 2 monoclonal antibody | |
| NZ618740B2 (en) | Anti-axl antibodies and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120704 Termination date: 20191209 |