CN101781653B - Jujube tree metallothionein gene and application thereof to treatment of heavy metal pollution - Google Patents

Abstract

The invention relates to the technical filed of gene engineering, in particular to a jujube tree metallothionein gene and application thereof to the treatment of heavy metal pollution. The jujube tree metallothionein gene has a nucleotide sequence and an amino acid sequence of SEQ ID NO: 1 and SEQ ID NO: 2 as shown in a sequence table. The application method comprises the following steps: (1) connecting the jujube tree metallothionein gene ZjMT to an expression vector pGEX-4T-2 after the PCR augmentation, and cloning the jujube tree metallothionein gene ZjMT to the expression vector for constructing recombinant expression plasmids pGEX-4T-2-ZjMT; and (2) converting the recombinant expression plasmids pGEX-4T-2-ZjMT into expression strains E.coli BL21 for constructing genetic engineering strains pGEX-ZjMT-B. The combining capability of the engineering strains on the heavy metal is obviously enhanced, and the invention belongs to an effective measure for realizing the biological recovery of the heavy metal and the control of the heavy metal pollution. The invention discovers that the ZjMT has the absorption effect on heavy metal ions for the first time. Experiments prove that the genetic engineering strains pGEX-ZjMT-B can endure the toxic effect of the heavy metal ions to different degrees, and at the same time, enrichment amount test experiments prove that the heavy metal enriching amount is greatly improved.

Description

Jujube tree metallothionein gene and the application in handling heavy metal contamination thereof

Technical field

The present invention relates to gene engineering technology field, be specially a kind of jujube tree metallothionein gene and the application in handling heavy metal contamination thereof.

Background technology

Water body and soil are the important component parts of human ecological environment, also are the main natural resourcess that the mankind depend on for existence.But along with developing rapidly of modern industry, contain a large amount of heavy metals in the environmental wastes such as industrial waste, sludge refuse, municipal wastewater, radwaste, Mining wastes, as cadmium, mercury, lead etc., they can not be by biological degradation after entering environment, mostly participate in the food chain circulation, and finally accumulation in vivo, destroy organism normal physiological Metabolic activity, have a strong impact on surrounding environment and human and livestock health.Up to now, heavy metal contamination has become one of important source of countries in the world environmental pollution.How to handle heavy metal contamination effectively, reclaim noble metal, implement the technology shifts of heavy metals exceeding standard discharging-qualified discharge-zero release as early as possible, become current protection environment, saved the only way which must be passed of resource.

Improvement to heavy metal contamination does not at present have special effective means, and except that factory is reduced the improvement of heavy metals emission, still incompetence is carried out meticulous processing to the zone of pollution.Usually adopt measures such as engineering, agricultural, improvement and biology to carry out the improvement of heavy metal contamination in the world for the heavy metal contamination of soil; And for the traditional treatment process of heavy metal-containing waste water mainly contain that chemical precipitation method, chemistry redox method, electrolytic process, absorption method, electrodialysis are sent out, reverse osmosis method etc., these methods are effective under certain condition, but all have relative merits separately.Though for example chemical precipitation method is easily removed a large amount of metal ions fast, forms secondary pollution easily.Although ion exchange method is simple to operate, need certain conditional effect better, and ion exchange resin select switching performance bad, cost an arm and a leg.

Compare with traditional treatment process, biosorption process is with its wide application prospect and environment, social benefit have caused people's attention preferably.So-called biological process generally is meant plant, the microorganism (as bacterium, fungi, yeast, algae etc.) that utilizes occurring in nature, after certain domestication is cultivated, form some and can absorb, adsorb the heavy metal ion in contaminated soil and the water, thereby reach the improvement purpose.Studies show that have many plants on the soil of heavy metal contamination, to grow, contain the heavy metal element of high density in its root, stem, the leaf; Microorganisms such as a lot of bacteriums, algae, fungi have very strong adsorptive power to metal ion.Compare with traditional chemical, physical method, biological process is handled contaminated soil, waste water and is had economy, advantage such as efficient and innoxious, has especially more shown the advantage that it is suitable in handling low-concentration heavy metal Contaminated soil, waste water.

Yet the general biomass of anti-heavy metal plant that directly filters out from nature is few, is difficult to directly apply to the improvement contaminated soil; The microorganism of selecting is also often low to the bioaccumulation efficiency of heavy metal ion, poor to the adaptive faculty of environment, is unfavorable for that the engineering of biological absorption is used.Along with the develop rapidly of molecular biotechnology, people can transform microorganism, the bacterial strain of seed selection excellent property by the wish of oneself in recent years.The utilization genetic engineering technique makes up the genetically modified microorganism with superpower accumulation ability and highly selective, has become the new developing direction that heavy metal wastewater thereby biological treatment and heavy metal resources are rationally utilized.

The current focus of utilizing biological process to handle heavy-metal contaminated soil, waste water focuses mostly at some new genes of clone, make up on novel gene engineering bacteria and the transgenic plant, promptly by microorganism is carried out microexamination, determine the mechanism of its absorption heavy metal and in conjunction with the site of heavy metal, use genetic engineering technique then, the gene that will have an absorption property changes in the big plant materials of biomass or is cloned in homology or the allogenic microorganism, improves the avidity, enhancing microorganism of microorganism and the heavy metal ion selectivity to the target heavy metal ion with this.

Metallothionein(MT) (Metallothionein, be called for short MT) be a class extensively be present in the life entity be rich in halfcystine, can be by heavy metal inductive lower molecular weight metal binding protein, it is abundant that it dredges basic content, and in the detoxifcation of the transportation that participates in metal ion and supply, subduction metal ion, keep the side such as stable state of intracellular environment and play an important role.As far back as nineteen fifty-seven, Margoshes and Vallee separate from the cell of horse kidney and have isolated animal MT first when the biological function of research heavy metal tin.And the research of plant metallothionein is started late, Casterline and Barnett have found plant MT first from the soybean root in 1977, then first plant MT albumen wheat endosperm Ec albumen is separated, and finds from various plants such as pea, paddy rice, Arabidopis thaliana, tomato, buckwheat, Indian mustard and corn successively later on and has separated many plant MT genes.Up to the present, yet there are no the report of from jujube tree, isolating the MT gene and being applied to environmental improvement.

Summary of the invention

The object of the present invention is to provide a kind of jujube tree metallothionein gene and the application in handling heavy metal contamination thereof.

The present invention adopts following technical scheme to realize: a kind of jujube tree metallothionein gene, its nucleotide sequence and with its corresponding amino acid sequence SEQ ID NO:1 and SEQ ID NO:2 as shown in sequence table respectively.

Utilize described jujube tree metallothionein gene to prepare the method for genetic engineering bacterium, may further comprise the steps: (1) is connected jujube tree metallothionein gene ZjMT behind pcr amplification with expression vector pGEX-4T-2, ZjMT is cloned into expression vector with the jujube tree metallothionein gene, makes up recombinant expression plasmid pGEX-4T-2-ZjMT; (2) recombinant expression plasmid pGEX-4T-2-ZjMT is transformed into expression strain Ecoli BL21 (DE3), the genetic engineering bacterium pGEX-ZjMT-B of successful construction expression fusion rotein.

The present invention is: the gene fragment of being cloned into a 225bp (Nucleotide) from the cDNA library of jujube growth earlier results branch, through with GnBank in the gene order comparison of having registered, prove that this fragment is the full-length cDNA of a metallothionein gene, with its called after ZjMT ( ZIzyphus jujuba Mill Me tAllothionein).According to the nucleotide sequence of this gene, design and synthesize a pair of primer that contains restriction enzyme site: upstream primer P1 sequence is 5 ' CT GGATCCATGTCTGGCTGTGGTTGT 3 ' comprises BamH I restriction enzyme site (part of promptly ruling) and protection base CT, and metallothionein(MT) initiator codon ATG; Downstream primer P2 is 3 ' AG AAGCTTTCATTTGCACGTGCATG 5 ' comprises Hind III restriction enzyme site (part of promptly ruling) and protection base AG, and metallothionein(MT) terminator codon TGA.Use round pcr successfully to amplify the target gene fragment of ZjMT then, the purpose clip size of electrophoretic analysis ZjMT gene is about 241bp, consistent with estimated molecular weight size (full length gene 225bp, enzyme-added cutting after site and the protection base is 241bp).After carrier pGEX-4T-2 was made into the T carrier, the purpose fragment of the ZjMT gene that goes out with pcr amplification was connected, and the ZjMT gene clone to expression vector pGEX-4T-2, is made up recombinant expression plasmid pGEX-4T-2-ZjMT.With the cold shock conversion method recombinant expression plasmid pGEX-4T-2-ZjMT is transformed into expression strain E.coli BL21 (DE3) then, double digestion through PCR and BamH I, HindIII is identified, the stable expression bacterial classification that changes over to of transformant confirms that containing ZjMT genetic engineering bacterium pGEX-ZjMT-B successfully constructs.After IPTG induces, the molecular weight identification of SDS-PAGE, the fusion rotein of about 35kDa size that confirmed genetic engineering bacterium pGEX-ZjMT-B successful expression and estimates that the molecular weight of albumen size is consistent.Simultaneously through this genetic engineering bacterium of verification experimental verification at inductor IPTG final concentration 0.1mM, induction time behind 4h, it is maximum that the Expression of Fusion Protein amount reaches.

The present invention also provides a kind of jujube tree metallothionein gene and the application in handling heavy metal contamination thereof.

The carrier pGEX-4T-2-ZjMT that carries the jujube tree metallothionein gene is changed among the coli strain E.coli BL21 (DE3) by genetic engineering means, make up bioengineered strain pGEX-ZjMT-B.This project bacterial strain obviously strengthens the binding ability of heavy metal, is the effective means that realizes the biological recovery heavy metal and administer heavy metal contamination.The present invention finds that first the jujube tree metallothionein gene has adsorption to heavy metal ion, and first the bioengineered strain pGEX-ZjMT-B that makes up has been carried out heavy metal ion adsorbed experiment.Experimental results show that this genetic engineering bacterium pGEX-ZjMT-B can tolerance heavy metal ion in various degree (comprise Cu, Pb, Cd, Cr, Zn, Mn, Ni, toxic action Al) shows that by the enriching quantity determination experiment engineering bacteria pGEX-ZjMT-B differs widely to different heavy metal ion adsorbed abilities with contrast bacterium pGEX-B simultaneously, and engineering bacteria pGEX-ZjMT-B compares with contrast bacterium pGEX-B, and enriching heavy metal ionic amount improves greatly.

Description of drawings

Fig. 1 is the pcr amplification result of ZjMT gene

Fig. 2 is a pGEX-4T-2-ZjMT recombinant plasmid bacterium colony PCR qualification result

Fig. 3 is a pGEX-4T-2-ZjMT plasmid double digestion qualification result

Fig. 4 is a pGEX-ZjMT-B recombinant plasmid bacterium colony PCR qualification result

Fig. 5 is a pGEX-4T-2-ZjMT recombinant plasmid double digestion qualification result

Fig. 6 is the SDS-PAGE analytical results of pGEX-ZjMT-B

Fig. 7 is the influence result of IPTG inducing culture time to the ZjMT expressing fusion protein

Fig. 8 is the influence result of IPTG induced concentration to the ZjMT expressing fusion protein

Fig. 9 is the growth curve of bacterial classification

Figure 10 is the growth curve of pGEX-ZjMT-B in the different metal ion

Figure 11 is the growth curve of pGEX-ZjMT-B in the different Cu ionic concn

Figure 12 is the growth curve of pGEX-ZjMT-B in different plumbum ion concentrations

Figure 13 is the growth curve of pGEX-ZjMT-B in different concentration of cadmium ions

Figure 14 is the growth curve of pGEX-ZjMT-B in the different aluminum ionic concn

Figure 15 is the growth curve of pGEX-ZjMT-B in the DIFFERENT Cr ionic concn

Figure 16 is the growth curve of pGEX-ZjMT-B in different manganese ion concentrations

Figure 17 is the growth curve of pGEX-ZjMT-B in different nickel ion concentrations

Figure 18 is the growth curve of pGEX-ZjMT-B in the Different Zinc ionic concn

Figure 19 is that pGEX-ZjMT-B is to Cu ²⁺The absorption collection of illustrative plates

Figure 20 is that pGEX-ZjMT-B is to Pb ²⁺The absorption collection of illustrative plates

Figure 21 is that pGEX-ZjMT-B is to Cd ²⁺The absorption collection of illustrative plates

Embodiment

Embodiment 1: the acquisition of jujube tree metallothionein gene ZjMT and the structure of recombinant expression plasmid pGEX-4T-2-ZjMT

One, experimental technique

1.1 the preparation of competent cell

Get frozen bacillus coli DH 5 alpha in-80 ℃ of refrigerators, streak inoculation on the LB culture medium flat plate, 37 ℃ of overnight incubation.Picking list bacterium colony from flat board is inoculated in the LB liquid nutrient medium, 37 ℃ of constant temperature oscillator 225r/min jolting overnight incubation.Inoculum size according to 1% is seeded to overnight culture in the LB liquid nutrient medium of 50mL, and the 200r/min jolting is cultured to OD ₆₀₀Be 0.5-0.6.Culture is placed 10min on ice, 4 ℃, 8, the centrifugal 10min of 000g.Abandon supernatant, add the 75mmol/L CaCL of 5mL precooling ₂The solution suspension cell places 10min on ice, makes cell sensitization.4 ℃ 8, the centrifugal 10min of 000g collects thalline.Every 50mL stock culture adds the 75mmol/L CaCl of 2mL ice precooling ₂Preserve liquid (including 15% glycerine), by 200 μ L/ centrifuge tube packing cells ,-80 ℃ of refrigerators are preserved standby.

1.2 connect the conversion of product

The connection product that 5 μ L are to be transformed joins the fresh of 100 μ L or is stored among-80 ℃ the competent escherichia coli cell DH5 α, and gentle mixing is placed 30min on ice.Put into the circulator bath heat-shocked 90s that is warmed to 42 ℃ in advance, fast pipe is transferred in the ice bath, make cell cooling 3-5min.Add 400 μ L SOC substratum, pipe is transferred on 37 ℃ the shaking table, temperature is bathed 40min and is made bacteria resuscitation, and the recovery phase should be gentle shakes cell (rotating speed be lower than 225 change part).The competent cell that proper volume has transformed is transferred to LB flat board (containing resistance).Place room temperature to be absorbed until liquid flat board, be inverted flat board, 37 ℃ leave standstill overnight incubation.

1.3 the extraction of plasmid DNA

Alkaline lysis rapid extraction plasmid pGEX-4T-2, pSPORT1-MT.Its extracting method is well-known to those having ordinary skill in the art, is not described in detail at this.

1.4T the preparation of carrier

With Smal I enzymolysis 1 μ g pGEX-4T-2,37 ℃ more than the 2h; Solution extended volume to 100 μ l adds equal-volume phenol: chloroform: behind the abundant mixing of primary isoamyl alcohol (V: V: V=25: 24: 1), and 1,3000g 10min; Shift the upper strata water to new centrifuge tube, add the cold dehydrated alcohol of 200 μ l, place more than the 30min with precipitation linearizing DNA for-20 ℃; 1,4000g 10min centrifugal collecting precipitation is abandoned supernatant, 70% washing with alcohol post precipitation, vacuum-drying.

Linearization plasmid DNA is dissolved in the 10 μ l water, is sequentially added into following material: 2.5 μ l, 10 * PCR buffer, 0.5 μ l100mmol/L dTTP, 0.5 μ l Taq archaeal dna polymerase (5U/ μ l), water replenishes volume to 25 μ l, 72 ℃ of 2h; Water enlarges reaction system to 100ul, uses equal-volume phenol respectively: chloroform: primary isoamyl alcohol (V: V: V=25: 24: 1), chloroform: primary isoamyl alcohol (V: V=24: 1) extracting, 1,3000g 10min; Shift the upper strata water to new centrifuge tube, add the cold dehydrated alcohol of 200 μ l, place more than the 30min for-20 ℃; 1,4000g 10min centrifugal collecting precipitation is abandoned supernatant, 70% washing with alcohol precipitation twice, vacuum-drying.Precipitation is dissolved in an amount of TE solution, and content is roughly 25-50ng/ μ l, and-20 ℃ of preservations are standby.

1.5 the acquisition of ZjMT nucleotide sequence

Gather the fruitful branch (jujube hangs) of tall bottle with spout jujube tree (Ziziphus jujuba Mill.HUPING) the about 2mm of length spring, utilize the CTAB method to extract total RNA, according to mRNA purification kit (article No.: Z5200) available from Promega (U.S.) method separation and purification mRNA from the total RNA that extracts.Utilize cDNA library construction test kit (article No.: 18248-039) available from Invitrogen (U.S.) construction cDNA library.CDNA in the library that obtains is connected with cloning vector pSPORT1, connect product and be converted into E.coli DH5 α competent cell, coat the 37 ℃ of overnight incubation of plate that contain amicillin resistance, blue hickie screening recombinant plasmid also entrusts Shanghai to give birth to worker's order-checking.

With sequencing result utilize NCBI ( Www.ncbi.nlm.nih.gov/) on-line analysis software carries out Blast and analyze, the result shows that one of them cDNA sequence is the metallothionein(MT) homologous gene complete sequence in the jujube tree.With its called after ZjMT ( ZIzyphusjujuba Mill Me tAllothionein).

According to the synthetic following primer of accurate nucleotide sequence design and trust Shanghai Sangon Biological Engineering Technology And Service Co., Ltd of the above-mentioned jujube tree metallothionein gene that has obtained, be used for the clone of ZjMT gene.Upstream primer P1 sequence is 5 ' CT GGATCCATGTCTGGCTGTGGTTGT 3 ' comprises BamH I restriction enzyme site (part of promptly ruling) and protection base CT, and metallothionein(MT) initiator codon ATG; Downstream primer P2 is 3 ' AG AAGCTTTCATTTGCACGTGCATG 5 ' comprises Hind III restriction enzyme site (part of promptly ruling) and protection base AG, and metallothionein(MT) terminator codon TGA.Primer is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

With cloning vector pSPORT1-ZjMT is template, is primer with P1 and P2, and amplification obtains to contain the jujube tree metallothionein gene of complete open reading frame.The PCR reaction system consists of: 5 μ L, 10 * PCR buffer, and 1 μ L 2.5Mm dNTPs, 10pmol P1,10pmol P2,1.5U Taq archaeal dna polymerase, the template of 50ng, deionized water replenishes volume to 50 μ L.The pcr amplification condition is: 94 ℃ of pre-sex change 5min, and 94 ℃ of 30s, 52 ℃ of 30s, 35 circulations of 72 ℃ of 1min, last 72 ℃ are extended 5min.

Get 5 μ L PCR products, 1.2% agarose gel electrophoresis analysis confirmation clip size.According to DNA purification kit description operation, purified pcr product.

1.6 the structure of recombinant expression plasmid pGEX-4T-2-ZjMT

With dna ligase the pGEX-4T-2-T carrier for preparing is connected with ZjMTPCR product behind the purifying, ligation system cumulative volume is 10 μ L, comprises 0.5 μ L 4DNA ligase enzyme, 300ng gene fragment and 300ng pGEX-4T-2-T.16 ℃ of connections are spent the night, and will connect product by preceding method and be converted into competent escherichia coli cell.

1.7 the evaluation of recombinant expression plasmid

Bacterium to be transformed is after growing bacterium colony on the amicillin resistance flat board, with the transformant bacterium colony of 24 whites of aseptic toothpick picking, boiling water bath cracking.Get 1 μ L and carry out the PCR positive identification as template, it is streak culture to be accredited as the male transformant.

PCR is accredited as after male clone extracts plasmid DNA with the alkali cracking subtraction, carries out the single endonuclease digestion evaluation with BamH I again.Above-mentioned single endonuclease digestion is not cut out the segmental plasmid pGEX-4T-2-ZjMT of purpose, identify with BamH I and HindIII double digestion, the segmental size of checking is preserved the segmental positive bacteria of purpose behind the agarose gel electrophoresis.

1.8 sequencing

Enzyme cut identify that correct positive colony plasmid serves the sea and give birth to worker bio-engineering corporation and carry out sequencing, obtain the nucleotide sequence and the amino acid sequence coded thereof of jujube tree metallothionein gene, as sequence table SEQ ID NO:1 and SEQ ID NO:2.

Two, experimental result and analysis

2.1PCR the ZjMT gene fragment of amplification

The recombinant plasmid pSPORT1-ZjMT that contains the ZjMT gene is a template, pcr amplification goes out the purpose fragment, amplified production is through showing that with molecular weight marker (marker) contrast electrophoresis result amplified fragments is consistent as shown in Figure 1 with estimated molecular weight 241bp size, 1:DNA marker among the figure; The 2:PCR product.

2.2 the structure of recombinant expression plasmid pGEX-4T-2-ZjMT and evaluation

Carrier pGEX-4T-2-T is with after the ZjMT fragment is connected, and single bacterium colony result after PCR identifies shows that tangible goal gene amplified band is arranged between 241bp, consistent with expected results, as shown in Figure 2, and 1:DNA marker among the figure; 2-9: bacterium colony PCR; Extraction has the positive colony plasmid of amplified band and after BamH I single endonuclease digestion does not have the purpose fragment, this plasmid is identified through BamH I and HindIII double digestion, restriction enzyme mapping as shown in Figure 3,1:DNA marker among the figure; The 2:pGEX-4T-2-ZjMT plasmid enzyme restriction, the result shows the band that a 241bp is arranged, and is in full accord with former pcr amplification band, proves the expression vector establishment success of goal gene ZjMT, the expression vector called after pGEX-4T-2-ZjMT that obtains.

2.3 experimental result is summed up

According to the accurate gene order of jujube ZjMT, design and synthesize a pair of primer that contains restriction enzyme site, success is cloned to such an extent that contain the ZjMT gene of entire reading frame from pSPORT1-MT, use round pcr successfully to amplify the target gene fragment of ZjMT, target gene fragment size by electrophoretic analysis ZjMT is about 241bp, and is consistent with the estimated molecular weight size.Target gene fragment gene and the expression vector pGEX-4T-2 of the external source fragment ZjMT of pcr amplification are carried out the A/T clone, made up expression vector pGEX-4T-2-ZjMT.Being configured to next step and in prokaryotic system, expressing the ZjMT gene and lay a good foundation of this expression vector.

Embodiment 2: the structure of genetic engineering bacterium pGEX-ZjMT-B (being the expression of ZjMT in prokaryotic organism)

One, experimental technique

3.1 the structure of genetic engineering bacterium pGEX-ZjMT-B and screening

1. recombinant plasmid pGEX-4T-2-ZjMT that preceding chapter is made up and carrier pGEX-4T-2 are by the heat shock method, import in expression strain E.coli BL21 (DE3) competent cell, be applied to the LB flat board that contains penbritin and kalamycin resistance respectively, 37 ℃ leave standstill overnight incubation.

2. the flat board that transforms from the recombinant plasmid pGEX-4T-2-ZjMT of 37 ℃ of incubated overnight well-grown 5 single bacterium colonies of random choose are respectively respectively got 1/2nd bacterium colony boiling water bath cracking, carry out PCR and identify, the positive engineering bacteria that identifies is rule again, preserve.

3. the alkali cracking subtraction extracts the positive recombinant plasmid that PCR identifies, and carries out double digestion recombinant plasmid pGEX-4T-2-ZjMT with BamHI and HindIII, the stability of agarose gel electrophoresis checking plasmid.

4. the positive engineering bacteria that identifies is rule again and preserved portion, and is standby.

5. carrying out SDS-PAGE from the positive engineering bacteria pGEX-ZjMT-B (importing the bacterial strain of the E.coli BL21 (DE3) of pGEX-4T-2-ZjMT plasmid) that identifies with contrast bacterium pGEX-B (importing the bacterial strain of the E.coli BL21 (DE3) of pGEX-4T-2 plasmid) detects.Add the IPTG final concentration to 0.4mmol/L, carry out inducing culture 5h at 37 ℃ respectively.

3.2SDS-PAGE discontinuous system electrophoresis specimen preparation

1. with 1-2 single bacterium colony of positive engineering bacteria pGEX-ZjMT-B and contrast bacterium pGEX-B difference picking, insert the LB liquid nutrient medium that 10mL contains penbritin and kalamycin resistance respectively, 37 ℃ of overnight incubation.

2. be inoculated on the identical LB substratum in 1: 100 ratio, cultivate more than the 2-4h, for 37 ℃ to OD ₆₀₀Be about 0.5.

3. the IPTG that adds different concns in culture, 37 ℃ are continued aerated culture.

4. get the 2mL sample in different induction times and be put in the Eppendorf tube, room temperature, 13, the centrifugal 1min of 000g.

5. precipitation is resuspended in 200 μ L, 1 * SDS sample-loading buffer, and the time spent adds 20 μ L mercaptoethanols, mixing.100 ℃ of heating 5-10min place on ice, treat upward sample of the intact back of whole sample preparation.

3.3SDS-PAGE discontinuous system electrophoresis working method

1. sheet glass is cleaned with tap water, SDS, tap water successively, used the dehydrated alcohol wiped clean, rinse well with ultrapure water again, dry.After treating that sheet glass is done, sheet glass is installed according to the explanation of producer.

2. take by weighing the 1.5g agar powder, put into triangular flask, add 100mL 1 * electrophoretic buffer, heating for dissolving is put and is cooled to non-scald on hand (about 50-60 ℃) on the desktop, and beginning is at sheet glass outward flange perfusion electrode glue.After the electrode mucilage binding is intact, leave standstill about 15min.

3. according to preparing 15% separation gel shown in the following table 3-1 earlier.In the break joint of two sheet glass, inject separation gel solution rapidly, notice that action is too not big, prevent bubble.Available 5mL pipettor is drawn sol solution and is evenly irritated down, the peptization hydrorrhea is not arrived the outside.Stop perfusion from about the 5cm of sheet glass upper end, seal the liquid level of glue with a little ultrapure water, gel is hung down, and oneself is positioned over the about 30min of room temperature and treats that glue solidifies fully.

Table 3-1SDS-PAGE separation gel and concentrated glue component list

4. blot water on the liquid level with filter paper, perfusion 5% concentrates glue, stops perfusion from about the 2mm of sheet glass upper end, inserts clean comb immediately in concentrating sol solution, avoids sneaking into bubble, and gel is hung down under the self-purchased room temperature.

5. after the spacer gel polymerization fully, carefully shift out comb, immediately with the deionized water wash loading slot removing unpolymerized dignified thing, about one hour after, in electrophoresis chamber, add 1 * electrophoretic buffer.

6. after concentrating glue polymerization fully, carefully shift out comb, use the micropipet application of sample.

7. open electrophoresis apparatus, the beginning electrophoresis concentrates glue voltage stabilizing 70v, but electric current surpasses 20mA, when tetrabromophenol sulfonphthalein in the gel arrives separation gel, boost to 150v and continue electrophoresis, when tetrabromophenol sulfonphthalein apart from separation gel bottom, 1cm place, gel bottom, electrophoresis end.

8. glue is unloaded, the lower-left corner cut adds an amount of stationary liquid and fixes processing.

9. the about 1.5h of gel sets, the Xylene Brilliant Cyanine G R-250 2h that dyes, decolour at last to background clear till.

10. take a picture and preserve the observation analysis result.

3.4 the expression of fusion protein molecule amount and mensuration

Carrying out SDS-PAGE from the positive engineering bacteria pGEX-ZjMT-B that identifies with contrast bacterium pGEX-B detects.Add the IPTG final concentration to 0.4mM, carry out inducing culture 5h at 37 ℃ respectively.

Separation criterion molecular weight protein matter and recombinant protein to be measured on same block of SDS-PAGE gel, gel is after Xylene Brilliant Cyanine G R-250 dyeing, take a picture and preserve, utilize the Protein Analysis of biosoftware net then, molecular weight to recombinant protein carries out analytical calculation, and engineering bacteria pGEX-ZjMT-B expressing protein size is consistent with expectation.

3.5IPTG induce the ZjMT fusion rotein is influenced

3.5.1IPTG induction time is to the influence of ZjMT expressing fusion protein

Choose the positive engineering bacteria pGEX-ZjMT-B that identifies, 37 ℃ of shaking culture are to OD ₆₀₀Value is about 0.5, add people IPTG to final concentration be 0.4mM, 37 ℃ of inducing culture, take out 2mL bacterium liquid in 0h, 1h, 2h, 3h, 4h, 5h, 6h, insert sub pGEX as blank not contain, bacterium pGEX-B add equally people IPTG to final concentration be 0.4mM, 37 ℃ of inducing culture, take out 2mL bacterium liquid in 0h, 1h, 2h, 3h, 4h, method by above-mentioned specimen preparation prepares sample, each sample is got 20 μ L, carries out SDS-PAGE and detects, and analyzes the influence of bacterium liquid induction time to protein induced expression amount.

3.5.2IPTG induced concentration is to the influence of ZjMT expressing fusion protein

Choose the positive engineering bacteria pGEX-ZjMT-B that identifies, 37 ℃ of shaking culture are to OD ₆₀₀Value is about 0.5, add IPTG to final concentration be respectively 0,0.1,0.2,0.4,0.6,0.8,1.0,1.2mM, 37 ℃ of inducing culture 4h, insert sub pGEX as blank not contain, bacterium pGEX-B add equally IPTG to final concentration be respectively 0,0.1,0.2,0.4,0.6,0.8,1.0mM, prepare sample by the method for above-mentioned specimen preparation, each sample is got 20 μ L, carry out SDS-PAGE and detect, analyze of the influence of bacterium liquid induced concentration protein induced expression amount.

Two, experimental result and analysis

4.1 the screening of reorganization bacterium

The result after PCR identifies who contains recombinant plasmid pGEX-4T-2-ZjMT shows that tangible goal gene amplified band is arranged at the 241bp place, consistent with expected results as shown in Figure 4,1:DNA marker among the figure; 2-4: genetic engineering bacterium pGEX-ZjMT-B bacterium colony PCR; Extraction has the positive colony plasmid of goal gene, carries out the double digestion recombinant plasmid with BamHI and HindIII, and agarose gel electrophoresis knot shows a band at the 241bp place, collection of illustrative plates as shown in Figure 5, among the figure: 1:DNA marker; 2-3:pGEX-4T-2-ZjMT plasmid double digestion; The carrier pGEX-4T-2-ZjMT that proof has goal gene ZjMT successfully changes among the intestinal bacteria E.coli BL21 (DE3).

4.2 the SDS-PAGE of genetic engineering bacterium pGEX-ZjMT-B expressed fusion protein analyzes

Engineering bacteria pGEX-ZjMT-B takes a sample after IPTG induces 4h, electrophoresis result as shown in Figure 6, among the figure: 1: low molecular weight protein (LMWP) marker; 2:pGEX-ZjMT-B; 3:pGEX-B, the GST molecular weight of albumen is 26.985kDa, iso-electric point is 6.453, add that the external source fragment MT gene fragment size that is recombined into is 237bp, its genetic information of carrying is translated into 79 amino-acid residues in the mode of triplet codon, molecular weight is about 8kDa, through the Protein of biosoftware net Analysis analysing protein molecular weight as can be known, and the about 35kDa of the total molecular weight of fusion rotein; Show according to the SDS-PAGE of genetic engineering bacterium is analyzed: the migration position of target protein near 35kDa, purpose fusion rotein successful expression.

4.3IPTG induce influence to the ZjMT expressing fusion protein

4.3.1IPTG induction time

IPTG is that the reorganization bacterium is expressed target protein inductor commonly used.At engineering bacteria pGEX-ZjMT-B and the contrast bacterium pGEX-B shaking culture OD of transferring with one of fresh culture percentage ₆₀₀Value is about 0.5, adds IPTG to final concentration 0.4mM, respectively at different time results thalline, carries out SDS-PAGE and detects.The result shows: and in beginning, the also obviously increase of its expressed proteins amount of increase along with induction time reaches maximum at 4h place expression amount, the back is along with the increase of time, and protein content does not have considerable change as shown in Figure 7, among the figure: 1: low molecular weight protein (LMWP) marker; 2-8:pGEX-ZjMT-B, IPTG induction time are respectively 0,1,2,3,4,5,6h; 9-13:pGEX-B, IPTG induction time are respectively 0,1,2,3,4h.

4.3.2IPTG induced concentration

Experiment adopts the IPTG (0,0.1,0.2,0.4,0.6,0.8,1.0,1.2mM) of different final concentrations to carry out abduction delivering respectively, carries out SDS-PAGE and detects.The result shows: under the different IP TG induced concentration, engineering bacteria pGEX-ZjMT-B expressed proteins band changes not obvious, illustrate that the IPTG induced concentration is little to the expressing quantity influence, be that IPTG just can induce the fusion rotein great expression as shown in Figure 8 under lower concentration, among the figure: 1: low molecular weight protein (LMWP) marker; 2-9:pGEX-ZjMT-B, IPTG induced concentration are respectively 0,0.1,0.2,0.4,0.6,0.8,1.0,1.2mM; 10-16:pGEX-B, IPTG induced concentration are respectively 0,0.1,0.2,0.4,0.6,0.8,1.0mM.

4.4 the chamber is tested the result and is summed up

Engineered final purpose is exactly to efficiently express required activated protein in suitable system, therefore, before expressing a certain protein, at first want the constructional feature and the ultimate aim of the clear and definite expressing protein of wanting, select corresponding host-vector system then as required.According to the difference of selected host bacterium, two kinds of prokaryotic expression and eukaryotic expressions are arranged.

In the present invention, why selecting e. coli bl21 (DE3) as expressing bacterium, is because escherichia expression system is to develop the earliest present widely used classical prokaryotic expression system in the gene expression technique; Compare with other expression system, escherichia expression system has characteristics such as genetic background is clear, target gene expression level height, cultural method is simple, growth is rapid, cost is low, contamination resistance is strong, is as the ideal tools of expressing multiple proteins.

Present embodiment is promptly on the basis of embodiment 1, recombinant plasmid pGEX-4T-2-ZjMT is transformed into expression bacterium E.coliBL21 (DE3), the genetic engineering bacterium pGEX-ZjMT-B of construction expression fusion rotein, identify by SDS-PAGE, genetic engineering bacterium pGEX-ZjMT-B has expressed target protein at the 35kDa place, and is consistent with expectation molecular weight of albumen size.And studied the expression of fusion rotein under different concns IPTG and different induction times simultaneously; Show that fusion rotein is at IPTG final concentration 0.1mM and can obtain the great expression of fusion rotein after inducing 4h.

Embodiment 3: the application of genetic engineering bacterium pGEX-ZjMT-B in handling heavy metal contamination

One, experimental technique

5.1 the mensuration of growth curve of bacteria

Take out culture dish,, put into the LB liquid nutrient medium that 10mL contains amicillin resistance, seal the mouth of pipe (noting: can not screw) with one engineering bacteria pGEX-ZjMT-B of aseptic toothpick picking and contrast bacterium pGEX-B bacterium colony.37 ℃ of constant temperature oscillator 225r/min jolting overnight incubation, the activation bacterium.The bacterium liquid of getting 500 μ L incubated overnight joins 50mL and contains in the LB fresh culture of amicillin resistance, writes down the time that moves into thalline, and measures initial OD ₆₀₀Value.Later on every regular hour sampling and measuring OD successively ₆₀₀Be worth, write down the time of sampling.

5.2 the measurement of dry cell weight

Take out culture dish,, put into the LB liquid nutrient medium that 10mL contains amicillin resistance, seal the mouth of pipe (noting: can not screw) with one engineering bacteria pGEX-ZjMT-B of aseptic toothpick picking and contrast bacterium pGEX-B bacterium colony.37 ℃ of constant temperature oscillator 225r/min jolting overnight incubation, the activation bacterium.The bacterium liquid of getting 500 μ L incubated overnight joins in the LB fresh culture that contains amicillin resistance, 37 ℃ of shaking culture.Measure gene recombination bacterium and contrast bacterium thallus suspension liquid OD ₆₀₀Value, get this suspension of 50mL then with microcentrifuge separating thallus after scouring, oven dry, draw the dry weight of the bacterium of 50mL, through the formula corresponding as can be known OD that converts ₆₀₀It is the bacterium of every liter of 1 o'clock corresponding what milligram.

5.3 the influence of different metal ion pair bacterial growth

Take out culture dish,, put into the LB liquid nutrient medium that 10mL contains amicillin resistance, seal the mouth of pipe (noting: can not screw) with the one engineering bacteria pGEX-ZjMT-B of aseptic toothpick picking bacterium colony.37 ℃ of constant temperature oscillator 225r/min jolting overnight incubation, the activation bacterium.The bacterium liquid of getting 500 μ L incubated overnight joins in the LB fresh culture that contains amicillin resistance, writes down the time that moves into thalline, and measures initial OD ₆₀₀Value, 37 ℃ of shaking culture.Measure OD every the regular hour ₆₀₀, work as OD ₆₀₀When being 0.5 left and right sides, according to the experiment needs, adding IPTG respectively, to make its final concentration be 0.1mM, and add copper (Cu respectively ²⁺), plumbous (Pb ²⁺), cadmium (Cd ²⁺), mercury (Hg ²⁺) to make its concentration be 200 μ M.Write down sample time, later on every regular hour sampling and measuring OD successively ₆₀₀Be worth, write down the time of sampling.

5.4 concentration of metal ions is to the influence of bacterial growth

Take out culture dish,, put into the test tube that contains 10ml LB liquid nutrient medium, seal the mouth of pipe (noting: can not screw) with one engineering bacteria pGEX-ZjMT-B of aseptic toothpick picking and contrast bacterium pGEX-B bacterium colony.37 ℃ of constant temperature oscillator 225r/min jolting overnight incubation, the activation bacterium.The bacterium liquid of getting 500 μ L incubated overnight joins in the 50mL LB fresh culture, writes down the time that moves into thalline, and measures initial OD ₆₀₀Value, 37 ℃ of shaking culture.Measure OD every the regular hour ₆₀₀, work as OD ₆₀₀When being 0.5 left and right sides, according to the experiment needs, adding IPTG respectively, to make its final concentration be 0.1mM, and add copper (Cu respectively ²⁺), plumbous (Pb ²⁺), cadmium (Cd ²⁺), chromium (Cr ³⁺), aluminium (Al ³⁺), nickel (Ni ²⁺), zinc (Zn ²⁺), manganese (Mn ²⁺) observe under the different concns variation of growth curve of bacteria.Write down sample time, later on every regular hour sampling and measuring OD successively ₆₀₀Be worth, write down the time of sampling.

5.5 genetic engineering bacterium is to the test of different metal ionic enriching quantity

Take out culture dish, with single engineering bacteria pGEX-ZjMT-B of aseptic toothpick picking and contrast bacterium pGEX-B bacterium colony, put into 10mL and contain amicillin resistance MJS liquid nutrient medium, seal the mouth of pipe (attention: can not screw).37 ℃ of constant temperature oscillator r/min jolting overnight incubation, the activation bacterium.

Get 6 Erlenmeyer flasks that steeped the 250mL of peroxy-nitric acid, add 100mL respectively and contain amicillin resistance MJS substratum, be inoculated at 1: 100 and contain in the amicillin resistance MJS fresh culture, 2h to OD are cultivated in 37 ℃ of constant temperature oscillator 225r/min joltings ₆₀₀To about 0.5, add Pb respectively among engineering bacteria pGEX-ZjMT-B and the contrast bacterium pGEX-B ²⁺, Cu ²⁺, Cd ²⁺, regulating its final concentration is 200 μ M.Continue 37 ℃ of constant temperature joltings and cultivate 4h, with the big centrifuge tube of bubble peroxy-nitric acid in super-magnum centrifuge with 5, the centrifugal 10min of the speed of 000g.

Wash bacterial precipitation three times with 5mmol/L HEPES (pH7.1) damping fluid that contains 0.85%NaCl, bacterial precipitation is collected in centrifugal back, in the freeze-drying of Eppendorf pipe.Add 70% nitric acid 4mL in dried bacterium, spend the night in 42 ℃ of water-baths, it is to be measured to add the dilution of 6mL deionized water.

5.6 analysis measurement method

5.6.1 the reduced turbidity method is measured cell concentration

Cell concentration is measured and is adopted the nucleic acid-protein detector to measure its optical density(OD) under the 600nm wavelength, utilizes the extinction of bacterium to measure the concentration of inoculum, thereby estimates the growing state of bacterium.Before the optical extinction coefficient of each measure sample, the zeroing of two cuvette dress proper amount of deionized water need be eliminated the difference of two cuvettes.

5.6.2 the measurement of concentration of metal ions

Heavy metal ion solution to be measured is diluted to deionized water in the optimum concentration range of metal ion to be measured and measures.Adopt Varian AA240FS rapid serial formula Atomic Absorption Spectroscopy AAS to measure.

Two, experimental result and analysis

6.1 the comparison of growth curve of bacteria

Microorganism growth generally comprises four-stage: lag phase, exponential phase or logarithmic phase, stationary phase and decline phase.Microorganism growth curve shape separately is basic identical, promptly shows similar growth rhythm.Be generally several hrs lag phase, this moment, cell volume constantly increased, accumulation organism and storage of chemical energy; Exponential phase,, biology entered quick division stage, biont exponentially or logarithmic growth; Exponential phase,, the split speed of cell reduced, and newly-generated cell number is consistent substantially with old dead cell number; The rate of death of decline phase cell surpasses generating rate, and the live body number begins to descend.

Because engineering bacteria pGEX-ZjMT-B is identical host bacterium with contrast bacterium pGEX-B importing, so under the situation that does not have inductor and metal ion, the growth curve of the two is roughly the same.The lag phase of the two is very short, substantially all is that after this cell enters exponential phase of growth about 2h, and pGEX-ZjMT-B and pGEX-B growth and breeding are very fast, all arrives the maximum growth amount of thalline to about the 20h, OD ₆₀₀Be respectively 2.89 and 2.86, and between 20-24h, pGEX-ZjMT-B and pGEX-B enter stationary phase substantially, along with further cultivation, because the disappearance of some nutritive ingredients and increasing of metabolic waste, the two growth all enters decline phase and begins self-dissolving, OD ₆₀₀Value descends.

The purpose of this experiment is that growth and the enrichment condition in the liquid nutrient medium of metal ion done early-stage preparations for pGEX-ZjMT-B and pGEX-B, so draw pGEX-ZjMT-B and the pGEX-B growth curve in the liquid nutrient medium of metal ion not, understand the bacterium growth change in each period, so that and the bacterial growth situation in the liquid nutrient medium of metal ion compares, help to hold the time that adds IPTG and metal ion.Fig. 9 is the growth curve of pGEX-ZjMT-B and pGEX-B.

6.2 the measurement of dry cell weight

By experiment, measure the pGEX-ZjMT-B of gained and dry cell weight (g/L, the OD of pGEX-B ₆₀₀=1) is respectively 0.612 and 0.610.

6.3 the influence of different metal ion pair pGEX-ZjMT-B growth

In order to understand the response situation of pGEX-ZjMT-B to different metal ion tolerance, the heavy metal ion of 4 kinds of common toxic has been used in this research: copper (Cu ²⁺), plumbous (Pb ²⁺), cadmium (Cd ²⁺), mercury (Hg ²⁺), the final concentration of each metal ion in substratum is 200 μ M, by passing through to measure OD ₆₀₀Observation adds the upgrowth situation of pGEX-ZjMT-B behind the different metal ions in substratum, obtain growth curve such as the Figure 10 of pGEX-ZjMT-B in different metal ion solutions.

As shown in the figure, containing Cu ²⁺, Pb ²⁺Nutrient solution in, the influence that the growth of pGEX-ZjMT-B is subjected to is very little; Contain Cd ²⁺Solution in, the growth phase of pGEX-ZjMT-B is to more slow; Contain Hg ²⁺Solution in, bacterium almost can not grow, at the beginning the growth just be suppressed, shown toxic effect and death.

Because this experiment is after bacterial strain enters logarithmic phase, adding IPTG and metal ion, entering the i.e. 3.5h of logarithmic phase, containing Cu ²⁺, Pb ²⁺, Cd ²⁺, Hg ²⁺In the nutrient solution of four metal ion species in the nutrient solution of the growth of pGEX-ZjMT-B and non-metallic ion the growth of pGEX-ZjMT-B almost approaching; But, containing Cu to 4.5h ²⁺, Pb ²⁺Nutrient solution in, the growth of pGEX-ZjMT-B is not subjected to obvious influence, contains Cd ²⁺Nutrient solution in the speed of growth of pGEX-ZjMT-B slow down, and contain Hg ²⁺Nutrient solution in, the growth of pGEX-ZjMT-B is subjected to obvious inhibition, number of bacteria descends; With the increase of incubation time, containing Cu ²⁺And Pb ²⁺In the nutrient solution, the growth of pGEX-ZjMT-B still is not subjected to obvious influence; Contain Cd ²⁺Nutrient solution in the speed of growth of pGEX-ZjMT-B slower, even at 7-8h of short duration resting appears, bacterial number is constant substantially; At this moment, contain Hg ²⁺Nutrient solution in, the growth of pGEX-ZjMT-B is suppressed already, bacterial number reduces; To 20h, pGEX-ZjMT-B is at Cu ²⁺, Pb ²⁺, Cd ²⁺, Hg ²⁺In the four metal ion species nutrient solutions and the growth in the nutrient solution of non-metallic ion notable difference has appearred, the OD of this moment ₆₀₀Be respectively: 2.575,2.68,1.779,0.21,2.88.

By last figure as can be seen, at the Cu of same concentrations ²⁺, Pb ²⁺, Cd ²⁺In the solution, pGEX-ZjMT-B shows tolerance preferably, and at Hg ²⁺In the solution, pGEX-ZjMT-B almost can not grow, and has shown toxic effect at the very start, shows that pGEX-ZjMT-B is to Cu ²⁺, Pb ²⁺, Cd ²⁺Tolerance is preferably arranged, and this experiment is further studied pGEX-ZjMT-B to Cu for the back ²⁺, Pb ²⁺, Cd ²⁺Absorption property lay the first stone.

6.4 the metal ion of different concns is to the influence of pGEX-ZjMT-B growth curve

Based on above test-results, below the main engineering bacteria pGEX-ZjMT-B that investigates to various Cu ²⁺, Pb ²⁺, Cd ²⁺, Al ³⁺, Cr ³⁺, Mn ²⁺, Ni ²⁺, Zn ²⁺The tolerance of ionic concn.With the nutrient solution that does not add each metal ion species is contrast.Figure 11-18 has listed the experimental result under the various concentration of metal ions.

In the LB liquid nutrient medium, the growth of engineering bacteria pGEX-ZjMT-B is subjected to the inhibition degree along with concentration of metal ions in the substratum improves and increases, and shows each metal ion species is had different tolerances.

1. Cu ²⁺Concentration is to the influence of engineering bacteria pGEX-ZjMT-B: in Figure 11, pGEX-ZjMT-B contains Cu below 2000 μ M ²⁺All can grow in the nutrient solution, but along with the growth growth of concentration obviously is suppressed, cultivating 24h and contrast (does not have Cu ²⁺Nutrient solution) identically reach stationary phase; Work as Cu ²⁺When concentration reached 3000 μ M, the growth of engineering bacteria was subjected to severe inhibition, and early stage is not growth almost, but the growth of the engineering bacteria recovery of having got back after the 7h, and 24 and return to substantially later on and do not add Cu ²⁺The maintenance level of cultivation; Work as Cu ²⁺When concentration reached 4000 μ M, engineering bacteria can not be grown, and cultivated 24h and can not recover later on.

At identical culture condition, pGEX-B is unaffected in 100-400 μ M copper ion solution, along with Cu ²⁺The increase of concentration, contrast bacterium pGEX-B enters the time of exponential phase and shows slightly prolongation, and the speed of growth slows down.When copper ion concentration is 1500 μ M, its lag phase significant prolongation, under the same culture conditions, the growth of contrast bacterium pGEX-B is subjected to obvious suppression, early enters stationary phase, OD ₆₀₀Value descends.

2. Pb ²⁺Concentration is to the influence of engineering bacteria pGEX-ZjMT-B: in Figure 12, pGEX-ZjMT-B is at the following Pb of 800 μ M ²⁺Growth is unaffected substantially in the nutrient solution.At Pb ²⁺During concentration 1600 μ M, when adding Pb ²⁺The time phenomenon (nutrient solution bleaches, and microscopically is observed the thalline relic of disintegration) of cellular lysate appears, but, finally reach the OD identical with low concentration solution with the prolongation of incubation time ₆₀₀Value; Along with Pb ²⁺Concentration must raise, and the ratio that thalline disintegrates also raises simultaneously, when at Pb ²⁺Concentration reaches 2600 μ M when above, because thalline disintegrates nutrient solution is bleached, and microscopically does not almost observe the thalline of survival.

3. Cd ²⁺Concentration is to the influence of engineering bacteria pGEX-ZjMT-B: in Figure 13, engineering bacteria pGEX-ZjMT-B is at the following Cd of 900 μ M ²⁺Can grow in the nutrient solution, but growth obviously descends along with the increase of concentration.Work as Cd ²⁺Concentration is increased to 1200 μ M when above, and along with the increase of incubation time, the concentration of engineering bacteria does not only raise and has been reduced on the contrary below the starting point concentration (0.5), illustrate that engineering bacteria is owing to Cd ²⁺Toxicity that thalline is occurred is dead.Showed that cadmium ion is compared cupric ion, lead ion has stronger bio-toxicity.

4. Al ³⁺Concentration is to the influence of engineering bacteria pGEX-ZjMT-B: among Figure 14, engineering bacteria pGEX-ZjMT-B is at the following Al of 1500 μ M ³⁺Can grow in the nutrient solution, work as Al ³⁺When concentration is increased to 3000 μ M, with Pb ²⁺The phenomenon that occurs cellular lysate equally, and with Al ³⁺The increase cellular lysate ratio of concentration increases, and during 4500 μ M, microscopically does not almost observe the thalline of survival.

5. Cr ³⁺Concentration is to the influence of engineering bacteria pGEX-ZjMT-B: Figure 15, and engineering bacteria pGEX-ZjMT-B is at Cr ³⁺In the nutrient solution along with Cr ³⁺The rising growth of concentration weakens gradually, works as Cr ³⁺When concentration increased to 4200 μ M, thalli growth seriously was obstructed, but along with the prolongation thalline of incubation time recovers growth gradually; But work as Cr ³⁺When concentration continues to increase to 4400 μ M, prolong incubation time and can not make thalline recover growth.

6. Mn ²⁺Concentration is to the influence of engineering bacteria pGEX-ZjMT-B: among Figure 16, engineering bacteria pGEX-ZjMT-B is at Mn ²⁺In the nutrient solution along with Mn ²⁺The rising growth of concentration weakens gradually, works as Mn ²⁺When concentration rose to 10000 μ M, thalline is not growth almost, maintains 0.5 of starting point concentration, but not have to occur increase with incubation time recovers to grow or thalline death (concentration drops to 0.The county is following) phenomenon.

7. Ni ²⁺Concentration is to the influence of engineering bacteria pGEX-ZjMT-B: among Figure 17, engineering bacteria pGEX-ZjMT-B is at Ni ²⁺In the nutrient solution along with Ni ²⁺The rising growth of concentration weakens Ni gradually ²⁺Concentration is cultivated 21h below 1000 μ M all can return to almost same normal growth level later on; After cultivating 21h, can not return to the normal growth level during 1500 μ M; Then can not recover growth when increasing to 3000 μ M.

8. Zn ²⁺Concentration is to the influence of engineering bacteria pGEX-ZjMT-B: among Figure 18, engineering bacteria pGEX-ZjMT-B is at Zn ²⁺Growth in the nutrient solution and above-mentioned Ni ²⁺Trend identical, just work as Zn ²⁺When concentration increased to 1500 μ M, thalline can not recover growth.

6.5 the balance enriching quantity of bacterium

Be the Cu of 200 μ M in concentration ²⁺, Pb ²⁺, Cd ²⁺In the solution, engineering bacteria pGEX-ZjMT-B and contrast bacterium pGEX-B are to different metal ionic enrichment experiment result such as Figure 19-21.Compare with pGEX-B, the pGEX-ZjMT-B of the metallothionein gene of having recombinated improves a lot to the enrichment capacity of metal ion.This is the metallothionein(MT) role of expressing because of in the reorganization bacterium, and metallothionein(MT) strides across cell membrane transporter in tenuigenin after GOLD FROM PLATING SOLUTION is belonged to the combination of ionic highly selective, makes enrichment in cell.

1. bacterium is to Cu ²⁺Enrichment: Cu ²⁺The concentration of standardized solution is respectively 0,1,2,3,4,5mg/L, uses.The mean light absorbency that Varian AA240FS rapid serial formula Atomic Absorption Spectroscopy AAS records is 0.0007,0.1383,0.2675,0.3810,0.4905,0.5990, linear equation with the Excell match is: Asp=0.1189C+0.0156, record pGEX-ZjMT-B and pGEX-B bacterium liquid mean light absorbency 0.1564,0.2221 respectively, calculate pGEX-ZjMT-B and the adsorbable Cu of pGEX-B by formula ²⁺Amount be respectively 17.368, the 11.842mg adsorptive capacity improved 43.1%, as shown in figure 19.

2. bacterium is to Pb ²⁺Enrichment: Pb ²⁺The concentration of standardized solution is respectively 0,0.1,0.2,0.3,0.4,0.5mg/L, uses.The mean light absorbency that Varian AA240FS rapid serial formula Atomic Absorption Spectroscopy AAS records is 0.0008,0.0063,0.0119,0.0171,0.0225,0.0276, linear equation with the Excell match is: Asp=0.0537C+0.001, with 50 times of testing liquid dilutions, the mean light absorbency that records pGEX-ZjMT-B and pGEX-B bacterium liquid is respectively 0.0103,0.0075, calculates pGEX-ZjMT-B and the adsorbable Pb of pGEX-B by formula ²⁺Amount be respectively 86.592,60.515mg, adsorptive capacity has improved 46.7%, as shown in figure 20.

3. bacterium is to Cd ²⁺Enrichment: Cd ²⁺The concentration of standardized solution is respectively 0,0.1,0.2,0.3,0.4,0.5mg/L, uses.The mean light absorbency that Varian AA240FS rapid serial formula Atomic Absorption Spectroscopy AAS records is 0.0007,0.0422,0.0847,0.1228,0.1602,0.1993, linear equation with the Excell match is: Asp=0.3957C+0.0027, with 50 times of testing liquid dilutions, the mean light absorbency that records pGEX-ZjMT-B and pGEX-B bacterium liquid is respectively 0.0120,0.0108, calculates pGEX-ZjMT-B and the adsorbable Cd of pGEX-B by formula ²⁺Amount be respectively 17.513,10.235mg, adsorptive capacity has improved 71.1%, as shown in figure 21.

6.6 the chamber is tested the result and is summed up

The heavy metal tolerance gene is changed in the microorganism by genetic engineering means, and the enhancement engineering bacterial strain is the effective means that realizes the biological recovery heavy metal and administer heavy metal contamination to the binding ability of heavy metal.

The engineering bacteria pGEX-ZjMT-B that the present invention has made up at E.coli BL21 (DE3) expression metallothionein(MT) is used for Cu ²⁺, Pb ²⁺, Cd ²⁺, Hg ²⁺Absorption, by investigating the upgrowth situation of engineering bacteria pGEX-ZjMT-B and contrast bacterium pGEX-B in the liquid medium that does not contain heavy metal, held the time that adds inductor IPTG and metal ion substantially.Be respectively 200 μ M Pb at final concentration ²⁺, Cu ²⁺, Cd ²⁺, Hg ²⁺Liquid medium in, engineering bacteria pGEX-ZjMT-B induces through inductor IPTG's, finds Pb ²⁺, Cu ²⁺, Cd ²⁺Less to the engineering bacteria influence.

Further investigated eight metal ion species concentration engineering bacteria pGEX-ZjMT-B has been compared the influence of shining bacterium pGEX-B growing state, found the Cu of engineering bacteria pGEX-ZjMT-B in the final concentration high density ²⁺, Pb ²⁺, Cd ²⁺, Al ³⁺, Cr ³⁺, Mn ²⁺, Ni ²⁺, Zn ²⁺Well-grown, and the growth of pGEX-B has been suppressed, illustrates that engineering bacteria pGEX-ZjMT-B can tolerate the toxic action of metal ion preferably.

At last, remove the heavy metal function efficiently in the contaminate environment of reality, again its situation in containing the liquid nutrient medium of single heavy metal has been carried out analysis of science for engineering bacteria pGEX-ZjMT-B can be brought into play.By research engineering bacterium pGEX-ZjMT-B to Cu ²⁺, Pb ²⁺, Cd ²⁺Enrichment experiment, show that engineering bacteria pGEX-ZjMT-B differs widely absorption Pb to different adsorption of metal ions abilities with contrast bacterium pGEX-B ²⁺Ability be higher than Adsorption of Cu ²⁺, Cd ²⁺By to Cu ²⁺, Pb ²⁺, Cd ²⁺The comparison of adsorptive capacity, engineering bacteria pGEX-ZjMT-B compares with contrast bacterium pGEX-B, and adsorptive capacity improves 43.1%, 46.7%, 71.1% respectively.

SEQUENCE?LISTING

＜110〉Shanxi Province Agriculture Biotechnology Research Center

＜120〉jujube tree metallothionein gene and the application in handling heavy metal contamination thereof

<160>2

<210>1

<211>225

<212>DNA

＜213〉jujube tree (Ziziphus jujuba Mill.)

<220>

<221>CDS

<222>(1)…(225)

<400>1

atgtctggct?gtggttgtgg?ctctagctgc?tcgtgtggaa?gtggctgcaa?atgtggtaga?60

aaccctgacc?tcggttactc?cgagaagacc?accactgaaa?ccatcgttgt?tggggttgca?120

ccagttaaga?tagacaatga?tggatcggag?gtgagccatg?gaacagagaa?cgaggggtgc?180

ggctgcggca?gtaactgcaa?gtgcgaccca?tgcacgtgca?aatga 225

<210>2

<211>75

<212>PRT

＜213〉jujube tree (Ziziphus jujuba Mill.)

<400>2

Met?Ser?Gly?Cys?Gly?Cys?Gly?Ser?Ser?Cys?Ser?Cys?Gly?Ser?Gly

1 5 10 15

Cys?Lys?Cys?Gly?Arg?Asn?Pro?Asp?Leu?Gly?Tyr?Ser?Glu?Lys?Thr

20 25 30

Thr?Thr?Glu?Thr?Ile?Val?Val?Gly?Val?Ala?Pro?Val?Lys?Ile?Asp

35 40 45

Asn?Asp?Gly?Ser?Glu?Val?Ser?His?Gly?Thr?Glu?Asn?Glu?Gly?Cys

50 55 60

Gly?Cys?Gly?Ser?Asn?Cys?Lys?Cys?Asp?Pro?Cys?Thr?Cys?Lys?*

65 70 75

Claims (3)

1. jujube tree metallothionein gene is characterized in that the nucleotide sequence of this gene is as follows:

atgtctggct?gtggttgtgg?ctctagctgc?tcgtgtggaa?gtggctgcaa?atgtggtaga?60

aaccctgacc?tcggttactc?cgagaagacc?accactgaaa?ccatcgttgt?tggggttgca?120

ccagttaaga?tagacaatga?tggatcggag?gtgagccatg?gaacagagaa?cgaggggtgc?180

ggctgcggca?gtaactgcaa?gtgcgaccca?tgcacgtgca?aatga 225。

2. by the nucleotide sequence coded aminoacid sequence of the described a kind of jujube tree metallothionein gene of claim 1, it is characterized in that this aminoacid sequence is as follows:

Met?Ser?Gly?Cys?Gly?Cys?Gly?Ser?Ser?Cys?Ser?Cys?Gly?Ser?Gly

1 5 10 15

Cys?Lys?Cys?Gly?Arg?Asn?Pro?Asp?Leu?Gly?Tyr?Ser?Glu?Lys?Thr

20 25 30

Thr?Thr?Glu?Thr Ile?Val?Val?Gly?Val?Ala?Pro?Val?Lys?Ile?Asp

35 40 45

Asn?Asp?Gly?Ser?Glu?Val?Ser?His?Gly?Thr?Glu?Asn?Glu?Gly?Cys

50 55 60

Gly?Cys?Gly?Ser?Asn?Cys?Lys?Cys?Asp?Pro?Cys?Thr?Cys?Lys?*

65 70 75。

3. the application of jujube tree metallothionein gene as claimed in claim 1 in handling heavy metal contamination.

Images