CN101790539A - Amelioration of cellular stress response - Google Patents

Abstract

The present invention is directed to compositions and methods useful for treating cancer and for amelioration of cellular stress response triggered by chemotherapy.

Description

The alleviation of cellular stress response

Related application

It, is completely included in this article by the priority and rights and interests for the U.S. Provisional Application serial number 60/892,806 submitted this application claims on March 2nd, 2007 by addressing.

Invention field

This invention address that treating the method for the cancer in mammal for the useful composition of the cancer in treatment mammal and using those compositions.

Background of invention

Malignant tumour (cancer) is U.S.'s second cause of the death, comes (Boring etc., CACancel J.Clin.43 after heart disease：7(1993)).Cancer is characterised by the neoplastic cell derived from normal structure or the number increase of abnormal cell, the cell is bred and forms tumor mass, these neoplasm cells invade adjacent tissue, and generation finally diffuses to regional nodes and distal site through being referred to as the process of transfer through blood or lymphatic system.In cancerous condition, cell is bred under conditions of normal cell will not grow.Cancer manifests itself by extremely diversified forms, is characterised by different degrees of invasive and aggressiveness.

In the trial of the effective cell target for the cancer therapy that tries to find out, researcher attempts to identify compared with one or more normal non-cancerous cells specific expressed cross-film on the surface of the one or more certain types of cancer cells or otherwise polypeptide with film combination.Generally, the abundance that such film combination polypeptide is expressed on cancer cell surfaces is higher than on non-cancerous cell surface.The identification of such film combination cell surface antigen polypeptide generates the ability of selectively targeted cancer cell, for the destruction carried out through the therapy based on antibody.In this regard it is noted that the therapy based on antibody is proved to be very effective in the treatment of some cancers.For example,

With

(the two both is from Genentech companies (South San Francisco, California)) is the antibody for being used successfully to treat breast cancer and non_hodgkin lymphoma respectively.In particular,

It is Humanized monoclonal antibodies derived from recombinant DNA, the ectodomain of its selective binding human epidermal growth factor receptor 2 (HER2) proto-oncogene.HER2 protein overexpressions are observed in 25-30% primary breast cancer.It is genetic engineering Chi-meric mice/human monoclonal antibodies, it is directed to the CD20 antigens found on the normal and surface of malignant B.Both antibody are all the recombinant productions in Chinese hamster ovary celI.

In other trials of the effective cell target for the cancer therapy that tries to find out, researcher attempts to identify the polypeptide for the non-film combination that (1) is generated compared with one or more certain types of non-cancerous normal cells by one or more certain types of cancer cell specificity, (2) by cancer cell with the polypeptide for the expression generation for being significantly higher than one or more non-cancerous cells, or (3) its expression specificity is limited to only a kind of polypeptide of (or difference of very limited number) organization type, the tissue is for carcinous and non-cancerous two states (such as normal prostatic and prostate tumor tissue).Such polypeptide can keep inner cellular localization, or can be by cancer cells secrete.In addition, such polypeptide can be by cancer cell oneself expression, but by generating or secreting the cell expression to polypeptide of the cancer cell with reinforcing or growth enhancing effect.Such secrete polypeptide is often that the growth for surpassing normal cell or the protein of survival advantage are provided to cancer cell, and includes the material of such as angiogenesis factor, CAF, growth factor etc..The identification expection of the antagonist of such non-film Binding peptide can serve as effective therapeutic agent of such treatment of cancer.Moreover, the identification of the expression pattern of such polypeptide can be useful for the diagnosis of particular cancers in mammal.It is even more so particularly with prostate cancer the need for existing significantly to the tumour and other therapeutic agent of the effectively growth of suppression neoplastic cell or survival for being able to detect in mammal in spite of the above-mentioned progress in mammalian cancer therapy.

Prostate cancer is the first cause of American male cancer mortality, and is most common malignant diseases (Landis etc., CA the Cancer J.Clin.49 in this crowd：8-31,1999).The starting stage of such cancer is typically characterized, and treated by androgen abatement with androgen dependent tumors cell.With the progress of cancer, it typically becomes what androgen was not answered, and currently without effective specific therapy.

Usually there is unintentional consequence using the conventional cancer treatment of chemotherapy, it disturbs the success for the treatment of.Particularly importantly applying for some chemotherapeutics triggers cellular stress response.The cancer cell that cellular stress response may be targetted to chemotherapy provides survival advantage.

Summary of the invention

The present invention relates to effects of the RA1c in the stress response (stress response) of cancerous cells.On the one hand, the invention provides the method for alleviating the cellular stress response in cell, including make the cell (preferably cancer cell, more preferably prostate cancer tumor cells) contact reduction or block the compound of RA1c expression or activity in the cell.In one embodiment, the cellular stress response is induced by chemotherapeutics.Preferably, the compound improves sensitiveness of the cell to the chemotherapeutics.

Another aspect provides the method for alleviating the cellular stress response in prostate cancer tumor cells, including make the tumour cell contact reduction or block the compound of RA1c expression or activity.In one embodiment, the tumour cell is undergoing the chemotherapy carried out with the chemotherapeutics of inducing cell stress response.Preferably, the compound improves sensitiveness of the tumour cell to the chemotherapeutics.The tumour cell sensitive to the chemotherapeutics can undergo growth retardation for example with ratio (rate) the experience apoptosis higher than cell not in contact with the compound or with the ratio higher than cell not in contact with the compound.

The method that another aspect provides the cellular stress response in the cell for alleviating (improvement) patient.The method includes the compound that the reduction of effective dose is applied to the patient or RA1c expression or activity is blocked.In one embodiment, the patient is cancer patient.In another embodiment, the cell is prostate cancer tumor cells.In still another embodiment, the tumour cell is undergoing the chemotherapy carried out with the chemotherapeutics of inducing cell stress response.Preferably, the compound improves sensitiveness of the tumour cell to the chemotherapeutics.The tumour cell sensitive to the chemotherapeutics can undergo growth retardation for example with the ratio experience apoptosis higher than cell not in contact with the compound or with the ratio higher than cell not in contact with the compound.

In the aspects of the invention, the chemotherapeutics is preferably mTor inhibitor or Akt1/2 inhibitor.The example of suitable mTor inhibitor includes rapamycin (rapamycin), CCI-779, RAD001, AP23573, XL7F65 and TAFA93 and their reactive derivative or the like.The example of suitable Akt1/2 inhibitor includes GSK690693, perifosine (perifosine) and XL418 and their reactive derivative or the like.

Compound used in some embodiments of various aspects of the invention is RA1c antagonists, such as antibody, antibody fragment, antibody coupling matter, fit, small molecule or oligopeptides.Preferably, the RA1c antagonists specific inhibition RA1c activity.In other embodiments, the compound reduction RA1c expression.In other other embodiments, the compounds block RA1c expression.Useful compound includes antisense polynucleotides, silence RNA molecule, catalytic RNA molecules and RNA-DNA block polymers in reducing or blocking RA1c expression.

Another aspect provides composition, it includes RA1c antagonists, such as anti-RA1c antibody, with the compound for improving RA1c expression, such as rapamycin, CCI-779, RAD001, AP23573, XL7F65, TAFA93, SK690693, perifosine and XL418 or its reactive derivative or the like, optionally further include pharmaceutical acceptable carrier.

It is yet another aspect of the present invention to provide determine the method whether chemotherapeutics induces the cellular stress response in cancer cell (preferably prostate gland cancer cell, more preferably LNCaP cells).Methods described includes making cancer cell contact the chemotherapeutics and determine the RA1c expressions in the cancer cell.Rise of the RA1c expression more than control cell or more than the RA1c expressions contacted in the chemotherapeutics foregoing description cancer cell indicates the induction to cellular stress response.The chemotherapeutics is preferably mTor inhibitor or Akt1/2 inhibitor and their reactive derivative or the like.

It is yet another aspect of the present invention to provide the method with conjoint therapy treating cancer.It the described method comprises the following steps, cancer cell contact is improved the chemotherapeutics of RA1c expression, and make the compound of the specific binding RA1c polypeptides of the cancer cell contact effective dose, such as anti-RA1c antibody.The antibody is preferably to be coupled to cytotoxic agent.The treatment of cancer effect of the chemotherapeutics and the compound synergistically exceedes the chemotherapeutics or any single effect of compound.In one embodiment, the chemotherapeutics is mTOR or Akt1/2 inhibitor.

After reading this specification, other other embodiments of the invention can be obvious for those of skill in the art.

Brief description

Figure 1A and 1B depict the few array analysis of tissue and cell line RA1c expression, as described in Example 1.In figure ia, normal structure is the leftmost result of each tissue sample, and cancer/Other diseases are the results of each tissue sample rightmost.

Fig. 2A -2C show quantitative real-time RT-PCR (Q-PCR) analysis of the RA1c expression that some cell factors of response are stimulated in LNCaP cells, as described in Example 2.

Fig. 3 A-3B show the result of the experiment for the influence that RA1c is expressed during test sera is deprived to LNCaP cells in the case of the absence or presence IL-6, as described in Example 2.

Fig. 3 A depict Q-PCR data, as described in embodiment 2 (b).Fig. 3 B depict the facs analysis of the Cell cycle status through processing or untreated LNCaP cells, as described in embodiment 2 (c).

Fig. 4 A-4B show the result of the Q-PCR analyses that RA1c is expressed in vitro (ex vivo) cells of LUCaP77 and LNCaP cells, as described in embodiment 2 (d).

Fig. 5 depicts the western blot of the presence of detection phosphorylation intracellular signaling pathways composition, as described in embodiment 3a.

Fig. 6 depicts the Q-PCR data of the effect for assessing the LNCaP cells that addition PI3K inhibitor is handled IL-6.

Fig. 7 depicts the Q-PCR data of the effect for assessing the LNCaP cells that addition P38 inhibitor is handled IL-6.

Fig. 8 is the schematic diagram for the key signal transduction approach for being contemplated by IL-6 processing or serum deprivation activation.

Fig. 9 depicts the Q-PCR data of the effect for the LNCaP cells that display addition mTor inhibitor is handled IL-6.

Figure 10 depicts the Q-PCR data of the effect for the LNCaP cells that display addition Akt1/2 inhibitor is handled IL-6.

Figure 11 depicts the determination method expressed with the effect of the mutagenesis in STAT3 sites that display carries the construct of prediction STAT3 binding sites.

Figure 12 depicts the mutagenesis in STAT3 sites.

Figure 13 depicts the data of the effect for the LNCaP cells that display addition JAK inhibitor is handled IL-6.

Figure 14 A-14B show the result of the Q-PCR researchs of the effect for assessing RA1c expression that DHT is induced IL-6 in LNCaP cells or serum deprivation induction, as described in Example 4.Figure 14 C show a kind of schematic diagram of potential scheme of intracellular RA1c expression regulations in LNCaP cells, and the schematic diagram is based on data described herein.

Figure 15 depicts the facs analysis of RA1c cell surface expressions in 293S cells, as described in Example 5.

Detailed description of the invention

I. define

Term " RA1c polypeptides " and " RA1c albumen " cover the fragment (having further definition herein) of natural sequence polypeptide, polypeptide variants and natural sequence polypeptide and polypeptide variants as used herein.RA1c polypeptides described herein can be from a variety of source separation, such as people's organization type or other sources, or is prepared by recombinantly or synthetically method.Term " RA1c polypeptides " and " RA1c albumen " also include the variant of RA1c polypeptides disclosed herein.

" native sequences RA1c polypeptides " includes the polypeptide that RA1c polypeptides corresponding to what it is derived from nature have same amino acid sequence.In one embodiment, native sequences RA1c polypeptides include SEQ IDNO：2 amino acid sequence：MSSCNFTHATFVLIGIPGLEKAHFWVGFPLLSMYVVAMFGNCIVVFIVRTERSLHAPMYLFLCMLAAIDLALSTSTMPKILALFWFDSREISFEACLTQMFFIHALSAIESTILLAMAFDRYVAICHPLRHAAVLNNTVTAQIGIVAVVRGSLFFFPLPLLIKRLAFCHSNVLSHSYCVHQDVMKLAYADTLPNVVYGLTAILLVMGVDVMFISLSYFLIIRTVLQLPSKSERAKAFGTCVSHIGVVLAFYVPLIGLSVVHRFGNSLHPIVRVVMGDIYLLLPPVINPIIYGAKTKQIRTRVLAMFKISCDKDLQAVGGK.In another embodiment, native sequences RA1c polypeptides include the amino acid sequence of maturation protein sequence and further comprising signal peptide, such as SEQ ID NO：3：MGGTAARLGAVILFVVIVGLHGVRGKYALADASLKMADPNRFRGKDLPVLDQLLEMSSCNFTHATFVLIGIPGLEKAHFWVGFPLLSMYVVAMFGNCIVVFIVRTERSLHAPMYLFLCMLAAIDLALSTSTMPKILALFWFDSREISFEACLTQMFFIHALSAIESTILLAMAFDRYVAICHPLRHAAVLNNTVTAQIGIVAVVRGSLFFFPLPLLIKRLAFCHSNVLSHSYCVHQDVMKLAYADTLPNVVYGLTAILLVMGVDVMFISLSYFLIIRTVLQLPSKSERAKAFGTCVSHIGVVLAFYVPLIGLSVVHRFGNSLHPIVRVVMGDIYLLLPPVINPIIYGAKTKQIRTRVLAMFKISCDKDLQAVGGK.In another embodiment, native sequences RA1c polypeptides are the polynucleotide sequence codings as listed by GenBank numberings NM 030774.In another embodiment, native sequences RA1c polypeptides include the amino acid sequence for lacking signal peptide.In still another embodiment, native sequences RA1c polypeptides are included with proprotein convertases enzymatic cutting SEQ ID NO：2 sequence and the amino acid sequence produced.Such native sequences RA1c polypeptides can be separated from nature, or can be generated by recombinantly or synthetically means.Term " native sequences RA1c polypeptides " clearly covers specific RA1c polypeptides (such as ectodomain sequence), the naturally occurring variant form (such as alternative splice forms) and naturally occurring allelic variant of the polypeptide of naturally occurring truncation or secreted form.Native sequences RA1c is also reported in Xu etc., Cancer Res.60：6568-6572(2000)；Yuan etc., Gene 278：41-51(2001)；Xia etc., Oncogene 20：5903-5907(2001)；And United States Patent (USP) No.6,372,891).

" RA1c polypeptide variants " mean the RA1c polypeptides for having at least about 80% amino acid sequence identity with native sequences RA1c peptide sequences disclosed herein, active RA1c polypeptides preferably as defined herein.Such RA1c polypeptide variants include for example adding or delete the RA1c polypeptides of one or more amino acid residues in N- the or C- ends of natural acid sequence.Generally, RA1c polypeptide variants and the amino acid sequence identity of native sequences RA1c peptide sequences disclosed herein with least about 80% amino acid sequence identity, or at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.Generally, the length of RA1c variant polypeptides is at least about 10 amino acid, or length is at least about 20,30,40,50,60,70,80,90,100,110,120,130,140,150,160,170,180,190,200,210,220,230,240,250,260,270,280,290,300,310,320 amino acid, or more an amino acid.It is optional that, there is RA1c variant polypeptides conserved amino acid at no more than one to substitute compared with natural RA1c peptide sequences, or compared with natural RA1c peptide sequences there is conserved amino acid at no more than 2,3,4,5,6,7,8,9 or 10 to substitute.

" percentage (%) amino acid sequence identity " of RA1c peptide sequences on being identified herein is defined as contrast sequence and introduces breach when necessary to obtain after largest percentage sequence identity, and when any conservative replacement not being considered as into a part for sequence identity, the percentage in candidate sequence with the amino acid residue identical amino acid residue in specific RA1c peptide sequences.It can be carried out to determine contrasting for percent amino acid sequence homogeneity purpose with the various ways in the range of art technology, for example using publicly available computer software, such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.Those skilled in the art can determine the suitable parameter for measuring contrast, including any algorithm needed for maximum contrast is obtained to institute's comparative sequences total length.However, for the purposes of the present invention, % amino acid sequence identity values are to compare computer program using sequence to obtain.It is used as a non-limitative example, ALIGN-2 sequences compare computer program and write by Genentech companies, its source code submits to U.S. Copyright Office (US Copyright Office together with customer documentation, Washington D.C., 20559), and with U.S. Copyright Registration TXU510087 register.The public can obtain the compilation of source code provided in ALIGN-2 programs, or many publications that can comform, such as United States Patent (USP) No.7,087,738 by Genentech companies (South SanFrancisco, California).ALIGN2 programs should be compiled into UNIX operating system, used on preferably number UNIX V4.0D.All sequences compare parameter by ALIGN-2 program settings and constant.

In the case of using ALIGN-2 come comparing amino acid sequence, given amino acid sequence A relative to (to), with (with) or for (against) give amino acid sequence B % amino acid sequence identities (or can be expressed as having or comprising relative to, with or for give amino acid sequence B a certain % amino acid sequence identities given amino acid sequence A) be calculated as below：

Fraction X/Y multiplies 100

Wherein X is that scoring is the total number of atnino acid of identical match in A and the B contrast of the program by sequence alignment programme ALIGN-2, and wherein Y is the total amino acid residues in B.It will be appreciated that if amino acid sequence A length and amino acid sequence B length are unequal, % amino acid sequence identities of the A relative to B will be equal to % amino acid sequence identities of the B relative to A.

" RA1c Variant polynucleotides " or " RA1c mutant nucleic acid sequences " mean to encode RA1c polypeptides as defined herein, preferably activity RA1c polypeptides and nucleic acid molecules of the nucleotide sequence with least about 80% nucleic acid sequence identity with encoding native sequences RA1c peptide sequences disclosed herein.Generally, RA1c Variant polynucleotides and nucleic acid sequence identity of the nucleotide sequence with least about 80% nucleic acid sequence identity, or at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% for encoding total length native sequences RA1c peptide sequences disclosed herein.Variant does not cover native nucleotide sequence.

Generally,The length of RA1c Variant polynucleotides is at least about 5 nucleotides,Or length is at least about 6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,35,40,45,50,55,60,65,70,75,80,85,90,95,100,105,110,115,120,125,130,135,140,145,150,155,160,165,170,175,180,185,190,195,200,210,220,230,240,250,260,270,280,290,300,310,320,330,340,350,360,370,380,390,400,410,420,430,440,450,460,470,480,490,500,510,520,530,540,550,560,570,580,590,600,610,620,630,640,650,660,670,680,690,700,710,720,730,740,750,760,770,780,790,800,810,820,830,840,850,860,870,880,890,900,910,920,930,940,950,960,970,980,990,1000,1010,1020,1030,1040,1050,1060,1070,1080,1090,1100,1110,1120,1130,1140,1150,1160,1170,1180,1190,1200,1201,Or 1204 nucleotides,Wherein in this linguistic context,Term " about " means the 10% of the nucleotide sequence length plus or minus the length.

On RA1c nucleotide sequences (corresponding native sequence RA1c polypeptides, such as SEQ ID NO：1 nucleotide sequence：ATGAGTTCCTGCAACTTCACACATGCCACCTTTGTGCTTATTGGTATCCCAGGATTAGAGAAAGCCCATTTCTGGGTTGGCTTCCCCCTCCTTTCCATGTATGTAGTGGCAATGTTTGGAAACTGCATCGTGGTCTTCATCGTAAGGACGGAACGCAGCCTGCACGCTCCGATGTACCTCTTTCTCTGCATGCTTGCAGCCATTGACCTGGCCTTATCCACATCCACCATGCCTAAGATCCTTGCCCTTTTCTGGTTTGATTCCCGAGAGATTAGCTTTGAGGCCTGTCTTACCCAGATGTTCTTTATTCATGCCCTCTCAGCCATTGAATCCACCATCCTGCTGGCCATGGCCTTTGACCGTTATGTGGCCATCTGCCACCCACTGCGCCATGCTGCAGTGCTCAACAATACAGTAACAGCCCAGATTGGCATCGTGGCTGTGGTCCGCGGATCCCTCTTTTTTTTCCCACTGCCTCTGCTGATCAAGCGGCTGGCCTTCTGCCACTCCAATGTCCTCTCGCACTCCTATTGTGTCCACCAGGATGTAATGAAGTTGGCCTATGCAGACACTTTGCCCAATGTGGTATATGGTCTTACTGCCATTCTGCTGGTCATGGGCGTGGACGTAATGTTCATCTCCTTGTCCTATTTTCTGATAATACGAACGGTTCTGCAACTGCCTTCCAAGTCAGAGCGGGCCAAGGCCTTTGGAACCTGTGTGTCACACATTGGTGTGGTACTCGCCTTCTATGTGCCACTTATTGGCCTCTCAGTTGTACACCGCTTTGGAAACAGCCTTCATCCCATTGTGCGTGTTGTCATGGGTGACATCTACCTGCTGCTGCCTCCTGTCATCAATCCCATCATCTATGGTGCCAAAACCAAACAGATCAGAACACGGGTGCTGGCTATGTTCAAGATCAGCTGTGACAAGGACTTGCAGGCTGTGGGAGGCAAGTGA,Include RA1c code areas) " percentage (%) nucleic acid sequence identity " be defined as contrast sequence and introduce breach when necessary to obtain after largest percentage sequence identity,With the percentage of the nucleotides identical nucleotides in purpose RA1c nucleotide sequences in candidate sequence.It can be carried out for the alignment of measure percentage nucleic acid sequence identity purpose with the various ways in the range of art technology, for example using publicly available computer software, such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.However, for the purposes of the present invention, % nucleic acid sequence identity values are to compare computer program ALIGN-2 acquisitions (described above) using sequence.ALIGN-2 sequences compare computer program and write by Genentech companies, its source code submits to U.S. Copyright Office (US Copyright Office together with customer documentation, Washington D.C., 20559), and registered with U.S. Copyright Registration TXU510087.The public can obtain the compilation of source code provided in ALIGN-2 programs, or many publications that can comform, such as United States Patent (USP) No.7,087,738 by Genentech companies (South San Francisco, California).ALIGN2 programs should be compiled into UNIX operating system, used on preferably number UNIX V4.0D.All sequences compare parameter by ALIGN-2 program settings and constant.

In the case of nucleotide sequence is compared using ALIGN-2, given nucleotide sequence C relative to (to), with (with) or for (against) give amino acid sequence D % nucleic acid sequence identities (or can be expressed as having or comprising relative to, with or for give nucleotide sequence D a certain % nucleic acid sequence identities given nucleotide sequence C) be calculated as below：

Fraction W/Z multiplies 100

Wherein W is that scoring is the few nucleotide of identical match in C and the D contrast of the program by sequence alignment programme ALIGN-2, and wherein Z is the total nucleotide number in D.It will be appreciated that if nucleotide sequence C length and nucleotide sequence D length are unequal, % nucleic acid sequence identities of the C relative to D will be equal to % nucleic acid sequence identities of the D relative to C.It is used as the example for making to calculate % nucleic acid sequence identities in this way, how table 3 and 4 calculates % nucleic acid sequence identity of the nucleotide sequence for being assigned as " comparison dna " relative to the nucleotide sequence for being assigned as " RA1c-DNA " if being demonstrated, wherein " RA1c DNA " represent purpose theory RA1c nucleotide sequences, " comparison dna " represents purpose, and " RA1c DNA " nucleic acid molecules are directed to the nucleotide sequence of its nucleic acid molecules being compared, and " N ", " L " and " V " each represents different theories nucleotides.Unless otherwise expressly specified, all % nucleic acid sequence identities values used herein are all the RA1c variant polypeptides obtained using ALIGN-2 computer programs according to described in the preceding paragraph.

In other embodiments, RA1c Variant polynucleotides be encode RA1c polypeptides and can be with the nucleotide sequence hybridization (preferably under stingent hybridization and cleaning condition) of coding RA1c polypeptides disclosed herein nucleic acid molecules.RA1c variant polypeptides can be those as coded by RA1c Variant polynucleotides.

" separation " mean it is identified and with the/molecules/compounds (such as polypeptide) that separate and/or reclaimed from its natural surroundings from its natural surroundings composition.The contaminant component of the natural surroundings of polypeptide, which refers to, would generally disturb the material of molecules/compounds (such as polypeptide) therapeutical uses, it may include the solute of enzyme, hormone and other oroteins property or non-proteinaceous.In some embodiments, polypeptide or oligopeptides are purified to (1) and are enough the N- ends by using spinning cup sequenator at least 10-15 residue of acquisition or the degree of internal amino acid sequence, or (2) reach homogeneity according to the gel electrophoresis (such as SDS-PAGE) under the irreducibility or reductive condition using such as Coomassie blue or Silver stain.Since at least one composition of the natural surroundings of RA1c polypeptides is not in, then the polypeptide of separation includes the polypeptides in situ in recombinant cell.However, the polypeptide of separation is generally prepared by least one purification step.

" separation " polynucleotides refer to the nucleic acid molecules of the coded polypeptide that at least one contaminative nucleic acid molecules being generally associated in the natural origin of nucleic acid identified and with the coded polypeptide or oligopeptides separate or oligopeptides.The coded polypeptide of separation or the nucleic acid molecules of oligopeptides are different from finding in nature at the form of it or situation.Therefore the coded polypeptide of separation or the nucleic acid molecules of oligopeptides have any different with being present in the nucleic acid molecules of specific coded polypeptide when in n cell or oligopeptides.But, the coded polypeptide of separation or the nucleic acid molecules of oligopeptides include the nucleic acid molecules for being often expressed as coded polypeptide or oligopeptides included in the cell of coded polypeptide or oligopeptides, such as when the chromosome mapping when the nucleic acid molecules in the cell is different from its chromosome or chromosome outside fix in n cell.

Term " control sequence " refers to DNA sequence dna necessary to the coded sequence expressed and be operatively connected in specific host organism.For example, the control sequence suitable for prokaryotes includes promoter, optional operator sequence and ribosome bind site.Known eukaryotic utilizes promoter, polyadenylation signal and enhancer.

If one section of nucleic acid is in functional interrelationship with another section of nucleotide sequence, it is " being operatively connected ".If for example, presequence (presequence) or secreting the DNA of leading (secretory leader) and being expressed as participating in the preceding protein (preprotein) of polypeptide secretion, the DNA of it and the polypeptide is operatively connected；If promoter or enhancer influence the transcription of coded sequence, it is operatively connected with the sequence；Or, if the position of ribosome bind site promotes translation, it is operatively connected with coded sequence.In general, " being operatively connected " means that connected DNA sequence dna is adjacent, and mean adjacent in the case of secretion is leading and be in read state.However, enhancer need not be adjacent.Connection can be realized by the connection at convenient restriction site.If without such site, according to oligonucleotides adapter or joint of the conventional practice using synthesis.

" stringency " of hybridization reaction easily determine by those of ordinary skill in the art, and generally depend on probe length, wash temperature and salinity and calculate by rule of thumb.In general, longer probe needs higher temperature to be used to correctly anneal, and shorter probe then needs relatively low temperature.When complementary strand is present in the environment less than their melting temperatures, hybridization generally depends on the ability that denatured DNA is annealed again.Expectation degree of homology between probe and the sequence that can hybridize is higher, so that it may use higher relative temperature.As a result, releasing, higher relative temperature is intended to make reaction condition stricter, and lower temperature is then less strict.Subsidiary details and explanation for the stringency of hybridization reaction are referring to Ausubel's etc.《Current Protocols in Molecular Biology》, Wiley IntersciencePublishers, (1995).

As defined herein, " stringent condition " or " high stringency conditions " can be defined as follows：(1) low ionic strength and high temperature, the lauryl sodium sulfate of such as 0.015M sodium chloride/0.0015M sodium citrates/0.1%, 50 DEG C are used for washing；(2) denaturant is used during hybridizing, such as formamide, for example, 50% (v/v) formamide and 0.1% bovine serum albumin/0.1%Ficoll/0.1% polyvinylpyrrolidones/there is 750mM sodium chloride, the 50mM sodium phosphate buffers pH 6.5 of 75mM sodium citrates, 42 DEG C, or (3) are using 50% formamide, 5x SSC (0.75M NaCl, 0.075M sodium citrates), 50mM sodium phosphates (pH6.8), 0.1% sodium pyrophosphate, 5x DenhardtShi solution, ultrasonically treated salmon sperm DNA (50 μ g/ml), in 42 DEG C of hybridized overnights in the solution of 0.1%SDS and 10% dextran glucosides, in 42 DEG C of washing 10 minutes in 0.2x SSC (sodium chloride/sodium citrate), followed by 55 DEG C of 10 minutes high washing stringencies being made up of the 0.1x SSC containing EDTA.

" medium stringency condition " may be designated as such as Sambrook etc.《Molecular Cloning：ALaboratory Manual》(New York：Cold Spring Harbor Press, 1989) described by, and including the use of wash solution and hybridization conditions (such as temperature, ionic strength and %SDS) less stringent compared with those described above.One example of medium stringency condition be containing：20% formamide, 5x SSC (150mM NaCl, 15mM trisodium citrates), 50mM sodium phosphates (pH7.6), 5xDenhardtShi solution, 10% dextran glucosides and 20mg/ml denaturation shearing salmon sperm DNA solution in be incubated overnight in 37 DEG C, then wash filter membrane in 1x SSC in about 37-50 DEG C.How those skilled in the art will be appreciated that according to adapting to adjust temperature, ionic strength etc. the need for the factor such as probe length.

Term " fit " refers to the nucleic acid molecules of binding target molecule (such as polypeptide).For example, the fit of the present invention specifically binds the molecule for regulating and controlling RA1c expression in RA1c polypeptides or signal transduction path.Fit generation and therapeutical uses is that this area has been completely set up.See, for example, United States Patent (USP) No.5,475,096, and

(Eyetech, New York) is used for the therapeutic efficiency for treating age related macular degeneration.

Term " Epitope tag " refers to comprising RA1c polypeptides or anti-RA1c antibody and its chimeric polyeptides merged with " tag polypeptide " as used herein.There is tag polypeptide enough residues can prepare the antibody for it to provide epitope, but its activity for not disturbing the polypeptide merged with it that causes short enough.Tag polypeptide is preferred or fairly individual so that substantially with other epitopes cross reaction does not occur for its antibody.Suitable tag polypeptide generally has at least six amino acid residue, generally between about 8 and about 50 amino acid residues (preferably, between about 10 and about 20 amino acid residues).The non-limitative example of tag polypeptide includes detectable mark, such as polyhistidine and PLAP.

" active " or " activity " refers to RA1c polypeptides and retains the biology of natural or naturally occurring RA1c polypeptides and/or the form of immunologic competence for the purposes of the present invention, wherein " biology " active (inhibition or irritating) refers to as caused by natural or naturally occurring RA1c polypeptides, biological function in addition to the ability of the antibody tormation for the antigenic epitopes that induction is possessed for natural or naturally occurring RA1c polypeptides, and " immunology " activity refers to the ability of the antibody tormation for the antigenic epitopes that induction is possessed for natural or naturally occurring RA1c polypeptides.

Term " antagonist " is used with broadest, including any reduction, the molecule for the biological activity for partially or completely blocking, suppressing or neutralizing natural RA1c polypeptides disclosed herein.Suitable antagonist molecules clearly include antagonistic antibodies or antibody fragment, the fragment of natural RA1c polypeptides or amino acid sequence variation, peptide, ASON, organic molecule or inorganic molecules, etc..The method of antagonist for identifying RA1c polypeptides, which can be included, makes RA1c polypeptides contact candidate agonist molecule, and measures the detectable change of one or more generally relevant with RA1c polypeptides of biological activity.

" processing " or " treatment " or " mitigation " refer to therapeutic treatment and preventative or precaution measure both, wherein target is prevention or slows down (mitigation) targeted pathological conditions or disorder.Needing the subject for the treatment of includes subject already with illness and tends to suffer from the subject of illness or to prevent the subject of illness.If after the combination of compound or one or more such compounds of at least one RA1c antagonists of therapeutic dose or regulation and control RA1c expression is received according to the method for the present invention, patient shows observable and/or measurable reduction or disappearance in following one or more, then subject or mammal success " treatment " cancer：Cancer cell number is reduced or cancer cell disappears；Tumor mass reduction；Cancer cell is infiltrated into peripheral organs, including cancer is traveled to and is suppressed in soft tissue and bone (i.e. a certain degree of to slow down, preferably to stop)；Metastases are suppressed (i.e. a certain degree of to slow down, preferably to stop)；Tumour growth is suppressed by a certain degree of；And/or the one or more symptoms relevant with particular cancers obtain a certain degree of mitigation；Morbidity and mortality are reduced；And quality of life is improved.For RA1c antagonists can prevent existing growth of cancer cells and/or kill existing cancer cell, it is probably suppress cell and/or Cytotoxic.The mitigation of these signs or symptom can also by patient perceptions to.

Above-mentioned parameter for assessing the successful treatment of disease and improving can be measured easily by old process known to internist.For treatment of cancer, effect can be measured for example, by assessing disease developing time (TTP) and/or determining the speed of response (RR).Transfer can be determined by testing (staging test) by stages, and by the test of bone scanning and calcium level and other enzymes to determine whether to travel to bone.CT scan can be also carried out to ascertain whether the lymph node traveled in pelvis and the region.The liver enzyme level measurement that is carried out respectively using chest X-ray and by known method ascertains whether to be transferred to lung and liver.Other conventional methods for monitoring of diseases include transrectal ultrasonography (TRUS) and per rectum needle biopsy (TRNB).

" long-term " apply refers to short term patterns on the contrary, medicament is applied in a continuous mode, so that initial treatment effect (activity) is maintained into longer period of time.It is not the treatment free of discontinuities being carried out continuously that " interval " administration, which refers to, but substantially periodic.

For treating cancer, mitigate cancer symptoms purpose, " mammal " aim enters mammiferous any animal, including people, domestic animal and livestock, and zoo animal, sports animals or pet animals, dog, cat, ox, horse, sheep, pig, goat, rabbit etc..Preferably, mammal refers to people.

" patient " refers to any animal, preferably mammal, more preferably people.

Being applied with one or more other therapeutic agents " joint " includes (common) administration and the sequential administration of any order simultaneously.

" carrier " includes pharmaceutically acceptable carrier, excipient or stabilizer as used herein, and they are nontoxic to the cell exposed to it or mammal in the dosage and concentration used.Generally, the acceptable carrier of physiology is pH aqueous buffer solutions.The example of physiology acceptable carriers includes buffer, such as phosphate, citrate and other organic acids；Antioxidant, including ascorbic acid；Low molecule amount (less than about 10 residues) polypeptide；Protein, such as serum albumin, gelatin or immunoglobulin；Hydrophilic polymer, such as polyvinylpyrrolidone；Amino acid, such as glycine, glutamine, asparagine, arginine or lysine；Monose, disaccharides and other carbohydrate, including glucose, mannose or dextrin；Chelating agent, such as EDTA；Sugar alcohol, such as mannitol or sorbierite；Into salt gegenion, such as sodium；Or nonionic surfactant, such as

Polyethylene glycol (PEG) and

" solid phase " or " solid support " means that antibody, RA1c polypeptide combination oligopeptides or the RA1c polypeptides of the present invention can adhere or adhere to non-aqueous base thereon with reference to organic or inorganic molecules.The example of the solid phase covered herein includes the solid phase that those are partially or completely made up of glass (such as controlled pore glass), polysaccharide (such as agarose), polyacrylamide, polystyrene, polyvinyl alcohol and polysiloxanes (silicone).In certain embodiments, according to linguistic context, solid phase may include the hole of assay plate；In other embodiments, it refers to purification column (such as affinity column).This term also includes in the discontinuous solid phase of discrete particle, such as United States Patent (USP) No.4,275,149 described.

" liposome " refers to what is be made up of various types of lipids, phosphatide and/or surfactant, available for the vesicles that medicine (all RA1c polypeptides, its antibody or RA1c polypeptide combinations oligopeptides as herein disclosed) is delivered to mammal.The composition of liposome is typically arranged to bilayer formation, similar to the lipid arrangement of biomembrane.

" small " molecule or organic " small " molecule are defined herein as molecular weight less than about 500 dalton.

" effective dose " of the combination of RA1c antagonists or the compound or one or more such compounds of regulation and control RA1c expression disclosed herein refers to the amount for being enough the purpose for realizing clear stipulaties." effective dose " can by rule of thumb and in a usual manner, and purpose as defined in contact is determined.

Term " therapeutically effective amount " refers to the combination of the compound or one or more such compounds of RA1c antagonists or regulation and control RA1c expression effective " treatment " disease or disorderly amount in subject or mammal.In the case of cancer, the therapeutically effective amount of the combination of the compound or one or more such compounds of RA1c antagonists or regulation and control RA1c expression can reduce cancer cell number；Reduce gross tumor volume；Suppress (i.e. a certain degree of to slow down, preferably to stop) cancer cell infiltration into peripheral organs；Suppress (i.e. a certain degree of to slow down, preferably to stop) metastases；A certain degree of suppression tumour growth；And/or a certain degree of mitigate one or more symptoms relevant with cancer.Referring to the definition of " treatment " herein.With regard to RA1c antagonists, the compound of regulation and control RA1c expression, regulating cell stress compound or one or more such compounds combination can prevent growth of cancer cells and/or the degree for killing existing cancer cell for, it can be suppression cell and/or Cytotoxic.

RA1c antagonists disclosed herein, " the growth inhibition amount " of the combination of the compound or one or more such compounds of regulation and control RA1c expression refer to suppress cell, especially tumour in vitro or in vivo, the amount of such as growth of cancer cells.RA1c antagonists, the combination of the compound or one or more such compounds of regulation and control RA1c expression can be determined by rule of thumb and in a usual manner for " the growth inhibition amount " of inhibition of enoplastic cell growth.

RA1c antagonists, " the cytotoxicity amount " of the combination of the compound or one or more such compounds of regulation and control RA1c expression refer to cause cell, especially tumour in vitro or in vivo, the amount of such as cancer cell destruction.RA1c antagonists, the combination of the compound or one or more such compounds of regulation and control RA1c expression can be determined by rule of thumb and in a usual manner for " the cytotoxicity amount " of inhibition of enoplastic cell growth.

Term " antibody " is used with broadest, clearly cover for example single anti-RA1c polypeptides monoclonal antibody (including Antagonism, associativity and/or neutrality antibody), with the specific anti-RA1c polypeptide antibodies composition of multi-epitope, polyclonal antibody, single-stranded anti-RA1c polypeptide antibodies and anti-RA1c polypeptide antibodies fragment (seeing below), as long as they show desired biology or immunologic competence.Term " immunoglobulin " (Ig) is used interchangeably with " antibody " herein.

Useful antibody refers to the antibody that a kind of identified and from its natural surroundings composition is separated and/or reclaimed in the method for the invention.The contaminant component of its natural surroundings refers to the material for the therapeutical uses that will disturb the antibody, it may include the solute of enzyme, hormone and other oroteins property or non-proteinaceous.In preferred embodiments, by antibody purification to the measure of (1) according to Lowry methods, antibody weight is more than 95%, most preferably weight is more than 99%, (2) the N- ends by using spinning cup sequenator at least 15 residues of acquisition or the degree of internal amino acid sequence are enough, or (3) are according to such as SDS-PAGE of the electrophoresis under reproducibility or non-reducing conditions and use such as Coomassie blue or Silver stain, reach homogeneity.

(IgM antibody is made up of the heterotetrameric glycoproteins that 4 basic chain antibody units are made up of two identical light chains (L) and two identical heavy chains (H) the other polypeptide of 5 different tetramer units and referred to as J chains substantially, therefore includes 10 antigen binding sites；And secretory IgA antibody is polymerizable and forms the multivalence assemblage for including 2-5 basic 4 chain elements and J chains).In the case of IgG, 4 chain elements typically about 150,000 dalton.Every light chain is connected by a covalent disulfide bonds with heavy chain, and two heavy chains are connected with each other by one or more disulfide bond, and the number of disulfide bond depends on the isotype of heavy chain.Every heavy chain and light chain also have the intrachain disulfide bond of regular interval.Every heavy chain has a variable region (VH) in N- ends, followed by three (for α and γ chains) or four (for μ and ε isotypes) constant regions (CH).Every light chain has a variable region (VL) in N- ends, followed by a constant region (CL) of its other end.VL is arranged together with VH, and CL and the constant region of heavy chain first (CH1) are arranged together.Think that specific amino acid residue forms interface between light chain and weight chain variable district.One VH and VL is matched and is formed an antigen binding site together.On the structure and property of different classes of antibody, see, for example, Basic and Clinical Immunology, the 8th edition, Daniel P.Stites, Abba I.Terr and Tristram G.Parslow (eds.), Appleton ＆ Lange, Norwalk, CT, page 1994,71 and the 6th chapter.

According to its constant domain amino acid sequence, the L chains from any invertebrate species can be included into one kind in two kinds of completely different types, referred to as Kappa (κ) and lambda (λ).According to its heavy-chain constant domains (C_H) amino acid sequence, immunoglobulin can be included into different classification or isotype.There are five immunoglobulin like protein：IgA, IgD, IgE, IgG and IgM, the heavy chain respectively with referred to as α, δ, ε, γ and μ.According to C_HThe smaller difference of sequence and function, γ and α classes can be further divided into subclass, and such as mankind express following subclass：IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2.

Term " variable " refers to the extensive truth of some of variable domain section sequence difference between antibody.V structure domain mediate antigen combines and limits specificity of the specific antibodies to its specific antigen.However, variability is not uniformly distributed in 110 amino acid of variable domain leap.In fact, V areas are by 15-30 amino acid, the referred to as section not made a variation relatively of framework region (FR) and each length for distinguishing framework is 9-12 amino acid, is referred to as the shorter region composition of the extreme variation of " hypervariable region ".Each self-contained four FR of variable domain of native heavy and light chain, they take beta-pleated sheet conformation mostly, are connected by three hypervariable regions for forming loop connecting and formed in some cases a beta-pleated sheet structure part.Hypervariable region in every chain the keeping together closely by FR, and facilitate the formation of the antigen binding site of antibody together with the hypervariable region of another chain (referring to Kabat etc., Sequences of Proteins of ImmunologicalInterest, 5th Ed.Public Health Service, National Institutes of Health, Bethesda, MD (1991)).Constant domain does not participate in the combination of antibody and antigen directly, but shows the participation of antibody in a variety of effector functions, the cytotoxicity (ADCC) of such as antibody dependent cellular.

Term " hypervariable region " refers to the amino acid residue for being responsible for antigen binding in antibody as used herein.Hypervariable region generally comprises amino acid residue (such as V from " complementary determining region " or " CDR "_LIn residue 24-34 (L1), 50-56 (L2) and 89-97 (L3) nearby and V_HIn residue 1-35 (H1), 50-65 (H2) and 95-102 (H3) near；Kabat etc., Sequences of Proteins of Immunological Interest, 5th Ed.Public Health Service, National Institutes of Health, Bethesda, MD. (1991)) and/or those residue (such as V from " hypervariable loop "_LIn residue 26-32 (L1), 50-52 (L2) and 91-96 (L3) and V_HIn residue 26-32 (H1), 53-55 (H2) and 96-101 (H3)；Chothia and Lesk, J.Mol.Biol.196：901-917(1987)).

Term " monoclonal antibody " refers to the antibody obtained from the antibody of a group substantially homogeneity as used herein, that is, each antibody individual for constituting colony is identical, in addition to can be with the possible naturally occurring mutant form of indivisible presence.Monoclonal antibody is high degree of specificity, for single antigenic site.In addition, different from the polyclonal antibody preparations comprising the different antibodies for different determinants (epitope), every kind of monoclonal antibody is for the single determinant on antigen.Outside their specificity, the advantage of monoclonal antibody is that they can be synthesized in the case of other antibody pollutions are not affected by.Modifier " monoclonal " should not be construed as requiring to generate antibody by any ad hoc approach.For example, the monoclonal antibody available for the present invention can be by initially by Kohler etc. (1975) Nature 256：Prepared by 495 hybridoma methods recorded, or can be prepared by recombinant DNA method in bacterium, eucaryon animal or plant cell (see, for example, United States Patent (USP) No.4,816,567)." monoclonal antibody " it is also possible to use (1991) Nature 352 such as Clackson：624-628；And (1991) J.Mol.Biol.222 such as Marks：Technology described in 581-597 is separated from phage antibody library.

Monoclonal antibody includes " chimeric " antibody herein, a wherein part for heavy chain and/or light chain is identical or homologous with derived from particular species or the corresponding sequence belonged in the antibody of specific antibodies classification or subclass, and the remainder of chain is identical or homologous with derived from another species or the corresponding sequence belonged in the antibody of another antibody isotype or subclass, and the fragment of this antibody-like, as long as they show desired biological activity (referring to United States Patent (USP) No.4,816,567；Morrison etc., Proc.Natl.Acad.Sci.USA81：6851-6855(1984)).Chimeric antibody interested includes including variable domain antigen-binding subsequences and " primatized " antibody of human constant region sequence derived from non-human primate (such as Old World monkey class (Old World Monkey), ape) herein.

" complete antibody " refers to comprising antigen binding site and C_LAt least heavy-chain constant domains C _H1、C _H2 and C _H3 antibody.Constant domain can be native sebquence constant domains (such as naive sebquence constant domains) or its amino acid sequence variation.Preferably, complete antibody has one or more of effector functions.

" antibody fragment " includes a part for complete antibody, the preferably antigen binding of complete antibody or variable region.The example of antibody fragment includes Fab, Fab ', F (ab ')₂With Fv fragments；Double antibody；Linear antibodies are (referring to United States Patent (USP) 5,641,870, embodiment 2；Zapata etc., Protein Eng.8 (10)：1057-1062(1995))；Single-chain antibody molecules；And the multi-specificity antibody formed by antibody fragment.

Two identical antigen-binding fragments are produced with Papain digestion of antibodies, are referred to as " Fab " fragment, and remnants " Fc " fragment, its title reflects the ability that it is easy to crystallization.Fab fragments are by a Whole light chains and the variable region (V of a heavy chain_H) and the first constant region (C_H1) constitute.Each Fab fragments are monovalent for antigen binding, i.e., it has an antigen binding site.Pepsin antibody produces F (ab ') one big₂Fragment, it is about the same in two Fab fragments being connected by disulfide bond, with bivalent antigen binding activity and still is able to crosslinking antigen.Fab ' fragments are because in C_HThe carboxyl terminal of 1 domain adds a small number of residues and different with Fab fragments, including one or more cysteines from antibody hinge region.Fab '-SH are the appellations for the Fab ' that herein wherein constant region cysteine residues are carried with free sulphur alcohol radical.F(ab′)₂Antibody fragment is generated as paired Fab ' fragments, has hinge cysteine between Fab ' fragments.Also know other chemical couplings of antibody fragment.

Fc fragments include the carboxy-terminal sections of all two heavy chains kept together by disulfide bond.What the sequence in the effector functions Shi You Fc areas of antibody was determined, the area also suffers from the part that the Fc acceptors (FcR) found on certain form of cell are recognized.

" Fv " is that the minimum antibody fragment with binding site is recognized comprising intact antigen.This fragment is made up of the dimer of close, Non-covalent binding a weight chain variable district and a light chain variable district.Hair tonic goes out six hypervariable loops (heavy chain and each 3 rings of light chain) from the folding of the two domains, contributes the amino acid residue of antigen binding and assigns antibody with antigen-binding specificity.Even however, single variable region (or only including half of Fv of three CDR to antigen-specific) also has the ability for recognizing and combining antigen, although affinity is less than entire binding site.

" scFv ", can also be abbreviated as " sFv " or " scFv ", be comprising the antibody V for connecting into a polypeptide chain_HAnd V_LThe antibody fragment of domain.Preferably, sFv polypeptides are in V_HAnd V_LPeptide linker is also included between domain so that the sFv formation desired structures of antigen binding.Summary on sFv referring to Pl ü ckthun,《The Pharmacology of Monoclonal Antibodies》, vol.113, Rosenburg and Moore compile, Springer-Verlag, New York, pp.269-315,1994；Borrebaeck 1995, sees below.

Term " double antibody " refers to by V_HAnd V_LThe small antibody fragments for building sFv fragments (see the preceding paragraph) using short circuit head (about 5-10 residue) between domain and preparing, because joint is short, matched so that V structure domain is carried out in interchain rather than chain, cause bivalent fragment, the i.e. fragment with two antigen binding sites.Bispecific double antibody is the heterodimer of two " intersection " sFv fragments, the V of two of which antibody_HAnd V_LDomain is present on different polypeptide chains.Double antibody it is more complete be described in such as EP 404,097；WO93/11161；Hollinger etc., Proc.Natl.Acad.Sci.USA, 90：6444-6448(1993).

" humanization " form of inhuman (such as rodent) antibody refers to the chimeric antibody that bottom line includes the sequence derived from non-human antibody.Largely, some hypervariable region residues that humanized antibody refers in human immunoglobulin(HIg) (receptor antibody) immunoglobulin that some hypervariable region residues of non-human species' (donor antibody) such as mouse, rat, rabbit or non-human primates with expectation antibody specificity, affinity and ability are replaced.In some cases, framework region (FR) residue of human immunoglobulin(HIg) is replaced with corresponding non-human residues.In addition, humanized antibody can be included in the residue for not having to find in receptor antibody or donor antibody.It is to further improve the performance of antibody to carry out these modifications.Generally, humanized antibody includes at least one, usually two substantially whole following variable regions, wherein entirely or substantially upper whole hypervariable loop corresponds to the hypervariable loop of non-human immunoglobulin, and entirely or substantially upper whole FR is the FR of human immunoglobulin sequence.Humanized antibody optionally also includes at least part constant region for immunoglobulin (Fc), the typically constant region of human immunoglobulin(HIg).More details are referring to Jones etc., Nature 321：522-525(1986)；Riechmann etc., Nature 332：323-329(1988)；Presta, Curr.Op.Struct.Biol.2：593-596(1992).

" species-dependent antibody ", such as mammalian anti-human's IgE antibody, refer to has the antibody for being better than the binding affinity to homologue of the antigen from the second mammalian species to the antigen from the first mammalian species.Generally, species-dependent antibody " specific binding " human antigen is (i.e. with no more than about 1x10^-7M, preferably more than about 1x10^-8M, is most preferably not more than about 1x10^-9M binding affinity (Kd)), but have the antigen homologue from the second non-human mammal species at least about 50 times weak to the binding affinity of human antigen than it, or at least about 500 times, or at least about 1000 times of binding affinity.Species-dependent antibody can be various types of antibody, but preferably humanized antibody or human antibody as defined above.

" RA1c polypeptide combinations oligopeptides " refers to combination, preferably specifically binds the oligopeptides of RA1c polypeptides described herein.Known oligopeptides synthetic methodology can be used and chemical synthesis in RA1c polypeptide combinations oligopeptides, or recombinant technique can be used to prepare and purify.The length of RA1c polypeptide combination oligopeptides is typically at least about 5 amino acid, or length is at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 amino acid or more, wherein such oligopeptides can be combined, it is preferred that specifically binding RA1c polypeptides described herein.Widely-known technique can be used just to be identified without excessively testing for RA1c polypeptide combinations oligopeptides.In this regard it is noted that the technology of the oligopeptides for being capable of specific binding polypeptide target to oligopeptides library screening is well-known in the art (see, for example, United States Patent (USP) 5,556,762,5,750,373,4,708,871,4,833,092,5,223,409,5,403,484,5,571,689,5,663,143；PCT Publication WO84/03506 and WO 84/03564；Geysen etc., Proc.Natl.Acad.Sci.U.S.A.81：3998-4002(1984)；Geysen etc., Proc.Natl.Acad.Sci.U.S.A.82：178-182(1985)；Geysen etc., in Synthetic Peptides as Antigens, 130-149 (1986)；Geysen etc., J.Immunol.Meth.102：259-274(1987)；Schoofs etc., J.Immunol.140：611-616(1988)；Cwirla, S.E. etc., Proc.Natl.Acad.Sci.USA 87：6378(1990)；Lowman, H.B. etc., Biochemistry 30：10832(1991)；Clackson, T. etc., Nature 352：624(1991)；Marks, J.D. etc., J.Mol.Biol.222：581(1991)；Kang, A.S. etc., Proc.Natl.Acad.Sci.USA 88：8363(1991)；And Smith, G.P., Current Opin.Biotechnol.2：668(1991)).

" RA1c polypeptides combine organic or inorganic molecules " refers to beyond oligopeptides defined herein or antibody, with reference to preferably specifically binding the organic or inorganic small molecule of RA1c polypeptides described herein.Small molecule RA1c antagonists are preferably organic molecule.RA1c polypeptide combination organic molecules can be used the known formula science of law to identify and chemical synthesis (see, for example, PCT Publication WO 00/00823 and WO 00/39585).The size of RA1c polypeptide combination organic molecules is typically less than about 2000 dalton, or size is less than about 1500,750,500,250 or 200 dalton, it can wherein combine, widely-known technique can be used just to be identified without excessively testing for this organic micromolecule for preferably specifically binding RA1c polypeptides described herein.In this regard it is noted that the technology of the molecule for being capable of Binding peptide target to organic molecule library screening is (see, for example, PCT Publication WO 00/00823 and WO 00/39585) well-known in the art.

Antibody of the present invention, oligopeptides or the other organic or inorganic small molecules of " with reference to " purpose antigen such as RA1c polypeptides refer to combines the antigen with enough affinity so that the antibody, oligopeptides or other organic or inorganic small molecules can be used for the cell or tissue of the targeted expression antigen as diagnosticum and/or therapeutic agent and significantly not occur cross reaction with other oroteins.In such embodiment, analyzed according to fluorescence-activated cell sorting (FACS) or radioimmunoprecipitation (RIA) measure, antibody, oligopeptides or other organic or inorganic small molecules combine the degree of " non-target " protein by less than the antibody, oligopeptides or other organic or inorganic small molecules to about the 10% of the combination of its specific target protein.Combination for antibody, oligopeptides or other organic or inorganic small molecules to target molecule, term " specific bond " or " specific binding " particular polypeptide or epitope in particular polypeptide target mean measurable combination different from non-specific interaction to its " special ".Specific bond can be for example, by determining the combination of molecule and being compared and measured with the combination of control molecule, and the control molecule is typically that structure is similar but be not bound with the molecule of activity.For example, specific bond can be determined by the competition with control molecule, the control molecule is similar to target, such as excessive unmarked target material.In this case, if the combination of labeled target and probe by excessive unmarked target material Reverse transcriptase, it indicates that specific bond.Term " specific bond " or " specific binding " particular polypeptide or epitope in particular polypeptide target can be as used herein at least about 10 by the Kd for example to target to its " special "^-4M, or at least about 10^-5M, or at least about 10^-6M, or at least about 10^-7M, or at least about 10^-8M, or at least about 10^-9M, or at least about 10^-10M, or at least about 10^-11M, or at least about 10^-12M or bigger molecule shows.In one embodiment, term " specific bond " refers to such combination, the wherein epitope in molecule combination particular polypeptide or particular polypeptide, and does not combine any other polypeptide or polypeptide epitope substantially.

The antibody of " growth of tumour cell for suppressing expression RA1c polypeptides ", oligopeptides, or other organic or inorganic small molecules, other RA1c antagonists, regulate and control the compound of RA1c expression, or combination or " growth inhibiting " antibody of one or more such compounds, oligopeptides, or other organic or inorganic small molecules, other RA1c antagonists, regulate and control the compound of RA1c expression, regulating cell stress compound, or the combination of one or more above-claimed cpds is instructed to cause measurable expression or is overexpressed those above-mentioned substances that the prostate carcinoma cell growth of RA1c polypeptides suppresses.In certain embodiments, the anti-RA1c antibody of growth inhibiting, oligopeptides, organic or inorganic small molecule, other RA1c antagonists, regulate and control the compound of RA1c expression, or the combination of one or more above-claimed cpds is suppressed over about 20% with appropriate controls compared with to the growth of tumour cell of expression RA1c polypeptides, or about 20% to about 50%, or more than 50% (such as about 50% to about 100%), the control is typically unused tested antibody, oligopeptides, other organic or inorganic small molecules, other RA1c antagonists, regulate and control the compound of RA1c expression, regulating cell stress compound, or the tumour cell of the combined treatment of one or more such compounds.In one embodiment, the antibody concentration that growth inhibition can be in cell culture is about 0.1-30 μ g/ml or measures during about 0.5nM to 200nM, wherein growth inhibition 1-10 days measure after tumour cell is exposed to antibody.If the administration of anti-the μ g/kg of RA1c polypeptide antibodies about 1 to about 100mg/kg body weight causes in about 5 days to 3 months away from administration of antibodies first or tumor mass reduction or tumor cell proliferation slow down in about 5-30 days, then the antibody is growth inhibiting in vivo.

" inducing cell stress response " means to cause cell to start at least one cell processes; such as signal transduction path or cascade reaction, the cell processes are to carry out acute or chronic transition trigger and purpose from common cell situation and stable state to be counteracting damage, repair infringement and protection cell.

" alleviation cellular stress response " means pair any reduction relevant with cellular stress response or any physiological status as caused by cellular stress response, suppression or prevention.In one embodiment, the alleviation of cellular stress response causes cell to become more sensitive to the chemotherapeutics of inducing cell stress response.The rise of the sensitiveness of chemotherapeutics can be monitored compared to whether undergoing apoptosis rate and raise for example, by determining apoptosis rate of the cell when contacting the chemotherapeutics with cell before cellular stress response alleviation.Apoptosis or apoptosis can be determined by monitoring annexin V combination, DNA break, cellular contraction, endoplasmic reticulum expansion, cell rupture, and/or membrane vesicle (being referred to as apoptotic body) formation.Induction to apoptosis can also be determined by the facs analysis to sample cell group.The cell is typically to be overexpressed RA1c polypeptides.Preferably, the cell is the tumour cell of carcinoma of prostate.There are a variety of methods to can be used for assessing the cell event relevant with apoptosis.For example, can combine to measure phosphatidylserine (PS) transposition by annexin；DNA break can be assessed by DNA ladder (laddering)；Core/Chromatin condensation along with DNA break can be assessed by any increase of hypodiploid cells.The increase of apoptosis refers in annexin binding assay causes about 2 times to 50 times or about 5 times to 50 times or about 10 times to 50 times or the bigger induction combined to annexin relative to untreated cell.The rise of the sensitiveness of chemotherapeutics can be also monitored compared to whether undergoing growth retardation (such as G0/G1 stagnations) and increase by determining growth retardation of the cell when contacting the chemotherapeutics with cell before cellular stress response alleviation.Method for determining G0/G1 stagnations is found in embodiment 2.The increase of growth retardation refers to the increase relative to the G0/G1 Arrested Cells for causing about 2 times to 50 times or about 5 times to 50 times or about 10 times to 50 times or bigger what is observed in untreated cell.

Antibody " effector functions " refers to those and is attributable to antibody Fc district (native sequences Fc areas or amino acid sequence variation Fc areas) and the biological activity changed with antibody isotype.The example of antibody mediated effect device function includes：C1q is combined and complement-dependent cytotoxicity；Fc acceptors are combined；The cytotoxicity (ADCC) of antibody dependent cellular mediation；Phagocytosis；Cell surface receptor (such as B-cell receptor) is lowered；With B cell activation.

" cytotoxicity of antibody dependent cellular mediation " or " ADCC " refer to the secreting type Ig being wherein attached to present on some cytotoxic cells (such as natural killer (NK) cell, neutrophil cell and macrophage) on Fc acceptors (FcR) and enable these cytotoxic effect cells to specifically bind the target cell for carrying antigen, and the cytotoxic form of target cell is then killed with cytotoxin.Antibody " arms " (arm) cytotoxic cell, and such lethal effect definitely requires.Mediation ADCC main cell, NK cells, an expression Fc γ RIII, and monocytes Fc γ RI, Fc γ RII and Fc γ RIII.Ravetch and Kinet, Annu.Rev.Immunol.9：The page tables 3 of 457-92 (1991) the 464th summarize the FcR expression on hematopoietic cell.For the ADCC activity of purpose of appraisals molecule, it can carry out in external ADCC determination methods, such as United States Patent (USP) No.5,500,362 or 5,821,337 described.Effector cell available for such determination method includes PMNC (PBMC) and natural killer (NK) cell.Or can purpose of appraisals molecule in vivo ADCC activity, such as in animal model, Clynes etc., (USA) 95：Disclosed in 652-656 (1998).

Term " Fc acceptors " or the acceptor in " FcR " description energy binding antibody Fc areas.It is preferred that FcR be native sequences people FcR.Furthermore it is preferred that FcR be that can combine the FcR (γ acceptors) of IgG antibody, including Fc γ RI, the acceptor of Fc γ RII and Fc γ RIII subclass include each allelic variant and each alternative splice forms of these acceptors.Fc γ RII acceptors include Fc γ RIIA (" activated receptor ") and Fc γ RIIB (" suppression acceptor "), and they have similar amino acid sequence, and difference essentially consists in its cytoplasmic domains.Activated receptor Fc γ RIIA are in its cytoplasmic domains comprising immunity receptor the activation motifs (ITAM) based on tyrosine.Suppress acceptor Fc γ RIIB and suppression motif (ITIM) of the immunity receptor based on tyrosine is included in its cytoplasmic domains (referring to summaryAnnu.Rev.Immunol.15：203-234(1997)).FcR summary is referring to Ravetch and Kinet, Annu.Rev.Immunol.9：457-492(1991)；Capel etc., Immunomethods4：25-34(1994)；And de Haas etc., J.Lab.Clin.Med.126：330-341(1995).Term " FcR " covers other FcR herein, including those futures will be identified.The term also include neonatal receptor, FcRn, it is responsible for Maternal immunoglobulin G being transferred to fetus (Guyer etc., J.Immunol.117：587 (1976) and Kim etc., J.Immunol.24：249(1994)).

" human effector cell " refers to expression one or more FcR and exercises the leucocyte of effector functions.Preferably, the cell at least expresses Fc γ RIII and exercises ADCC effector functions.Mediating the example of ADCC human leukocytes includes PMNC (PBMC), natural killer (NK) cell, monocyte, cytotoxic T cell and neutrophil cell, preferably PBMC and NK cells.Effector cell can separate from its natural origin, such as blood.

" complement-dependent cytotoxicity " or " CDC " refers to dissolving when there is complement to target cell.The activation of classic complement approach is antibody (suitable subclass) starting combined by the component of complement system first (Clq) with reference to its associated antigen.In order to assess complement activation, CDC determination methods can be carried out, such as Gazzano-Santoro, J.Immunol.Methods 202：Described in 163 (1996).

The physiological status being generally characterized in term " cancer " and " carcinous " sensing or description mammal with the cell number of imbalance increase (being commonly referred to as cell growth herein) (it is unbalance with the amount of cell death that it can be due to the abnormal rise of cell propagation, the abnormal reduction of cell death or cell propagation).The example of cancer includes but is not limited to carcinoma of prostate.The example of carcinoma of prostate includes but is not limited to tumor of prostate, gland cancer and prostate intraepithelial neoplasia formation (postate intraepithelial neoplasia).

Term " cell proliferative disorders " and " proliferative disorders " refer to the illness relevant with a certain degree of abnormal cell proliferation.In one embodiment, cell proliferative disorders refer to cancer.

" tumour " refers to all neoplastic (neoplastic) cell growths and propagation as used herein, either pernicious or benign, and (pre-cancerous) and cancerous cells and tissue before all cancers.Term " cancer ", " carcinous ", " cell proliferative disorders ", " proliferative disorders " and " tumour " is not mutually exclusive when mentioning herein.

The Assembler Directives of the compound or one or more such compounds of the RA1c antagonists of " inducing cell death " or regulation and control RA1c expression rise can survivaling cell become unable to the antibody of survival.The cell refers to the cell of expression RA1c polypeptides, and is the cell of the cell type of expression or overexpression RA1c polypeptides.The cell can be the carcinous or normal cell of particular cell types.RA1c polypeptides can be the transmembrane polypeptide expressed on cancer cell surfaces, or can be the polypeptide for being generated and being secreted by cancer cell.The cell can be cancer cell, such as prostate gland cancer cell.Cell death in vitro can be determined when in the absence of complement or immune effector cell, to distinguish by the cell death of cytotoxicity (ADCC) or complement-dependent cytotoxicity (CDC) induction of antibody dependent cellular mediation.In this way, hot inactivated serum (i.e. without complement) can be used to be carried out when in the absence of immune effector cell for the determination method for cell death.In order to determine antibody, oligopeptides or other organic molecules, other RA1c antagonists, the compound of regulation and control RA1c expression, regulating cell stress compound or the combinations of one or more such compounds whether being capable of inducing cell death, the forfeiture of film integrality can be assessed relative to untreated cell, it is (referring to Moore etc., Cytotechnology 17 by propidium iodide (propidium iodide) (PI), trypan blue：1-11 (1995)) or 7AAD intake assess.It is preferred that antibody, oligopeptides or the other organic molecules of inducing cell death, other RA1c adjusting control agents, the combination of the compound or one or more such compounds of regulation and control RA1c expression be to induce PI to absorb in a non-limitative example LNCaP cell of prostate gland cancer cell model in PI intake determination methods.

" cell of expression RA1c polypeptides " refers to the cell that endogenous or transfection RA1c polypeptides are for example expressed with secreted form.Can be in detection or prognostic assays by assessing the RA1c protein levels of in cell and/or cell surface and/or cell secretion (such as by Immunohistochemical assay, recombinant DNA technology can be used to be prepared from the nucleic acid of the separation of coding RA1c polypeptides for the anti-RA1c polypeptide antibodies prepared using the RA1c polypeptides for separation, the RA1c polypeptides；Facs analysis；Deng) determine RA1c expression of polypeptides.Or the nucleic acid of RA1c polypeptides or mRNA level are encoded in measurable cell, such as by FISH, use the nucleic acid or the probe (FISH based on nucleic acid of its complementary strand corresponding to coding RA1c polypeptides；Referring to WO 98/45479, in October, 1998 is disclosed in)；Southern traces；Northern traces；Or PCR (PCR) technology, such as real-time quantitative PCR (RT-PCR).The determination method based on antibody is it is also possible to use, (referring also to such as United States Patent (USP) 4,933,294, June nineteen ninety is issued to 12 by measuring the released antigen in biological fluid such as serum to study RA1c expression of polypeptides；WO 91/05264, is disclosed on April 18th, 1991；United States Patent (USP) 5,401,638, is issued to March nineteen ninety-five 28；Sias etc., J.Immunol.Methods 132：73-80(1990)).Except said determination method, skilled practitioner is also using a variety of in vivoassay methods.For example, can be by cell in patient's body exposed to optionally with the antibody of detectable such as labelled with radioisotope, and the combination of cell in antibody and patient's body can be assessed, such as the biopsy being derived from by external scan radioactivity or by analysis in advance exposed to the patient of the antibody is cut into slices.

As used herein, term " immunoadhesin " refers to the antibody sample molecule that the effector functions of the binding specificity of heterologous protein (" adhesin ") and immunoglobulin constant domain are joined together.In structure, immunoadhesin includes the fusions of antigen recognizing and binding site (being " heterologous ") different from antibody, the amino acid sequence with expectation binding specificity and immunoglobulin constant domain sequence.The adhesin part of immunoadhesin molecule is typically the continuous amino acid sequence of the binding site including at least acceptor or part.Immunoglobulin constant domain sequence in immunoadhesin can be obtained from any immunoglobulin, such as IgG-1, IgG-2, IgG-3 or IgG-4 hypotype, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.

Word " label " refers to as used herein to be directly or indirectly coupled to generate the detectable compounds or composition of " tape label thing " or " by mark " antibody, oligopeptides or other organic or inorganic small molecules with antibody, oligopeptides or other organic or inorganic small molecules.Label can be by itself just detectable (such as radioisotopic tracer or fluorescent marker), or in the case of enzyme marker, the chemical modification of detectable substrate compounds or composition can be catalyzed.

Term " cytotoxic agent " refers to suppression or prevents the function of cell and/or cause the material of cytoclasis as used herein.The term is intended to include：Radio isotope, such as At²¹¹、I¹³¹、I¹²⁵、Y⁹⁰、Re¹⁸⁶、Re¹⁸⁸、Sm¹⁵³、Bi²¹²、P³²With Lu radio isotope；Chemotherapeutics, such as methotrexate (MTX) (methotrexate), adriamycin (adriamycin), vinca alkaloids (vinca alkaloids) (vincristine (vincristine), vincaleukoblastinum (vinblastine), Etoposide (etoposide)), Doxorubicin (doxorubicin), melphalan (melphalan), mitomycin (mitomycin) C, Chlorambucil (chlorambucil), daunorubicin (daunorubicin) or other intercalators；Enzyme and its fragment, such as nucleolytic enzyme；Antibiotic；And toxin, such as small molecule toxins or bacterium, fungi, the enzyme activity toxin of plant or animal origin, including its fragment and/or variant；And the various antineoplastics or anticarcinogen being disclosed below.Hereafter describe other cytotoxic agents.Kill the destruction that tumour efficacy-enhancing ingredient plays tumour cell.

" chemotherapeutics " refers to the chemical compound available for treating cancer.The instantiation of chemotherapeutics includes the medicament for suppressing mTor or AKT approach, including but not limited to rapamycin/sirolimus (sirolimus), CCI-779/temsirolimus (Wyeth), RAD001/ everolimuses (everolimus) (Novartis), AP23573 (Ariad), XL7F65, TAFA93 (Isotechnika), GSK690693 (GlaxoSmithKline), perifosine (AEterna Zentaris) and XL418 (Exelixis) and their reactive derivative and analog.

Other examples of chemotherapeutics include alkylating agents (alkylating agents), such as phosphinothioylidynetrisaziridine (thiotepa) and

Endoxan (cyclophosphamide)；Alkylsulfonates (alkyl sulfonates), such as busulfan (busulfan), Improsulfan (improsulfan) and piposulfan (piposulfan)；Aziridines (aziridines), such as Benzodepa (benzodepa), carboquone (carboquone), meturedepa (meturedepa) and uredepa (uredepa)；Ethylenimines (ethylenimines) and methylamelamines (methylamelamines), including hemel (altretamine), triethylenemelamine (triethylenemelamine), triethylphosphoramide (triethylenephosphoramide), triethylene thiophosphamide (triethylenethiophosphoramide) and trimethylolmelamine (trimethylolomelamine)；Annonaceousacetogenicompounds (acetogenin) (especially bullatacin (bullatacin) and bullatacinone (bullatacinone))；Delta-9-Tetrahydrocannabinol (tetrahydrocannabinol) (Dronabinol (dronabinol),

)；β-lapachol (lapachone)；Lapachol (lapachol)；Colchicines (colchicines)；Betulic acid (betulinic acid)；Camptothecine (camptothecin) (including synthetic analogues Hycamtin (topotecan) (

), CPT-11 (Irinotecan (irinotecan),

), acetyl camptothecine, scopoletin (scopoletin) and 9-aminocamptothecin)；Bryostatin (bryostatin)；callystatin；CC-1065 (including its Adozelesin (adozelesin), Carzelesin (carzelesin) and Bizelesin (bizelesin) synthetic analogues)；Podophyllotoxin (podophyllotoxin)；Podophyllic acid (podophyllinic acid)；Teniposide (teniposide)；Cryptophycins (cryptophycins) (particularly cryptophycin 1 and cryptophycin 8)；Dolastatin (dolastatin)；Duocarmycin (including synthetic analogues, KW-2189 and CB1-TM1)；Eleutherobin (eleutherobin)；pancratistatin；sarcodictyin；Spongistatin (spongistatin)；Nitrogen mustards (nitrogen mustards), such as Chlorambucil (chlorambucil), Chlornaphazine (chlornaphazine), cholophosphamide (cholophosphamide), Estramustine (estramustine), ifosfamide (ifosfamide), chlormethine (mechlorethamine), mustron (mechlorethamineoxide hydrochloride), melphalan (melphalan), novoembichin (novembichin), phenesterin (phenesterine), prednimustine (prednimustine), Trofosfamide (trofosfamide), uracil mastard (uracil mustard)；Nitrosourea (nitrosoureas), such as BCNU (carmustine), chlorozotocin (chlorozotocin), Fotemustine (fotemustine), lomustine (lomustine), Nimustine (nimustine) and Ranimustine (ranimustine)；Antibioticses, such as Enediyne Antibiotic (enediyne) (such as Calicheamicin (calicheamicin), especially Calicheamicin γ 1I and Calicheamicin ω I1 are (see, for example, Agnew, Chem.Intl.Ed.Engl.33：183-186(1994))；Anthracycline antibiotic (dynemicin), including dynemicin A；Ai sibo mycin (esperamicin)；And Neocarzinostatin (neocarzinostatin) chromophore and related chromoprotein Enediyne Antibiotic chromophore), aclacinomycin (aclacinomycin), D actinomycin D (actinomycin), anthramycin (anthramycin), azaserine (azaserine), bleomycin (bleomycin), act-C (cactinomycin), carabicin, carminomycin (carminomycin), cardinophyllin (carzinophilin), chromomycin (chromomycin), actinomycin D (dactinomycin), daunorubicin (daunorubicin), Detorubicin (detorubicin), 6- phenodiazine -5- oxygen-L- nor-leucines,

Doxorubicin (doxorubicin) (including morpholino Doxorubicin, Cyanomorpholino Doxorubicin, 2- pyrroles is for Doxorubicin and deoxydoxorubicin), epirubicin (epirubicin), esorubicin (esorubicin), idarubicin (idarubicin), marcellomycin (marcellomycin), mitomycin (mitomycins) such as mitomycin C, mycophenolic acid (mycophenolic acid), nogalamycin (nogalamycin), olivomycin (olivomycin), Peplomycin (peplomycin), porfiromycin (potfiromycin), puromycin (puromycin), triferricdoxorubicin (quelamycin), rodorubicin (rodorubicin), streptonigrin (streptonigrin), streptozotocin (streptozocin), tubercidin (tubercidin), ubenimex (ubenimex), Zinostatin (zinostatin), zorubicin (zorubicin)；Antimetabolic species, such as methotrexate (MTX) and 5 FU 5 fluorouracil (5-FU)；Folacin, such as denopterin (denopterin), methotrexate (MTX), pteroyltriglutamic acid (pteropterin), Trimetrexate (trimetrexate)；Purine analogue, such as fludarabine (fludarabine), Ismipur (mercaptopurine), thiapurine (thiamiprine), thioguanine (thioguanine)；Pyrimidine analogue, such as ancitabine (ancitabine), azacitidine (azacitidine), 6- azauridines, Carmofur (carmofur), cytarabine (cytarabine), dideoxyuridine (dideoxyuridine), doxifluridine (doxifluridine), enocitabine (enocitabine), floxuridine (floxuridine)；Androgens, such as calusterone (calusterone), dromostanolone propionate (dromostanolone propionate), epitiostanol (epitiostanol), Mepitiostane (mepitiostane), Testolactone (testolactone)；Anti- adrenal gland class, such as aminoglutethimide (aminoglutethimide), mitotane (mitotane), Trilostane (trilostane)；Folic acid supplement, such as folinic acid (folinic acid)；Aceglatone (aceglatone)；Aldophosphamideglycoside (aldophosphamide glycoside)；Amino-laevulic acid (aminolevulinic acid)；Eniluracil (eniluracil)；Amsacrine (amsacrine)；bestrabucil；Bisantrene (bisantrene)；Edatrexate (edatraxate)；Defosfamide (defosfamide)；Demecolcine (demecolcine)；Diaziquone (diaziquone)；elfornithine；Elliptinium Acetate (elliptinium acetate)；Epothilones (epothilone)；Ethoglucid (etoglucid)；Gallium nitrate；Hydroxyurea (hydroxyurea)；Lentinan (lentinan)；Lonidamine (lonidamine)；Maytansinoids (maytansinoids), such as maytansine (maytansine) and maytansinol (maytansinol)；Ansamitocin (ansamitocin)；Mitoguazone (mitoguazone)；Mitoxantrone (mitoxantrone)；Mopidamol (mopidamol)；C-283 (nitracrine)；Pentostatin (pentostatin)；Phenamet (phenamet)；THP (pirarubicin)；Losoxantrone (losoxantrone)；2- ethylhydrazides (ethylhydrazide)；Procarbazine (procarbazine)；

Polysaccharide compound (JHS Natural Products, Eugene, OR)；Razoxane (razoxane)；Rhizomycin (rhizoxin)；Sizofiran (sizofiran)；Spirogermanium (spirogermanium)；Tenuazonic acid (tenuazonic acid)；Triethyleneiminobenzoquinone (triaziquone)；2,2 ', 2 "-trichlorotriethylamines；Trichothecin class (trichothecenes) (especially T-2 toxin, verrucarine (verrucarin) A, roridin (roridin) A and snake rhzomorph (anguidin))；Urethane (urethan)；Eldisine (vindesine) (

)；Dacarbazine (dacarbazine)；Mannomustin (mannomustine)；Dibromannitol (mitobronitol)；Mitolactol (mitolactol)；Pipobroman (pipobroman)；gacytosine；Cytarabine (arabinoside) (" Ara-C ")；Phosphinothioylidynetrisaziridine (thiotepa)；Taxoid (taxoids), for exampleTaxol (paclitaxel) (Bristol-Myers Squibb Oncology, Princeton, N.J.), ABRAXANE^TMWithout cremophor (Cremophor), the nano particle formulation taxol (American Pharmaceutical Partners, Schaumberg, Illinois) of albumin transformation andTaxotere (doxetaxel) (

- Poulenc Rorer, Antony, France)；Chlorambucil (chlorambucil)；Gemcitabine (gemcitabine) (

)；6- thioguanines (thioguanine)；Purinethol (mercaptopurine)；Methotrexate (MTX) (methotrexate)；Platinum analogs, such as cis-platinum (cisplatin) and carboplatin (carboplatin)；Vincaleukoblastinum (vinblastine) ()；Platinum；Etoposide (etoposide) (VP-16)；Ifosfamide (ifosfamide)；Mitoxantrone (mitoxantrone)；Vincristine (vincristine) (

)；Oxaliplatin (oxaliplatin)；Folinic acid (leucovorin)；Vinorelbine (vinorelbine) (

)；NSC-279836 (novantrone)；Edatrexate (edatrexate)；Daunomycin (daunomycin)；Aminopterin (aminopterin)；Ibandronate (ibandronate)；Topoisomerase enzyme inhibitor RFS 2000；DFMO (DMFO)；Retinoids (retinoids), such as Tretinoin (retinoic acid)；Capecitabine (capecitabine) (

)；Pharmaceutically acceptable salt, acid or the derivative of any of above material；And the combination of two or more above-mentioned substances, such as CHOP (endoxan, Doxorubicin, the abbreviation of vincristine and prednisolone conjoint therapy) and FOLFOX (oxaliplatin (ELOXATIN^TM) joint 5-FU and folinic acid therapeutic scheme abbreviation).

This definition also includes acting as adjusting, reduce, block or suppressing that the antihormone agent of the hormone effect of cancer growth, and the often form of system or whole body therapeutic can be promoted.Their own can be hormone.Example include anti-estrogens and SERM class (SERM), including for example TAM (tamoxifen) (including

TAM),

Raloxifene (raloxifene), Droloxifene (droloxifene), 4-hydroxytamoxifen, Trioxifene (trioxifene), that Lip river former times fragrant (keoxifene), LY117018, Onapristone (onapristone) and

Toremifene (toremifene)；Antiprogestin class；Estrogen receptor down agent class (ERD)；Function for suppress or close ovary medicament, such as luteinizing hormone releasing hormone (LHRH) activator, such as

With

Leuprorelin acetate (leuprolide acetate), goserelin acetate (goserelinacetate), buserelin acetate (buserelin acetate) and Triptorelin (triptorelin)；Other anti-androgenses, such as Drogenil (flutamide), Nilutamide (nilutamide) and bicalutamide (bicalutamide)；And suppress in adrenal gland adjust estrogen production aromatase enzyme aromatase inhibitor, such as 4 (5)-imidazoles, aminoglutethimide (aminoglutethimide),

Megestrol acetate (megestrol acetate),

Exemestane (exemestane), formestane (formestane), Fadrozole (fadrozole),

R 83842 (vorozole),

Letrozole (letrozole) and

Anastrozole (anastrozole).In addition, this definition of chemotherapeutics includes diphosphonates (bisphosphonates), such as clodronate (clodronate) (for example

Or)、

Etidronate (etidronate), NE-58095,Zoledronic acid/zoledronate (zoledronic acid/zoledronate),

Alendronate (alendronate),

Pamidronate (pamidronate),

Tiludronate (tiludronate) or

Risedronate (risedronate)；And troxacitabine (troxacitabine) (DOX nucleosides analogue of cytosine)；ASON, particularly suppresses to involve the ASON of gene expression of the signal of adhesive cell propagation in, such as PKC- α, Raf, H-Ras and EGF-R ELISA (EGF-R)；Vaccine, such as

Vaccine and gene therapy vaccine, for exampleVaccine,

Vaccine and

Vaccine；

The inhibitor of topoisomerase 1；

rmRH；Lapatinib ditosylate (ErbB-2 and EGFR dual tyrosine kinase micromolecular inhibitors, also referred to as GW572016)；And pharmaceutically acceptable salt, acid or the derivative of any of above material.

" growth inhibitor " refers to the compound or composition for the cancerous cell growth for suppressing expression RA1c polypeptides in vitro or in vivo as used herein.Therefore, growth inhibitor can be the medicament for the cell percentages for significantly reducing the expression RA1c polypeptides in the S phases.The example of growth inhibitor includes the medicament for blocking the cell cycle to advance and (be in the position beyond the S phases), such as induces the medicament that G1 is stagnated and the M phases stagnate.Classical M phases blocking agent includes long aphrodisiac class (vincas) (vincristine (vincristine) and vincaleukoblastinum (vinblastine)), taxanes (taxanes) and Topoisomerase II inhibitors such as Doxorubicin (doxorubicin), epirubicin (epirubicin), daunorubicin (daunorubicin), Etoposide (etoposide) and bleomycin (bleomycin).Those retardances G1 medicaments also overflow into the S phases and stagnated, such as DNA alkylating agents such as TAM (tamoxifen), metacortandracin (prednisone), Dacarbazine (dacarbazine), chlormethine (mechlorethamine), cis-platinum (cisplatin), methotrexate (MTX) (methotrexate), 5 FU 5 fluorouracil (5-fluorouracil) and ara-C.More information can be found in《TheMolecular Basis of Cancer》, Mendelsohn and Israel compile, the 1st chapter, entitled " Cell cycleregulation, oncogenes, and antieioplastic drugs ", Murakaini et al., WB Saunders, Philadelphia, 1995, especially the 13rd page.Taxanes (Taxol (paclitaxel) and docetaxel (docetaxel)) is the anticarcinogen derived from yew tree.Derived from European yew docetaxel (

Rhone-Poulenc Rorer) be taxol (

Bristol-MyersSquibb semi-synthetic analog).Taxol and docetaxel promote to be assembled into micro-pipe and by preventing depolymerization from making microtubule stabilization by tubulin dimer, cause to suppress to mitotic in cell.

" Doxorubicin (Doxorubicin) " is anthracycline antibiotic.The full chemical name of Doxorubicin is (8S- is cis) -10- [(3- amino -2,3, the deoxidation-α-L- lysols of 6- tri--pyranohexose base) epoxide] -7; 8,9,10- tetrahydrochysenes -6; 8,11- trihydroxy -8- (hydroxyacetyl) -1- methoxyl group -5,12- naphthalenediones.

(8S-cis) -10- [(3-amino-2,3,6-trideoxy- α-L-lyxo-hexapyranosyl) oxy] -7,8,9,10-tetrahydro-6,8,11-trihydroxy-8- (hydroxyacetyl) -1-methoxy-5,12-naphthacenedione

Term " cytokine " " is discharged by a kind of cell mass, and the common name of the protein of another cell is acted on as extracellular medium.The example of this type cytokines has lymphokine, monokine and traditional polypeptide hormone.Cell factor includes growth hormone, such as human growth hormone (HGH), N- methionyl human growth hormones and bovine growth hormone；Parathormone；Thyroxine；Insulin；Proinsulin；Relaxins；Relaxins is former；Glycoprotein hormone, such as follicle-stimulating hormone (FSH) (FSH), thyrotropic hormone (TSH) and metakentrin (LH)；Liver growth factor；Fibroblast growth factor；Prolactin；Human placental lactogen；Tumor necrosis factor-alpha and-β；Mu Leshi (Mullerian) inhibitory substance；Small mouse promoting sexual gland hormone related peptide；Inhibin；Activin；VEGF (VEGF)；Integrin；TPO (TPO)；Nerve growth factor, such as NGF- β；Platelet growth factor；TGF (TGF), such as TGF- α and TGF-β；Insulin like growth factor-1 and-II；Erythropoietin(EPO) (EPO)；Bone-inducing factor (osteoinductive factor)；Interferon, such as interferon-' alpha ' ,-β and-γ；Colony stimulating factor (CSF), such as macrophage CSF (M-CSF), granulocytes-macrophages CSF (GM-CSF) and granulocyte CSF (G-CSF)；Interleukin (IL), such as IL-1, IL-1 α, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12；TNF, such as TNF-α or TNF-β；And other polypeptide factors, including LIF and kit parts (KL).As used herein, term cell factor includes the biological activity equivalent of the protein and native sequence cytokines from natural origin or from recombinant cell culture thing.

" package insert ", which is used to refer to, is typically included in specification in the commercial packing for the treatment of product, and they, which include, concerns and the indication of such treatment products application, usage, dosage, the information using, contraindication, and/or warning.

II. the compositions and methods of the invention

RA1c altimeters in prostate gland cancer cell reach, and do not expressed substantially in most of other normal and illing tissues generally tested, as described in herein and following bibliography, such as US published patent application No.20050106644, Xu etc., Cancer Res.60：6568-6572 (2000), Yuan etc., Gene 278：41-51 (2001), Xia etc., Oncogene 20：5903-5907(2001)；And United States Patent (USP) No.6,372,891.RA1c has the sequence homology with seven transmembrane G protein protein-coupled receptor families.

Herein show first RA1c be located at prostate gland cancer cell epicyte on, therefore as characterizing prostate cancer and treatment target can and.

The RA1c herein that also show in prostate gland cancer cell model expresses response IL-6 processing or serum deprivation and raised, and points out RA1c expression by the elevated stimulation of cellular stress.Cellular stress response in terms of evolution is conservative in all live organisms, and cause order undergoing stress organism adaptation survival or death Molecular responses.Cell response involves many signal specific conducted events, and it is that specific cells adapt to step and are that the specific cells of other cellular elements and function adapt to step and are ready in metabolism, film, cytoskeleton.Szalay etc., FEBS Letters, 581 (19)：3675-3680(2007).These to stress Molecular responses be largely beneficial to organism.If however, cellular stress response is induced in cancer cell, then it may interfere with effect of chemotherapeutic agent.Herr, I. and Debatin, K-M, Blood, 98：2603-2614(2001)；Tiligada, E., Endocrine-RelatedCancer, 13：S115-S124(2006).In general, chemotherapeutics suppresses cell growth and/or apoptosis-induced in sensibility tumor cell.These medicaments can cause the unbalance of Cell Homeostasis, cause cellular stress.It is used as response, cell experience cellular stress response, it is intended to make cell recover its previous state.In cellular environment stress type and dosage seem the result of regulation cell response.Cellular stress response can determine that cell is sensitive to chemotherapeutic agent or chemotherapeutic agent is resisted.Blood, 98：2603-2614.

The research carried out with the inhibitor for some intracellular signaling pathways for being considered as involving IL-6 or described herein cellular stress responses demonstrates the suppression to p38 map kinases or any RA1c caused in handled cell in PI3K suppression is expressed and reduces.However, mTOR active to composition and Akt 1/2 suppression has reverse effect, that is, RA1c is stimulated to express, and this effect is at least additive to the effect observed by single IL-6.

The data presented in embodiment hereof specify the gene that RA1c is stress-induced, can provide survival advantage to cancer cell.Figure 14 C.Under normal sufficient growth conditions, RA1c expression is contained, and RA1c expression responses are beneficial to the condition (IL-6 processing or serum deprivation) of cellular stress and raised.In addition, RA1c expression responsive cell stress up-regulation can reverse or mitigate by growth promotion pathway activation (DHT), and (rapamycin) amplifies when growth promotion approach is by further suppress.

Suppression and IL-6 to Akt1/2 or mTOR are at least additive observation result and point out these inhibitor and the combination of anti-RA1c molecules to have treatment benefit in treatment of cancer.Several targeting mTOR medicament is in clinical assessment, for example rapamycin/sirolimus (sirolimus), CCI-779/temsirolimus, RAD001/ everolimus (everolimus), AP23573, XL7F65 and TAFA93 and their reactive derivative or the like.Akt inhibitor equally comes into clinical development, including GSK690693, perifosine and XL418 and their reactive derivative or the like at present.

Thus, the invention provides the method for alleviating cellular stress response, particularly in prostate gland cancer cell, by reducing or blocking, RA1c in those cells is expressed or RA1c activity is realized for it.Reduction blocks the RA1c expression in cell or compound of the compound including RA1c antagonists and regulation and control RA1c expression of activity.Reduction blocks the RA1c expression in cell or the example of the compound of activity to include but is not limited to antibody, antibody fragment, antibody coupling matter, fit, small molecule, oligopeptides, antisense polynucleotides, silence RNA molecule, catalytic RNA molecules and RNA-DNA block polymers, and further describes herein.

A variety of factor energy inducing cell stress responses.For example, by by cell be placed under the conditions of serum deprivation can in cell inducing cell stress response.Also can inducing cell stress response by exposing cells to IL-6.The chemotherapeutics usually inducing cell stress response in the cell that the medicament is targetted.Cellular stress response successfully permissive cell can survive in chemotherapeutic agent.As a result, cell is less sensitive to medicament, and effect of chemotherapeutic treatment is adversely affected.Alleviation to cellular stress response improves sensitiveness of the cell to chemotherapeutic agent.In one embodiment, after contact chemotherapeutics with the speed higher than cell not in contact with the compound apoptosis occurs for the cell that cellular stress response has been alleviated.In another embodiment, after contact chemotherapeutics with the speed higher than cell not in contact with the compound growth retardation occurs for the cell that cellular stress response has been alleviated.

One aspect of the present invention provides the method for alleviating cellular stress response in the cancer patient for the chemotherapy that the chemotherapeutics received using inducing cell stress response is carried out, including applies at least one reduction to the patient or block the compound of RA1c expression or activity.In a specific embodiment, the cancer patient suffers from prostate cancer.Receiving the patient of this treatment method has the cancer cell more sensitive to chemotherapeutic treatment.

The chemotherapeutics of inducing cell stress response includes but is not limited to the inhibitor of mTOR or Akt1/2 approach.

Invention further provides the conjoint therapy for treating cancer.In one embodiment, the conjoint therapy includes the compound of the chemotherapeutics for making cancer cell contact improve RA1c expression and specific binding RA1c polypeptides.Improving the example of the chemotherapeutics of RA1c expression includes the medicament of inducing cell stress response.The specific example for improving the chemotherapeutics of RA1c expression includes but is not limited to the inhibitor of mTOR or Akt1/2 approach.The compound of specific binding RA1c polypeptides includes but is not limited to anti-RA1c antibody or its fragment, RA1c combinations oligopeptides, specific binding RA1c small molecule and other RA1c antagonists are such as fit.The rise of RA1c expression of polypeptides provides the target raised to recognize and combining RA1c compound.Preferably, the compound of specific binding RA1c polypeptides is coupled to cytotoxic agent.The therapeutic alliance of chemotherapeutics and specific binding RA1c compound provides cooperative effect, causes improved treatment of cancer.In a specific embodiment, the cancer cell is prostate gland cancer cell.

In another embodiment, conjoint therapy includes the chemotherapeutics for making cancer cell contact improve RA1c expression and reduces or block the compound of RA1c expression or activity.Improving the example of the chemotherapeutics of RA1c expression includes the medicament of inducing cell stress response.The specific example for improving the chemotherapeutics of RA1c expression includes but is not limited to the inhibitor of mTOR or Akt1/2 approach.The rise of RA1c expression provides the target of up-regulation for identification RA1c compound.Chemotherapeutics and reduction block RA1c expression or the therapeutic alliance of active compound to provide cooperative effect, cause improved treatment of cancer.In a specific embodiment, the cancer cell is prostate gland cancer cell.

In the background for the treatment of cancer patient, conjoint therapy involves the compound that the chemotherapeutics for improving RA1c expression and reduction are applied to cancer patient or RA1c expression or activity and/or specific binding RA1c polypeptides is blocked.

Present invention also offers the composition for including above-claimed cpd either individually or in combination, just as further described herein.

Present invention also offers cancer diagnosis and by stages method.Because RA1c cell surface can and, and be the Specific marker of prostatic cell (particularly cancerous prostate cells), the use of RA1c binding molecules (include but is not limited to anti-RA1c antibody or its fragment, RA1c combinations oligopeptides, RA1c antibody coupling matters, specific binding RA1c inorganic or organic molecule and other RA1c antagonists are such as fit) of the invention should allow to express the inner or in vitro identification of RA1c cell.One or more suitable labels (including but is not limited to radioactively labelled substance, fluorescent marker, enzyme marker, colorimetric marker, spin label and any other suitable labels well known in the art) can be attached to RA1c binding molecules to help to develop.

Another aspect of the present invention is related to the method whether chemotherapeutics causes cellular stress response in cancer cell that determines.Such method is useful in terms of determining the need for undergoing the patient of chemotherapy with the compounds for treating of reduction or blocking RA1c expression or activity.

Thus, the invention provides determine chemotherapeutics whether in cancer cell inducing cell stress response method, including cancer cell is contacted chemotherapeutics and is determined the RA1c expressions in cancer cell.RA1c expressions exceed control cell or raise induction of the instruction to cellular stress response more than the RA1c expressions in the cancer cell before contact chemotherapeutics.Suitable control cell includes the cancer cell of cancer cell identical category that is untreated and being determined.Cancer cell used in this determination method is preferably prostate gland cancer cell, such as LNCaP cells.

The chemotherapeutics determined in these methods is that any suspection can cause the medicament of cellular stress response.In one embodiment, the chemotherapeutics is mTor inhibitor.In another embodiment, the chemotherapeutics is Akt1/2 inhibitor.

Present invention also offers kit and product, just as further described herein.

Following part these method and compositions and their specific aspect described in more detail.

A. anti-RA1c antibody

In one embodiment, the invention provides the anti-RA1c polypeptide antibodies that can be used herein as therapeutic agent or diagnosticum.Exemplary antibody includes polyclonal, monoclonal, humanization, bispecific and Heteroconjugate antibody.

1. polyclonal antibody

Polyclonal antibody is preferably generated by animal multiple subcutaneous (sc) or intraperitoneal (ip) injection related antigen and adjuvant.With there is the protein molecule of immunogenicity in immune species are treated it is probably useful by related antigen when synthetic peptide (especially using).For example; difunctional or derivatization reagent, such as maleimidobenzoyl sulfosuccinimide ester (coupling through cysteine residues), n-hydroxysuccinimide (through lysine residue), glutaraldehyde, succinic anhydride, SOCl can be used₂Or R¹N=C=NR, wherein R and R¹It is different alkyl, by antigen and keyhole

Hemocyanin (KLH), serum albumin, bovine thyroglobulin or soybean trypsin inhibitor coupling.In certain embodiments, the animal for generating antibody can be transgenic animals.In some such embodiments, them can be caused to show the complete missing of coding RA1c polynucleotides with engineered animal so that they do not have RA1c to express (referred to as " knocking out " animal).The method for generating such animal is it is known in the art that see, for example, Snouwaert etc., Science 257：1083,1992；Lowell etc., Nature 366：740-42,1993；Capecchi, M.R., Science 244：1288-1292,1989.Generation is probably favourable for the antibody of the protein or polypeptide in the knock-out animal for specified protein or polypeptide, because the anti-autoreactivity that may reduce antibody tormation or yield will not occur in the animal, as is well known the art.

By the way that such as 100 μ g or 5 μ g proteins or conjugate (being respectively used to rabbit or mouse) and the Freund's complete adjuvant of 3 times of volumes are mixed, and thus solution intracutaneous injection animal is immunized for antigen, immunogenic conjugate or derivative in multiple positions.After one month, by the hypodermic injection at multiple positions, reinforced immunological is carried out to animal with the peptide or conjugate of 1/5-1/10 primary quantities in Freund's complete adjuvant.After 7-14 days, the blood of animal is gathered, and determines the antibody titer of serum.Animal is strengthened until titre reaches stable high level.Conjugate can also be prepared as protein fusions in recombinant cell culture thing.Equally, suitably immune response is strengthened using flocculating agent such as alum.

2. monoclonal antibody

Monoclonal antibody can be used initially by Kohler etc., Nature 256：Prepared by the hybridoma method that 495 (1975) are recorded, or (United States Patent (USP) No.4,816,567) can be prepared by recombinant DNA method.

In hybridoma method, immune mouse as described above or other suitable host animals, such as hamster, to trigger generation or can generate the lymphocyte of following antibody, the antibody can be specifically bound for immune protein.Or, can immunological lymphocyte in vitro.After immune, lymphocyte is separated, is then merged lymphocyte with myeloma cell line using suitable fusion agent such as polyethylene glycol, hybridoma (Goding, Monoclonal Antibodies is formed：Principles and Practice, pp.59-103, Academic Press, 1986).

By thus prepared hybridoma in suitable inoculation of medium and culture, the culture medium preferably comprises the one or more materials for suppressing Parent Myeloma Cell (also referred to as merging spouse) the growth or survival do not merged.For example; if Parent Myeloma Cell lacks hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT); selective medium so for hybridoma would generally contain hypoxanthine, aminopterin-induced syndrome and thymidine (HAT culture mediums), and these materials prevent the growth of HGPRT deficient cells.

Preferably fusion spouse myeloma cell is that those efficiently merge, supported the antibody-producting cell of selection stably high level generation antibody and the sensitive myeloma cell of selective medium to carrying out selection for not merging parental cell.It is preferred that myeloma cell line be rat bone marrow tumour system, such as can be from Sol gram research institute cell distributing center (Salk Institute Cell Distribution Center, San Diege, California, USA) cell line derived from MOPC-21 the and MPC-11 mouse tumors obtained, and can be from American type culture collection (American Type Culture Collection, Manassas, Virginia, USA) SP-2 and derivative obtained, such as X63-Ag8-653 cells.Human myeloma and mouse-people's heteromyeloma cell lines for generating human monoclonal antibodies also have been described (Kozbor, J.Immunol.133：3001(1984)；And Brodeur etc., Monoclonal AntibodyProduction Techniques and Applications, pp.51-63, Marcel Dekker, Inc., NewYork, 1987).

Generation of the culture based assays that hybridoma just can be wherein being grown for the monoclonal antibody of antigen.Preferably, by immunoprecipitation or by external binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA), the binding specificity of the monoclonal antibody generated by hybridoma is determined.

The binding affinity of monoclonal antibody can be for example, by Munson etc., Anal.Biochem.107：Scatchard described in 220 (1980) analyzes to determine.

Once identification obtains the hybridoma of antibody of the generation with required specificity, affinity and/or activity, the clone can be subcloned by limiting dilution flow, and be cultivated (Goding, Monoclonal Antibodies by standard method：Principles and Practice, pp.59-103, Academic Press, 1986).Culture medium suitable for this purpose includes such as D-MEM or RPMI-1640 culture mediums.In addition, hybridoma can be in animal as ascites tumor progress In vivo culture, such as by the way that cell i.p. is expelled in mouse.

Flow can be purified by conventional antibody, such as affinity chromatography (such as using albumin A or Protein G-Sepharose) or ion-exchange chromatography, hydroxyapatite, gel electrophoresis, dialysis, the monoclonal antibody for being subcloned secretion is suitably separated with culture medium, ascites or serum.

The DNA old process easy to use of coding monoclonal antibody is separated and is sequenced (such as by using the oligonucleotide probe that can be combined with the gene specific of coding mouse heavy chain and light chain).Such DNA preferred source is used as using hybridoma.Once separation, DNA can be placed in expression vector, then the expression vector is transfected into the host cell for not producing antibody protein in addition, such as Bacillus coli cells, ape COS cells, Chinese hamster ovary (CHO) cell or myeloma cell, to obtain the synthesis of monoclonal antibody in recombinant host cell.The summary paper of recombination expressions of the DNA in bacterium on encoding antibody is including Skerra etc., Curr.Opinion in Immunol.5：256-262 (1993) and Pl ü ckthun, Immunol.Revs.130：151-188(1992).

In another embodiment, can be from use McCafferty etc., Nature 348：Monoclonal antibody or antibody fragment are separated in the phage antibody library of 552-554 (1990) described technique construction.Clackson etc., Nature 352：624-628 (1991) and Marks etc., J.Mol.Biol.222：581-597 (1991) is respectively described separates mouse antibody and human antibody using phage library.Subsequent publications are described reorganizes (Marks etc., Bio/Technology 10 by chain：779-783 (1992)), and combination infects and In vivo recombination is used as strategy (Waterhouse etc., the Nuc.Acids Res.21 for building very big phage library：2265-2266 (1993)), the human antibody of generation high-affinity (nM scopes).In this way, these technologies are the feasible replacement methods for separating the conventional monoclonal antibody hybridoma technology of monoclonal antibody.

The DNA of encoding antibody can be modified to generate chimeric or fusion antibody polypeptide, for example, pass through employment heavy chain and light-chain constant domains (C_HAnd C_L) sequence replacing homologous murine sequences (United States Patent (USP) No.4,816,567；And Morrison etc., Proc.Natl.Acad.Sci.USA 81：6851 (1984)), or by merging the coded sequence all or in part of immunoglobulin coding sequence and NIg polypeptide (heterologous polypeptide).The constant domain of the alternative antibody of NIg polypeptide sequence, or the variable domain of an antigen binding site of antibody is substituted with them, to produce chimeric bivalent antibody, it is comprising having a specific antigen binding site to a kind of antigen and have another specific antigen binding site to not synantigen.

3. human antibody and humanized antibody

The anti-RA1c antibody of the present invention can further comprise humanized antibody or human antibody.The humanization form of inhuman (such as mouse) antibody refers to bottom line and included from the gomphosis immunoglobulin of sequence derived from non-human immunoglobulin, immunoglobulin chain or its fragment (such as Fv, Fab, Fab ', F (ab ')₂Or other antigen binding subsequences of antibody).Immunoglobulin obtained from complementary determining region (CDR) residue that humanized antibody is included in human immunoglobulin(HIg) (receptor antibody) is replaced with the CDR residues with non-human species' (donor antibody) such as mouse, rat or rabbit for expecting specificity, affinity and ability.In some cases, the Fv Framework residues of human immunoglobulin(HIg) are replaced with corresponding non-human residues.Humanized antibody can be additionally included in receptor antibody or the CDR or Frame sequence that are inputted in there is no the residue found.Generally, humanized antibody includes at least one, usually two substantially whole following variable domains, wherein all or substantially all CDR regions correspond to the CDR region of non-human immunoglobulin, and all or substantially all FR areas are the FR areas of human immunoglobulin(HIg) consensus sequence.Humanized antibody preferably also includes constant region (Jones etc., the Nature 321 of at least part constant region for immunoglobulin (Fc), typically human immunoglobulin(HIg)：522-525(1986)；Riechmann etc., Nature 332：323-329(1988)；And Presta, Curr.Op.Struct.Biol.2：593-596(1992)).

For the method for non-human antibody's humanization to be well known in the art.Generally, humanized antibody has one or more amino acid residues introduced from non-people source.These non-human amino acid residues are often referred to as " inputting " residue, and they are normally taken from " inputting " variable domain.Humanization can implement (Jones etc., Nature 321 substantially according to the method for Winter and its colleague：522-525(1986)；Riechmann etc., Nature 332：323-327(1988)；Verhoeyen etc., Science 239：1534-1536 (1988)), substitute corresponding human antibody sequence to carry out by using rodent CDR sequence.Thus, such " humanization " antibody is chimeric antibody (United States Patent (USP) No.4,816,567), wherein substantially less than whole people's variable domain is substituted with the corresponding sequence from non-human species.In practice, humanized antibody is typically antibody obtained from some CDR residues in human antibody are substituted with some possible FR residues with the residue in the similar site in rodent antibodies.

When antibody is intended to human therapeutic use, the selection of people's variable domain for generating humanized antibody, including light chain and heavy chains, it is extremely important for reduction antigenicity and HAMA responses (human anti-mouse antibody).According to so-called " most suitable (best-fit) " method, the whole library of known people's variable domain sequence is screened with rodent antibodies variable domain sequence.Identification and the immediate people's V structure domain sequence of rodent, and receive people's framework region (FR) therein for humanized antibody (Sims etc., J.Immunol.151：2296(1993)；Chothia etc., J.Mol.Biol.196：901(1987)).Another method is used from specific frame area derived from light chain or the consensus sequence of all human antibodies of heavy chain specific subtype.Same framework can be used for several different humanized antibody (Carter etc., Proc.Natl.Acad.Sci.USA 89：4285(1992)；Presta etc., J.Immunol.151：2623(1993)).

What is more important, antibody keeps the high binding affinity and other favourable biological characteristicses to antigen after humanization.In order to realize this purpose, according to a kind of preferred method, analyze the method for parental array and various conceptual humanized products to prepare humanized antibody by using the threedimensional model of parent and humanized sequence.Three dimensional immunoglobulin model is typically obtainable, and is familiar with by those skilled in the art.It can also be illustrated and be shown the computer program of the possibility three-dimensional conformation structure of selected candidate immunoglobulin sequences sequence.Check that these display images can analyze possibility effect of the residue in candidate immunoglobulin sequences sequence functions, i.e. analyzing influence candidate immunoglobulin sequences combine the residue of the ability of its antigen.So, FR residues can be selected from acceptor and list entries and are combined, so as to obtain required antibody characteristic, such as the affinity to target antigen is improved.Generally, the direct and most substantive influence being related to antigen binding of some hypervariable region residues.

The present invention covers the various forms of the anti-RA1c polypeptide antibodies of humanization.For example, humanized antibody can be antibody fragment, such as Fab, optionally coupling has one or more cytotoxic agents to generate immune conjugate.Or, humanized antibody can be complete antibody, such as complete IgG1 antibody.

As the alternative of humanization, human antibody can be generated.For example, it is now possible to which the transgenic animals (such as mouse) of human antibody full repertoire can be generated in the case where lacking endogenous immunoglobulin generation after immune by generating.For example, it has been described that antibody heavy chain joining region (J in chimeric and germ line mutant mice_H) gene homozygosis delete cause the complete inhibition to endogenous antibody tormation.Human germline immunoglobulin's Gene Array (array), which is transferred in such germ line mutant mice, can cause to generate human antibody after antigen is attacked.See, for example, Jakobovits etc., Proc.Natl.Acad.Sci.USA 90：2551(1993)；Jakobovits etc., Nature 362：255-258(1993)；Bruggemann etc., Year in Immuno.7：33(1993)；United States Patent (USP) No.5,545,806,5,569,825,5,591,669 (being all GenPharm)；5,545,807；And WO 97/17852.

Or, display technique of bacteriophage (McCafferty etc., Nature 348：552-553 (1990)) it can be used in vitro from immunoglobulin variable (V) domain gene complete or collected works generation human antibody and antibody fragment from epidemic disease donor rather.According to this technology, antibody V domain genes are cloned into filobactivirus such as M13 or fd main or secondary coat protein gene in the way of meeting reading frame, and functional antibody fragment is shown as on phage particle surface.Because filamentous particle includes the single-stranded DNA copy of phage genome, the selection carried out based on the functional characteristic of antibody also causes the selection of the gene of the antibody of those characteristics of coding displaying.In this way, bacteriophage simulates some characteristics of B cell.Phage display can be carried out in a variety of forms, be summarized see, for example, Johnson, Kevin S. and Chiswell, David J., CurrentOpinion in Structural Biology 3：564-571(1993).The Several sources of V constant gene segment Cs can be used for phage display.Clackson etc., Nature 352：624-628 (1991) is from the isolated a large amount of different Kang azolactone antibody of the small-sized V genes random combinatorial libraries derived from immune mice spleen.Marks etc., J.Mol.Biol.222 can substantially be followed：581-597 (1991) or Griffith etc., EMBO is J.12：725-734 (1993) described technology, V gene complete or collected works are built by people donor is not immunized, and Separated pin is to the largely not antibody of synantigen (including autoantigen).Referring also to United States Patent (USP) No.5,565,332 and 5,573,905.

As described above, can also pass through vitro activated B cells (referring to United States Patent (USP) No.5,567,610 and 5,229,275) next life human antibodies.

4. antibody fragment

In some cases, the use of antibody fragment rather than complete antibody is favourable.The small volume of fragment, allows quick removing, and can cause to the close of solid tumor and enter raising.

The multiple technologies for generating antibody fragment are developed.Traditionally, these fragments are derived by proteolytic digestion complete antibody (see, for example, Morimoto etc., Journal of Biochemical andBiophysical Methods 24：107-117(1992)；And Brennan etc., Science 229：81(1985)).However, these fragments directly can be generated by recombinant host cell now.Fab, Fv and scFv antibody fragment all can so be allowed to easily produce these substantial amounts of fragments in expression in escherichia coli and by E. coli secretion.Can be from antibody phage libraries isolated antibody fragment discussed above.Or, Fab '-SH fragments directly can be reclaimed from Escherichia coli, and be coupled to form F (ab ') by chemical method₂Fragment (Carter etc., Bio/Technology 10：163-167(1992))., can be directly from recombinant host cell culture separation F (ab ') according to another method₂Fragment.The Fab and F (ab ') of Half-life in vivo comprising salvage receptor binding epitope residue, with extension₂Fragment is described in United States Patent (USP) No.5,869,046.Other technologies for generating antibody fragment are obvious to skilled practitioner.In other embodiments, the antibody of selection is Single-Chain Fv Fragment of Murine (scFv).Referring to WO 93/16185；United States Patent (USP) No.5,571,894；And United States Patent (USP) No.5,587,458.Fv and sFv are the unique class with entire binding site and shortage constant region；In this way, they are suitable, because having the non-specific binding of reduction during use in vivo.SFv fusion proteins can be built to generate effector albumen matter positioned at sFv amino or the fusions of carboxyl terminal.Referring to《Antibody Engineering》, Borrebaeck compile, see above.Antibody fragment can also be " linear antibodies ", such as such as United States Patent (USP) No.5, described in 641,870.Such linear antibody fragments can be monospecific or bispecific.

5. bispecific antibody

Bispecific antibody refers to the antibody for having binding specificity at least two different epitopes.Exemplary bispecific antibody can combine two kinds of different epitopes of RA1c polypeptides described herein.This other antibody-like can combine RA1c polypeptides binding site with the binding site for another polypeptide.Or, anti- RA1c polypeptide antibodies arm can be combined with the arm of triggering molecule such as φt cell receptor molecule (such as CD3) or IgG Fc acceptors (Fc γ R) such as Fc γ RI (CD64), Fc γ RII (CD32) and Fc γ RIII (CD16) on combination leucocyte, so as to focus on and be positioned at expression by cellular defence mechanisms and/or combine the cell of RA1c polypeptides.Bispecific antibody can also be used to cytotoxic agent being positioned at expression and/or combine the cell of RA1c polypeptides.These antibody possess RA1c polypeptides combination arm and combine the arm of cytotoxic agent (such as saporin (saporin), anti-interferon-α, vinca alkaloids (vinca alkaloid), ricin A chains, methotrexate (MTX) or radioactive isotope hapten).Bispecific antibody can be prepared into full length antibody or antibody fragment (such as F (ab ')₂Bispecific antibody).

WO 96/16673 describes bispecific anti-ErbB/anti- Fc γ RIII antibody, and United States Patent (USP) No.5, and 837,234 disclose bispecific anti-ErbB/anti- Fc γ RI antibody.Bispecific anti-ErbB/Fc Alpha antibodies are shown in WO 98/02463.United States Patent (USP) No.5,821,337 teaches bispecific anti-ErbB/anti-cd 3 antibodies.

Method for generating bispecific antibody is known in the art.Coexpression of the tradition generation based on two kinds of heavy chain immunoglobulin-light chains pair of total length bispecific antibody, two of which chain has different specificity (Millstein etc., Nature 305：537-539(1983)).Due to being randomly assigned for heavy chain immunoglobulin and light chain, these hybridomas (four source hybridomas (quadroma)) generate the potential mixture of 10 kinds of different antibodies molecules, wherein only a kind of have correct bispecific structure.The purifying of the correct molecule generally carried out by affinity chromatography step is fairly cumbersome, and Product yields are low.WO 93/08829 and Traunecker etc., EMBO are J.10：3655-3659 discloses similar flow in (1991).

According to a kind of different method, the antibody variable domains will with required binding specificity (antibody-antigen binding site) are merged with immunoglobulin constant domain sequence.Preferably, fusion uses and includes at least part hinge, C _H2 and C_HThe heavy chain immunoglobulin constant domain in 3rd area.Preferably, there is the first heavy chain constant region (C that necessary site is combined comprising light chain at least one fusions _H1).By encoding immune immunoglobulin heavy chain fusions thing and, if it is desired, the DNA of light chain immunoglobulin is inserted in separated expression vector, and cotransfection is into suitable host cell.There is provided when not waited for the three of structure kind polypeptide chain ratio in the embodiment for the optimum point of production for expecting bispecific antibody, this provides greater flexibility to adjust the mutual ratio of three kinds of polypeptide fragments.However, when at least two polypeptide chains cause high yield with same ratio expression or when the ratio is to it is expected that the yield of chain combination has no significant effect, it is possible to which the coded sequence of two kinds or all three polypeptide chains is inserted into same expression vector.

In a preferred embodiment of this method, bispecific antibody has the hybrid immunoglobulin heavy chain of the first binding specificity on an arm, and hybrid immunoglobulin heavy chain-light chain on another arm is constituted to (providing the second binding specificity).Because presence of the light chain immunoglobulin only in half of bispecific molecule provides the facility approach of separation, consequently found that this dissymmetrical structure is easy to separate required bispecific compound with undesired immunoglobulin chain combinations.This method is disclosed in WO94/04690.On generating other details of bispecific antibody see, for example, Suresh etc., Methods inEnzymology 121：210(1986).

According to United States Patent (USP) No.5, another method described in 731,168 can transform the interface between a pair of antibody molecules, by the percent maximum of the heterodimer reclaimed from recombinant cell culture thing.It is preferred that interface include at least part C _H3 domains.In the method, one or more small-sized amino acid side chains of first antibody molecular interface are replaced with larger side chain (such as tyrosine or tryptophan).Large-scale amino acid side chain is replaced by using compared with small amino acid side chains (such as alanine or threonine), size is produced on the interface of secondary antibody molecule same or analogous compensatory " cavity " with large-scale side chain.This provides the mechanism that heterodimer yield is improved than other undesired end-products such as homodimer.

Bispecific antibody includes crosslinking or " Heteroconjugate " antibody.For example, a kind of antibody in Heteroconjugate thing can be coupled with avidin, another antibody is coupled with biotin.For example, this antibody-like is proposed to be used in targets undesired cell (United States Patent (USP) No.4,676,980) by immune system cell, and for treating HIV (WO 91/00360, WO 92/200373 and EP 03089).Any easily cross-linking method can be used to prepare Heteroconjugate antibodies.Suitable crosslinking agent is well-known in the art, and is disclosed in United States Patent (USP) No.4,676,980 together with many crosslinking technologicals.

The technology that bispecific antibody is generated by antibody fragment is also described in document.It is connected chemically to prepare bispecific antibody for example, can be used.Brennan etc., Science 229：81 (1985) describe a kind of code, wherein cutting complete antibody to generate F (ab ') by proteolysis₂Fragment.These fragments are reduced in the case where there are two mercaptan complexing agent sodium arsenites, to stablize two neighbouring mercaptan and prevent the formation of intermolecular disulfide bond.Then Fab ' the fragments of generation are changed into thionitrobenzoate ester (TNB) derivative.Then one of Fab '-TNB derivatives are reverted into Fab '-mercaptan by the reduction of mercaptoethylmaine again, and mixed with another Fab '-TNB derivatives of equimolar amounts, to form bispecific antibody.The bispecific antibody of generation can be used as the selective immobilized reagent of enzyme.

Nearest progress make it that directly reclaiming Fab '-SH fragments from Escherichia coli becomes to be more prone to, and these fragments are chemically coupled to form bispecific antibody.Shalaby etc., J.Exp.Med.175：217-225 (1992) describes the bispecific antibody F (ab ') of full-length human₂The generation of molecule.Each Fab ' fragments are separately secreted by Escherichia coli, and are oriented chemical coupling in vitro to form bispecific antibody.The bispecific antibody being thusly-formed can combine cell and the normal human T cells for being overexpressed ErbB2 acceptors, and triggering people's cell Cytotoxic Lymphocytes for the dissolving activity of human breast tumor target.Also describe the multiple technologies for directly preparing and separating bispecific antibody fragment from recombinant cell culture thing.For example, generating bispecific antibody using leucine zipper.Kostelny etc., J.Immunol.148 (5)：1547-1553(1992).Leucine zipper peptide from Fos and Jun albumen is connected by Gene Fusion with the Fab ' parts of two kinds of different antibodies.Antibody homodimer reduces in hinge area and forms monomer, then reoxidized and form antibody heterodimer.This method can also be used for generating antibody homodimer.By Hollinger etc., Proc.Natl.Acad.Sci.USA 90：" double antibody (diabody) " technology of 6444-6448 (1993) descriptions provides the replacement mechanism for preparing bispecific antibody fragment.The fragment includes the V being connected by joint_HAnd V_L, the joint too it is short cause same chain on two domains between can not match.Thus, force the V in a fragment_HAnd V_LDomain and the complementary V in another fragment_LAnd V_HDomain is matched, and is consequently formed two antigen binding sites.It is also reported that preparing another strategy of bispecific antibody fragment by using scFv (scFv) dimer.Referring to Gruber etc., J.Immunol.152：5368(1994).

Cover the antibody with more than two potency.For example, three-specific antibody can be prepared.Tutt etc., J.Immunol.147：60(1991).

6. Heteroconjugate antibodies

Heteroconjugate antibodies are also within the scope of the invention.Heteroconjugate antibodies are made up of the antibody of two kinds of covalent attachments.This antibody-like is advised for example for immune system cell to be targetted into undesired cell (United States Patent (USP) No.4,676,980) and for treating HIV (WO 91/00360；WO 92/200373；EP03089).Antibody can be prepared using the known method of synthetic protein chemistry in vitro, including those are related to the method for crosslinking agent.For example, disulfide exchange can be used to react or build immunotoxin by forming thioether bond.Example suitable for the reagent of this purpose includes imino group mercaptan alcohol ester/salt (iminothiolate) and 4- sulfydryl fourth methyl ester imidates (methyl-4-mercaptobutyrimidate) and such as United States Patent (USP) No.4, disclosed in 676,980.

7. multivalent antibody

Multivalent antibody can be than bivalent antibody quickly by the internalization (and/or alienation) for the cell for expressing the antibody combination antigen.The antibody of the present invention can be the multivalent antibody (being different from IgM classes) with three or more antigen binding sites (such as tetravalent antibody), and it easily can be generated by the recombination expression of the nucleic acid of encoding antibody polypeptide chain.Multivalent antibody can include dimerization domain and three or more antigen binding sites.It is preferred that dimerization domain include (or being made from it) Fc areas or hinge area.In this case, three or more antigen binding sites that antibody can be comprising Fc areas and Fc areas amino terminal.Multivalent antibody preferred herein includes (or being made from it) three to about eight, but preferably four antigen binding sites.Multivalent antibody includes at least one polypeptide chain (and preferably two polypeptide chains), wherein the polypeptide chain includes two or more variable domains.For example, polypeptide chain can be the first variable domain comprising VD1- (X1) n-VD2- (X2) n-Fc, wherein VD1, VD2 is the second variable domain, and Fc is a polypeptide chain in Fc areas, X1 and X2 represented amino acids or polypeptide, and n is 0 or 1.For example, polypeptide chain can be included：VH-CH1- flexible joint-VH-CH1-Fc areas chain；Or VH-CH1-VH-CH1-Fc areas chain.Multivalent antibody herein is preferably further comprising at least two (and preferably four) light chain variable domain polypeptides.Multivalent antibody herein can include e.g., from about two to about eight light chain variable domain polypeptides.The light chain variable domain polypeptide covered herein includes light-chain variable domain, and optionally further includes CL domains.

8. effector functions is engineered

It may want to modify the antibody of the present invention in terms of effector functions, for example the cytotoxicity (ADCC) and/or complement-dependent cytotoxicity (CDC) for the antibody dependent cellular mediation that strengthens antibody.This can be realized by introducing one or more amino acid replacements in antibody Fc district.Or cysteine residues are introduced in Ke Fc areas, so as to allow to form interchain disulfide bond in this zone.The homodimer antibody so generated can have the cell killing and antibody-dependent cytotoxicity (ADCC) of the complement-mediated of improved internalization capability and/or raising.Referring to Caron etc., J.Exp.Med.176：1191-1195 (1992) and Shopes, B., J.Immunol.148：2918-2922(1992).Homodimer antibody with enhanced antitumor activity it is also possible to use such as Wolff, Cancer Research 53：It is prepared by heterobifunctional crosslinker described in 2560-2565 (1993).Or, antibody can be transformed into dual Fc areas, thus can have enhanced complement lysis and ADCC abilities.Referring to Stevenson etc., Anti-Cancer Drug Design 3：219-230(1989).In order to improve the serum half-life of antibody, salvage receptor binding epitope can be mixed in antibody (especially antibody fragment) described in 739,277 such as such as United States Patent (USP) No.5.As used herein, term " remedying (salvage) receptor binding domain " refers to IgG molecules (such as IgG₁、IgG₂、IgG₃Or IgG₄) it is responsible for improving the epitope of serum half-life in IgG molecule bodies in Fc areas.

9. immune conjugate

The present invention is also on there is the immune conjugate of the antibody of cytotoxic agent comprising coupling, also referred to as antibody coupling matter or antibody-drug conjugates (ADC), the cytotoxic agent such as chemotherapeutics, medicine, growth inhibitor, toxin (such as bacterium, fungi, plant or the enzyme activity toxin of animal origin or its fragment) or radio isotope (radiating conjugate).

Antibody-drug conjugates local delivery cytotoxicity or cell inhibiting reagent (medicine for killing or suppressing tumour cell) (Syrigos and Epenetos (1999) AnticancerResearch 19 are used in the treatment of cancer：605-614；Niculescu-Duvaz and Springer (1997) Adv.Drg Del.Rev.26：151-172；US 4,975,278), allow drug moiety targeted delivery in theory to tumour and gather in the cell there, wherein these medicaments not being coupled of Formulations for systemic administration can also result in unacceptable toxic level (Baldwin etc. to normal cell while the tumour cell to attempt to eliminate causes toxicity, (1986) Lancet pp. (Mar.15,1986)：603-05；Thorpe, (1985) " Antibody CarriersOf Cytotoxic Agents In Cancer Therapy：A Review ", in Monoclonal Antibodies ' 84：The (eds.), pp.475-506 such as Biological And Clinical Applications, A.Pinchera).It is derived from maximum effect and toxicity is minimum.Polyclonal antibody and monoclonal antibody are it is reported that can be used in these strategies (Rowland etc., (1986) Cancer Immunol.Immunother., 21：183-87).Medicine used includes daunomycin, Doxorubicin, methotrexate (MTX) and eldisine (Rowland etc., (1986) ibid) in these methods.Toxin used includes bacteriotoxin (diphtheria toxin), phytotoxin (ricin), small molecule toxins (geldanamycin (Mandler etc. (2000) Jour.of the Nat.Cancer Inst.92 (19) in Antibody-toxin conjugate：1573-1581；Mandler etc. (2000) Bioorganic＆Med.Chem.Letters 10：1025-1028；Mandler etc. (2002) Bioconjugate Chem.13：786-791), maytansinoid (EP 1391213；Liu etc., (1996) Proc.Natl.Acad.Sci.USA 93：8618-8623) and Calicheamicin (Lode etc. (1998) Cancer Res.58：2928；Hinman etc. (1993) Cancer Res.53：3336-3342)).Toxin can pass through its cytotoxicity of mechanisms play and cell inhibiting effect including tubulin binding, DNA combinations or topoisomerase enzyme level.Some cytotoxic drugs are reduced with tending to inactivation or activity after big antibody or protein receptor ligand coupling.

(ibritumomab tiuxetan, Biogen/Idec) is the mouse IgG1 κ monoclonal antibodies by the CD20 antigens for being found on normal and malignant B surface with being combined by thiourea linker-chelator¹¹¹In or⁹⁰Plain conjugate (Wiseman etc. (2000) Eur.Jour.Nucl.Med.27 (7) of antibody-radioisotope that Y radio isotopes are constituted：766-77；Wiseman etc. (2002) Blood 99 (12)：4336-42；Witzig etc. (2002) J.Clin.Oncol.20 (10)：2453-63；Witzig etc. (2002) J.Clin.Oncol.20 (15)：3262-69).Although ZEVALIN has the activity for B cell non_hodgkin lymphoma (NHL), but dispenser causes serious and lasting haemocyte to reduce in Most patients.MYLOTARG^TM(gemtuzumab ozogamicin, Wyeth Pharmaceuticals), the antibody-drug conjugates for being connected and being constituted with Calicheamicin by hu CD33 antibody, ratified to be used for through injection treatment acute myelogenous leukemia (Drugs of the Future (2000) 25 (7) in 2000：686；United States Patent (USP) No.4,970,198；5,079,233；5,585,089；5,606,040；5,693,762；5,739,116；5,767,285；5,773,001).Cantuzumab mertansine (Immunogen, Inc.), the antibody-drug conjugates for being connected and being constituted with maytansinoid drugs module DM1 through disulfde linker SPP by huC242 antibody, the II phases for being going into the cancer (such as colon cancer, cancer of pancreas, stomach cancer and other cancers) for treating expression CanAg test.MLN-2704 (Millennium Pharm., BZL Biologics, Immunogen Inc.), the antibody-drug conjugates for being connected and being constituted with maytansinoid drugs module DM1 by anti-prostatic specific membrane antigen (PSMA) monoclonal antibody, in potential treatment of the exploitation for tumor of prostate.By the synthetic analogues auristatin peptides of dolastatin (dolastatin), auristatin E (AE) and monomethyl auristatin (MMAE) and chimeric mAb cBR96 (special to the Lewis Y in carcinoma) and cAC10 coupling (Doronina etc. (2003) Nature Biotechnology 21 (7) (special to the CD30 on haematological malignancies)：778-784), therapeutic exploitation and is carried out.

It is hereinbefore described available for the chemotherapeutics for generating such immune conjugate.Workable enzyme activity toxin and its fragment include diphtheria toxin A chains, the nonbinding active fragments of diphtheria toxin, exotoxin A chain (comes from pseudomonas aeruginosa (Pseudomonas aeruginosa)), ricin (ricin) A chains, abrin (abrin) A chains, capsule lotus root toxalbumin (modeccin) A chains, α-broom aspergillin (sarcin), tung oil tree (Aleutites fordii) toxalbumin, carnation (dianthin) toxalbumin, dyers' grapes (Phytolacaamericana) toxalbumin (PAPI, PAPII and PAP-S), balsam pear (Momordica charantia) mortifier, curcin (curcin), crotin (crotin), Saponaria officinalis (sapaonaria officinalis) mortifier, gelonin (gelonin), morphine (mitogellin), restrictocin (restrictocin), phenomycin (phenomycin), enomycin (enomycin) and trichothecin (trichothecenes).A variety of radionuclides can be used for generation radiation coupled antibody.Example includes²¹²Bi、¹³¹I、¹³¹In、⁹⁰Y and¹⁸⁶Re.A variety of bifunctional protein coupling agents can be used to prepare for the conjugate of antibody and cytotoxic agent, such as N- succinimides base -3- (2- pyridine radicals two is thio) propionic ester (SPDP), iminothiolane (IT), imino-ester (such as hydrochloric acid adipyl imido dimethyl phthalate), active ester (such as succinimide base ester of suberic acid two), aldehyde (such as glutaraldehyde), double azido compound (such as double (p- azido benzoyl base) hexamethylene diamines), dual azepine derivatives (such as double (p- diazoniumbenzoyl) ethylenediamines), diisocyanate (such as toluene 2, 6- diisocyanate) and double activated fluorine compounds (such as 1, 5- bis- fluoro- 2, 4- dinitro benzenes) dual-function derivative.For example, can such as Vitetta, Science 238：Ricin immunotoxin is prepared described in 1098 (1987).The 1- isothiocyanic acid benzyl -3- methyl diethylene-triamine pentaacetic acids (MX-DTPA) of carbon-14 mark are for by the exemplary chelating agent of radioactive nucleotides and antibody coupling.Referring to WO94/11026.

Antibody and one or more small molecule toxins such as Calicheamicin (calicheamicin), maytansinoids (maytansinoids), trichothecin (trichothecene) and CC1065 are also contemplated by herein, and these toxin have the conjugate of the derivative of neurotoxin active.

Maytansine and maytansinoids

In one embodiment, anti-RA1c polypeptide antibodies (total length or fragment) of the invention and one or more maytansinoid molecule coupling labeleds.

Maytansinoids are the mitotic inhibitors played a role by suppressing tubulin polymerization.Maytansine is initially from East Africa shrub tingia Caulis Mayteni (Maytenus serrata) isolated (United States Patent (USP) No.3,896,111).It is subsequently found certain micro-organisms and also generates maytansinoids, such as maytansinol and C-3 maytansinols ester (United States Patent (USP) No.4,151,042).Synthesis maytansinol and its derivative and analog are disclosed in such as United States Patent (USP) No.4,137,230；4,248,870；4,256,746；4,260,608；4,265,814；4,294,757；4,307,016；4,308,268；4,308,269；4,309,428；4,313,946；4,315,929；4,317,821；4,322,348；4,331,598；4,361,650；4,364,866；4,424,219；4,450,254；4,362,663；And 4,371,533, clearly the disclosure of which is collected herein by reference.

Maytansinoid-antibody coupling matter

In the trial for improving its therapeutic index, by maytansine and maytansinoids and the antibody coupling of specific binding tumor-cell antigen.Immune conjugate and its therapeutical uses comprising maytansinoids are disclosed in such as United States Patent (USP) No.5,208,020；5,416,064；And the B1 of European patent EP 0 425235, clearly the disclosure of which is collected herein by reference.Liu etc., Proc.Natl.Acad.Sci.USA 93：8618-8623 (1996) describes the immune conjugate for including the maytansinoid for being referred to as DM1 being connected with the monoclonal antibody C242 for human colorectal cancer.It was found that the conjugate has the high cell toxicity of the colon cancer cell for culture, and show antitumor activity in tumour growth measurement method in vivo.Chari etc., Cancer Research 52：127-131 (1992) describes wherein maytansinoid through disulfde linker and the immune conjugate for combining another mouse monoclonal antibody TA.1 couplings of the mouse antibody A 7 of antigen or combination HER-2/neu oncogenes in human colon cancer cell line.The cytotoxicity of TA.1- maytansinoid conjugates, each cell expression 3x10 of the cell line are tested on human breast cancer cell line SK-BR-3 in vitro⁵Individual HER-2 surface antigens.Drug conjugates have reached the cytotoxicity with free maytansinoid drugs similarity degree, and this can be improved by increasing the maytansinoid molecule amount of each antibody molecule coupling.A7- maytansinoid conjugates show low systemic cellular toxicity in mouse.

Anti- RA1c polypeptide antibodies-maytansinoid conjugate (immune conjugate)

Anti- RA1c polypeptide antibodies can be by being connected and not significantly attenuating antibody or prepared by the biological activity of maytansinoid molecule by anti-RA1c polypeptide antibodies-maytansinoid conjugate with maytansinoid molecular chemistry.Each average 3-4 maytansinoid molecule of antibody molecule coupling shows effect in the cytotoxicity that enhancing is directed to target cell, and the function or solubility of antibody are had no adverse effect, although it is expected that even one molecule toxin/antibody also will strengthen cytotoxicity than the use of exposed antibody.Maytansinoids are well known in the art, and can be synthesized or be separated from natural origin by known technology.For example in United States Patent (USP) No.5,208,020 and other patents mentioned above and non-patent publications disclose suitable maytansinoids.It is preferred that maytansinoids be the maytansinol analog of the aromatic rings or other positions of maytansinol and maytansinol molecule by modification, such as various maytansinol esters.

Know that many linking groups can be used for preparing antibody-maytansinoid conjugate, including such as United States Patent (USP) No.5,208, the 020 or B1 of European patent 0 425 235 in this area；And Chari etc., CancerResearch 52：Disclosed in 127-131 (1992).Linking group includes disulphide group, sulfide group, acid-unstable group, photo-labile group, the unstable group of peptase or the unstable group of esterase, as mentioned previously disclosed in patent, preferably disulphide and sulfide group.

A variety of bifunctional protein coupling agents can be used to prepare the conjugate of antibody and maytansinoid, the coupling agent such as N- succinimides base -3- (2- pyridine radicals two is thio) propionic ester (SPDP), succinimide base -4- (N- Maleimidomethyls) hexamethylene -1- carboxylates, iminothiolane (IT), imino-ester (such as hydrochloric acid adipyl imido dimethyl phthalate), active ester (such as succinimide base ester of suberic acid two), aldehyde (such as glutaraldehyde), double azido compound (such as double (p- azido benzoyl base) hexamethylene diamines), dual azepine derivatives (such as double (p- diazoniumbenzoyl)-ethylenediamines), diisocyanate (such as toluene 2, 6- diisocyanate) and double activated fluorine compounds (such as 1, 5- bis- fluoro- 2, 4- dinitro benzenes) dual-function derivative.Particularly preferred coupling agent includes N- succinimide bases -3- (2- pyridine radicals two is thio) propionic ester (SPDP) (Carlsson etc., Biochem.J.173：723-737 (1978)) and N- succinimide bases -4- (2- pyridylthios) valerate (SPP), thus disulphide connection is provided.

According to the type of connection, joint can be attached to multiple positions of maytansinoid molecule.For example, conventional coupling techniques can be used to pass through the reaction with hydroxyl to form ester bond.Reaction can occur in the C-3 positions with hydroxyl, C-14 positions, the C-15 positions through hydroxyl modified and the C-20 positions with hydroxyl modified through methylol.In a preferred embodiment, key connection is formed in the C-3 positions of maytansinol or maytansinol analog.

Calicheamicin

Another immune conjugate interested includes the anti-RA1c polypeptide antibodies that coupling has one or more calicheamicin molecules.Calicheamicin antibiotic family can generate double-strand DNA cleavage in sub- picomolar concentrations.Preparation on Calicheamicin family conjugate is referring to United States Patent (USP) No.5,712,374；5,714,586；5,739,116；5,767,285；5,770,701；5,770,710；5,773,001；5,877,296 (belonging to Cyanamid companies of the U.S.).Workable Calicheamicin analogue includes but is not limited to γ₁ ^I、α₂ ^I、α₃ ^I, N- acetyl group-γ₁ ^I, PSAG and θ^I ₁(Hinman etc., Cancer Research 53：3336-3342(1993)；Lode etc., Cancer Research 58：2925-2928(1998)；And the above-mentioned United States Patent (USP) for authorizing Cyanamid companies of the U.S.).Can be QFA with another antineoplastic of antibody coupling, it is a kind of antifolic thing.Calicheamicin and QFA have intracellular action site, and are difficult through plasma membrane.Therefore, these reagents greatly strengthen their cellulotoxic effect via the cellular uptake of antibody-mediated internalization.

Other cytotoxic agents

BCNU, streptozotocin (streptozoicin), vincristine (vincristine), 5 FU 5 fluorouracil, United States Patent (USP) No.5 can be included with other antitumor agents of the anti-RA1c polypeptide antibodies coupling of the present invention, 053,394th, 5,770, the reagent family for being referred to as LL-E33288 compounds and ai sibo mycin class (esperamicins) (United States Patent (USP) No.5 described in 710,877,296).

Workable enzyme activity toxin and its fragment include diphtheria toxin A chains, the nonbinding active fragments of diphtheria toxin, exotoxin A chain (comes from pseudomonas aeruginosa (Pseudomonas aeruginosa)), ricin (ricin) A chains, abrin (abrin) A chains, capsule lotus root toxalbumin (modeccin) A chains, α-broom aspergillin (sarcin), tung oil tree (Aleutites fordii) toxalbumin, carnation (dianthin) toxalbumin, dyers' grapes (Phytolaca americana) toxalbumin (PAPI, PAPII and PAP-S), balsam pear (Momordicacharantia) mortifier, curcin (curcin), crotin (crotin), Saponaria officinalis (sapaonaria officinalis) mortifier, gelonin (gelonin), morphine (mitogellin), restrictocin (restrictocin), phenomycin (phenomycin), enomycin (enomycin) and trichothecin (trichothecenes).The WO 93/21232 announced see, for example, on October 28th, 1993.

Present invention also contemplates that antibody and compound (such as ribalgilase or DNA endonucleases, such as deoxyribonuclease with nucleic acid decomposition activity；DNA enzymatic) between the immune conjugate that is formed.

For selective destruction tumour, antibody can include high radioactive atom.A variety of radio isotopes can be used for the anti-RA1c antibody of generation radiation coupling.Example includes At²¹¹、I¹³¹、I¹²⁵、Y⁹⁰、Re¹⁸⁶、Re¹⁸⁸、Sm¹⁵³、Bi²¹²、P³²、Pb²¹²With Lu radio isotope.When conjugate to be used to detect, it can be studied comprising radioactive atom for scitiphotograph, such as tc^99mOr I¹²³, or being used for nuclear magnetic resonance (NMR) comprising spin label is imaged (also referred to as magnetic resonance imaging, mri), such as iodo- 123, iodine -131, indium -111, fluoro- 19, carbon -13, nitrogen -15, oxygen -17, gadolinium, manganese or iron.

Radioactivity or other labels can be mixed in conjugate in a known way.For example, can biosynthesis peptide, or by chemical amino acid synthetic method synthetic peptide, be related to for example fluoro- 19 suitable amino group acid precursors for replacing hydrogen wherein using.Label, such as tc can be adhered to through the cysteine residues in peptide^99mOr I¹²³、Re¹⁸⁶、Re¹⁸⁸And In¹¹¹.Yttrium-90 can be adhered to through lysine residue.IODOGEN methods (Fraker etc., Biochem.Biophys.Res.Commun.80：49-57 (1978)) it can be used for mixing iodo- 123.《Monoclonal Antibodies in Immunoscintigraphy》(Chatal, CRC Press, 1989) describes other methods in detail.

A variety of bifunctional protein coupling agents can be used to prepare the conjugate of antibody and cytotoxic agent, the coupling agent such as N- succinimides base -3- (2- pyridine radicals two is thio) propionic ester (SPDP), succinimide base -4- (N- Maleimidomethyls) hexamethylene -1- carboxylates, iminothiolane (IT), imino-ester (such as hydrochloric acid adipyl imido dimethyl phthalate), active ester (such as succinimide base ester of suberic acid two), aldehyde (such as glutaraldehyde), double azido compound (such as double (p- azido benzoyl base) hexamethylene diamines), dual azepine derivatives (such as double (p- diazoniumbenzoyl)-ethylenediamines), diisothio-cyanate (such as toluene 2, 6- diisocyanate) and double activated fluorine compounds (such as 1, 5- bis- fluoro- 2, 4- dinitro benzenes) dual-function derivative.For example, can such as Vitetta, Science 238：Ricin immunotoxin is prepared described in 1098 (1987).The 1- isothiocyanic acid benzyl -3- methyl diethylene-triamine pentaacetic acids (MX-DTPA) of carbon-14 mark are for by the exemplary chelating agent of radioactive nucleotides and antibody coupling.Referring to WO94/11026.Joint can be easy for discharging " the cleavable joint " of cell toxicity medicament in cell.For example, sour unstable joint, peptidase-sensitive linker, photo-labile joint, dimethyl linker or containing disulfde linker (Chari etc., Cancer Research 52 can be used：127-131(1992)；United States Patent (USP) No.5,208,020).

The compound of the present invention clearly covers but is not limited to the ADC prepared with following cross linker reagent：BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo-GMBS, sulfo-KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC, sulfo-SMPB and SVSB (succinimide base-(4- vinyl sulfones) benzoic ether), they can obtain (such as PierceBiotechnology by commercial sources, Inc., Rockford, IL., U.S.A).Referring to the 467-498 pages of the annual application manuals of 2003-2004 and catalogue (2003-2004 Applications Handbook and Catalog).

The preparation of antibody-drug conjugates

In the antibody-drug conjugates (ADC) of the present invention, antibody (Ab) has one or more drug moieties (D), such as about 1 to the about 20 each antibody of drug moiety through joint (L) coupling.Can using those skilled in the art will know that organic chemical reactionses, condition and reagent formula I ADC is prepared by several paths, including：(1) nucleophilic group of antibody then reacts through covalent bond and bivalent linker reagent reacting formation Ab-L with drug moiety D；(2) nucleophilic group of drug moiety reacts through covalent bond and bivalent linker reagent reacting formation D-L, the then nucleophilic group with antibody.

Ab-(L-D)_p    I

The nucleophilic group of antibody includes but is not limited to：(i) N-terminal amido；(ii) side chain amido, such as lysine；(iii) pendent thiol group, such as cysteine；Sugared hydroxyl or amino in (iv) glycosylated antibodies.Amine, mercaptan and oh group are nucleophilics, can be reacted with the electrophilic group on joint module and form covalent bond, and linker reagents include：(i) active esters, such as NHS esters, HOBt esters, haloformate and acid halide；(ii) alkyl and benzylic halides, such as Haloacetamide；(iii) aldehydes, ketone, carboxyl and maleimide base group.Some antibody have reducible interchain disulfide bond, i.e. cysteine bridge.It can be handled by reducing agent such as DTT (dithiothreitol (DTT)), so that with the reactivity being coupled with linker reagents.Each cysteine bridge can form two reactive nucleophilic thiol bodies in theory.Extra nucleophilic group can be introduced into antibody, via the reaction of lysine and 2- iminothiolanes (TrautShi reagents), cause amine to be changed into mercaptan.

The electrophilic submodule that can react with the nucleophilic displacement of fluorine base on linker reagents or medicine can be also imported by modified antibodies to generate the antibody-drug conjugates of the present invention.The sugar of such as periodate oxidation agent oxidative glycosylation antibody can be used, so as to form the aldehydes or ketones group that can be reacted with the amine groups of linker reagents or drug moiety.Gained imines Schiff base can form stable connection, or can be formed stable amine with the reduction of such as borohydride reagent and be connected.In one embodiment, the reaction of the carbohydrate portions of glycosylated antibodies and galactose oxidase or sodium metaperiodate can generate carbonyl (aldehyde and ketone) in protein, it can react (Hermanson, BioconjugateTechniques) with the suitable groups on medicine.In another embodiment, the protein comprising N- terminal serines or threonine residues can react with sodium metaperiodate, cause to generate aldehyde (Geoghegan and Stroh, (1992) Bioconjugate Chem.3 at first amino acid：138-146；US 5362852).Such aldehyde can be with drug moiety or joint nucleophilic precursor reactant.

Similar, the nucleophilic group on drug moiety includes but is not limited to：Amine, mercaptan, hydroxyl, hydrazides, oxime, hydrazine, thiosemicarbazones, hydrazinecarboxylate and aryl hydrazide group, they can react with the electrophilic group on joint module and form covalent bond, and linker reagents include：(i) active esters, such as NHS esters, HOBt esters, haloformate and acid halide；(ii) alkyl and benzylic halides, such as Haloacetamide；(iii) aldehydes, ketone, carboxyl and maleimide base group.

Or, the fusion protein comprising anti-RA1c polypeptide antibodies and cytotoxic agent can be prepared for example, by recombinant technique or peptide symthesis.DNA length can include the region of each two parts of own coding conjugate, abut one another or separated by the region of encoding linker peptide, the joint peptide does not destroy the desired characteristic of conjugate.

In still another embodiment, antibody can be coupled with " acceptor " (such as streptavidin) to target in advance for tumour, wherein to patient's administration of antibodies-receptor conjugate, then using uncombined conjugate is removed in scavenger self-loopa, then using " part " (such as the avidin) being coupled with cytotoxic agent (such as radioactive nucleotides).

10. immunoliposome

Anti- RA1c polypeptide antibodies disclosed herein can also be configured to immunoliposome." liposome " refers to what is be made up of all kinds lipid, phosphatide and/or surfactant, available for the vesicles for delivering mammal medicine.Similar to the lipid arrangement of biomembrane, the composition of liposome is typically arranged to bilayer formation.Liposome containing antibody can be prepared by means known in the art, Epstein etc., Proc.Natl.Acad.Sci.USA 82：3688(1985)；Hwang etc., Proc.Natl.Acad.Sci.USA 77：4030(1980)；United States Patent (USP) No.4,485,045 and 4,544,545；And described in the WO97/38731 of announcement on October 23rd, 1997.The circulation time liposome of extension is disclosed in United States Patent (USP) No.5,013,556.

Particularly useful liposome can be generated by reverse phase evaporation with the lipid composite comprising phosphatidyl choline, cholesterol and PEG derivatization phospholipid acyl monoethanolamines (PEG-PE).Liposome is squeezed through into the filter with setting aperture, to produce the liposome with desired diameter.Can such as Martin, J.Biol.Chem.257：Described in 286-288 (1982), the Fab ' fragments of antibody of the present invention are coupled through disulfide exchange reaction and liposome.Chemotherapeutics is optionally included in liposome.Referring to Gabizon etc., J.National Cancer Inst.81 (19)：1484(1989).

B.RA1c polypeptide combination oligopeptides

The RA1c polypeptide combination oligopeptides of the present invention refers to combination, preferably specifically binds the oligopeptides of RA1c polypeptides described herein.RA1c polypeptide combination oligopeptides can use known oligopeptides synthetic methodology chemical synthesis, or usable recombinant technique to prepare and purify.The length of RA1c polypeptide combination oligopeptides is typically at least about 5 amino acid, or length is at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 amino acid or longer, wherein such oligopeptides can be combined, it is preferred that specifically binding RA1c polypeptides described herein.RA1c polypeptide combinations oligopeptides just known technology can be used to identify without excessively testing.In this regard it is noted that the technology of the oligopeptides for being capable of specific binding polypeptide target to oligopeptides library screening is well known in the art (see, for example, United States Patent (USP) 5,556,762,5,750,373,4,708,871,4,833,092,5,223,409,5,403,484,5,571,689,5,663,143；PCT Publication WO 84/03506 and WO84/03564；Geysen etc., Proc.Natl.Acad.Sci.U.S.A.81：3998-4002(1984)；Geysen etc., Proc.Natl.Acad.Sci.U.S.A.82：178-182(1985)；Geysen etc., inSynthetic Peptides as Antigens, 130-149 (1986)；Geysen etc., J.Immunol.Meth.102：259-274(1987)；Schoofs etc., J.Immunol.140：611-616(1988)；Cwirla, S.E. etc., (1990) Proc.Natl.Acad.Sci.USA 87：6378；Lowman, H.B. etc., (1991) Biochemistry 30：10832；Clackson, T. etc., (1991) Nature 352：624；Marks, J.D. etc., (1991), J.Mol.Biol.222：581；Kang, A.S. etc., (1991) Proc.Natl.Acad.Sci.USA88：8363；Smith, G.P., (1991) Current Opin.Biotechnol.2：668).

At this point, phage display is a kind of can to screen large-scale oligopeptides library to identify the known technology for the member for being capable of specific binding polypeptide target in those libraries.Phage display is a kind of technology (Scott, J.K. and the Smith, G.P. (1990) Science 249 that variant polypeptide is illustrated in phage particle surface as the fusion protein with coat protein：386).The effectiveness of phage display is, can quickly and efficiently sort those to the large-scale library of selective randomized proteins qualitative change body (or Random clones cDNA) with the sequence of high-affinity binding target molecule.Displayed polypeptide (Cwirla, S.E. etc., (1990) Proc.Natl.Acad.Sci.USA 87 on bacteriophage：Or protein (Lowman, H.B. etc., (1991) Biochemistry 30 6378)：10832；Clackson, T. etc., (1991) Nature 352：624；Marks, J.D. etc., (1991) J.MoI.Biol.222：581；Kang, A.S. etc., (1991) Proc.Natl.Acad.Sci.USA88：8363) library has been used to those polypeptides or oligopeptides (Smith, G.P. (1991) Current Opin.Biotechnol.2 with specific binding properties to millions of polypeptides or oligopeptides screening：668).The phage library of sorting random mutant needs to build and expand the strategy of a large amount of variants, the flow of affinity purification is carried out using target acceptor, and assess the means for the result for combining enrichment.Referring to United States Patent (USP) 5,223,409,5,403,484,5,571,689 and 5,663,143.

Although most of phage display methods use filobactivirus, λ classes (lambdoid) phage display system (WO 95/34683；US 5,627,024), T4 phage display systems (Ren etc., Gene 215：439(1998)；Zhu etc., Cancer Research 58 (15)：3209-3214(1998)；Jiang etc., Infection ＆ Immunity 65 (11)：4770-4777(1997)；Ren etc., Gene 195 (2)：303-311(1997)；Ren, Protein Sci.5：1833(1996)；Efimov etc., Virus Genes 10：173 (1995)) and T7 phage display systems (Smith and Scott, Methods in Enzymology 217：228-257(1993)；US 5,766,905) it is also known.

Many other improvement and accommodation to basic phage display concept development now.These improvement enhance display systems and peptide library are screened and selected the combination of target molecule and show the ability of functional protein, and the functional protein has the potentiality that these protein are screened with desired characteristic.The composite reaction device (WO 98/14277) reacted for phage display has been developed, and phage display library has been used to analyze and controls bio-molecular interaction (WO 98/,201 69；WO 98/20159) and constrained (constrained) helical peptides characteristic (WO 98/20036).The method that WO 97/35196 describes separation affinity ligand, phage display library is wherein set to contact the part that the first solution and second of solution are combined with Selective Separation, part is by binding target molecule in the first solution, and affinity ligand will not binding target molecule in second of solution.WO 97/46251 describes such a method, i.e., with the antibody biopanning random phage body display storehouse of affinity purification, then separate the bacteriophage of combination, then carries out panning process to separate the bacteriophage that high-affinity is combined using the hole of micro plate.It has been reported that use (Li etc., (1998) Mol.Biotech.9 of staphylococcus aureus (Staphylococcus aureus) albumin A as affinity tag：187).WO 97/47314 describes the purposes that substrate subtracted library is used to distinguish enzyme spcificity, wherein using the combinatorial libraries that can be phage display library.WO 97/09446 describes the method that the enzyme suitable for detergent is selected using phage display.Other methods of the protein of selection specific binding are described in United States Patent (USP) 5,498,538,5,432,018 and WO 98/15833.

The method for producing these libraries of peptide library and screening is also disclosed in United States Patent (USP) 5,723,286,5,432,018,5,580,717,5,427,908,5,498,530,5,770,434,5,734,018,5,698,426,5,763,192, and 5,723,323.

C.RA1c polypeptide combination small molecules

RA1c polypeptide combination small molecules preferably refer to beyond oligopeptides defined herein or antibody, with reference to, preferably specifically bind the organic molecules of RA1c polypeptides described herein.RA1c polypeptide combination organic molecules can use the known formula science of law to identify and chemical synthesis (see, for example, PCT Publication WO 00/00823 and WO 00/39585).The size of RA1c polypeptide combination organic molecules is generally less than about 2000 dalton, or its size is less than about 1500,750,500,250 or 200 dalton, wherein it is such can combine, the organic molecule that preferably specifically binds RA1c polypeptides described herein just known technology can be used to identify without excessively test.In this regard it is noted that the technology of the molecule for being capable of Binding peptide target to organic molecule library screening is (see, for example, PCT Publication WO 00/00823 and WO00/39585) well known in the art.RA1c polypeptide combination organic molecules can be such as aldehyde, ketone, oxime, hydrazone, semicarbazones (semicarbazone), carbonohydrazides (carbazide), primary amine, secondary amine, tertiary amine, the hydrazine of N- substitutions, hydrazides, alcohol, ether, mercaptan, thioether, disulphide, carboxylic acid, ester, acid amides, urea, carbamate (carbamate), carbonic ester (carbonate), ketal, thio ketal ization (thioketal), acetal, mercaptal, aryl halide, aromatic yl sulphonate (aryl sulfonate), alkyl halogen, hydrocarbyl sulfonic ester (alkyl sulfonate), aromatic compound, heterocyclic compound, aniline, alkene, alkynes, glycol, amino alcohol, oxazolidine, oxazoline, thiazolidine, thiazoline, enamine, sulfonamide (sulfonamide), epoxides, ethylene imine (aziridine), isocyanates (isocyanate), sulfonic acid chloride, diazonium compound, acid chloride (acid chloride) etc..

D. the compound that regulation and control RA1c is expressed

The compound that the regulation and control RA1c of the present invention is expressed is the compound of RA1c expression of polypeptides in antisense polynucleotides, silence RNA molecule, catalytic RNA molecules, RNA-DNA block polymers, fit (aptamers), antibody, oligopeptides, inorganic or organic molecule or other regulating cells, as described in this article.Some such compound activation or the transcription for improving RA1c polynucleotides.Some such compound activation or the translation for improving RA1c polynucleotides.Some such compound activation improve RA1c expression of polypeptides.Some such compound reductions or the transcription for blocking RA1c polynucleotides.Some such compound reductions or the translation for blocking RA1c polynucleotides.Some such compound reductions block RA1c expression of polypeptides.The compound of regulation and control RA1c expression may act on one or more intracellular signaling pathways for involving RA1c expression.For example, the compound controllable p38 map kinase signal transduction paths of regulation and control RA1c expression.In another example, the compound controllable PI3K signal transduction paths of regulation and control RA1c expression.In another example, the usual signal transduction path activated by IL-6 of compound controllable of regulation and control RA1c expression.

The compound of the regulation and control RA1c expression of the present invention can be prepared in the way of being adapted to compound essence.For example, the antibody or antibody fragment of regulation and control RA1c expression can be used herein in connection with preparing anti-RA1c antibody or prepared by constructed described by its fragment.In another example, the oligopeptides of regulation and control RA1c expression can be by constructed preparing herein in connection with prepare described by RA1c polypeptide combination oligopeptides.In another example, the organic molecule of regulation and control RA1c expression can be used constructed to be prepared herein in connection with prepare described by RA1c polypeptide combination small molecules.In another example, regulation and control RA1c expression it is fit can by herein in connection with prepares RA1c combine it is fit described by constructed prepare.

E. screening regulation and control RA1c is expressed RA1c antagonists and compound

The technology of the compound for producing RA1c antagonists (such as with reference to the antibody, oligopeptides and small molecule of RA1c polypeptides) and regulation and control RA1c expression is hereinbefore described.As needed, the RA1c antagonists with some biological properties or the compound of regulation and control RA1c expression can further be selected.

The cell of RA1c polypeptides by means commonly known in the art, such as can be expressed using endogenous or after being transfected with RA1c polypeptide genes, to assess the growth inhibitory effect for the compound that RA1c antagonists of the present invention or regulation and control RA1c are expressed.For example, the compound that can express suitable tumor cell line and RA1c polypeptides transfectional cell with the RA1c antagonists of the present invention or regulation and control RA1c of various concentrations is handled several days (such as 2-7 days), and dyed with crystal violet or MTT, or analyzed by some other colorimetric methods.Another method of measurement propagation is by comparing the handled cell when there is or lack the compound of the RA1c antagonists of the present invention or regulation and control RA1c expression³H- thymidines are absorbed.After processing, harvesting is simultaneously measured in scintillation counter to the radioactive amount for mixing DNA.Suitable positive control includes handling the cell line with the known growth inhibiting antibody for suppressing selected cell line growth.The a variety of methods that can be known with this area determine the growth inhibition of interior tumor cell.The tumour cell can be the cell for being overexpressed RA1c polypeptides.Compared with untreated tumour cell, RA1c antagonists or the compound of regulation and control RA1c expression breed the cell for suppressing to express the tumour cell of RA1c polypeptides in vitro or in vivo of about 25-100%, more preferably from about 30-100%, very more preferably from about 50-100% or 70-100%, in one embodiment, antibody concentration is about 0.5-30 μ g/ml.In certain embodiments, it can in cell culture in antibody concentration be about 0.5-30 μ g/ml or measure growth inhibition during about 0.5nM to 200nM, wherein 1-10 days after tumour cell is exposed to antibody measure growth inhibition.In certain embodiments, if applied with about 1 μ g/kg to about 100mg/kg body weight, anti-RA1c polypeptide antibodies cause in from administration of antibodies first about 5 days to 3 months, tumor mass reduction or tumor cell proliferation are reduced in preferably from about 5 to 30 days, then the antibody is tumor growth inhibition.

In order to select the RA1c antagonists of inducing cell death (apoptosis) or the compound of regulation and control RA1c expression, the forfeiture of film integrality can be assessed relative to control, this is indicated by such as propidium iodide (PI), trypan blue or 7AAD intakes.PI intakes determination method can be carried out when lacking complement and immune effector cell.Tumour cell and the single culture medium of RA1c polypeptides will be expressed or incubated containing suitable anti-RA1c polypeptide antibodies (e.g., from about 10 μ g/ml), RA1c polypeptide combination oligopeptides, RA1c polypeptide combinations organic molecule, other RA1c antagonists or together with regulating and controlling the culture medium of the compound that RA1c is expressed.By the cell culture period of 3 days.After per treatment, cleaning cell and decile (aliquot) into (strainer-capped) of the 35mm with filter cover 12x75 test tubes (every test tube 1ml, each 3 test tubes for the treatment of group) are used to remove cell mass.Then PI (10 μ g/ml) is added to test tube.In a non-limitative example, it can be usedFlow cytometer and

CellQuest softwares (BectonDickinson) analyze sample.Those may be selected the RA1c antagonists for the cell death for being defined as inducing statistical significant level or the compound of regulation and control RA1c expression are absorbed as the RA1c antagonists of inducing cell death or the compound of regulation and control RA1c expression by PI.

In order to screen antibody, oligopeptides or the other organic molecules or other RA1c antagonists of the epitope combined with reference to purpose antibody on RA1c polypeptides, conventional cross-blocks determination method can be carried out, such as Antibodies, A Laboratory Manual, described in Cold Spring Harbor Laboratory, Ed Harlow and David Lane (1988).This determination method can be used for determining test antibody, oligopeptides, other organic molecules and other RA1c antagonists whether with known anti-RA1c polypeptide antibodies combination identical site or epitope.Or epitope mapping (mapping) can be carried out by methods known in the art.For example, come matagenized antibody sequence contact residues can be identified by such as Alanine-scanning.Mutant antibodies are tested first with the combination of polyclonal antibody to ensure correctly to fold.In different methods, can in competition assay use corresponding to RA1c polypeptide different zones peptide, using several test antibodies or a kind of test antibody and with characterized or known epitope antibody.

F. the prodrug therapy (ADEPT) of the enzyme mediation of antibody is relied on

By the way that antibody and prodrug activation enzyme are coupled, antibody of the invention can be additionally used in ADEPT, and pro-drug (such as peptidyl chemotherapeutic agent, referring to WO 81/01145) is changed into active anticancer medicine by the prodrug activation enzyme.See, for example, WO 88/07378 and United States Patent (USP) 4,975,278.

Enzyme component available for ADEPT immune conjugate includes that pro-drug can be acted in such a way to be transformed into any enzyme of more active cytotoxic form.

Enzyme available for the inventive method includes but is not limited to the pro-drug of phosphate-containing/ester can be changed into the alkaline phosphatase of free drug；The pro-drug of containing sulfate/ester can be changed into the aryl sulfatase of free drug；Nontoxic 5-flurocytosine can be changed into the cytosine deaminase of anticarcinogen 5 FU 5 fluorouracil；Medicine containing propeptide can be changed into the protease of free drug, such as Serratieae protease (serratiaprotease), thermolysin (thermolysin), subtilopeptidase A (subtilisin), carboxypeptidase and cathepsin (such as cathepsin B and L)；The D- alanylcarboxypeptidases of the pro-drug of the amino acid replacement containing D- can be converted；Glycosylated prodrugs can be changed into the carbohydrate-cleaving enzyme of free drug, such as beta galactosidase and neuraminidase；It can will be changed into the beta-lactamase of free drug with medicine derived from beta-lactam；And can will be transformed into the penicillin amidase of free drug, such as Penicillin-V-Amidase or Penicillin-G-amidases with medicine derived from benzene oxygen acetyl group or phenylacetyl group respectively at its ammonia nitrogen.Or, the antibody with enzymatic activity can be used, this area is also referred to as " abzyme ", the pro-drug of the present invention is changed into free active medicine (see, for example, Massey, Nature 328：457-458(1987)).Antibody-antibody enzyme conjugates as described herein can be prepared, for abzyme to be delivered into tumor cell group.

Can be by technology well-known in the art by the enzyme of the present invention and anti-RA1c antibody covalent bond, such as using heterobifunctional crosslinker as discussed above.Or, it recombinant DNA technology well-known in the art can be used to build the fusion protein of at least antigen binding domain comprising the antibody of the present invention being connected with least functional activity part of enzyme of the present invention (see, for example, Neuberger etc., Nature 312：604-608(1984)).

G. anti-RA1c polypeptide antibodies and variant

Except anti-RA1c polypeptide antibodies described herein, it is contemplated to anti-RA1c polypeptide antibodies variant can be prepared.Anti- RA1c polypeptide antibodies can be by changing introducing coding DNA by suitable nucleotides or being prepared by synthesizing expectation antibody.Skilled artisans will appreciate that, amino acid change can change the post translational processing of anti-RA1c polypeptide antibodies, such as change the number or position or change film anchor feature of glycosylation site.

Row variation can be entered in anti-RA1c polypeptide antibodies described herein, such as using such as United States Patent (USP) 5, any technology and guilding principle of the conservative and non-conservative mutation described in 364,934.Variation can be the replacement of one or more codons of encoding antibody or polypeptide, delete or insertion that it causes amino acid sequence relative to the change of native sequences antibody.It is optional that, variation is that at least one amino acid is substituted by any other amino acid in one or more domains by anti-RA1c polypeptide antibodies.Pass through the sequence and the sequence of homologous known protein molecule of relatively more anti-RA1c polypeptide antibodies, and the number of the amino acid sequence carried out in high homology area change is minimized, it is possible to find determine which amino acid residue be can be inserted into, substituted or be deleted without to expecting the active policy adversely affected.Amino acid replacement can be the result that a kind of amino acid is used to another amino acid replacement with similar structure or chemical characteristic, and such as substituting leucine, i.e. conserved amino acid with serine substitutes.Insertion or deletion can be optionally in the range of about 1 to 5 amino acid.Amino acid insertion can be carried out by system in the sequence, substitute or delete, and the activity shown to gained mutation testing by parental array determines permissible variation.

There is provided herein the fragment of anti-RA1c polypeptide antibodies and RA1c polypeptides.For example, when being compared with total length natural antibody or protein, such fragment can be truncated in N- ends or C- ends, or can lack internal residues.The expectation biological activity that some fragments lack for anti-RA1c antibody or RA1c polypeptides is not vital amino acid residue.

Anti- RA1c antibody and RA1c polypeptide fragments can be prepared by any of a variety of routine techniques.It is expected that fragments of peptides is chemically synthesized.A kind of alternative approach involves produces antibody or polypeptide fragment by enzymatic digestion, for example by using the enzyme-treated protein of the known scinderin matter at the site limited by particular amino acid residue, or by using suitable limitation enzymic digestion DNA, and separate expectation fragment.Also a kind of suitable technology involves separation and by PCR (PCR) amplification coding expectation antibody or the DNA fragmentation of polypeptide fragment.Limit DNA fragmentation and it is expected that the oligonucleotides of end is used as 5 ' and 3 ' primers in PCR.Preferably, anti-RA1c antibody and RA1c polypeptide fragments and natural anti-RA1c polypeptide antibodies or RA1c polypeptides shared at least one biology or immunologic competence disclosed herein.

In a particular embodiment, conservative replacement interested is shown in Table shown under 1 title " preferably substituting ".If such replacement causes the change of biological activity, then can be introduced into table 1 and be referred to as the more material alterations of " illustrate and substitute ", or following article is described further on amino acid classification, and screens product.

Table 1

Original Residue	Illustrate and substitute	It is preferred that substituting
			Ala(A)	val；leu；ile	val
Arg(R)	lys；gln；asn	lys
			Asn(N)	gln；his；asp；lys；arg	gln
Asp(D)	glu；asn	glu
			Cys(C)	ser；ala	ser
Gln(Q)	asn；glu	asn
			Glu(E)	asp；gln	asp
Gly(G)	pro；ala	ala
			His(H)	asn；gln；lys；arg	arg
Ile(I)	leu；val；met；ala；phe；Nor-leucine	leu
			Leu(L)	Nor-leucine；ile；val；met；ala；phe	ile
Lys(K)	arg；gln；asn	arg
			Met(M)	leu；phe；ile	leu
Phe(F)	trp；leu；val；ile；ala；tyr	leu
			Pro(P)	ala	ala
Ser(S)	thr	thr
			Thr(T)	val；ser	ser
Trp(W)	tyr；phe	tyr

Original Residue	Illustrate and substitute	It is preferred that substituting
			Tyr(Y)	trp；phe；thr；ser	phe
Val(V)	ile；leu；met；phe；ala；Nor-leucine	leu

Confrontation RA1c antibody or the function of RA1c polypeptides or the substantive sex modification of immunology identity are by selecting dramatically different replacement in the effect for keeping following aspect to complete：(a) structure of the polypeptide backbone of replacement area, such as pleated sheet or helical conformation, (b) target site punishment son electric charge or hydrophobicity, or (c) side chain volume.According to the similitude of its side chain properties, amino acid can be as follows grouped (A.L.Lehninger, in Biochemistry, second edition, pp.73-75, Worth Publishers, New York (1975))：

(1) it is nonpolar：Ala(A)、Val(V)、Leu(L)、Ile(I)、Pro(P)、Phe(F)、Trp(W)、Met(M)

(2) it is uncharged, polarity：Gly(G)、Ser(S)、Thr(T)、Cys(C)、Tyr(Y)、Asn(N)、Gln(Q)

(3) it is acid：Asp(D)、Glu(E)

(4) it is alkaline：Lys(K)、Arg(R)、His(H)

Or, according to common side chain properties, naturally occurring residue can be grouped as follows：

(1) it is hydrophobic：Nor-leucine, Met, Ala, Val, Leu, Ile；

(2) it is neutral, hydrophilic：Cys、Ser、Thr、Asn、Gln；

(3) it is acid：Asp、Glu；

(4) it is alkaline：His、Lys、Arg；

(5) residue of influence side chain orientation：Gly、Pro；With

(6) it is aromatic：Trp、Tyr、Phe.

Non-conservative replacement will need to exchange another classification with a member in one of these classifications.Such replacement residue can also be introduced to conservative substitution sites, or it is further preferred that introduce remaining (non-conservative) site.

Variation can be used the method that this area is known to carry out, such as oligonucleotide mediated (fixed point) mutagenesis, Alanine-scanning and PCR mutagenesis.Direct mutagenesis (Carter etc., Nucl.Acids Res.13 can be carried out to the DNA of clone：4331(1986)；Zoller etc., Nucl.Acids Res.10：6487 (1987)), cassette mutagenesis (Wells etc., Gene 34：315 (1985)), limitation Sexual behavior mode mutagenesis (restriction selectionmutagenesis) (Wells etc., Philos.Trans.R.Soc.London SerA 317：415 (1986)) or other known technology to produce anti-RA1c polypeptide antibodies or RA1c polypeptide variants DNA.

One or more amino acid along continuous sequence can be also identified using scanning amino acid analysis.There is relatively small neutral amino acid in preferred scanning amino acid.This amino acid includes alanine, glycine, serine and cysteine.Alanine is typically the preferred scanning amino acid in this group, because it eliminates the side chain on β-carbon, and unlikely Conformation of the main chain (Cunningham and Wells, the Science 244 for changing variant：1081-1085(1989)).Alanine is generally also preferably as it is most common amino acid.In addition, usually its (Creighton, The Proteins, W.H.Freeman＆Co., N.Y. can be found in concealed location and exposure position；Chothia, J.Mol.Biol.150：1(1976)).If alanine substitutes the variant for not producing sufficient amount, then can be used and wait row's (isoteric) amino acid.

It is any be not related to keep the cysteine residues of anti-RA1c polypeptide antibodies or the correct conformation of RA1c polypeptides also to be substituted, generally with serine, to improve the oxidation stability of molecule and prevent abnormal crosslinking.On the contrary, cysteine key can be added into anti-RA1c antibody or RA1c polypeptides to improve its stability (particularly when antibody is antibody fragment such as Fv fragments).

Particularly preferred class alternative variations involve the one or more some hypervariable region residues (such as humanization or human antibody) for substituting parental antibody.Be typically chosen for the gained variant further developed relative to produce their parental antibody will have improved biological characteristics.A kind of facilitated method for producing such alternative variations involves the affinity maturation carried out using phage display.In brief, several hypervariable region sites (such as 6-7 site) are mutated, all possible amino acid replacement is produced in each site.The antibody variants so produced are illustrated on filamentous phage particle with monovalent fashion, are used as the fusions with the M13 gene III products of each particle inner packing.Then its biological activity (such as binding affinity) is screened to the variant of phage display as disclosed herein.In order to identify the candidate hypervariable region site for modification, alanine scanning mutagenesis can be carried out to identify some hypervariable region residues of significant contribution are combined with to antigen.Or the crystal structure of analysis antigen-antibody complex is probably beneficial to identify the contact point between antibody and people's RA1c polypeptides.Such contact residues and neighbouring residue are according to the candidate locus that detailed description technology is substituted herein.Once such variant is produced, it is as described herein that this group of variant is screened, it may be selected there is the antibody of good characteristic to be used to further develop in one or more relevant assays.

Encoding the nucleic acid molecules of the amino acid sequence variation of anti-RA1c antibody can be prepared by a variety of methods known in the art.These methods include but is not limited to from natural origin separation (in the case of naturally occurring amino acid sequence variation), or carry out oligonucleotide mediated (or fixed point) mutagenesis, PCR mutagenesis and cassette mutagenesis to prepare by the variant or the anti-RA1c antibody of non-variant form that prepare early stage.

H. the modification of confrontation RA1c antibody and RA1c polypeptides

The covalent modification of confrontation RA1c polypeptide antibodies and RA1c polypeptides is included within the scope of the invention.A type of covalent modification includes making the targeted amino acid residues of anti-RA1c antibody or RA1c polypeptides react with organic derivatization reagent, and organic derivatization reagent can react with the selected side chain or N- or C- terminal residues of anti-RA1c polypeptide antibodies or RA1c polypeptides.The derivatization carried out with bifunctional reagent can be used for for example making anti-RA1c antibody or RA1c polypeptides and water insoluble supported matrix or surface-crosslinked, and for the purification process of anti-RA1c antibody, vice versa.Conventional crosslinking agent includes such as 1; ester for example with the formation of 4- azidosalicylic acids of 1- double (diazonium-acetyl group) -2- vinylbenzenes, glutaraldehyde, N-hydroxy-succinamide esters, with difunctional imino-ester include two succinimide esters such as 3; the reagent such as such as double-N- maleimides -1, the 8- octanes of 3 '-two thiobis (Succinimidyl Propionate), difunctional maleimide and methyl -3- [(p- azidophenyl) two is thio] third imide ester.

It is glutamy and aspartyl residue that other modifications, which include glutaminyl and asparaginyl difference deamidation; the hydroxylating of proline and lysine; the phosphorylation of the hydroxyl of seryl or threonyl residues; alpha-amino (T.E.Creighton, the Proteins of methylating of lysine, arginine and histidine side chains：Structure and Molecular Properties, W.H.Freeman ＆ Co., San Francisco, pp.79-86 (1983)), the acetylation of N- terminal amines, and any C- terminal carboxyl groups amidatioon.

The another kind of covalent modification of included confrontation RA1c antibody or RA1c polypeptides includes the Natively glycosylated pattern for changing antibody or polypeptide in the scope of the invention." change Natively glycosylated pattern " refers to delete herein one or more carbohydrate moieties (moiety) found in the anti-RA1c antibody of native sequences or RA1c polypeptides (or by eliminating potential glycosylation site, or glycosylated by being deleted with chemistry or enzymatic means), or add one or more non-existent glycosylation sites in the anti-RA1c antibody of native sequences or RA1c polypeptides.In addition, this phrase includes the change of the matter during native protein is glycosylated, involve essence and the change of ratio of existing multiple kinds of carbohydrate module.

It is the glycosylation of antibody and other polypeptides generally N- connections or O- connections.N- connections refer to the side chain that carbohydrate moiety is attached to asparagine residue.Tripeptide sequence asparagine-X-serine and asparagine-X-threonine (wherein X is any amino acid in addition to proline) are the recognition sequences that carbohydrate moiety enzymatic is attached to asparagine side chain.Thus, the presence of these tripeptide sequence any of which produces potential glycosylation site in polypeptide.The glycosylation of O- connections refers to is attached to hydroxy-amino-acid, most commonly serine or threonine by one of sugars N-aceylgalactosamine, galactolipin or xylose, but 5-OxoPro or 5- hydroxylysines can also be used.

Glycosylation site is added into anti-RA1c antibody or RA1c polypeptides makes it advantageously be completed comprising one or more above-mentioned tripeptide sequences (glycosylation site for being used for N- connections) by changing amino acid sequence.This change can also be carried out (glycosylation site for being used for O- connections) by adding or substituting one or more serines or threonine residues in the sequence to original anti-RA1c antibody or RA1c polypeptides.The amino acid sequence of anti-RA1c antibody or RA1c polypeptides can optionally be changed by the change of DNA level, especially by the DNA of the anti-RA1c antibody of mutation coding or RA1c polypeptides at the base being pre-selected, so that the codon for expecting amino acid will be translated into by producing.

Another method for increasing the number of sugared module on anti-RA1c antibody or RA1c polypeptides is by making glucosides and chemiluminescent polypeptide or enzymatic of glucosides.This area is described to such method, such as WO 87/05330 disclosed in 1987 on Septembers 11, and Aplin and Wriston, CRC Crit.Rev.Biochem., pp.259-306 (1981).

Removing sugared module present on anti-RA1c antibody or RA1c polypeptides can be realized by chemistry or enzymatic method, or be substituted by the mutation for the codon for encoding the amino acid residue for serving as glycosylation target.Chemical deglycosylation technology is known in the art, and is described in such as Hakimuddin, Arch.Biochem.Biophys.259：52 (1987) and Edge etc., Anal.Biochem.118：131(1981).Sugared module on enzymatic cutting polypeptide can be realized by using a variety of inscribes and exoglycosidase, such as Thotakura, Meth.Enzvmol.138：350 (1987) are described.

The another kind of covalent modification of confrontation RA1c antibody or RA1c polypeptides includes, with United States Patent (USP) 4,640,835；4,496,689；4,301,144；4,670,417；4,791,192 or 4, one of antibody or polypeptide and polymer of a variety of non-proteinaceous are connected, such as polyethylene glycol (PEG), polypropylene glycol or poly (oxyalkylene) (polyoxyalkylene) by mode described in 179,337.Antibody or polypeptide can also contain in the microcapsules prepared for example by condensation technique or by interfacial polymerization (being for example hydroxymethyl cellulose or gelatin-microcapsule and poly- (methyl methacrylate) microcapsules respectively), in colloidal drug delivery system (such as liposome, albumin microspheres, microemulsion, nano particle and Nano capsule) or in macro emulsion.Such technology is disclosed in such as Remington ' s Pharmaceutical Sciences, 16th edition, Osol, A.Ed., 1980.

The mode that chimeric molecule can also be formed modifies the anti-RA1c antibody or RA1c polypeptides of the present invention, and the chimeric molecule includes the anti-RA1c antibody or RA1c polypeptides merged with another heterologous polypeptide or amino acid sequence.

In one embodiment, such chimeric molecule includes the fusions of anti-RA1c antibody or RA1c polypeptides with tag polypeptide, and the tag polypeptide provides the epitope that anti-tag antibody alternative is combined.Epitope tag is usually located at the amino or carboxyl terminal of anti-RA1c antibody or RA1c polypeptides.The antibody for the tag polypeptide can be used to detect for the presence of the anti-RA1c antibody or RA1c polypeptides of such epitope tagged forms.Moreover, the offer of epitope tag makes anti-RA1c antibody or the affinity substrate of RA1c polypeptides anti-tag antibody easy to use or the another kind of epitope tag with reference to described in be purified by affinity purification.A variety of tag polypeptides and its respective antibody are well known in the art.Example includes polyhistidine (poly-his) or many-HIS-GLY (poly-his-gly) label；Influenza HA tag polypeptide and its antibody 12CA5 (Field etc., Mol.Cell.Biol.8：2159-2165(1988))；C-myc labels and its antibody 8F9,3C7,6E10, G4, B7 and 9E10 antibody (Evan etc., Molecular and Cellular Biology 5：3610-3616(1985))；And herpes simplex virus glycoprotein D (gD) labels and its antibody (Paborsky etc., Protein Engineering3 (6)：547-553(1990)).Other tag polypeptides include Flag peptides (Hopp etc., BioTechnology 6：1204-1210(1988))；KT3 epitope peptides (Martin etc., Science 255：192-194(1992))；Alpha-tubulin epitope peptide (Skinner etc., J.Biol.Chem.266：15163-15166(1991))；And the protein peptide tag of T7 genes 10 (Lutz-Freyermuth etc., Proc.Natl.Acad.Sci.USA 87：6393-6397(1990)).

In an alternative embodiment, chimeric molecule may include anti-RA1c antibody or RA1c polypeptides and immunoglobulin or the fusions of immunoglobulin specific region.For the chimeric molecule (also referred to as " immunoadhesin ") of bivalent form, such fusions can be merged with IgG molecule Fc areas.Ig fusions preferably comprise the replacement of at least one variable region of anti-RA1c antibody or RA1c polypeptides displacement Ig intramoleculars with soluble form (membrane spaning domain is deleted or inactivated).In an especially preferred embodiment, immunoglobulin fusions include hinge area, the CH of IgG1 molecules₂Area and CH₃Area, or hinge area, CH₁Area, CH₂Area and CH₃Area.The United States Patent (USP) 5,428,130 that preparation on immunoglobulin fusions was authorized referring also to 27 days June nineteen ninety-five.

I. the preparation of anti-RA1c antibody and RA1c polypeptides

Following description relates generally to prepare anti-RA1c antibody and RA1c polypeptides by cultivating with the cell of the carrier conversion comprising the nucleic acid for encoding anti-RA1c antibody and RA1c polypeptides or transfection.It has been certainly contemplated as that anti-RA1c antibody and RA1c polypeptides can be prepared using alternative approach well known in the art.For example, solid phase technique can be used to pass through direct peptide symthesis to generate suitable amino acid sequence or part thereof (see, for example, Stewart etc., Solid-Phase Peptide Synthesis, W.H.Freeman Co., San Francisco, CA, 1969；Merrifield, J.Am.Chem.Soc.85：2149-2154(1963)).Protein synthesis in vitro can be used manual skill or be carried out by automating.Fully automated synthesis can be completed for example using AppliedBiosystems Peptide Synthesizer (Foster City, CA) according to the specification of manufacturer.The some of anti-RA1c antibody or RA1c polypeptides can separate chemical synthesis, and be combined using chemistry or enzymatic method to generate desired anti-RA1c antibody and RA1c polypeptides.

1. the DNA of the anti-RA1c antibody of coding or RA1c polypeptides separation

Encoding the DNA of anti-RA1c antibody or RA1c polypeptides can obtain from cDNA library, and the cDNA library is from thinking to express its tissue preparation with anti-the RA1c antibody or RA1c polypeptides mRNA and with detectable level.Therefore, the anti-RA1c antibody or RA1c polypeptid DNAs of people can be obtained easily from the cDNA library of people's tissue preparation.Anti- RA1c antibody or RA1c polypeptide coding genes can also be obtained from genomic library or by known synthesis flow (such as automatic nucleic acid synthesis).

It can use designed for identification target gene or library is screened by the probe (oligonucleotides of such as at least about 20-80 base) of its protein encoded.CDNA is screened with selected probe or normal process can be used to carry out for genomic library, Sambrook etc., Molecular Cloning：A LaboratoryManual, New York, Cold Spring Harbor Laboratory Press, described in 1989.A kind of alternative approach of the gene of the anti-RA1c antibody of separation coding or RA1c polypeptides is that (Sambrook etc., sees above using PCR method；Dieffenbach etc., PCR Primer：A Laboratory Manual, ColdSpring Harbor Laboratory Press, 1995).

Technology for screening cDNA library is well known in the art.Be elected to be probe oligonucleotide sequence should long enough and enough clearly (unambiguous) so that false positive is preferably minimized.Oligonucleotides is preferably mark so that it can detect that when with DNA hybridization in screened library.Labeling method be it is known in the art that including the use of radio-labeled thing, as³²ATP, biotinylation or the enzyme mark of P- marks.Hybridization conditions, including medium stringency and High stringency, are shown in Sambrook etc., see above.

The sequence identified in such library screening methods can with preservation and available other known sequence is compared and contrasted in the privately owned sequence libraries of public database such as GenBank or other.That in the molecule limited area or across full length sequence sequence identity (on amino acid levels or on nucleotide level) can be used that this area knows and method described herein is determined.

Nucleic acid with protein coding sequence can screen the cDNA selected or genomic library to obtain by using the amino acid sequence of deduction first public herein, and if necessary, using Sambrook etc., see above the custom primer extension flow detect may not reverse transcription be cDNA mRNA precursor and the intermediate product of processing.

2. the selection and conversion of host cell

Host cell is transfected or converted with the expression described herein generated for anti-RA1c antibody or RA1c polypeptides or cloning vector, and is cultivated in for evoked promoter, the conventional nutrient culture for selecting transformant or the gene of amplification coding expectation sequence and appropriately adjusting.Condition of culture, such as culture medium, temperature, pH etc., can just be selected by those skilled in the art without excessively experiment.It is commonly used for making the maximized principle of cell culture biological productivity, scheme and practical technique reference can be made to Mammalian CellBiotechnology：A Practical Approach, M.Butler, ed., IRL Press, 1991 and Sambrook etc., see above.

The method that eukaryotic cell transfection and prokaryotic are converted is such as CaCl known to those of ordinary skill₂、CaPO₄, liposome-mediated and electroporation.According to host cell used, conversion is carried out using the standard technique suitable to such cell.Using the Calcium treatment of calcium chloride, such as Sambrook sees above described, or electroporation is generally used for prokaryotic.It is used for certain plants transformation, such as Shaw, Gene 23 with the infection of Agrobacterium tumdfaciens (Agrobacteriumtumefaciens)：Described in WO 89/05859 disclosed in 315 (1983) and 29 days June in 1989.For the mammalian cell of not such cell membrane, Graham and van der Eb, Virology 52 can be used：456-457 (1978) calcium phosphate precipitation.The ordinary circumstance of mammalian cell host system transfection is referring to United States Patent (USP) 4,399,216.Conversion into yeast is generally according to Van Solingen etc., J.Bact.130：946 (1977) and Hsiao etc., Proc.Natl.Acad.Sci. (USA) 76：The method of 3829 (1979) is carried out.It is also possible, however, to use other methods for DNA to be imported to cell, such as core microinjection, electroporation, bacterial protoplast are merged or polycation such as polybrene, poly ornithine with intact cell.See Keown etc., Methods in Enzvmology 185 on the multiple technologies for transformed mammalian cell：527-537 (1990) and Mansour etc., Nature 336：348-352(1988).

Host cell suitable for cloning or expressing the DNA in this paper carriers includes prokaryotes, yeast or higher eucaryotic cells.Suitable prokaryotes include but is not limited to eubacteria, such as Gram-negative or gram-positive organism, such as such as enterobacteriaceae, Escherichia coli.A variety of coli strains are publicly available, such as e. coli k12 strain MM294 (ATCC 31,446)；Escherichia coli X1776 (ATCC 31,537)；Coli strain W3110 (ATCC 27,325) and K5 772 (ATCC53,635).Other suitable prokaryotes host cells include enterobacteriaceae, such as Escherichia (Escherichia) such as ETEC (Escherichia coli) (E.coli), Enterobacter (Enterobacter), Erwinia (Erwinia), Klebsiella (Klebsiella), proteus (Proteus), Salmonella (Salmonella) such as salmonella typhimurium (Salmonellatyphimurium), Serratia (Serratia) such as serratia marcescens (Serratiamarcescans), with Shigella (Shigella), and bacillus (Bacilli) such as bacillus subtilis (B.subtilis) and bacillus licheniformis (the B.licheniformis) (DD 266 that on April 12nd, 1 publishes, bacillus licheniformis 41P disclosed in 710), pseudomonas (Pseudomonas) such as pseudomonas aeruginosa (P.aeruginosa), with streptomyces (Streptomyces).These examples are illustrative rather than restricted.Bacterial strain W3110 is particularly preferred a host or parent host, because it is the conventional host strain for recombinant DNA product fermentations.Preferably, host cell secretes the proteolytic enzyme of minimum.For example, bacterial strain W3110 can be modified, genetic mutation is produced in the gene for encoding protein endogenous for host, the example of such host includes Escherichia coli W3110 bacterial strain 1A2, and it has complete genotype tonA；Escherichia coli W3110 bacterial strain 9E4, it has complete genotype tonA ptr3；Escherichia coli W3110 bacterial strains 27C7 (ATCC55,244), it has complete genotype tonA ptr3 phoA E15 (argF-lac) 169degP ompT kan^r；Escherichia coli W3110 bacterial strain 37D6, it has the degP ompT rbs7 ilvG kan of complete genotype tonA ptr3 phoA E15 (argF-lac) 169^r；Escherichia coli W3110 bacterial strain 40B4, it is the bacterial strain 37D6 that mutation is deleted with non-kalamycin resistance degP；And the coli strain of the mutant periplasmic protease disclosed in the United States Patent (USP) 4,946,783 authorized for 7th with nineteen ninety August.Or, body outer clone method, such as PCR or other nucleic acid polymerase reactions are also suitable.

Full length antibody, antibody fragment and antibody fusions protein can be prepared in bacterium, particularly when that need not glycosylate with Fc effector functions, such as when treatment is coupled with antibody and cytotoxic agent (such as toxin) and immune conjugate itself shows the effect of tumor cell destruction.Full length antibody has relatively long half-life in the circulating cycle.Preparation in Escherichia coli is faster and more economical.For the expression of antibody fragment and polypeptide in bacterium, see, for example, US 5,648,237 (Carter et al.), US 5,789,199 (JoIy et al.), and US 5,840,523 (Simmons et al.), they describe the Translation initiator (TIR) and signal sequence for Optimal Expression and secretion, these patents are taken in herein as reference.After expression, from Bacillus coli cells paste separation antibody in soluble fraction, and for example it can be purified according to isotype by albumin A or G posts.Final purifying can be similar with the method for purifying the antibody for example expressed in Chinese hamster ovary celI progress.

In addition to prokaryotes, eukaryotic microorganisms, such as filamentous fungi or yeast are also the suitable clones or expressive host of the carrier of the anti-RA1c antibody of coding or RA1c polypeptides.Saccharomyces cerevisiae (Saccharomycescerevisiae) is conventional low eucaryon host microorganism.Others include grain wine pombe (Schizosaccharomyces pombe) (Beach and Nurse,Nature290：140(1981)；EP139, on May 2nd, 383,1985 is open)；Kluyveromyces (Kluyveromyces) host's (United States Patent (USP) 4,943,529；Fleer etc.,Bio/Technology 9：968-975 (1991)) such as Kluyveromyces lactis (K.lactis) (MW98-8C, CBS683, CBS4574；Louvencourt etc.,J.Bacteriol.154(2)：737-742 (1983)), Kluyveromyces fragilis (K.fragilis) (ATCC 12,424), Bulgaria kluyveromyces (K.bulgaricus) (ATCC 16,045), Brunswick kluyveromyces (K.wickeramii) (ATCC 24,178), K.waltii (ATCC 56,500), drosophila kluyveromyces (K.drosophilarum) (ATCC 36,906；Van den Berg etc.,Bio/Technology 8：135 (1990)), Kluyveromyces thermotolerans (K.thermotolerans) and Kluyveromyces marxianus (K.marxianus)；Yarrow saccharomyces (Yarrowia) (EP 402,226)；Pichia pastoris phaff (Pichia pastoris) (EP183,070；Sreekrishna etc.,J.Basic Microbiol.28：265-278(1988))；Candida (Candida)；Filamentous fungi (Trichoderma reesia) (EP 244,234)；Neuraspora crassa (Neurospora crassa) (Case etc.,Proc.Natl.Acad.Sci.USA 76：5259-5263(1979))；Perhaps all so prosperous yeast (Schwanniomycesoccidentalis) of prosperous saccharomyces (Schwanniomyces) (EP 394,538, October 31 nineteen ninety is open)；With filamentous fungi such as Neurospora (Neurospora), Penicillium (Penicillium), Tolypocladium (Tolypocladium) (WO91/00357, on January 10th, 1991 is open) and aspergillus (Aspergillus) host aspergillus nidulans (A.nidulans) (Balance etc.Biochem.Biophys.Res.Commun.112：284-289(1983)；Tilburn etc.,Gene 26：205-221(1983)；Yelton etc.,Proc.Natl.Acad.Sci. USA 81：1470-1474 (1984)) and aspergillus niger (A.niger) (Kelly and Hynes,EMBO J.4：475-479(1985)).Methylotrophic yeast (Methylotropic yeast) be suitable to the present invention, include but is not limited to can be grown on methanol, selected from the yeast of subordinate：Hansenula anomala category (Hansenula), candida (Candida), gram Le kirschner saccharomyces (Kloeckera), pichia category (Pichia), saccharomyces (Saccharomyces), Torulopsis (Torulopsis) and Rhodotorula (Rhodotorula).C.Anthony, TheBiochemistry of Methylotrophs, 269 (1982) are can be found in as the specific species list of the example of this kind of yeast.

Multicellular organisms are derived from suitable for the host cell of the anti-RA1c antibody of expression glycosylation or RA1c polypeptides.The example of invertebral zooblast include insect cell such as drosophila S2 and noctuid Sf9, and plant cell such as cotton, corn, potato, soybean, petunia, tomato, tobacco cell culture..Many baculoviral strains and variant and the insect host cell allowed accordingly are identified, they are from hosts such as fall army worm Spodoptera frugiperda (caterpillar), Aedes aegypti Aedes aegypti (mosquito), aedes albopictus Aedes albopictus (mosquito), Drosophila melanogaster Drosophila melanogaster (drosophila) and silkworm Bombyx mori.The public, which can obtain a variety of Strain, to be used to transfect, such as autographa california (Autographa californica) NPV L-1 variants and silkworm (Bombyx mori) NPV Bm-5 strains, and this viroid can be used as this paper virus according to the present invention, particularly for transfecting Spodopterafrugiperda cells.

However, it is most interested to vertebrate cells, and have become old process by culture (tissue cultures) vertebrate cells to breed.The example of useful mammalian host cell line is the monkey kidney CV1 systems (COS-7, ATCC CRL 1651) converted with SV40；Human embryonic kidney cell line (293 or 293 cells that are subcloned for the growth in the culture that suspends, Graham etc., 1977, J.Gen Virol.36：59)；Baby hamster kidney cell (BHK, ATCC CCL 10)；Chinese hamster ovary cell/- DHFR (CHO, Urlaub etc., 1980, Proc.Natl.Acad.Sci.USA 77：4216)；Mouse Sai Tuoli (sertoli) cell (TM4, Mather, 1980, Biol.Reprod.23：243-251)；MK cells (CV1, ATCC CCL 70)；African green monkey kidney cell (VERO-76, ATCC CRL-1587)；Human cervical carcinoma cell (HELA, ATCC CCL 2)；MDCK (MDCK, ATCC CCL 34)；Ox mouse (buffalo rat) liver cell (BRL 3A, ATCC CRL 1442)；Human pneumonocyte (W138, ATCC CCL 75)；Human liver cell (Hep G2, HB 8065)；Mouse mammary tumor (MMT 060562, ATCC CCL 51)；TRI cells (Mather etc., 1982, Annals N.Y.Acad.Sci.383：44-68)；MRC5 cells；FS4 cells；With people's hepatoma system (Hep G2).

Host cell is converted with the above-mentioned expression generated for anti-RA1c antibody or RA1c polypeptides or cloning vector, and is cultivated in for evoked promoter, the conventional nutrient culture for selecting transformant or the gene of amplification coding expectation sequence and appropriately adjusting.

3. the selection of replicating vector and use

Nucleic acid (such as cDNA or genomic DNA) the insertion replicating vector for encoding anti-RA1c antibody or RA1c polypeptides can be used to clone (DNA cloning) or expression.Variety carrier is publicly available.Carrier can be such as plasmid, clay, virion or the form of bacteriophage.Can be by a variety of methods by suitable nucleotide sequence insertion vector.Generally, DNA is inserted to suitable restriction endonuclease sites using techniques known in the art.Support element typically includes, but not limited to following one or more：Signal sequence, replication orgin, one or more marker gene, enhancer element, promoter and transcription terminator.The structure of suitable carrier comprising these one or more components uses standard ligation techniques known to technical staff.

RA1c polypeptides not only can directly recombinant production, and can be as the fused polypeptide with heterologous polypeptide, the heterologous polypeptide can be the signal sequence or other polypeptides for having specific cleavage site in the N- ends of mature protein or polypeptide.Generally, signal sequence can be the component of carrier, or it can be the DNA for encoding anti-RA1c antibody or RA1c polypeptides of an insertion vector part.Signal sequence can be prokaryotic signal sequence, selected from such as alkaline phosphatase, penicillase, lpp or heat-staple enterotoxin II leaders.For yeast secretary, signal sequence can be that for example yeast invertase leader, α factor leaders (include α-factor leaders of sugar yeast and kluyveromyces, the latter sees United States Patent (USP) 5,010, or the signal described in acid phosphatase leader, Candida albicans glucoamylase targeting sequencing (EP 362,179 disclosed in April 4 nineteen ninety) or WO 90/13646 disclosed in 15 days November nineteen ninety 182).In mammalian cell expression, mammalian signal sequences can be used to instruct the secretion of protein, such as signal sequence from identical or relative species secreted polypeptides, and viral secretory leaders.

Expression and cloning vector are all comprising the nucleotide sequence that carrier can be made to be replicated in the host cell of one or more selection.It is known that such sequence of various bacteria, yeast and virus.Replication orgin from pBR322 plasmid is suitable for most of gramnegative bacteriums, 2 μ plasmid origins are suitable for yeast, and various viral origins (SV40, polyomavirus, adenovirus, VSV or BPV) are available for the cloning vector in mammalian cell.

Expression and cloning vector will generally include Select gene, also referred to as selection marker.Typical Select gene encodes following protein：(a) antibiotic or other toxin resistances, such as ampicillin, neomycin, methotrexate (MTX) or tetracycline are assigned；(b) auxotrophy is supplied；Or (c) provides the critical nutrients that can not be obtained by complex medium, such as encodes the gene of bacillus D-alanine racemase.

An example suitable for the selection marker of mammalian cell is the selection marker of the cell for the nucleic acid that can identify the have the ability anti-RA1c antibody of intake coding or RA1c polypeptides, such as DHFR or thymidine kinase.When using wild type DHFR, suitable host cell is the Chinese hamster ovary celI system of DHFR active defects, and it is prepared and breeding such as Urlaub,Proc.Natl.Acad.Sci.USA77：4216 (1980) are described.It is trp1 genes (Stinchcomb etc., 1979, Nature 282 for being present in yeast plasmid YRp7 suitable for the Select gene of yeast：39；Kingsman etc., 1979,Gene7：141；Tschemper etc., 1980,Gene 10：157).Trp1 bases are in default of the yeast mutant of the growth ability in tryptophan, and such as ATCCNo.44076 or PEP4-1 provide selection marker (Jones, 1977, Genetics 85：12).

Expression and cloning vector generally comprise the promoter that is operatively connected with the nucleotide sequence of the anti-RA1c antibody of coding or RA1c polypeptides to instruct mRNA to synthesize.The promoter recognized by a variety of potential host cells is well-known.Suitable for prokaryotic hosts promoter include beta-lactamase and lactose promoter system (Chang etc.,Nature 275：615(1978)；Goeddel etc.,Nature 281：544 (1979)), alkaline phosphatase, tryptophan (trp) promoter systems (Goeddel,Nucleic acids Res.8：4057(1980)；EP36,776) and hybrid promoter tac promoters (deBoer etc.,Proc.Natl.Acad.Sci.USA 80：21-25(1983)).Promoter for bacterial system is also by comprising with encoding Shine-Dalgarno (S.D.) sequence that the DNA of anti-RA1c antibody or RA1c polypeptides is operatively connected.

Suitable for yeast host promoter sequence example include glycerol 3-phosphate acid kinase (Hitzeman etc.,J.Biol.Chem.255：2073 (1980)) or other glycolytic ferments (Hess etc.,J.Adv.Enzyme Reg.7：149(1968)；Holland,Biochemistry17：4900 (1978)) promoter, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, GPI, 3-phoshoglyceric acid mutase, pyruvate kinase, phosphotriose isomerase, glucose phosphate isomerase and glucokinase.

It is the promoter region of the enzyme of alcohol dehydrogenase 2, different cell pigment C, acid phosphatase, the digestive enzyme relevant with nitrogen metabolism, metallothionein, glyceraldehyde-3-phosphate dehydrogenase and responsible maltose and galactose utilization as other Yeast promoters of the inducible promoter with the additional advantage that transcription is controlled by growth conditions.EP 73,657 is further described in suitable for the carrier and promoter of Yeast expression.

Anti- RA1c antibody or RA1c polypeptides are transcribed by for example by viral such as polyomavirus by carrier in mammalian host cell, fowlpox virus (UK 2 disclosed in 5 days July in 1989, 211, 504), adenovirus (such as adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, retrovirus, the promoter that hepatitis B and simian virus 40 (SV40) genome are obtained, by heterologous mammal promoter such as actin promoter or immunoglobulin promoter, and by the control of heat-shock promoters, if if such promoter is compatible with host cell systems.

Transcription of the higher eucaryotic cells to the anti-RA1c antibody of coding or the DNA of RA1c polypeptides can be improved by inserting enhancer sequence in the carrier.Enhancer is DNA cis-acting elements, and generally about 10 to 300bp, acts on promoter to increase transcription.Known many enhancer sequences from mammalian genes (globulin, elastoser, albumin, α-fetoprotein and insulin).However, usually using the enhancer from eukaryotic cell virus.Example includes enhancer (bp 100-270), the sub- enhancer of cytomegalovirus early promoter, the enhancer and adenovirus cancers of polyomavirus replication orgin late period side of SV40 replication orgins late period side.Enhancer can be with montage into carrier, positioned at 5 ' or 3 ' positions of anti-RA1c antibody or RA1c polypeptid coding sequences, it is preferred that positioned at 5 ' sites of promoter.

Expression vector for eukaryotic host cell (yeast, fungi, insect, plant, animal, people or karyocyte from other multicellular organisms) will also be comprising terminating transcription and sequence necessary to stable mRNA.Such sequence can generally be obtained by 5 ' ends of eucaryon or viral DNA or cDNA non-translational regions with 3 ' ends once in a while.These regions are included in the nucleotide segment that polyadenylated fragments are transcribed into the untranslated part for the mRNA for encoding anti-RA1c antibody or RA1c polypeptides.

It is adapted to synthesize anti-RA1c antibody in recombinant vertebrate cell culture after change or other methods, carrier and the host cell of RA1c polypeptides is shown in Gething etc., Nature 293：620-625(1981)；Mantei etc., Nature 281：40-46(1979)；EP 117,060；With EP 117,058.

4. cultivate host cell

The host cell for generating anti-RA1c antibody of the invention or RA1c polypeptides can be cultivated in a variety of culture mediums.Commercially available culture medium such as HamShi F10 (Sigma), minimum essential medium (MEM, Sigma), the EagleShi culture mediums (DMEM, Sigma) of RPMI-1640 (Sigma) and DulbeccoShi improvement are suitable to culture host cell.Further, it is possible to use the culture medium of any culture medium described in following documents as host cell：Ham etc., 1979, Meth.Enz.58：44；Barnes etc., 1980, Anal.Biochem.102：255；United States Patent (USP) 4,767,704；4,657,866；4,927,762；4,560,655；Or 5,122,469；WO 90/03430；WO 87/00195；Or U.S.Patent Re.30,985.These any culture mediums can hormone supplemented or other growth factors (such as insulin, transferrin or EGF), salt (such as sodium chloride, calcium, magnesium and phosphate), buffer (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotic (such as GENTAMYCIN as needed^TMMedicine), trace element (being defined as the inorganic compound generally existed with the final concentration of micro-molar range) and glucose or the equivalent energy.Can also with debita spissitudo include those skilled in the art will know that any other required supplement.Condition of culture temperature, pH etc. had previously been selected for host cell for expression, and this is obvious for those of ordinary skill.

5. detect gene magnification/expression

The amplification or expression of gene can direct measurements in the sample, for example according to provided herein is sequence, using suitable label probe, by conventional Southern traces, quantitative Northern traces (Thomas, Proc.Natl.Acad.Sci.USA 77 is transcribed to mRNA：5201-5205 (1980)), point trace (DNA analysis) or in situ hybridization.Or, can be using the antibody of specific duplex can be recognized, the duplex includes DNA duplex, RNA duplexs and DNA-RNA hybrid duplexes or DNA- protein duplexes.Then can labelled antibody, and can be measured method, wherein duplex is attached on surface so that when duplex is formed on the surface, the presence of the detectable antibody combined with duplex.

Or, in order to which the expression directly to gene outcome is quantified, the determination method of gene expression, such as immunohistochemical staining of cell or tissue section and cell culture or body fluid can be measured by immunological method.It can be monoclonal or polyclonal available for immunohistochemical staining or the antibody of sample liquids determination method, and can be prepared in any mammal.It is expedient to, can for native sequences RA1c polypeptides or for based on provided herein is DNA sequence dna synthetic peptide or for merging with RA1c polypeptid DNAs and the exogenous array of encoding particular antibodies epitope prepares antibody.

6. the anti-RA1c antibody of purifying and RA1c polypeptides

Various forms of anti-RA1c antibody and RA1c polypeptides can be reclaimed from nutrient solution or from host cell lysats.If film combination, then suitable detergent solution (such as Triton-X100) can be used or it is discharged from film by enzymatic lysis.Cell employed in anti-RA1c antibody and RA1c expression of polypeptides can be ruptured by a variety of physically or chemically means, such as Frozen-thawed cycled, ultrasonically treated, mechanical disruption or cell lytic agent.

It may be desirable to from recombinant cell protein matter or the anti-RA1c antibody of peptide purification and RA1c polypeptides.Following flow is the illustration of appropriate purification flow：Classification on ion exchange column；Ethanol precipitation；Reversed-phase HPLC；Chromatography on tripoli or cationic ion-exchange resin such as DEAE；Chromatofocusing；SDS-PAGE；Ammonium sulfate precipitation；Use such as Sephadex G-75 gel filtration；Albumin A Sepharose posts are to remove pollutant such as IgG；And combine the metal chelating column of the epitope tagged forms of anti-RA1c antibody and RA1c polypeptides.Multiple proteins purification process can be used, such method is known in the art, and is described in such as Deutscher,Methods in Enzymology, 182 (1990)；Scopes,Protein Purification：Principes and Practice, Springer-Verlag, New York (1982).The selection of purification step is by depending on the property of generation method for example used and produced specific anti-RA1c antibody or RA1c polypeptides.

When using recombinant technique, can in the cell, antibody is generated in periplasmic space, or be directly secreted into culture medium.If generating antibody in the cell, then as the first step, the particle debris of host cell or crack fragment is removed for example, by centrifugation or ultrafiltration.Carter etc., Bio/Technology 10：163-167,1992 describe the flow of the antibody for being secreted into colibacillus periplasm space.Briefly, cell paste is made to melt when there is sodium acetate (pH 3.5), EDTA and phenylmethylsulfonyl fluoride (PMSF) about 30 minutes.Cell fragment can be removed by centrifugation.If by antibody-secreting into culture medium, then generally first by commercialization protein concentration filter, such as supernatant of the Amicon or Millipore Pellicon ultra filtration units concentration from such expression system.In any above-mentioned steps, protease inhibitors such as PMSF can be included to suppress proteolysis, and antibiotic can be included to prevent the growth of external contaminant.

Such as hydroxyapatite, gel electrophoresis, dialysis and affinity chromatography can be used to purify the antibody compositions prepared by cell, purification technique preferably is affinity chromatography.Albumin A depends on the species and isotype of any immunoglobulin fc region present in antibody as the suitability of affinity ligand.Albumin A can be used for purifying antibody (Lindmark etc., 1983, J.Immunol.Meth.62 based on people γ 1, γ 2 or the heavy chains of γ 4：1-13).Protein G recommends to be used for all mouse isotypes and people γ 3 that (Guss etc., 1986, EMBO J.5：1567-1575).Matrix accompanying by affinity ligand is most commonly used that agarose, but can use other matrix.The matrix of physically stable such as controlled pore glass or poly- (styrene divinyl) benzene result in flow velocity more faster than agarose and shorter process time.For including C_HFor the antibody of 3 domains, Bakerbond ABX can be used^TMResin (J.T.Baker, Phillipsburg, NJ) is purified.According to antibody to be recycled, it is possible to use the classification separation on other oroteins purification technique, such as ion exchange column, ethanol precipitation, reversed-phase HPLC, the chromatography on tripoli, heparin SEPHAROSE^TMOn chromatography, anion or cationic ion-exchange resin (such as poly-aspartate post) on chromatography, chromatofocusing, SDS-PAGE and ammonium sulfate precipitation.

After any preliminary purification step, the mixture comprising purpose antibody and pollutant can use pH about 2.5-4.5 elution buffer, preferably carry out low pH hydrophobic interaction chromatographies in low salt concn (e.g., from about 0-0.25M salt).

Nucleic acid -- concrete form and the application of J.RA1c polypeptides and coding RA1c polypeptides

The nucleotide sequence (or its complementary series) of coding RA1c polypeptides has a variety of applications in biology field, including as hybridization probe, for chromosome and gene mapping, and for generating antisense RNA and DNA probe.The nucleic acid of coding RA1c polypeptides can also be used to prepare RA1c polypeptides by recombinant technique described herein, and those in which RA1c polypeptides can be used for for example preparing anti-RA1c antibody described herein.

Total length native sequences RA1c polypeptide genes or part thereof can separate the other cDNA for having expectation sequence homogeneity with natural RA1c peptide sequences disclosed herein (such as cDNA of the naturally occurring variant of those coding RA1c polypeptides or the RA1c polypeptides from other species) as hybridization probe for cDNA library.It is optional that, the length of probe is about 20 to about 50 bases.Hybridization probe can the new region of at least part derived from total length native nucleotide sequence, those in which region need not excessively test and be assured that, or carry out the genome sequence of promoter, enhancer element and the introne of self-contained native sequences RA1c polypeptides.For example, screening technique will separate the code area of RA1c polypeptide genes including the use of known dna sequence to synthesize the selected probe of about 40 bases.Hybridization probe can use a variety of mark substance markers, including radioactive nucleotides, such as³²P or³⁵S, or enzyme marker, such as pass through avidin/biotin coupling system and the alkaline phosphatase of probe conjugate.Label probe with the complementary sequence of the sequence with RA1c polypeptide genes of the present invention can be used for screening people cDNA, genomic DNA or mRNA libraries to determine that probe and which member in such library hybridize.The following examples have described in more detail hybridization technique.Using method disclosed herein, any est sequence disclosed herein can similarly serve as probe.

Encoding other useful fragments of the nucleic acid of RA1c polypeptides includes antisense or has MODN, including can combine target RA1c polypeptides mRNA (having justice) or the single strand nucleotide sequence (RNA or DNA) of RA1c polypeptid DNAs (antisense) sequence.According to the present invention, antisense or the fragment for thering is MODN to include RA1cDNA code areas.Such fragment generally comprises at least about 14 nucleotides, preferably from about 14 to 30 nucleotides.Derive antisense according to the cDNA sequence of the given protein of coding or have the ability description of MODN in such as Stein and Cohen, Cancer Res.48：2659,1988 and van der Krol etc., BioTechniques 6：958,1988.

Antisense or the combination for having MODN and target nucleic acid sequence cause the formation of duplex, and it blocks the transcription or translation of target sequence by one of multiple means, and the means include the premature end or other means of degraded enhancing, transcription or the translation of duplex.Such method covers in the present invention.ASON is therefore available for RA1c protein expressions are blocked, wherein the RA1c protein may play induced cancer in mammal.Antisense has MODN also to include the oligonucleotides with sugar-phosphodiester backbone (or other sugared keys (linkage), such as described in WO 91/06629) by modification, and wherein such sugared key is resistant to endogenous nuclease.This class oligonucleotide of resistant sugared key is stable (can resist enzymatic degradation) in vivo, but remain can with reference to target nucleotide sequences sequence-specific.

Site includes the translation initiation codon (5 '-AUG/5 '-ATG) of incorporation gene open read frame (ORF) or the region of terminator codon (5 '-UAA, 5 '-UAG and 5-UGA/5 '-TAA, 5 '-TAG and 5 '-TGA) in the preferred gene combined for antisense.These regions refer to about 25 parts to about 50 contiguous nucleotides for covering the either direction (i.e. 5 ' or 3 ') from translation initiation or terminator codon in mRNA or gene.The other favored areas combined for antisense include：Introne；Extron；Intron-exon junction；Region between open read frame (ORF) or " code area ", i.e. translation initiation codon and translation termination codon；MRNA 5 ' caps, it is included methylates G residue, including 5 ' caps itself and preceding 50 nucleotides adjacent with cap via N7- of 5 ' -5 ' triphosphoric acid key and mRNA most 5 ' end residues connections；In 5 ' non-translational regions (5 ' UTR), i.e. mRNA from translation initiation codon 5 ' directions part, therefore including the corresponding nucleotide on the nucleotides or gene in mRNA between 5 ' capsites and translation initiation codon；With 3 ' non-translational regions (3 ' UTR), i.e. in mRNA from translation termination codon 3 ' directions part, therefore including the corresponding nucleotide on the nucleotides or gene between translation termination codon in mRNA and 3 ' ends.

Specific example available for the preferred antisense compounds for suppressing RA1c expression of polypeptides is included comprising the oligonucleotides through modifying key between skeleton or non-natural nucleoside.With through modify skeleton oligonucleotides include those retain in skeleton phosphorus atoms and those there is no the oligonucleotides of phosphorus atoms in skeleton.For the purpose of this specification, and sometimes refer in the art, the modified oligonucleotides for not having phosphorus atoms in its intemucleoside backbone are also believed to oligonucleotides.It is preferred that modified oligonucleotides skeleton include thiophosphate for example with normal 3 ' -5 ' key, chiral phosphorothioates, phosphorodithioate, phosphotriester, the ester of aminoalkyl three (aminoalkylphosphotriester), methyl and other alkyl phosphonates include 3 '-alkylene phosphonate ester (3 '-alkylene phosphonate), 5 '-alkylene phosphonate ester (5 '-alkylenephosphonate) and chiral phosphonate, phosphite ester, phosphoramidate includes 3 '-amino phosphoramidate (3 '-amino phosphoramidate) and ammonia hydrocarbylamino phosphate (aminoalkylphosphoramidate), thion phosphoramidate (thionophosphoramidate), thion alkyl phosphonate (thionoalkylphosphonate), the ester of thion hydrocarbyl phosphate three (thionoalkylphosphotriester), phosphoroselenoate (selenophosphate) and brominated phosphate (borano-phosphate), their 2 ' -5 ' connection analog, and those have the analog of reversed polarity, key is 3 ' to 3 ' between wherein one or more nucleotides, 5 ' to 5 ', or 2 ' to 2 ' keys.Preferred oligonucleotides with reversed polarity key between most 3 ' terminal nucleotides includes single 3 ' to 3 ' key, you can be the single reverse nucleotide residues of no base (core base lack or with hydroxyl replaced).In the form of a variety of salt, salt-mixture and free acid is also included within.The representative United States Patent (USP) of the preparation of phosphorous key is instructed to include but is not limited to United States Patent (USP) 3,687,808；4,469,863；4,476,301；5,023,243；5,177,196；5,188,897；5,264,423；5,276,019；5,278,302；5,286,717；5,321,131；5,399,676；5,405,939；5,453,496；5,455,233；5,466,677；5,476,925；5,519,126；5,536,821；5,541,306；5,550,111；5,563,253；5,571,799；5,587,361；5,194,599；5,565,555；5,527,899；5,721,218；5,672,697；With 5,625,050, each single item is taken in herein and is used as reference.

Wherein the preferred modified oligonucleotides skeleton without phosphorus atoms has the skeleton that key is formed between short-chain hydrocarbon group or cyclic hydrocarbon radical nucleoside bond, mixing hetero atom and alkyl or cyclic hydrocarbon radical nucleoside bond or one or more short chain heteroatomics or heterocycle nucleosides.These, which include those, has morpholino key (partly being formed by the sugar moieties of nucleosides)；Siloxane backbone；Sulfide, sulfoxide and sulfone skeleton；Formoxyl (formacetyl) and thioformyl (thioformacetyl) skeleton；Methylene formacetyl (formacetyl) and thioformyl (thioformacetyl) skeleton；Riboacetyl skeleton；Skeleton containing alkene；Sulfamate (sulfamate) skeleton；Methylene imino group and methylene diazanyl (methylenehydrazino) skeleton；Sulphonic acid ester and sulfonamide (sulfonamide) skeleton；Amide backbone；And it is other with mixing N, O, S and CH₂The skeleton of part.The representative United States Patent (USP) of the preparation of this class oligonucleotide is instructed to include but is not limited to United States Patent (USP) 5,034,506；5,166,315；5,185,444；5,214,134；5,216,141；5,235,033；5,264,562；5,264,564；5,405,938；5,434,257；5,466,677；5,470,967；5,489,677；5,541,307；5,561,225；5,596,086；5,602,240；5,610,289；5,602,240；5,608,046；5,610,289；5,618,704；5,623,070；5,663,312；5,633,360；5,677,437；5,792,608；5,646,269；With 5,677,439, each single item is taken in herein and is used as reference.

In other preferred ASONs, the sugar and nucleoside bond of nucleotide units, i.e. skeleton use new substituent group.Base units are kept with suitable nucleic acid target compound to hybridize.Have shown that such a oligomeric compounds with remarkable hybrid trait, i.e. oligonucleotide mimetic, referred to as peptide nucleic acid (PNA).In PNA compounds, the sugared skeleton of oligonucleotides is replaced with amide containing skeleton, particularly aminoethylglycine backbone.Core base obtains retaining and directly or indirectly combines the aza nitrogen atom of framework amide part.The representative United States Patent (USP) of the preparation of PNA compounds is instructed to include but is not limited to United States Patent (USP) 5,539,082；5,714,331；With 5,719,262, each single item is taken in herein and is used as reference.More teachings of PNA compounds can be found in Nielsen etc., 1991, Science 254：1497-1500.

It is preferred that ASON be mixed with thiophosphate (phosphorothioate) skeleton or heteroatom backbones, particularly-CH₂-NH-O-CH₂-、-CH₂-N(CH₃)-O-CH₂- (being referred to as methylene (methyl-imino) or MMI skeletons) ,-CH₂-O-N(CH₃)-CH₂- ,-CH described in above-mentioned United States Patent (USP) 5,489,677₂-N(CH₃)-N(CH₃)-CH₂- and-O-N (CH₃)-CH₂-CH₂- (wherein natural phosphodiester skeleton representation is-O-P-O-CH₂-) and above-mentioned United States Patent (USP) 5,602,240 amide backbone.The ASON with morpholino backbone structures of above-mentioned United States Patent (USP) 5,034,506 is also preferred.

Oligonucleotides through modification can also include the sugared module of one or more substitutions.It is preferred that oligonucleotides in 2 ' positions comprising one of following：OH；F；O- alkyl, S- alkyl, or N- alkyl；O- alkenyls, S- alkenyls, or N- alkenyls；O- alkynyls, S- alkynyls, or N- alkynyls；Or O- alkyl-O- alkyl, wherein alkyl, alkenyl and alkynyl can be substituted or unsubstituted C₁To C₁₀Alkyl or C₂To C₁₀Alkenyl and alkynyl.Particularly preferably O [(CH₂)_nO]_mCH₃、O(CH₂)_nOCH₃、O(CH₂)_nNH₂、O(CH₂)_nCH₃、O(CH₂)_nONH₂And O (CH₂)_nON[(CH₂)_nCH₃)]₂, wherein n and m are 1 to about 10.Other preferred ASONs are in 2 ' positions comprising one of following：C₁To C₁₀Lower alkyl, substituted lower alkyl, alkenyl, alkynyl, hetero atom, aryl, O- hetero atoms or O- aryls, SH, SCH₃, OCN, Cl, Br, CN, CF₃, OCF₃, SOCH₃, SO₂CH₃, ONO₂, NO₂, N₃, NH₂Heterocycle alkyl, heterocycle hetero atom, ammonia hydrocarbylamino (aminoalkylamino), poly- hydrocarbylamino (polyalkylamino), substituted silicyl, RNA cutting groups (cleaving group), reporter group (reporter group), intercalator, for the group for the pharmacokinetics for improving oligonucleotides, or for the group for the pharmacodynamic properties for improving nucleotides, and other substituents with similar quality.It is preferred that modification include 2 '-methoxy ethoxy (2 '-O-CH₂CH₂OCH₃, also referred to as '-O- (2- methoxy ethyls) or 2 '-MOE) and (Martin etc., 1995, HeIv.Chim.Acta 78：486-504) it is oxyl oxyl (alkoxyalkoxy).Further preferred modification includes 2 '-dimethylaminooxyethoxy, i.e. O (CH₂)₂ON(CH₃)₂Group, also referred to as 2 '-DMAOE, described in following article embodiment, and 2 '-Dimethylaminoethoxy ethyoxyl (this area is also referred to as 2 '-O- Dimethylaminoethoxies ethyls or 2 '-DMAEOE), i.e. 2 '-O- (CH₂)₂-O-(CH₂)₂-N(CH₃)₂。

Further preferred modification includes locked nucleic acid (Locked Nucleic Acid, LNA), wherein 2 '-hydroxyl is connected with 3 ' or 4 ' carbon atoms of sugared ring, is consequently formed bicyclic sugared module.The key is preferably methylene (methelyne) (- CH of the oxygen atom of bridge joint 2 ' and 4 ' carbon atoms₂-)_nGroup, wherein n are 1 or 2.LNA and its preparation are referring to WO 98/39352 and WO 99/14226.

Other preferred modifications include 2 '-methoxyl group (2 '-O-CH₃), 2 '-ammonia propoxyl group (2 '-OCH₂CH₂CH₂NH₂), 2 '-pi-allyl (2 '-CH₂- CH=CH₂), 2 '-O- pi-allyls (2 '-O-CH₂- CH=CH₂) and 2 '-fluorine (2 '-F).2 '-modification can be in arabinose (arabino) (on) position or ribose (ribo) (under) position.It is preferred that 2 '-arabinose modification be 2 '-F.Also other positions that can be on oligonucleotides carry out similar modification, the 3 ' sugared positions of particularly 3 ' terminal nucleotides or the 5 ' positions in the oligonucleotides of 2 ' -5 ' connection with 5 ' terminal nucleotides.Oligonucleotides can also have sugared analogies, such as with cyclobutyl module substituted furan pentose base (pentofuranosyl) sugar.The representative United States Patent (USP) of the preparation of the such sugared structure by modification of teaching includes but is not limited to United States Patent (USP) 4,981,957；5,118,800；5,319,080；5,359,044；5,393,878；5,446,137；5,466,786；5,514,785；5,519,134；5,567,811；5,576,427；5,591,722；5,597,909；5,610,300；5,627,053；5,639,873；5,646,265；5,658,873；5,670,633；5,792,747；With 5,700,920, complete income each single item is used as reference herein.

Oligonucleotides may also include core base (in the art often referred to simply as " base ") modification or substitute.As used herein, " unmodified " or " naturally " core base include purine base adenine (A) and guanine (G), and pyrimidine base thymine (T), cytimidine (C) and uracil (U).Core base by modification includes other synthesis and natural core base, such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenines, the 6- methyl and other alkyl derivatives of adenine and guanine, the 2- propyl group and other alkyl derivatives of adenine and guanine, 2- thiouracils, 2- sulphur thymidine and 2- sulphur cytimidines, 5- halo uracils and cytimidine, other alkynyl derivatives of 5- propinyls (- C ≡ C-CH3 or-CH2-C ≡ CH) uracil and cytimidine and pyrimidine bases, 6- azos (azo) uracil, cytimidine and thymidine, 5- uracils (pseudouracil), 4- thiouracils, 8- halos, 8- amino, 8- sulfydryls (thiol), the thio alkyl of 8- (thioalkyl), 8- hydroxyls and the adenine and guanine of other 8- substitutions, 5- halos particularly 5- bromines, 5- trifluoromethyls and the uracil and cytimidine of other 5- substitutions, 7- methyl guanines and 7- methyl adenines, 2-F- adenines, 2- amino-adenines, guanozola and 8- azaadenines, 7- deazaguanines and 7- denitrogenations adenine and 3- deazaguanines and 3- denitrogenation adenines.The core base further modified includes tricyclic pyrimidine, such as phenoxazine cytidine (1H- pyrimidines [5, 4-b] [1, (3H) -one of 4] Ben Bing oxazines -2), phenthazine cytidine (1H- pyrimidines [5, 4-b] [1, 4] phenylpropyl alcohol thiazine -2 (3H) -one), G- clamp rings (G-clamp) such as replace phenoxazines cytidine (such as 9- (2- amino ethoxies)-H- pyrimidines [5, 4-b] [1, (3H) -one of 4] Ben Bing oxazines -2), carbazole cytidine (2H- pyrimidines [4, 5-b] indol-2-one), pyridine diindyl cytidine (H- pyridines [3 ', 2 '：4,5] pyrroles [2,3-d] pyrimid-2-one).Core base through modification may also include those wherein other heterocycles of purine or pyrimidine bases, the core base that such as 7- denitrogenations-adenine, 7- deazaguanines, PA and 2- pyridones replace.More core bases include those disclosed in United States Patent (USP) 3,687,808；The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.L, ed.John Wiley ＆ Sons, those disclosed in 1990；With Englisch etc., Angewandte Chemie, International Edition, those disclosed in 1991,30,613.Some of these core bases are particularly useful in enhancing the binding affinity of oligomeric compounds of the present invention.These include the purine of the pyrimidine that 5- replaces, 6- aza-pyrimidines and N-2, N-6 and O-6 substitution, including 2- aminopropyl adenines, 5- propynyluracils and 5- propynylcytosines.5-methylcytosine substitution has shown that improves 0.6-1.2 DEG C of (Sanghvi etc. by the stability of nucleic acid duplex, AntisenseResearch and Applications, CRC Press, Boca Raton, 1993, pp.276-278) and be preferred base substitution, it is more preferred or even when with the sugar-modified combination of 2 '-O- methoxy ethyls.The representative United States Patent (USP) of the preparation through modifying core base is instructed to include but is not limited to United States Patent (USP) 3,687,808, and United States Patent (USP) 4,845,205；5,130,302；5,134,066；5,175,273；5,367,066；5,432,272；5,457,187；5,459,255；5,484,908；5,502,177；5,525,711；5,552,540；5,587,469；5,594,121,5,596,091；5,614,617；5,645,985；5,830,653；5,763,588；6,005,096；5,681,941；With 5,750,692, each single item is taken in herein and is used as reference.

The one or more modules or conjugate (conjugate) that another modification of ASON involves activity, cell distribution or cellular uptake by oligonucleotides is improved are chemically bonded to oligonucleotides.The compound of the present invention can include the coupling group (conjugate group) being covalently attached with functional group such as primary hydroxyl or secondary hydroxyl.The coupling group of the present invention includes intercalator, reporter molecule, polyamines, polyamide, polyethylene glycol, polyethers, the group for improving oligomer pharmacodynamic properties and the group for improving oligomer pharmacokinetics.Typical coupling group includes cholesterol, lipid, cation lipid, phosphatide, cationic phospholipid, biotin, azophenlyene, folic acid (folate), phenanthridines, anthraquinone, acridine, fluorescein, rhodamine, cumarin and dyestuff.In present disclosure, improving the group of pharmacodynamic properties includes improving oligomer intake, improves oligomer to the resistance of degraded or enhancing and the group of RNA sequence specific hybridization.In present disclosure, the group that the group of pharmacokinetics includes improving oligomer intake, distribution, metabolism or excretion is improved.Conjugate module includes but is not limited to lipid moiety, cholesterol module (Letsinger etc., 1989, Proc.Natl.Acad.Sci.USA 86：6553-6556), cholic acid (Manoharan etc., 1994, Bioorg.Med.Chem.Let.4：1053-1060), thioether such as hexyl-S- trityls mercaptan (tritylthiol) (Manoharan, 1992, Ann.N.Y.Acad.Sci.660：306-309；Manoharan etc., 1993, Bioorg.Med.Chem.Let.3：2765-2770), thio cholesterol (Oberhauser etc., 1992, Nucl.Acids Res.20：533-538), (Saison-Behmoaras, 1991, EMBO J.10 such as dodecanediol or undecyl residues for aliphatic chain：1111-1118；Kabanov etc., 1990, FEBS Lett.259：327-330；Svinarchuk etc., 1993, Biochimie 75：49-54), phosphatide such as two-hexadecyl-rac-glycerol or triethyl group-ammonium 1,2- bis--O- hexadecyl-rac-glycerol -3-H- phosphonate esters (Manoharan etc., 1995, Tetrahedron Lett.36：3651-3654；Shea etc., 1990, Nucl.Acids Res.18：3777-3783), polyamines or polyglycol chain (Manoharan etc., 1995, Nucleosides ＆ Nucleotides 14：969-973), or acetic acid adamantane (Manoharan etc., 1995, Tetrahedron Lett.36：3651-3654), palmityl module (Mishra etc., 1995, Biochim.Biophys.Acta 1264：229-237), or octadecylamine or own amino-carbonyl-oxygen cholesterol module.The oligonucleotides of the present invention can be also coupled with active drug substance, such as aspirin (aspirin), warfarin (warfarin), bute (phenylbutazone), brufen (ibuprofen), suprofen (suprofen), fenbufen (fenbufen), Ketoprofen (ketoprofen), (S)-(+)-pranoprofen (pranoprofen), Carprofen (carprofen), red sulphonyl methyl amimoacetic acid (dansylsarcosine), 2, 3, 5- Triiodobenzoic acids, Flufenamic acid (flufenamic acid), folinic acid (folinic acid), benzothiadiazine (benzothiadiazide), chlorothiazide (chlorothiazide), phenodiazine grass is miscellaneous(diazepine), Indomethacin (indomethacin), barbiturate (barbiturate), cynnematin (cephalosporin), sulfa drug (sulfa drug), antidiabetic (antidiabetic), antimicrobial (antibacterial) or antibiotic.Oligonucleotides-drug conjugates and its preparation are referring to U.S. Application Serial 09/334,130 (submission on June 15th, 1999) and United States Patent (USP) 4,828,979；4,948,882；5,218,105；5,525,465；5,541,313；5,545,730；5,552,538；5,578,717,5,580,731；5,580,731；5,591,584；5,109,124；5,118,802；5,138,045；5,414,077；5,486,603；5,512,439；5,578,718；5,608,046；4,587,044；4,605,735；4,667,025；4,762,779；4,789,737；4,824,941；4,835,263；4,876,335；4,904,582；4,958,013；5,082,830；5,112,963；5,214,136；5,082,830；5,112,963；5,214,136；5,245,022；5,254,469；5,258,506；5,262,536；5,272,250；5,292,873；5,317,098；5,371,241,5,391,723；5,416,203,5,451,463；5,510,475；5,512,667；5,514,785；5,565,552；5,567,810；5,574,142；5,585,481；5,587,371；5,595,726；5,597,696；5,599,923；5,599,928；With 5,688,941, each single item is taken in herein and is used as reference.

Homogeneous modification need not be made to giving all positions in compound, incorporation exceedes a kind of above-mentioned modification at single nucleosides that in fact can be in single compound or even in oligonucleotides.

Present invention additionally comprises the antisense compounds as Chimeric compounds.In present disclosure, " chimeric " antisense compounds or " block polymer " refer to the antisense compounds for including two or more different areas in chemistry, particularly oligonucleotides, each area is made up of at least one monomeric unit, is nucleotides in the case of oligonucleotide compound.These oligonucleotides generally comprise at least one area, the resistance degraded to nuclease, the cellular uptake improved or the binding affinity to target nucleic acid improved that wherein oligonucleotides assigns the oligonucleotides to improve by modification.The further region of oligonucleotides may act as that RNA can be cut:DNA or RNA:The substrate of the enzyme of RNA heterocomplexs.For example, RNase H is cutting RNA:The cellular endonuclease of the RNA chains of DNA duplex.Therefore, RNase H activation causes the cutting to RNA target thing, thus greatly improves suppression efficiency of the oligonucleotides to gene expression.Therefore, when using chimeric oligonucleotide, compared with hybridizing in the thiophosphate deoxy-oligonucleotide of identical target area, suitable result is generally obtained with shorter oligonucleotides.The Chimeric antisense compounds of the present invention are formed as the composite construction of two or more oligonucleotides as described above, the oligonucleotides through modification, few nucleosides or oligonucleotide mimetic.It is preferred that Chimeric antisense oligonucleotides mixed in 3 '-end at least one 2 ' modification sugar (preferably 2 '-O- (CH₂)₂-O-CH₃) to assign nuclease resistant, and with least four be connected 2 '-H sugar region to assign RNase H activity.Such compound is also referred to as heterocomplex (hybrid) or binding element (gapmer) in this area.It is preferred that binding element (gapmer) by with least four be connected 2 '-H sugar at least one distinguish every 3 '-end and 5 ' ends have 2 ' modification sugar (preferably 2 '-O- (CH₂)₂-O-CH₃) area, and be preferably incorporated into phosphorothioate backbone key.The representative United States Patent (USP) of the preparation of such heterocomplex structure is instructed to include but is not limited to United States Patent (USP) 5,013,830；5,149,797；5,220,007；5,256,775；5,366,878；5,403,711；5,491,133；5,565,350；5,623,065；5,652,355；5,652,356；With 5,700,922, complete income each single item is used as reference herein.

Conventional it can be prepared conveniently and by well-known solid phase synthesis technique according to the antisense compounds that use of the present invention.There are many retailers to sell the equipment for such synthesis, including such as AppliedBiosystems (Foster City, Calif.).Additionally or alternatively, any other means known in the art for such synthesis can be used.It is known that preparing oligonucleotides, such as thiophosphate and hydrocarbylation derivative using similar techniques.The compound of the present invention can also mix with the mixture of other molecules, molecular structure or compound, it is encapsulated, be coupled or be otherwise associated to such as liposome, receptor target molecule, oral, rectum, local or other formulations to help to absorb, be distributed or absorb.The representative United States Patent (USP) of the such intake of teaching, distribution or the preparation for absorbing formulation auxiliary includes but is not limited to United States Patent (USP) 5,108,921；5,354,844；5,416,016；5,459,127；5,521,291；5,543,158；5,547,932；5,583,020；5,591,721；4,426,330；4,534,899；5,013,556；5,108,921；5,213,804；5,227,170；5,264,221；5,356,633；5,395,619；5,416,016；5,417,978；5,462,854；5,469,854；5,512,295；5,527,528；5,534,259；5,543,152；5,556,948；5,580,575；With 5,595,756, each single item is taken in herein and is used as reference.

Other examples of sense or antisense oligonucleotides include those and organic module, those described in such as WO90/10048, and improve other modules of the oligonucleotides to the affinity of target nucleic acid sequence, the oligonucleotides that such as poly- (1B) is covalently attached.Moreover, intercalator, such as ellipticine (ellipticine) and alkylating agent or metal complex can be attached to sense or antisense oligonucleotides to adjust antisense or have binding specificity of the MODN to target nucleotide sequences.

Can be by the way that any gene transfer method is by antisense or has MODN to import the cell for including target nucleic acid sequence, including such as CaPO₄The DNA transfections of mediation, electroporation or viral (Epstein-Barr virus) by using gene transfer vector such as angstrom bar Er Shi.In a kind of preferred flow, by antisense or there is MODN to insert suitable retroviral vector.Make the cell comprising target nucleic acid sequence in vivo or ex vivo contact recombinant retroviral vector.Suitable retroviral vector include but is not limited to those be derived from mouse retrovirus M-MuLV those, N2 (retrovirus for being derived from M-MuLV), or it is named as DCT5A, DCT5B and DCT5C double copy carriers (see WO 90/13641).

Also the cell for including target nucleotide sequences can be imported by with ligand binding molecules formation conjugate by sense or antisense oligonucleotides, as described in WO 91/04753.Suitable ligand binding molecules include but is not limited to cell surface receptor, growth factor, other cell factors or the other parts for combining cell surface receptor.Preferably, do not disturb the ligand binding molecules to combine the ability of its corresponding molecule or acceptor substantially to the coupling of ligand binding molecules or block sense or antisense oligonucleotides or its conjugate pattern to enter cell.

Or, can be by forming the cell that the importing of sense or antisense oligonucleotides is included target nucleic acid sequence by oligonucleotides-lipid complex, as described in WO 90/10448.Sense or antisense oligonucleotides-lipid complex is preferably dissociated by endogenous lipase in the cell.

Antisense or the length for having adopted RNA or DNA molecular are typically at least about 5 nucleotides,Or length is at least about 6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,35,40,45,50,55,60,65,70,75,80,85,90,95,100,105,110,115,120,125,130,135,140,145,150,155,160,165,170,175,180,185,190,195,200,210,220,230,240,250,260,270,280,290,300,310,320,330,340,350,360,370,380,390,400,410,420,430,440,450,460,470,480,490,500,510,520,530,540,550,560,570,580,590,600,610,620,630,640,650,660,670,680,690,700,710,720,730,740,750,760,770,780,790,800,810,820,830,840,850,860,870,880,890,900,910,920,930,940,950,960,970,980,990,Or 1000 nucleotides,Term " about " refers to the nucleotide sequence length and adds deduct the 10% of the length wherein in this content.

Also probe can be used to round pcr produce the sequence pond for identifying closely related RA1c polypeptid coding sequences.

The nucleotide sequence of coding RA1c polypeptides can also be used to build hybridization probe, for the gene mapping for encoding the RA1c polypeptides and for making genetic analysis to the individual for suffering from genetic disorder.Can be used known technology by provided herein is nucleotide sequence be positioned at chromosome and specific chromosome regions, such as in situ hybridization, the linkage analysis for known chromosome marker and the hybridization for screening library.

The other oroteins or molecule for the binding interactions for participating in occurring with RA1c polypeptides can be identified using RA1c polypeptides in determination method.Pass through such method, it is possible to identify the mortifier of receptor/ligand binding interactions.The protein for participating in such binding interactions can be additionally used in the peptide or little molecules in inhibiting thing for screening binding interactions.The screening test method can be designed with the leading compound for the biological activity for finding to simulate natural RA1c polypeptides or RA1c polypeptide receptors.Determination method including adapting to high flux screening chemistry library is make them particularly suitable for use in identification small molecule drug candidates by such the screening test method.Contemplated small molecule includes the organic or inorganic compound of synthesis.Method, including protein-protein binding assay, biochemistry the screening test method, immunoassay and the determination method based on cell that this area has been characterized very well can be measured in a variety of forms.

The nucleic acid or its modified forms for encoding RA1c polypeptides can be additionally used in generation transgenic animals or " knockout " animal, and they then can be used for exploitation and the upper useful reagent of screening treatment.Transgenic animals (such as mouse or rat) refer to the animal with the cell comprising transgenosis, wherein transgenosis is imported into animal or antenatal animal precursor (ancestor), such as embryo stage.Transgenosis refers to the DNA being incorporated into the genome for the cell for developing into transgenic animals.In one embodiment, the genomic DNA of RA1c polypeptides can be encoded with the cDNA clone of coding RA1c polypeptides according to the technology set up, and be used to the genome sequence generate transgenic animals, the transgenic animals encode the DNA of RA1c polypeptides cell comprising expression.For generating transgenic animals, particularly the method for the animal such as mouse or rat has been conventional in this area, see, for example, United States Patent (USP) 4,736,866 and 4,870,009.Generally, the incorporation for making RA1c polypeptide transgenics with tissue-specific enhancer targets specific cells.The effect that the transgenic animals of the transgene copies of the coding RA1c polypeptides of animal germline can be used for the DNA expression of test code RA1c polypeptides to improve is imported included in embryo stage.Such animal can be used to test as test animal to be thought for being for example overexpressed the reagent that relevant pathological condition assigns protection with it.According to this aspect of the present invention, with the preparation for treating animal, the incidence of disease of pathological condition declines the potential therapeutic intervention that will indicate that to the pathological condition compared with the untreated animal of carry genetic modification.

Or, the non-human homologue of RA1c polypeptides can be used for building RA1c genes " knockout " animal, and it has the gene of coding RA1c polypeptides that are defective or changing due to homologous recombination between the genomic DNA of the endogenous gene for encoding RA1c polypeptides and the coding RA1c polypeptides for the change for importing the animal embryonic stem cell.For example, the cDNA of coding RA1c polypeptides can be used for the genomic DNA of clones coding RA1c polypeptides according to the technology set up.Another gene substitution, gene that another gene is such as integrated available for monitoring, coding selection marker are deleted or used to the part that can will encode the genomic DNA of RA1c polypeptides.Generally, comprising the unchanged flanking DNA of many kilobases (5 ' and 3 ' ends have), (description is see, for example, Thomas and Capecchi, 1987, Cell 51 as described in homologous recombination vector in carrier：503).By vector introduction embryonic stem cell line (such as by electroporation), and wherein imported DNA is selected to occur the cell of homologous recombination (see, for example, Li etc., 1992, Cell 69 with interior source DNA：915).Then by the blastocyst of selected cell infusion to animal (such as mouse or rat) to form aggregation chimera (see, for example, Bradley, inTeratocarcinomas and Embryonic Stem Cells：A Practical Approach, E.J.Robertson, ed.IRL, Oxford, 1987, pp.113-152).Then chimeric embryo can be implanted into suitable pseudopregnant female foster animal, and make embryo is mature to produce " knockout " animal.The offspring comprising homologous recombination DNA can be identified by standard technique in its reproduction cell, and be used for the animal that all cells of breeding wherein animal all include homologous recombination DNA.Knock-out animal can be identified due to lacking RA1c polypeptides according to for example with the ability of some pathological conditions is resisted with pathological condition is formd.

The nucleic acid of coding RA1c polypeptides can be additionally used in gene therapy.In gene therapy application, by gene into cells to realize the internal synthesis of the upper efficient gene product for the treatment of, such as substituting dcc gene." gene therapy " includes conventional gene therapy and applies two kinds of gene therapeutic agents, and the former obtains lasting effect by single treatment, and the latter, which is related to, once or repeatedly applies treatment upper effective DNA or mRNA.Antisense RNA and DNA can be used for the expression for blocking some genes in vivo as therapeutic agent.Short ASON can be inputted in the cell that they play inhibitor wherein by having shown that, although because cell membrane is limited to their intake, thus their intracellular concentration low (Zamecnik etc., 1986, Proc.Natl.Acad.Sci.USA 83：4143-4146).Their intake can be improved with modified oligonucleotide, such as by using their negatively charged phosphodiester groups of uncharged substituent group.

There are multiple technologies to can be used for nucleic acid importing living cells.These technologies are according to being transferred to nucleic acid in external culture cell, or in the cell of internal expection host and are varied from.Suitable for nucleic acid is transferred into technology in mammalian cell including the use of liposome, electroporation, microinjection, cell fusion, DEAE- dextrans, calcium phosphate precipitation etc. in vitro.Transfection (Dzau etc., 1993, Trends in Biotechnology 11 of transfection and virus capsid protein of the currently preferred vivo gene transfer technology including the use of virus (be typically retrovirus) carrier-liposome-mediated：205-210).In some cases, expect to provide nucleic acid source, the reagent antibody special to cell surface membrane protein or target cell, the part of receptor on target cells etc. together with the reagent for targetting target cell.When using liposome, with reference to the cell surface membrane protein relevant with endocytosis protein can be used for targeting or promote intake, such as capsid protein to particular cell types aeoplotropism or its fragment, in the circulating cycle experience internalization protein antibody, target inner cellular localization and strengthen the protein of intracellular half-life period.The technology of receptor-mediated endocytosis is see, for example, Wu etc., 1987, J.Biol.Chem.262：4429-4432；With Wagner etc., 1990, Proc.Natl.Acad.Sci.USA 87：3410-3414.Summary on genetic marker and gene therapy protocol is shown in Anderson etc., 1992, Science 256：808-813.

The nucleic acid molecules or its fragment of coding RA1c polypeptides described herein can be used for Chromosome Identification.At this point, the demand of new chromosome marker is identified in increase, because according to actual sequence data, only relatively small number of chromosome marking reagent is available now.Every kind of RA1c nucleic acid molecules of the present invention are used as chromosome marker.

Other useful nucleic acid compounds in reducing or blocking RA1c expression or activity have ribozyme.Ribozyme is can be catalyzed the enzymatic RNA molecules of the specificity cutting to RNA.Ribozyme then carries out endonuclease hydrolysis (endonucleolytic) cutting to work by occurring sequence specific hybridization with complementary target rna.The specific Ribozyme cleavage site in potential rna target can be identified by known technology.More details are see, for example, Rossi, Current Biology, and 4：469-471 (1994) and PCT Publication WO 97/33551 (disclosure on the 18th of September in 1997).

K. composition and medicinal proportional preparation

Present invention also offers the compound comprising RA1c antagonists or regulation and control RA1c expression and the composition of carrier.In a further embodiment, the composition can include the RA1c antagonists with other therapeutic agents such as cytotoxic agent or growth inhibitor such as chemotherapeutic agent combination or the compound of regulation and control RA1c expression.Present invention also offers the compound comprising RA1c antagonists or regulation and control RA1c expression and the preparaton of carrier.In one embodiment, the preparaton is freeze-dried formulation or aqueous solution form, include at least one pharmaceutical acceptable carrier, excipient and/and stabilizer (Remington ' s PharmaceuticalSciences, 16th edition, Osol, A. compile, 1980) treatment preparaton.Acceptable carrier, excipient or stabilizer are nontoxic to recipient in the dosage and concentration used, include the buffer of buffer, such as acetate, Tris, phosphate, citrate and other organic acids；Antioxidant, including ascorbic acid and methionine；Preservative (such as octadecyl dimethyl benzyl ammonium chloride；Hexamethonium chloride；Benzalkonium chloride, benzethonium chloride；Phenol, butanol or phenmethylol；Alkyl paraben, such as methyl p-hydroxybenzoate or propyl ester；Catechol；Resorcinol；Cyclohexanol；3- amylalcohols；And metacresol)；Low molecule amount (less than about 10 residues) polypeptide；Protein, such as serum albumin, gelatin or immunoglobulin；Hydrophilic polymer, such as polyvinylpyrrolidone；Amino acid, such as glycine, glutamine, asparagine, histidine, arginine or lysine；Monose, disaccharides and other carbohydrate, including glucose, mannose or dextrin；Chelating agent, such as EDTA；Tension regulator (tonicifier), such as trehalose and sodium chloride；Carbohydrate, such as sucrose, mannitol, trehalose or sorbierite；Surfactant, such as polysorbate；Into salt counter ion, such as sodium；Metal composite (such as Zn- protein complexes)；Or nonionic surfactant, such as TWEEN^TM、PLURONICS^TMOr polyethylene glycol (PEG).The preparaton of the antibody preferably comprises concentration for 5-200mg/ml, preferably 10-100mg/ml antibody.

Preparaton herein can also contain have more than it is a kind of treat reactive compound necessary to specific indication, preferably complementary activities and not adversely affect each other.For example, outside the combination of RA1c antagonists or the compound or one or more such compounds of regulation and control RA1c expression, may be it is also expected to containing another antibody in a kind of preparaton, for example with reference to the second anti-RA1c antibody of different epitopes on RA1c polypeptides, or for some other targets such as influence particular cancer grow growth factor antibody.Or the composition can also include chemotherapeutics, cytotoxic agent, cell factor, growth inhibitor, antihormone agent or heart protective agent.Suitably, this quasi-molecule exists to be combined for the effective amount of predetermined purpose.

The active component can also contain in the microcapsules prepared for example by condensation technique or by interfacial polymerization (being for example hydroxymethyl cellulose or gelatin-microcapsule and poly- (methyl methacrylate) microcapsules respectively), in colloidal drug delivery system (such as liposome, albumin microspheres, microemulsion, nano particle and Nano capsule) or in macro emulsion.Such technology is disclosed in such as Remington ' sPharmaceutical Sciences, and the 16th edition, Osol, A. is compiled, and 1980.

Extended release preparation can be prepared.The suitable example of extended release preparation includes the solid hydrophobic polymers semipermeable matrices containing antibody, and the matrix is the form of approved product, such as film or microcapsules.The example of sustained-release matrix includes polyester, hydrogel (such as poly- (2- ethoxys-methacrylate) or poly- (vinyl alcohol)), polyactide (United States Patent (USP) 3,773,919), the copolymer of Pidolidone and Pidolidone γ-ethyl ester, nondegradable ethane-acetic acid ethyenyl, degradable lactic acid-ethanol copolymer such as LUPRONDEPOT^TM(the Injectable microspheres body being made up of lactic acid-ethanol copolymer and leuprorelin acetate) and poly- D- (-) -3-hydroxybutyrate.

Preparaton for applying in vivo must be sterile.This easily can be realized using standard technique, for example, filtered by sterilised membrane filter.

L. treatment use

The compound that RA1c antagonists and regulation and control RA1c are expressed is useful in cellular stress response is alleviated, and is useful especially in expression RA1c cancer such as prostate cancer.The chemotherapeutic treatment to cancer is strengthened the sensitiveness of chemotherapeutics by improving cell to the alleviation of cellular stress response in cancer cell.

RA1c antagonists and the compound of regulation and control RA1c expression are useful, such as prostate cancers in the therapy of the cancer for treating expression RA1c, especially in the chemotherapeutic agent combination with improving RA1c expression.Improving the example of the chemotherapeutics of RA1c expression includes the medicament of inducing cell stress response.The specific example for improving the chemotherapeutics of RA1c expression includes but is not limited to mTOR or Akt1/2 inhibitor.In one embodiment, conjoint therapy includes the compound of specific binding RA1c polypeptides, and such as anti-RA1c antibody or its fragment, RA1c combinations oligopeptides, specific binding RA1c inorganic or organic molecule and other RA1c antagonists are such as fit.In a specific embodiment, the compound is anti-RA1c antibody.Preferably, the anti-RA1c antibody is coupled to cytotoxic agent.

In another embodiment, the conjoint therapy is comprising reduction or blocks RA1c expression or active compound.

The rise of RA1c expression provides increase that can be with the RA1c of anti-RA1c compound phases interaction amount.The Combined Treatment of compound of the chemotherapeutics with reducing or blocking RA1c expression or activity provides synergy, causes treatment of cancer to improve.

For therapeutic application, can be used alone RA1c antagonists or regulation and control RA1c expression compound, the either conjoint therapy for the compound with such as hormone, antiangiogenic agent (antiangiogen) or radio-labeled or with operation, cold therapy or radiotherapy.

RA1c antagonists or the compound of regulation and control RA1c expression can be administered in combination with the routine treatments of other forms, with routine treatment continuous administration, apply before or after it.Chemotherapeutics is such as

Taxotere (doxetaxel),

Taxol (paclitaxel), Estramustine (estramustine) and mitoxantrone (mitoxantrone) are used for the patient for the treatment of cancer, particularly smaller risk (good risk).In a therapeutic treatment, the compound of RA1c antagonists or regulation and control RA1c expression can be applied to patient together with the processing of one or more chemotherapeutics.Specifically, the present invention covers the conjoint therapy with mTOR or Akt1/2 inhibitor.RA1c antagonists or the compound of regulation and control RA1c expression are applied together with the chemotherapeutics for the treatment of effective dose.Physicians ' Desk Reference (PDR) disclose the dosage of these medicaments used in the treatment of kinds cancer.Effective dosage regimen and dosage will can be determined depending on other factorses known to the internist of the specific cancer, the degree of disease and capable field technique treated and by internist these foregoing chemotherapeutic medicines in the treatment.

RA1c antagonists or the compound of regulation and control RA1c expression are administered to human patientses according to known method, it is such as intravenous to apply, for example as the continuous infusion for injecting (bolus) or a period of time, by intramuscular, intraperitoneal, myelencephalon, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, part or suction path.It is preferred that intravenously or subcutaneously administration of antibodies, oligopeptides or organic molecule.

The administration of RA1c antagonists or the compound of regulation and control RA1c expression can combine other therapeutic schemes.Be administered in combination co-application including the use of separated preparaton or single medicinal proportional preparation, and random order continuous administration, wherein it is preferred that all two kinds of (or a variety of) activating agents play its biological activity simultaneously for some time.Preferably, such conjoint therapy causes synergistic therapeutic effect.

May be it is also expected to the administration of RA1c antagonists or the compound of regulation and control RA1c expression be combined with applying for the antibody for another tumour antigen relevant with particular cancers.

RA1c antagonists or the compound of regulation and control RA1c expression can be combined with anti-hormonal compound with the known dose of this quasi-molecule, the compound such as antiestrogenic compound, such as TAM (tamoxifen)；Antiprogestin compound, such as Onapristone (onapristone) (see EP 616,812)；Or Anti-androgenic compounds, such as Drogenil (flutamide).

Sometimes, it may be also beneficial to return patient and co-administer heart protective agent (to prevent or reduce the myocardial dysfunction relevant with therapy) or one or more cell factors.Except above-mentioned therapeutic scheme, before antibody, oligopeptides or organic/inorganic small molecule therapy, simultaneously or afterwards, operation can be carried out to patient and remove cancer cell or radiotherapy.Any of above suitable dose for co-administering medicament is exactly those used dosage at present, and can be reduced due to the synergy (synergy) of the medicament and RA1c antagonists or the compound of regulation and control RA1c expression.

In order to prevent or treat disease, applied dose and pattern can be selected by internist according to known standard.RA1c antagonists or the optimal dose of the compound of regulation and control RA1c expression by being in order to prevent or therapeutic purposes, previous therapy, the clinical history of patient and the response and the judgement of attending doctor to RA1c antagonists or the compound of regulation and control RA1c expression depending on the as defined above type of disease to be treated, the order of severity of disease and process, using the compound of RA1c antagonists or regulation and control RA1c expression.Appropriate disposably or in a series of treatments is administered to patient by compound.Preferably, RA1c antagonists or the compound of regulation and control RA1c expression are applied by intravenous infusion or by being subcutaneously injected.

In a specific embodiment, about 1 μ g/kg can be administered to patient to the anti-RA1c antibody of about 50mg/kg body weight (e.g., from about 0.1-15mg/kg/ agent) as initial candidate dosage, either for example by one or many separated administrations, or pass through continuous infusion.Dosage regimen may include the initial loading dose using about 4mg/kg, the maintenance dose weekly of the rear anti-RA1c antibody of renewed treaty 2mg/kg.However, other dosages can also be used.According to above-mentioned factor, typical daily dosage can be in about 1 μ g/kg to 100mg/kg or bigger scope.For take several days or the longer time repetitive administration, according to situation, maintaining treatment until occur the expectation to disease symptomses containment.The progress of this therapy can easily by conventional method and determination method, and based on internist or it is other those skilled in the art will know that standard monitor.

It is administered to by the antibody protein or antibody fragment protein of the present invention outside patient, the application covers by gene therapy come administration of antibodies.Such apply of the nucleic acid of encoding antibody is covered in statement " antibody for applying therapeutically effective amount ".On producing the purposes of intracellular antibody using gene therapy see, for example, WO 96/07321 disclosed in 14 days March in 1996.

The position of the combination target of antibody of the present invention is can contemplate in preparation and administration of antibodies.If being intracellular molecule (the compounds of this invention expressed for regulation and control RA1c) with reference to target, certain embodiments of the present invention, which provide to import antibody or its antigen-binding fragment, combines target position in cell.In one embodiment, antibody of the invention can be with intracellular expression into intracellular antibody (intrabody).Term " intracellular antibody " refers in intracellular expression and is capable of the antibody or its antigen-binding portion thereof of selective binding target molecule as used herein, referring to Marasco, Gene Therapy 4：11-15(1997)；Kontermann, Methods 34：163-170(2004)；U.S. Patent number 6,004,940 and 6,329,173；U.S. Patent Application Publication No. 2003/0104402；And PCT Publication WO2003/077945.The intracellular expression of intracellular antibody can be implemented as described below, and the nucleic acid (lacking generally with encoding wild-type leader sequence and secretion signal that the gene of the antibody or antigen-binding fragment is connected) that will encode expectation antibody or its antigen-binding portion thereof imports target cell.It can use any standard method of nucleic acid into cells, including but not limited to microinjection, ballistic injection, electroporation, calcium phosphate precipitation, liposome, and use the transfection for retrovirus, adenovirus, adeno-associated virus and the vaccinia virus vector for carrying purpose nucleic acid.One or more delivery of nucleic acids of the compounds of this invention all or in part can will be encoded to target cell, so that one or more intracellular antibody expression, it being capable of intracellular binding signal pathway component polypeptide and the one or more cellular pathways for directly or indirectly involving RA1c expression or activity of regulation and control.

The method of another cell for making nucleic acid (being optionally included in carrier) enter patient is ex vivo (exvivo).For ex vivo therapy, the cell of patient is gathered, nucleic acid is imported to the cell of these separation, and by the cell by modification or patient is directly applied to, or for example load the interior simultaneously implantation within a patient of perforated membrane (see, for example, United States Patent (USP) 4,892,538 and 5,283,187).There are multiple technologies to can be used for nucleic acid importing living cells.These technologies are according to being that nucleic acid is transferred into the cultured cell in vitro or internal cell of expected host and is varied from.Suitable for nucleic acid is transferred into technology in mammalian cell including the use of liposome, electroporation, microinjection, cell fusion, DEAE- dextrans, calcium phosphate precipitation etc. in vitro.The carrier for being usually used in ex vivo delivery gene is retrovirus.

There is provided internalization antibody in one embodiment.Antibody can have some features, or have this category feature after modification, so that enhancing antibody enters the delivering of cell.For realizing that the technology of this effect is known in the art.For example, the known intake for promoting it to enter cell of the cationization of antibody (see, for example, U.S. Patent number 6,703,019).Fat transfection (lipofection) or liposome can also be used for antibody delivery entering cell.If using antibody fragment, the minimum inhibition fragment for specifically binding the binding structural domain of target protein is usually beneficial.For example, according to the variable region sequences of antibody, the peptide molecule retained with target protein sequence binding ability can be designed.Such peptide can be generated with chemical synthesis or by recombinant DNA technology.See, for example, Marasco etc., Proc.Natl.Acad.Sci.USA, 90：7889-7893(1993).

Antibody can be strengthened by methods known in the art and enter target cell.For example, all those sequences as derived from HIV Tat or feeler foot (Antennapedia) homeodomain protein of some sequences can guidance of heterologous protein through cell membrane so as to effectively taking in.See, for example, Chen etc., Proc.Natl.Acad.Sci.USA, 96：4325-4329(1999).

M. diagnose and non-therapeutic use

RA1c antagonists or the compound of regulation and control RA1c expression have a variety of non-therapeutic applications.For example, RA1c antagonists or the compound of regulation and control RA1c expression can be used for the cancer of expression RA1c polypeptides by stages (such as in radiophotography).RA1c antagonists or the compound of regulation and control RA1c expression can also be used for tissue typing in diagnosis, wherein RA1c polypeptides may in one kind tissue compared with another organize, preferably in illing tissue compared with the normal structure of identical organization type differential expression.These compounds can be additionally used in purifying or immunoprecipitation RA1c polypeptides from cell, vitro detection and the quantitative cell for killing and eliminating expression RA1c polypeptides from mixed cellularity group as a step for purifying other cells for example in ELISA or western blot for RA1c polypeptides.RA1c nucleic acid molecules can be used for generation probe, for PCR, Northern analysis, Southern analyses and Western analyses.

In order to determine the RA1c expression of polypeptides in cancer, using a variety of detection assay methods.In one embodiment, RA1c polypeptides overexpression can be analyzed by SABC (IHC).IHC determination methods can be carried out to the paraffin-embedded tissue section from tumor biopsy, and give following RA1c polypeptides staining intensity criteria：

Score 0：Not it was observed that dyeing or film dyeing being observed in the tumour cell less than 10%.

Score 1+：Faint/just perceptible film dyeing is detected in the tumour cell more than 10%.The cell only has dyeing on its part film.

Score 2+：Faint to medium complete film dyeing is observed in the tumour cell more than 10%.

Score 3+：Medium to strong complete film dyeing is observed in the tumour cell more than 10%.

Those RA1c expression of polypeptides scores 0 or 1+ tumour can be accredited as and not be overexpressed RA1c polypeptides, and those scores 2+ or 3+ tumour can be accredited as overexpression RA1c polypeptides.

Or formalin can be fixed, the tumor tissues of FFPE carry out FISH determination methods such as

(by Ventana, Arizona sell) or

(Vysis, Illinois) is to determine the degree (if any) that RA1c polypeptides in tumour are overexpressed.

It it is also possible to use vivo detection determination method and be overexpressed or expand to assess RA1c polypeptides, for example by applying the molecule (such as antibody, antibody fragment, antibody coupling matter, oligopeptides or organic molecule or fit) for combining molecules detected and being marked with detectable (such as radio isotope or fluorescent marker), then patient is carried out external scan to position the label.

Present invention also offers the method whether measure cell is undergoing cellular stress response.These methods determine the processing of specific chemotherapeutics whether in cancer cell in inducing cell stress response it is particularly useful.Induction to cellular stress response can provide survival advantage to cell, and make it that cell is less sensitive to the effect of chemotherapeutics or resistant.If it find that chemotherapeutics inducing cell stress response in target cancer cells, then it is desirable that alleviating cellular stress response, such as with reducing or blocking the compound of RA1c expression or activity, to improve sensitiveness of the cell to chemotherapeutics.

RA1c expressions in the cell that induction to cellular stress response is handled by monitoring with chemotherapeutics are determined.In one embodiment, methods described includes making cancer cell contact chemotherapeutics and determining the RA1c expressions in cancer cell.RA1c expressions in this test cell are compared with the RA1c expressions in the test cell before contacting chemotherapeutics, rise of the expression in test cell compared with the expression in the test cell before contact treatment agent after contact chemotherapeutics indicates the chemotherapeutics inducing cell stress response.Or, the RA1c expressions in test cell can be compared with the RA1c expressions in the control cell of test cell same type.In a specific embodiment, the rise of the RA1c expression is about 50 times, either about 2-50 times or about 5-50 times, or about 10-50 times.As in known in the art, it is advantageous that the method that monitoring housekeeping gene is used as the gene expression dose in calibration test and/or control cell.Cancer cell used in this determination method is preferably prostate gland cancer cell, such as LNCaP cells.

The determination method can monitor the expression of RA1c genes or the expression of RA1c polypeptides.

The chemotherapeutics determined in these methods is that any suspection can cause the medicament of cellular stress response.In one embodiment, the chemotherapeutics is mTor inhibitor.In another embodiment, the chemotherapeutics is Akt1/2 inhibitor.

Present invention further contemplates that screening compounds are to identify that those prevent RA1c polypeptides effect (methods of the compound of (antagonist).The screening test method for antagonist drug candidates is designed to that identification is combined or compound with the RA1c polypeptides for the coded by said gene identified herein, or the compound for otherwise disturbing coded polypeptide to be interacted with other cell proteins, including for example suppress cell expression RA1c polypeptides.Such the screening test method includes the determination method for adapting to high flux screening chemistry library so that they are particularly suitable for use in identifying small molecule drug candidates.

Method, including the perfect protein-protein binding assay in this area, biochemistry the screening test method, immunoassay and the determination method based on cell can be measured in a variety of forms.

All determination methods for antagonist have in common that they need the RA1c polypeptides for making drug candidates contact the encoded by nucleic acid identified herein, and its condition and time are enough to make both components interact.

In binding assay, interaction refers to combination, and the compound formed can be separated or detected in the reactive mixture.In a specific embodiment, by RA1c polypeptides or drug candidates by being covalently or non-covalently attached to fixed in solid phase, such as on microtiter plate.Non-covalent attachment is generally realized by using RA1c polypeptide solutions coating solid phase surface and drying.Or, the immobilized antibody such as monoclonal antibody to RA1c polypeptides to be fixed can be used for anchoring to it on solid phase surface.Determination method is carried out as follows, and can will be added to the on-fixed component of detectable label substance markers on the immobilization component such as coating surface comprising grappling component.When reacting completion, for example, unreacted component is removed by cleaning, and detect the compound anchored on solid phase surface.If initial on-fixed component carries detectable, detect that the label being fixed on surface shows to there occurs compound action.If initial on-fixed component does not carry label, compound action for example can be detected by using the labelled antibody of fixed complex is specifically bound.

If candidate compound and many peptide interactions of RA1c but do not combined, then the interaction of it and the polypeptide can be by determining for detecting the known method of protein-protein interaction.Such determination method includes conventional method, such as crosslinking, co-immunoprecipitation and pass through gradient or the copurification of chromatographic column.Furthermore it is possible to such as Chevray and Nathans, 1991, Proc.Natl.Acad.Sci.USA 89：Disclosed in 5789-5793, Fields and its colleague (Fields and Song, 1989, Nature (London) 340 are used：245-246；Chien etc., 1991, Proc.Natl.Acad.Sci.USA 88：9578-9582) genetic system based on yeast of description monitors protein-protein interaction.Many transcriptional activators, such as yeast GAL4, discrete modular structural domains are constituted in two spaces, and one is played DNA binding structural domains, and another plays the function of transcriptional activation domain.Yeast expression system (being commonly referred to as " two-hybrid system ") described in above-mentioned publication make use of this characteristic, using two kinds of hybrid proteins, target protein is merged with GAL4 DNA binding structural domains in one, and merged candidate's activator protein matter with activation structure domain in another.Expression of the GAL1-lacZ reporters under the promoter control that GAL4 is activated is dependent on reconstruction of the GAL4 activity via protein-protein interaction.The bacterium colony of interaction polypeptide is included with the chromogenic substrate detection of beta galactosidase.Complete kit (the MATCHMAKER of the protein-protein interaction between two kinds of specified proteins is identified using two-hybrid techniques^TM) can be bought from Clontech.This system may also extend into the mapping of the protein domain to participating in specified protein interaction and point out to these vital amino acid residues of interaction.

The compound for disturbing the RA1c polypeptides for the coded by said gene identified herein to be interacted with other intracellulars or extracellular fraction can be tested as follows：Generally it is being enough to make to prepare the reactant mixture comprising gene outcome and intracellular or extracellular fraction under two kinds of product interactions and the condition and time conditions that combine.The ability combined to test candidate compound to suppress, is reacted when lacking and there is test compound.Furthermore it is possible to add placebo (placebo) into the 3rd part of reactant mixture, positive control is used as.Combination present in monitoring mixture between RA1c polypeptides and intracellular or extracellular fraction as described above (compound is formed).Formed in control reaction thing and do not form compound in compound but reactant mixture containing test compound and show, test compound interference RA1c polypeptides react the interaction of gametophyte.

In order to determine antagonist, RA1c polypeptides can be added in cell together with the compound of given activity to be screened, when there is RA1c polypeptides, the compound suppresses the active ability of purpose and shows that the compound is the antagonist of RA1c polypeptides.Or, antagonist can be detected as follows, and RA1c polypeptides and potential antagonist are combined with the RA1c polypeptide receptors or coded acceptor of film combination under conditions of suitable for Reverse transcriptase determination method.RA1c polypeptides can be marked, and such as pass through radioactive label so that the number of the RA1c peptide molecules combined with acceptor can be used for the effect for determining potential antagonist.Encode acceptor gene can by those skilled in the art will know that a variety of methods identify, such as part elutriation and FACS sortings.Coligan etc., 1991, Current Protocols in Immun.1 (2)：Chapter 5.Preferably, using expression cloning, wherein preparing polyadenylation RNA to the cell that RA1c polypeptides have response, several set will be divided into from this RNA cDNA libraries built, and for rotaring redyeing COS cell or the other cells not responded to RA1c polypeptides.The transfectional cell cultivated on slide is set to be exposed to the RA1c polypeptides by mark.RA1c polypeptides, including iodate or the recognition site for including site-specific protein kinases can be marked by multiple means.After fixed and incubation, slide is subjected to radioautographic analysis.The positive set of identification, prepares subset, and carries out transfection and again screening process again with the subset of interaction, finally produces the single clone of coding presumption acceptor.

As the alternative approach of receptor identification, labeled RA1c polypeptides can be made to be connected with the cell membrane or extraction prepared product photoaffinity of expressed receptor molecule.By PAGE parsings crosslinking material and x-ray film is exposed.The labeled complex comprising acceptor can be cut, fragments of peptides is dissociated into, and carry out Protein microassay sequencing.The amino acid sequence obtained from microsequencing can be used for one group of degenerate oligonucleotide probe of design, estimate the gene of acceptor with identification code for screening cDNA library.

In another determination method for antagonist, the mammalian cell of expressed receptor or film preparation thing are incubated together with the RA1c polypeptides by mark when there is candidate compound.Then the compound enhancing or the ability for blocking this to interact are measured.

N. product and kit

Another embodiment of the invention is the product of the material comprising the cancer (such as prostate cancer) that can be used for treatment expression RA1c polypeptides.The product includes the label or package insert being connected on container and container or with container.Suitable container is included such as medicine bottle, pencil, syringe.The container can be made of multiple material, such as glass or plastics.The container is equipped with the composition for effectively treating the cancer illness, can have sterile access port (such as described container can be the medicine bottle of intravenous solution bag or the plug that can pierce with hypodermic needle).At least one of composition active agents are the compounds of RA1c antagonists or regulation and control RA1c expression.The label or package insert indicate that said composition is used for treating cancer.The label or package insert further include the specification on applying the antibody, oligopeptides or organic/inorganic small molecule compositions to cancer patient.In addition, the product can further comprise second container, wherein equipped with pharmaceutically acceptable buffer solution, such as injection bacteriostatic water (BWFI), phosphate buffered saline (PBS), woods grignard (Ringer) solution and dextrose solution.It can further comprise the other materials from business and user's position needs, including other buffer solutions, diluent, filter, pin and syringe.

Additionally provide the kit available for various purposes, such as expressing the cell killing determination method of RA1c polypeptides, for from cell purification or immunoprecipitation RA1c polypeptides and determining the determination method of the induction to cellular stress response.In order to separate and purify RA1c polypeptides, the kit can include the anti-RA1c antibody being coupled with pearl (such as sepharose pearls), anti-RA1c antibody fragments, anti-RA1c antibody coupling matters, oligopeptides, organic/inorganic small molecule or other combination RA1c antagonist.The antagonist for including anti-RA1c antibody, anti-RA1c antibody fragments, anti-RA1c antibody coupling matters, oligopeptides, organic/inorganic small molecule or the other combination RA1c for being used for RA1c polypeptides vitro detection and quantitative (for example being carried out in ELISA or western blot) can be provided.As product, the kit includes the label or package insert being connected on container and container or with container.The container is equipped with the composition of the antagonist comprising at least one anti-RA1c antibody of the invention, anti-RA1c antibody fragments, anti-RA1c antibody coupling matters, oligopeptides, organic/inorganic small molecule or other combination RA1c.It may include such as diluent and buffer solution, other container of control antibodies are housed.The label or package insert can provide the description of said composition and be intended to the specification that external or detection is used.

Including following examples to show the preferred embodiment of the invention.Those skilled in the art will be appreciated that the technology disclosed in following examples represents technology that inventor is had found, operational excellence in an embodiment of the present invention, so it is considered that these technological maheups implement the preference pattern of the present invention.However, according to the disclosure, those skilled in the art will be appreciated that on the premise of without departing substantially from the spirit and scope of the present invention, many changes can be produced in disclosed specific embodiment, and still obtain alike or similar result.All bibliography cited in entire description clearly and are intactly included by referring to.

Embodiment

Embodiment 1：RA1c is expressed

The RA1c expression in few kinds of tissues and tumour is checked using Affymetrix HGU133P oligomer arrays (GeneLogic).In GeneLogic companies (Gaithersburg, MD) by using the probe assay oligonucleotide microarray (HG-U133 for being designed to hybridize with the UTR of people RA1c 3 ' (NM_030774 base 2349-2742), Affymetrix it) have evaluated RA1c expression, (Shen-Ong etc., Cancer Res.2003 as previously noted：63(12)：3296-3301).As a result show that the expression of the RA1c in prostata tissue is significantly higher than any other test organization (Figure 1A).In addition, the RA1c expression in cancerous prostate tissue is significantly higher than the expression (Figure 1A) in normal prostate tissue.The more close inspection (Figure 1B) carried out in several parts of normal and ill prostate samples shows that normal prostate tissue and benign prostatauxe have similar RA1c expressions, and neoformation (neoplasm) sample is expressed with than that the two kinds significantly lower amount of RA1c of tissue between prostatic epithelium, and Gleason is scored at 7 RA1c expression of three parts of different adenocarcinoma samples with than that the two kinds significantly higher amounts of tissue.

Embodiment 2：The regulation and control expressed RA1c

(a) influence that cell factor is expressed RA1c

One previous research is found that a kind of RA1c expression immortalized in prostate cell line by enhancing (Weng etc., J.Cell.Biochem.96 for applying interleukin 6 (IL-6) to the cell：1034-1048(2005)).Thus, test the effect that IL-6 and other cell factors are applied to LNCaP cells (one kind immortalization, Androgen-sensitive prostate cancer cell line).By LNCaP cells with equal density (about 0.5x10⁶Individual cells/well) it is coated in six orifice plates, and in the DMEM containing 10% hyclone (FBS):In 37 DEG C in 5%CO in F12K culture mediums₂Middle culture 48 hours, is replaced, the culture medium contains IL-6, insulin, EGF or the IGF-1 of shown concentration with without phenol red complete medium or serum-free, without phenol red culture medium afterwards.IL-6, EGF and IGF-1 processing are carried out 24 hours, and insulin processing is carried out 7 hours.After processing, by mechanical lifting come harvesting.Use RNAeasy^TMThe cell separation RNA that kit (Qiagen) and DNA enzymatic processing are harvested certainly.Using from PE Biosystems and Q-PCR systems (Taqman^TM, PE Biosystems) reagent implement quantitative real-time RT-PCR (Q-PCR) according to the instruction of manufacturer.Used Q-PCR primers are：Positive CCC ATC ATC TATGGT GCC AAA (SEQ ID NO：4), reverse TCC TTG TCA CAG CTG ATC TTGAA (SEQ ID NO：5).Used probe is CCA AAC AGA TCA GAA CAC GGGTGC TG (SEQ ID NO：6).As a result it is shown as passing through the RA1c values that are compared and standardized with ribosomal protein L 19 (RPL19) using equation below in Figures 2 A and 2 B：2^{The average Ct of RPL19}/2^{RA1c Average Ct values}。

As a result show, with reporting consistent earlier, IL-6 processing significantly increases the RA1c expression in the cell of complete medium processing, more than control level (see Fig. 2A).Although EGF and the IGF-1 processing of the cell to being cultivated in serum free medium observe that the RA1c improved is expressed, seen in the control cell cultivated in complete medium, but the expression is not varied significantly from and (see Fig. 2A, and compared what is observed in the control cell cultivated in serum free medium with Fig. 4 B and 14A).Similarly, compared with the control cell that culture medium is matched, insulin processing has no significant effect (Fig. 2 B) to RA1c expression.RPL19 Ct values are consistent between each sample of each experiment, and are also consistent in the cell and the iuntercellular of serum free medium processing of complete medium processing.In this way, these experiments demonstrate the RA1c expression in the LNCaP cells handled by IL-6 processing raisings, more than related control cell, but also point out, serum deprivation may be also independent from IL-6 processing and improve the expression of the RA1c in cell.This two discoveries are further investigated.

In order to assess the opportunity of IL-6 processing up-regulation RA1c expression, the time course research in LNCaP cells is implemented.By cell with equal density (about 0.5x10⁶Individual cells/well) it is coated in six orifice plates, and in the DMEM containing 10% hyclone (FBS):In 37 DEG C in 5%CO in F12K culture mediums₂Middle culture 72 hours, afterwards first with IL-6 processing (24 hours processing samples).Therefore, the total time that experiment termination is applied to certainly is 96 hours.The processing of cell stage point is staggeredly so that harvest all samples by mechanical lifting in the same time.Cell is cleaned once in phosphate buffered saline (PBS) (PBS), afterwards using RNAeasy^TMKit (Qiagen) is cracked and separation RNA.During RNA is separated all samples are handled with DNA enzymatic.Implement Q-PCR using Q-PCR systems described above, primer and probe, and as described above standardize result relative to RPL19.As a result Fig. 2 C are shown in.RA1c expression response IL-6 processing was raised at 4 hours, and reached peak value at 8 hours.Processing in 24 hours is also raised, and is expressed more than control cell RA1c, but similar to the level observed in 4 hours points.This result is pointed out, and RA1c is the early stage target gene of IL-6 approach in LNCaP cells.

(b) influence that serum deprivation is expressed RA1c

Experiment is also embodied in further to assess influence of the serum deprivation to LNCaP cells.By cell with equal density (about 0.5x 10⁶Individual cells/well) it is coated in six orifice plates and allows it in the DMEM containing 10% hyclone (FBS):In 37 DEG C in 5%CO in F12K culture mediums₂It is middle to stand 24 hours.Cell is added to by serum-free and without phenol red culture medium (" 50/50 ").The hyclone (FBS) of amount shown is added to some samples, and processing continues 18 hours.After incubation, by mechanical lifting come harvesting, and RNAeasy is used as described above^TMKit (Qiagen) separates RNA, is handled during RNA is separated with DNA enzymatic.Using the primer and probe described in Q-PCR systems and reagent (PE Biosystems) and embodiment 2 (a), implement Q-PCR as described in embodiment 2 (a).As a result as described above relative to RPL19 standardization.In 50/50 culture medium, obviously there is correlation (Fig. 3 A) between the shortage of serum and the rise of RA1c expression.Raised with the percentage of the hyclone added to cell, the amount reduction (Fig. 3 A) of RA1c expression.In this way, RA1c show by normal cell system apply stress condition (such as serum deprivation and IL-6 processing) induction.Result when being tested using another kind of serum free medium (i.e. RPMI) is similar.

Further research is indicated, rises of the RA1c mRNA under serum deprivation is not only due to the elimination of the androgen entrained by serum.Handle peptide cow's serum to eliminate androgen and other organic small components (such as bioactive lipid) with activated carbon (CDS).The LNCaP cells cultivated in the culture medium for be supplemented with CDS are with similar horizontal expression RA1c compared with the cell cultivated in the culture medium with complete hyclone.On the contrary, the cell cultivated in the culture medium of serum-free expresses elevated RA1c, as being previously observed.RA1c expression under DHT processing containment all conditions.

(c) influence of the cell cycle regulating in the LNCaP cells that serum deprivation is handled IL-6

The previous day is handled in IL-6, by LNCaP cells with 0.5x10⁶The density of individual cells/well is coated in six orifice plates.Coating one day after, culture medium is changed with fresh complete medium or serum-free and without phenol red culture medium, and certain some holes is in addition with 10 or 50ng/mL IL-6 processing.Handle in 37 DEG C in 5%CO₂In continue 48 hours, cell is now taken out from plate using 1mL 1X trypsase/10mM EDTA, and with cold PBS twice.Then cell is thoroughly resuspended in 100% cold ethanol and is held in 4 DEG C until analysis.In order to which propidium iodide (PI) is dyed, cell is rotated, is then resuspended in 1mL PI dyeing liquors (0.4%NP40,0.05mg/mL PI, 0.02mg/mL RNase) and is incubated overnight, until using FACScalibur^TMSystem (BD Biosciences) sorts (FACS) analysis to analyze by fluorescence activated cell.Obtained in culture medium under facilities, every part of sample obtains 25x10³Individual cell.

It can find out from Fig. 3 B, compared with the control cell cultivated in serum free medium, the control cell cultivated in complete medium has the cell in G0/G1 stagnations of notable lower ratio.Contain the growth factor and cell factor of many stimulation active cell growths and division in view of serum, this result is unexpected.As IL-6 concentration is raised, it was observed that leaving G0/G1 Arrested Cells, the conversion towards apoptotic cell.It should be noted that IL-6 exposures (Fig. 2 C) required for RA1c expression rises want much shorter than generate that apoptotic cell applied shown in Fig. 3 B.The prompting RA1c expression rises of these results are probably the early stage response to cellular stress, ultimately result in growth retardation or apoptosis.

(d) effect of the serum deprivation in other carcinoma of prostate models

In order to which whether the effect for assessing the serum deprivation observed in embodiment 2 (a) and 2 (b) in LNCaP cells is more generally applicable, experiment is repeated using other carcinoma of prostate models.A kind of such model is LUCaP77 prostate cancer xenografts model (see Chen etc., Am.J.Pathol.162：1349-1354(2003)).Using sieve and glass pestle by LUCaP77 tumor homogenates, then it is coated in the complete medium containing 20%FBS.Allow cell growth 10 days, with fresh complete medium or serum-free and change culture medium without phenol red culture medium afterwards.Also LNCaP cells are handled in an identical manner.IL-6 processing continues 7 hours, is harvested afterwards by mechanical lifting.By the cell of harvest with PBS once.Use RNAeasy^TMKit (Qiagen) is from the cell separation RNA harvested, as described in embodiment 2 (a).During RNA is separated all samples are handled with DNA enzymatic.Implement Q-PCR using the quantitative real-time PCR reagent described in embodiment 2 (a), primer and probe.As described in embodiment 2 (a), result is standardized relative to RPL19, and be shown in Fig. 4 A and 4B.

It is similar with the LNCaP results described in embodiment 2 (a) and 2 (b), LUCaP77 cells significantly more RA1c when expression in the case of lacking serum in there is serum than cultivating.It is worth noting that, IL-6 processing in complete medium background does not cause the RA1c in these cells to express rise, although when by cell serum starvation, as the extra rise (see Fig. 4 A, comparing the left side of figure and the right side of figure) of the appropriateness of RA1c expression is observed in the rise of IL-6 concentration.The Average Ct values of RA1c and RPL19 expression in vitro (ex vivo) cells of LUCaP77 are not influenceed by type of culture medium or IL-6 concentration.LNCaP cells are being determined under the same conditions with LUCaP77 cells (see Fig. 4 B).The notable rise that the IL-6 of RA1c generation response increasing concentrations is not observed in those cells cultivated in complete medium and occurs, but the notable rise of RA1c expression is observed in the cell cultivated in serum free medium, and observe when using IL-6 to handle serum-free cell further rise (Fig. 4 B).The rise that RA1c expresses response serum deprivation and IL-6 processing and occurred in LNCaP cells is noticeably greater than what is observed in LUCaP77 cells, although both cell types obviously demonstrate the expression rise that response serum deprivation and IL-6 handle the two and occurred.Some aspects (response IL-6 processing and the upper mediation response serum deprivation that occurs and the up-regulation that occurs) that these results demonstrate RA1c gene regulations are conservative between the external model of prostate cancer.

Embodiment 3：The influence that signal transduction path inhibitor is expressed RA1c

As many cell factors, IL-6 can stimulate several different intracellular signal transduction cascades, and these signal transductions then can be regulated and controled by other intracellular factors.For example, as it is known that suppression (Ahmed etc., J.Leukocyte Biol.72 of the p38 map kinases mediation to IL-6 signal transductions：154-162(2002)；Chang etc., Am.J.Physiol.Lung cell .Molec.Physiol.289：L446-L453 (2005)), and known IL-6 activates 4,5- phosphatidyl-myo-inositol 3- kinases (PI3K) (Xie etc., Prostate 60 in LNCaP cells：61-67 (2004)) (see Fig. 8).Known PI3K activation has a variety of downstream consequences, including promotees survival Akt/mTOR approach and protein kinase PDK1 activation, the latter's regulatory transcription via the activation of p70S6 kinases.LNCaP cells shortage feature PTEN, a kind of tumor suppressor thing opposite with PI3K effect, therefore, in LNCaP cells, PI3K downstream effector can be that composition is active.JAK/STAT3 approach is also activated (Hirano etc., Oncogene, 19 by IL-6：2548-2556(2000)).Therefore, it have evaluated the influence for the RA1c expression that several different known signal conduction depressant drugs are induced IL-6.

(a) effect of specificity PI3K and p 38 map kinase inhibitor

By LNCaP cells with equal density (about 0.5x10⁶Individual cells/well) it is coated in six orifice plates and is allowed to settle 72 hours, serum-free and phenol red culture medium are added afterwards and are allowed to settle 24 hours.Or cell is cultivated in the case of no inhibitor, or handle cell with LY294002 (inhibitor with the wide spectrum kinases of the given efficacy for PI3K) or high degree of specificity p38 map kinase inhibitors SB203580 (it blocks main cell stress response approach).By (2 μM and 4 μM) of LY294002 is added to suitable hole and incubates 1 hour, 50ng/mL IL-6 are added afterwards, then incubate 24 hours.By (5 μM and 10 μM) of SB203580 is added to suitable hole and incubates 1 hour, 50ng/mLIL-6 is added afterwards, then incubate 7 hours.By mechanical lifting come harvesting, and with PBS once.Use RNAeasy^TMKit (Qiagen) is from the cell separation RNA harvested, as described in embodiment 2 (a).During RNA is separated all samples are handled with DNA enzymatic.Implement Q-PCR using the Q-PCR systems described in embodiment 2 (a), reagent, primer and probe.As described in embodiment 2 (a), result is standardized relative to RPL19.

Some molecules in PI3K and P38 map kinase signal transduction paths also be have evaluated in LNCaP cells with the ability being appropriately activated after the known factors stimulated growth for activating those approach.By LNCaP cells with about 0.5x10⁶The density of individual cells/well is coated in six orifice plates.By cell culture 72 hours, handled 1 hour, stimulated 10 minutes with 10nM EGF afterwards with various inhibitor afterwards.By cell with cold PBS once, afterwards in the cold 2X sample buffers containing beta -mercaptoethanol crack.Load 35 μ l lysis things and run on 4-20% polyacrylamide gels, be then transferred to pvdf membrane using standard schedule.Assess the presence of (i.e. phosphorylation) PI3K and p38MAP kinsase signaling pathway components of activation by western blot using standard schedule using following antibody (both being from Cell Signaling Technologies)：Rabbit polyclonal anti-phosphorylation AKT Ser 473, mouse monoclonal anti-phospho map kinase p44/42, mouse monoclonal anti-phospho p38 map kinases, and mouse monoclonal anti-phospho mTOR.Trace standardization uses anti-beta-actin antibody.As a result it is shown in Fig. 5, and demonstrates in LNCaP cells the presence of those signal transduction components phosphorylation form of each, and shown inhibitor regulates and controls the effect of (activation) protein population of these phosphorylations.

As shown in Figure 6, addition LY294002 is substantially reducing at RA1c observed when the LNCaP cells of serum starvation are incubated together with single IL-6 to serum starvation and IL-6 processing cell and is overexpressed.In addition, the cell of addition LY294002 to serum starvation also reduces the RA1c expression (two posts and that leftmost post that compare rightmost in Fig. 6) induced during in the absence of IL-6 by serum deprivation.Although LY294002 processing reduction phosphorylation Akt levels, the activity equally energy potential explanation LY294002 effect unrelated with PI3K suppression.P38 MAPK inhibitor SB203580 processing also suppresses the RA1c expression (Fig. 7) of IL-6 inductions, although p38 itself is not raised by IL-6.

(b) effect of specific mTOR inhibitors

By LNCaP cells with about 0.5x10⁶The density of individual cells/well is coated in six orifice plates and allows it in complete medium in 37 DEG C and 5%CO₂Growth 24 hours.Culture medium is changed, and is replaced with fresh complete medium, by cell in 37 DEG C and 5%CO₂Overnight incubation.By rapamycin (100nM or 500nM) is added to suitable hole and incubates 1 hour, addition 50ng/mL IL-6, then incubate 7 hours afterwards.By mechanical lifting come harvesting, and with cold PBS once.Cell being harvested, through over cleaning is stored in -80 DEG C.From after taking out -80 DEG C, RNAeasy will be come from immediately^TMThe RLT lysis buffers of kit are laid equal stress on suspension cell added to cell pellet.The cell of freezing was never preserved more than one week.Again by the cell of resuspension with PBS once.Use RNAeasy^TMKit (Qiagen) is from the cell separation RNA harvested, as described in embodiment 2 (a).During RNA is separated all samples are handled with DNA enzymatic.Implement Q-PCR using the Q-PCR systems described in embodiment 2 (a), reagent, primer and probe.As described in embodiment 2 (a), result is standardized relative to RPL19.

As shown in Figure 9, single rapamycin treatment or single IL-6 processing cause the measurable rise that LNCaP cells RA1c is expressed.Show synergistically to strengthen the RA1c expression (Fig. 9) in handled cell however, both IL-6 and rapamycin are handled together.Any explanation is not limited to, concertedness is probably by being handled from IL-6 caused by the cellular stress being overlapped mutually combined with mTOR activity suppressions.IL-6 causes growth retardation in LNCaP cells, and PI3K/Akt/mTOR approach is also that composition is active in those cells, and is important for LNCaP cell growths.In this way, the combination that IL-6 processing and mTOR suppress stress can cause the collaboration up-regulation that RA1c is expressed.

(c) effect of AKT1/2 inhibitor

With about 0.5x10⁶The density coating LNCaP cells of individual cell per well, and cultivate 48 hours.Then culture medium is replaced with to fresh growth medium, is handled after 24 hours with the Akt1/2 inhibitor (Calbiochem) of shown concentration.Addition 50ng/mL IL-6 after Akt1/2 inhibitor is handled 1 hour.IL-6 processing is carried out 7 hours.Then by mechanical lifting come harvesting, then snap frozen and stayed overnight in liquid nitrogen in -80 DEG C of preservations with cold 1X PBSs once.Then RNA is separated from cell pellet using Qiagen RNAeasy kits.During RNA is separated sample is handled with DNA enzymatic.Addition Akt1/2 inhibitor causes RA1c courier (message) level to raise (Figure 10).Importantly, the combination of AKT inhibitor and external source IL-6 further improves RA1c courier (Figure 10).These effects are clearly additive.Consider together with mTOR histamine results as discussed above, this result opposes that Akt/mTOR approach is the positive regulator that RA1c expression responses IL-6 is present.

(d) effect that JAK/STAT3 suppresses

In order to assess the effect of JAK/STAT3 approach, promoter Analysis is implemented.Weng etc. reports STAT3 binding sites (the J.Cell Bioch.2005 that the RA1c promoters of presumption contain a prediction；96：1034-1048).Construct the luciferase reporter construct of the different zones driving by estimating RA1c promoters.Luciferase of the construct expression more than control level (being represented by pGL-3- carrier is carriers) of STAT3 binding sites is carried, and this expression is further enhanced (Figure 11) by adding external source IL-6.Acutely reduction composition is active and eliminates the IL-6 responses (Figure 11) of this promoter for the mutation (Figure 12) in STAT3 sites.Further, although JAK inhibitor AG490 itself slightly strengthens luciferase activity, the further rise (Figure 13) of luciferase activity is prevented when being combined with IL-6.In a word, these results are pointed out, and responsible RA1c expresses response IL-6 and elevated main path is JAK/STAT3 approach.

Embodiment 4：The influence that DHT is expressed RA1c

LNCaP cells are upset and grown in the case of it there is testosterone and correlation molecule to Androgen-sensitive.Previous research shows the induction to NE differentiation in LNCaP cells that IL-6 mediates by being blocked (Xie etc., Prostate 60 using androgen to those cells：61-67(2004)).Because research described above shows that IL-6 processing stimulates RA1c to express, therefore the influence of the RA1c expression of androgen is induced IL-6 and serum deprivation induction is investigated.

LNCaP cells are coated with equal density and cultivated three days, the culture medium are changed with the fresh complete medium containing 5 α-dihydrotestosterone (DHT) or without serum, without culture medium phenol red, containing DHT afterwards.For IL-6 processing, 10nM, 25nM, 100nM and 1 μM of DHT dosage are used in combination with 10ng/mL IL-6 in complete medium and without serum, without phenol red culture medium.All processing are stayed overnight, afterwards by mechanical lifting come harvesting.By the cell of harvest with PBS once, afterwards using RNAeasy^TMKit (Qiagen) separates RNA.During RNA is separated all samples are handled with DNA enzymatic.Implement Q-PCR using the Q-PCR systems described in embodiment 2 (a), reagent, primer and probe.As described in embodiment 2 (a), result is standardized relative to RPL19.

The RA1c expression that DHT processing is induced for the IL-6 RA1c expression induced and serum deprivation has substantive depression effect (Figure 14 A and 14B).The effect is dose dependent, and most notable in the case of it there is 100nMDHT.RPL19 Ct values are consistent in DHT process ranges, the reason for change for indicating cell viability is not the RA1c expression reductions observed by after DHT is handled.Consider together with the result from embodiment 2 and 3, this Notes of Key Data RA1c is the gene of stress-induced, it can provide survival advantage (Figure 14 C) to cancer cell.Under normal and sufficient growth conditions, RA1c expression is contained.Data are considered together, the RA1c expression rises of (such as IL-6 processing or serum deprivation) can be reversed or mitigated by growth promotion pathway activation (DHT) under prompting stressed condition, and (rapamycin) amplifies when growth promotion approach is by further suppress.

Embodiment 5：The proof of RA1c surface expressions

Although RA1c has a homology with seven transmembrane G protein protein-coupled receptor families, this area previously provided RA1c be on cell surface membrane can and rather than the evidence that is only merely positioned on intercellular membrane.In order to assess the cellular localization of RA1c albumen, use

(Roche) transfection reagent is overexpressed RA1c of the N-terminal with gD labels in human embryonic kidney cells (293S cells).With 2x10⁶The density coating 293S cells of individual cell/10cm wares, and it is allowed in 37 DEG C and in 5%CO₂In in complete growth medium grow 24 hours, transfect afterwards.Use

Reagent allows it to rest 48 hours with 5.6 μ g RA1c-pRK-N ends gD plasmid-transfected cells, and cell is taken out from plate with 5mM EDTA afterwards.Then clean cell 2 times with FACS buffer solution (the 1X PBS containing 3%BSA, 1mM EDTA), be suspended in afterwards in the anti-gD mAb of 4 μ g/mL and in incubated on ice 1 hour.Then cell is cleaned with cold FACS buffer solution three times, be suspended in afterwards in the anti-mouse secondary antibody (1: 500 dilution) of phycoerythrin (PE) mark and in incubated on ice 1 hour.Cell is cleaned with FACS three times, facs analysis is carried out afterwards.

As shown in Figure 15, facs analysis detect it is large numbers of be specifically bound to PE mark anti-mouse secondary antibodies cells, indicate RA1c be at 293S cell surfaces can and.The result is confirmed using expressing cho cell (result is not shown), the cell surface expression that RA1c is observed in the different cell lines from different organisms is indicated.

Claims (55)

1. Alleviate the method for the cellular stress response in cell 1. a kind of, including make the cells contacting reduce or block the RA1c in the cell to express or active compound.
2. 2. the method for claim 1 wherein the cell is cancer cell.
3. 3. the method for claim 2, wherein the cancer cell is prostate tumor cells.
4. 4. the method for Claims 2 or 3, wherein the cellular stress response is induced by chemotherapeutics.
5. 5. the method for claim 4, wherein the chemotherapeutics is selected from mTor inhibitor and Akt1/2 inhibitor.
6. 6. the method for claim 5, wherein the chemotherapeutics is the one or more mTor inhibitor being selected from the group：Rapamycin, CCI-779, RAD001, AP23573, XL7F65 and TAFA93 and their reactive derivative or the like.
7. 7. the method for claim 5, wherein the chemotherapeutics is the one or more Akt1/2 inhibitor being selected from the group：GSK690693, perifosine and XL418 and their reactive derivative or the like.
8. 8. the method for claim 1 wherein the compound is RA1c antagonists.
9. 9. the method for claim 8, wherein the one or more that the RA1c antagonists are selected from the group：Antibody, antibody fragment, antibody coupling matter, fit, small molecule and oligopeptides.
10. 10. the method for claim 9, wherein the RA1c antagonists specific inhibition RA1c is active.
11. 11. the method for claim 1 wherein compound reduction RA1c expression.
12. 12. the method for claim 1 wherein compounds block RA1c expression.
13. 13. the method for claim 11 or 12, wherein the one or more that the compound is selected from the group：Antisense polynucleotides, silence RNA molecule, catalytic RNA molecules and RNA-DNA block polymers.
14. 14. the method for claim 4, wherein the compound improves sensitiveness of the cell to the chemotherapeutics.
15. Alleviate the method for the cellular stress response in prostate cancer tumor cells 15. a kind of, including make the tumour cell contact reduction or block the compound of RA1c expression or activity.
16. 16. the method for claim 15, wherein the tumour cell is undergoing the chemotherapy carried out with the chemotherapeutics of inducing cell stress response.
17. 17. the method for claim 16, wherein the chemotherapeutics is selected from mTor inhibitor and Akt1/2 inhibitor.
18. 18. the method for claim 17, wherein the chemotherapeutics is the one or more mTor inhibitor being selected from the group：Rapamycin, CCI-779, RAD001, AP23573, XL7F65 and TAFA93 and their reactive derivative or the like.
19. 19. the method for claim 17, wherein the chemotherapeutics is the one or more Akt1/2 inhibitor being selected from the group：GSK690693, perifosine and XL418 and their reactive derivative or the like.
20. 20. the method for claim 15, wherein the compound is RA1c antagonists.
21. 21. the method for claim 20, wherein the one or more that the RA1c antagonists are selected from the group：Antibody, antibody fragment, antibody coupling matter, fit, small molecule and oligopeptides.
22. 22. the method for claim 21, wherein the RA1c antagonists specific inhibition RA1c is active.
23. 23. the method for claim 15, wherein compound reduction RA1c expression.
24. 24. the method for claim 15, wherein the compounds block RA1c is expressed.
25. 25. the method for claim 23 or 24, wherein the one or more that the compound is selected from the group：Antisense polynucleotides, silence RNA molecule, catalytic RNA molecules and RNA-DNA block polymers.
26. 26. the method for claim 16, wherein the compound improves sensitiveness of the tumour cell to the chemotherapeutics.
27. 27. the method for claim 26, wherein the tumour cell undergoes apoptosis with the ratio higher than cell not in contact with the compound.
28. 28. the method for claim 26, wherein the tumour cell undergoes growth retardation with the ratio higher than cell not in contact with the compound.
29. 29. a kind of method of the cellular stress response in cell of reduction of patient, including the reduction of effective dose is applied to the patient or the compound of RA1c expression or activity is blocked.
30. 30. the method for claim 29, wherein the patient is cancer patient.
31. 31. the method for claim 30, wherein the cell is prostate cancer tumor cells.
32. 32. the method for claim 31, wherein the tumour cell is undergoing the chemotherapy carried out with the chemotherapeutics of inducing cell stress response.
33. 33. the method for claim 32, wherein the chemotherapeutics is selected from mTor inhibitor and Akt1/2 inhibitor.
34. 34. the method for claim 33, wherein the chemotherapeutics is the one or more mTor inhibitor being selected from the group：Rapamycin, CCI-779, RAD001, AP23573, XL7F65 and TAFA93 and their reactive derivative or the like.
35. 35. the method for claim 33, wherein the chemotherapeutics is the one or more Akt1/2 inhibitor being selected from the group：GSK690693, perifosine and XL418 and their reactive derivative or the like.
36. 36. the method for claim 29, wherein the compound is RA1c antagonists.
37. 37. the method for claim 36, wherein the RA1c antagonists be selected from the group in one or more：Antibody, antibody fragment, antibody coupling matter, fit, small molecule and oligopeptides.
38. 38. the method for claim 37, wherein the RA1c antagonists specific inhibition RA1c is active.
39. 39. the method for claim 29, wherein compound reduction RA1c expression.
40. 40. the method for claim 29, wherein the compounds block RA1c is expressed.
41. 41. the method for claim 39 or 40, wherein the one or more that the compound is selected from the group：Antisense polynucleotides, silence RNA molecule, catalytic RNA molecules and RNA-DNA block polymers.
42. 42. the method for claim 32, wherein the compound improves sensitiveness of the tumour cell to the chemotherapeutics.
43. 43. the method for claim 42, wherein the tumour cell undergoes apoptosis with the ratio higher than cell not in contact with the compound.
44. 44. the method for claim 42, wherein the tumour cell undergoes growth retardation with the ratio higher than cell not in contact with the compound.
45. 45. a kind of composition, it is comprising RA1c antagonists and improves the compound that RA1c is expressed, and optionally further includes pharmaceutical acceptable carrier.
46. 46. the composition of claim 45, wherein the compound is selected from following one or more：Rapamycin, CCI-779, RAD001, AP23573, XL7F65, TAFA93, SK690693, perifosine and XL418 and their reactive derivative or the like.
47. 47. the composition of claim 46, wherein the RA1c antagonists are antibody and the compound is selected from following one or more：Rapamycin, CCI-779, RAD001, AP23573, XL7F65, TAFA93, SK690693, perifosine and XL418 and their reactive derivative or the like.
48. 48. a kind of method whether measure chemotherapeutics induces the cellular stress response in cancer cell, including：

    A) cancer cell is made to contact the chemotherapeutics,

    B) the RA1c expressions in the cancer cell are determined,

    C) 1) the RA1c expressions in relatively more described cancer cell with contacting the RA1c expressions in the chemotherapeutics foregoing description cancer cell, or 2) RA1c expressions in control cell, wherein RA1c expression rises indicate the induction to cellular stress response.
49. 49. the method for claim 48, wherein the cancer cell is prostate gland cancer cell.
50. 50. the method for claim 49, wherein the prostate gland cancer cell is LNCaP cells.
51. 51. the method for claim 48, wherein the chemotherapeutics is selected from mTor inhibitor and Akt1/2 inhibitor.
52. 52. a kind of method of use conjoint therapy treating cancer, including：

    A) cancer cell contact is made to improve the chemotherapeutics of RA1c expression, and

    B) compound of the specific binding RA1c polypeptides of the cancer cell contact effective dose is made,

    Thus the treatment of cancer effect of the combination of the chemotherapeutics and the compound is collaboration, and it exceedes the chemotherapeutics or any single effect of compound.
53. 53. the method for claim 52, wherein the chemotherapeutics is mTOR or Akt1/2 inhibitor.
54. 54. the method for claim 52, wherein the compound is anti-RA1c antibody.
55. 55. the method for claim 54, wherein the anti-RA1c antibody is coupled to cytotoxic agent.

Images