CN101780283A - Application of signal adjusting protein alpha in preparation of DC vaccine for preventing and treating tumors - Google Patents
Application of signal adjusting protein alpha in preparation of DC vaccine for preventing and treating tumors Download PDFInfo
- Publication number
- CN101780283A CN101780283A CN 201010125677 CN201010125677A CN101780283A CN 101780283 A CN101780283 A CN 101780283A CN 201010125677 CN201010125677 CN 201010125677 CN 201010125677 A CN201010125677 A CN 201010125677A CN 101780283 A CN101780283 A CN 101780283A
- Authority
- CN
- China
- Prior art keywords
- sirp
- vaccine
- tumor
- alpha
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention belongs to the technical field of medical bio-engineering, and particularly relates to new application of the signal adjusting protein alpha(SIRP alpha). The signal adjusting protein alpha(SIRP alpha) belongs to a member of the immunoglobulin super family(IGSF). In-vitro biological experiments and in-vivo animal experiments prove that in the application of the signal adjusting protein alpha(SIRP alpha) in the preparation of the DC vaccine for preventing and treating tumors of the invention, the SIRP alpha signal path negatively regulates the activity and antigen presentation functions of the DC. The invention further constructs a tumor DC vaccine which can interfere with the SIRP alpha expression by the mediation of a lentiviral vector, and the tumor DC vaccine can obviously improve the DC activation level and the antigen presentation function of the DC and be used for preventing and treating mouse tumors and is a novel tumor vaccine. The invention provides a new idea for clinical treatment application of the SIRP alpha.
Description
Technical field
The invention belongs to the bioengineering technical field.Specifically, the present invention relates to a kind of signal adjusting protein alpha (SIRP α), be used to prepare a kind of tumor DC vaccine of the interference SIRP alpha expression by the slow virus carrier mediation, and with this vaccine prevention with treat tumor.
Background technology
Signal adjusting protein alpha (SIRP α) is the member (IgSF) of contactin.In MOLECULAR AND CELLULAR BIOLOGY magazines in 1996 and the NATURE magazine delivered in 1997, the Protein-tyrosine-phosphatase SIRP α of rat is at first identified.SIRP α also is SHPS1, CD172a, and P84 is a kind of memebrane protein that mainly is expressed in myeloid cell, GeneID:19261.SIRP α extracellular region contains three immunoglobulin superfamily (IgSF) domains and a plurality of glycosylation site.Its cytoplasmic domain is rat, and high conservative between mice and the people has two immunity receptor tyrosine and suppresses primitive (ITIMs, its feature aminoacid sequence is ' I/VxYxxL '), wherein comprises four tyrosine residues.Because its special celluar localization and structure have determined it to transmit different signals in different cells, bring into play different functions.
SIRP α transmits the phosphorylation that signal mainly passes through tyrosine residue in the born of the same parents in cell.Three Ig spline structure territory SIRP α of its extracellular region can be activated by multiple mitogen and phosphorylation takes place, as serum, insulin, somatomedin, EGF, PDGF and neurotrophic factor etc.SIRP α can make it to activate after by phosphorylation in conjunction with the phosphoprotein phosphatase SHP-1 that has the SH2 domain and SHP-2, and as its substrate by dephosphorylation.The extracellular region of SIRP α combines with ligands specific, also is its important channel of realizing signal transduction functionality.At present to the ligands specific research of SIRP α many be another kind of memebrane protein CD47.Express differently with the strict histiocyte of SIRP α, CD47 has expression at most of cell type, so SIRP α and CD47 complex play an important role in the alpha mediated signal transduction of SIRP, comprises that mediated cell is engulfed, migration and cytokine secretion etc.
Because the tissue distribution of SIRP α is mainly in medullary system (macrophage, dendritic cell etc.), so the effect of SIRP α in immunity of organism is regulated is by pay attention to day by day.Generally speaking, SIRP α brings into play the negative regulation effect by interacting with CD47 in immune system.In the natural immunity, LPS can induce SIRP alpha expression downward modulation in the macrophage by transcribing inhibition and protein degradation approach, SIRP α suppresses MAPK, IKKs, NF-κ B and IRF3 by shielding SHP-2 effect and activates, and reduces inflammatory factor IL-6, TNF α and IFN β and discharges.But combine with SIRP α with the SIRP Alpha antibodies, can promote macrophage secretion nitric oxide, this understands that on the other hand SIRP α might play certain forward regulating action in the natural immunity.In the research of SIRP α and acquired immunity relation, utilize CD47-Fc section fusion rotein to interact as part and DC surface SIRP α, can observe the inhibition of DC phenotype and function, comprise that the ripe sign of DC reduces, cytokine IL-12 secretes minimizing.The SIRP α on DC surface and the CD47 of T cell surface mutually combine, two-way negative adjusting DC and T cell function: on the one hand, suppress the DC activation, reduce its antigen presentation ability; On the other hand, suppressor T cell propagation and killing ability.But also there is research to stimulate the extracellular region of SIRP α can effectively reduce the propagation of tranquillization memory T cell with anti--SIRP Alpha antibodies, FEBS in recent years, research worker has confirmed that also SIRP alpha-mutant mice has very strong resistivity to testing inductive autoimmunity encephalomyelitis, collagen induced arthritis and 2,4 dinitros-inductive contact allergy of 1-fluorobenzene; Equally, CD47 disappearance mice also can suppress to comprise the autoimmune disease of collagen induced arthritis and contact allergy, and this has illustrated that SIRP α has promoted the generation of autoimmune disease to a certain extent.This function of SIRP α is mainly relevant with SIRP α inhibition Th17 emiocytosis IL-17, Th17 is the important regulatory T cells of body one class, it is the too drastic inhibition factor of immune system response, induce in the autoimmune disease model SIRP alpha-mutant mice, can detect the IL-17 up-regulated.Except the adjusting to immune cell function, SIRP α has also played crucial effects to the growth of immunocyte.In mouse boosting cell, SIRP α expresses on the CD8a+CD11c+DCs cell membrane and is better than CD8a-CD11c+DCs greatly, and when transgenic mouse was expressed sudden change SIRP α, the CD8a+CD11c+DCs ratio obviously reduced in the splenocyte.
In tumour immunity, the acquired immunity activation plays a part indispensable, and dendritic cell (dendritic cell, DC) be the strongest sole duty antigen presenting cell (the antigen-presenting cells of function that finds at present, apc), can absorb and processing submission antigen, ability with powerful activation CD8+, CTL and CD4+T accessory cell, controlling the process of the acquired immune response in the body, in immunne response, be in middle cardiac status, thereby become the key link of tumor immunity.DC can be used for immunization therapy in the body behind In vitro culture, also can transplant by marrow hemopoietic stem cells, and be aided with cytokine or other factor such as flt-3 etc. increase in vivo.Carry out immunotherapy of tumors with the DC vaccine and come into one's own, and become the hot subject that current Biotherapeutics field receives much attention.
Slow virus (Lentivirus) carrier is to be the gene therapy vector that base growth is got up with HIV-1 (human immune deficiency I type virus).Distinguish general retroviral vector, it all has infection ability to somatoblast and Unseparated Cell.The research and development of slow virus carrier gets very fast, research also very deep.This carrier can be incorporated into exogenous gene on the host chromosome effectively, expresses thereby reach persistency.Slow virus also is widely used in the research of expressed rna i at present.Because some cell type liposome transfection weak effect, it is short to transfer to the intracellular siRNA half-life, and external synthetic siRNA is normally of short duration to the inhibitory action of gene expression, thereby makes its application be subjected to bigger restriction.Adopt the carrier that to express siRNA in advance in external structure, transfer to the strategy of transcribing siRNA in the cell then, effective cells transfected kind is increased, and gene expression suppressed effect also no less than external synthetic siRNA, in the cell of expression vector steady in a long-term, even can bring into play the effect that long-term blocking gene is expressed.
Summary of the invention
The object of the present invention is to provide the new purposes of signal adjusting protein alpha (SIRP α).
The invention provides the application of signal adjusting protein alpha (SIRP α) in the DC vaccine of preparation prevention and treatment tumor.
Further, the present invention has made up a kind of tumor DC vaccine of the interference SIRP alpha expression by slow virus carrier mediation, specifically is the method for utilizing slow virus infection, the little RNA that disturbs the SIRP alpha expression is imported DC after, make the DC vaccine, can be used for prevention and treatment tumor.
Technical scheme of the present invention mainly comprises the following aspects:
1. the structure of slow virus expression plasmid: LV-microRNA-SIRP α, LV-GFP;
2. expression plasmid and packaging plasmid corotation 293T cell are packed slow virus, and carry out titre and detect;
3. derived from bone marrow DC separation and Culture;
4. slow virus infection DC;
5. the observation in vitro slow virus disturbs the DC:(a of SIRP α) MHC II, CD80, the CD86-flow cytometry of the change-PE labelling of ripe phenotype; (b) change of survival ability-PI dyeing-flow cytometry; (c) change-IL12 of secrete cytokines function, IL-6, TNF α-ELISA detect;
6. the observation in vitro slow virus disturbs the DC:(a of SIRP α) change of draining lymph node migration phenotype: CCR5, CCR7-flow cytometry; (b) in the change of time-to-live of draining lymph node: the painted DC of injection CFSE in the body, determine the time-to-live of DC in lymph node by flow cytometry.(C) ability-observation lymph node volume of promotion draining lymph node T cell proliferation;
7. observation in vitro disturbs the DC of SIRP α that the T cell function is regulated: (a) change of the multiplication capacity of T cell-H3 proliferation experiment; (b) change of T cell-specific secretion of gamma-IFN level-ELISPOT detects.(C) change of the multiplication capacity of the T cell of specific expressed antigenic specificity epi-position-pentamer flow cytometry;
8. observe the change-interferential DC vaccine of application SIRP α in treatment and prophylaxis model of the tumour immunity function of the DC that disturbs SIRP α in the body, observe influence tumor size and mice life span.
The invention provides the new purposes of signal adjusting protein alpha (SIRP α), prove through extracorporeal biology experiment and interior animal experiment: activation and the antigen presentation function of SIRP alpha signal path negative regulation DC.
The tumor DC vaccine of the interference SIRP alpha expression by slow virus carrier mediation provided by the invention can significantly improve DC activation levels and antigen presentation function, and can be used for prevention and treatment mouse tumor, is a kind of novel tumor vaccine.
The present invention uses for the clinical treatment of SIRP α new thinking is provided.
Description of drawings
Fig. 1 is that structure, evaluation and slow virus packing, infection and the jamming effectiveness of slow virus expression plasmid identified.
Slow virus expression vector sketch map and the enzyme action qualification result of Fig. 1-1. wherein; Fig. 1-2. slow virus package carrier sketch map; Fig. 1-3. slow virus infection efficient fluorescence microscope 400 * observation; The slow virus jamming effectiveness Western-Blot qualification result of Fig. 1-4..
Fig. 2 is the sketch map that concerns of SIRP α and DC existence.
Fig. 3 is SIRP α and DC phenotype and the sophisticated sketch map that concerns of function.
Wherein behind the slow virus infection 60hr of Fig. 3-1., each organizes the DC form by light microscopic 400 * take pictures; Behind the slow virus infection 60hr of Fig. 3-2., each organizes MHC II, CD80 and the CD86 expression streaming testing result on DC surface; Under the Different L PS stimulation time of Fig. 3-3., each organizes the ELISA testing result of DC TNF secretion α, IL-6 and IL-12.
Fig. 4 is the sketch map that concerns of SIRP α and DC transfer ability.
Wherein respectively organize the CCR7 and the CCR5 expression streaming testing result on DC surface behind the slow virus infection 60hr of Fig. 4-1.; Fig. 4-2.DC is in vivo to the streaming testing result of draining lymph node migration and variation; Fig. 4-3. respectively organize DC is after lymph node was gone back to the nest 10 days in vivo, draining lymph node volume sketch map.
Fig. 5 is that SIRP α regulation and control DC is to t cell activation ability sketch map.
The short T ability of cell proliferation H of Fig. 5-1. respectively organize DC wherein
3Testing result; Fig. 5-2. respectively organize the short T cell-specific multiplication capacity Pantamer of DC to dye the streaming testing result.
Fig. 6 is the sketch map that concerns of miSIRP α-DC vaccine and antineoplastic immune.
Fig. 6-1. respectively organize in the DC vaccine prevention mice EG7 tumor model tumor growth situation and the horizontal ELISA testing result of tumor-bearing mice CD8+T emiocytosis IFN-γ wherein; Fig. 6-2. respectively organize in the DC vaccine prevention mice B16F10 tumor model statistical result of tumor-bearing mice life span; Fig. 6-3. respectively organize in the DC vaccine therapy mice EG7 tumor model tumor growth situation cartogram; Fig. 6-4. respectively organize in the DC vaccine therapy mice B16 tumor model tumor growth situation cartogram and tumor-bearing mice splenocyte, CD4
+And CD8
+The horizontal ELISA testing result of T emiocytosis IFN-γ.
The specific embodiment
Describe the present invention below in conjunction with drawings and Examples, but enforcement of the present invention is not limited only to this.
Embodiment 1: the structure of slow virus expression plasmid, evaluation and slow virus packing, infection
1. slow virus carrier makes up, identifies
Material:
1) microRNA disturbs the primer sequence of SIRP α:
The upstream
TGCTGTCTATGAGCAGATGAGTTCACGTTTTGGCCACTGACTGACGTGAACTCCTGCTCATAGA，
The downstream
CCTGTCTATGAGCAGGAGTTCACGTCAGTCAGTGGCCAAAACGTGAACTCATCTGC TCATAGAC, it is synthetic to entrust Shanghai to give birth to the worker.
2) linearized vector pcDNA6.2-GW/miR and package carrier pLP1, pLP2, pLP/VSVG purchase the company in Invitrogen.
3) restriction endonuclease spe1, BamH1, Nhe1 purchase in MBI, and T4 ligase and Buffer purchase the company in Invitrogen.
4) 293T cell line is available from the Chinese Academy of Sciences.
5) calcium phosphate transfection reagent (concrete prescription sees molecular cloning for details).
6) the C57 mice is male, in 6 weeks, purchases in the Chinese Academy of Sciences.
7) mIL-4, mGM-CSF purchase the company in R and D.
8) 1640 culture medium, DMEM culture medium, hyclone (FBS).
9) the anti-Mus polyclonal antibody of rabbit SIRP α prepares (concrete preparation method is seen molecular cloning) voluntarily.
Method
1) slow virus carrier makes up, identifies
At first make up the slow virus expression vector, and identify by restriction enzyme digestion and electrophoresis.MicroRNA disturbs the primer of SIRP α in 95 ℃ of annealing 5min, is cooled to room temperature, forms dimer.Re-use the T4 ligase, in room temperature, connect 5min, dimer is connected among the linearized vector pcDNA6.2-GW/miR, preparation RNA interference plasmid pcDNA6.2-GW/miSIRP α.Again by forward primer GGACTAGTGCAGATATCAACAAGTTTG (band SpeI restriction enzyme site), with downstream primer GGACTAGTCTGCGGCCGCACCACTTTGTACAAGAAAGTCGG (band SpeI restriction enzyme site), with pcDNA6.2-GW/miSIRP α is masterplate, pcr amplification goes out GFP-miSIRP α fragment, is about 900bp.The PCR fragment is connected to by the T4 ligase in the pLenti linearisation slow virus carrier of Nhe1 and SpeI double digestion through the SpeI single endonuclease digestion.
2) slow virus packing, titre detects
Slow virus package cell line 293T (DMEM+10%FBS) in the 10cm culture dish cultivates 12h to 70% and converges rate, adopts calcium phosphate transfection method (concrete grammar reference molecule clone) corotation slow virus packaging plasmid and expression plasmid.60hr collects culture supernatant (being viral supernatant) and detects titre after the transfection.
Virus titer detects by infecting 293T, passes 1 * 10
5293T added 24 orifice plates in 24 orifice plates in 1: 10,1: 100,1: 1000 with serum-free medium virus dilution stock solution, and infecting volume is 200 μ l.After infecting 60hr, collecting cell identifies that through flow cytometry virus titer is that computing formula is: titre (/ml): ratio % * (1 * 10
5) * extension rate/volume of culture ml.When virus dilution in 1: 100, streaming counting is 5.2%, calculates titre to be: 5.2% * 1 * 10
5* 100 ÷ 0.2=0.5 * 10
7/ ml.
3) interference effect detects
Mouse bone marrow cells dendritic cell (BMDC) separation and Culture (concrete grammar is seen Molecular Therapy:Abrogation of Local Cancer Recurrence After Radiofrequency Ablation byDendritic Cell-based Hyperthermic Tumor Vaccine), 1 * 10
6The BMDC that cultivates the 5th day passes in 6 orifice plates, and selected MOI value is 50,80, infects 8hr and changes liquid, and 60hr observes efficiency of infection (fluorescence), and identifies interference effect by western-blot.
The result
Identify the method (concrete grammar sees molecular cloning for details) that adopts gel electrophoresis.Insertion fragment the place ahead and insertion sheet intrasegmental part BamH1 site downstream cut singly whether evaluation inserts and whether direction is correct in the use pLenti carrier.See Fig. 1 for details, wherein slow virus expression vector sketch map and the enzyme action qualification result of Fig. 1-1. singly cut by BamH1, compares with contrast, and pLenti-miSIRP α emits the fragment of about 900bp, identifies correct.Fig. 1-2. slow virus package carrier sketch map.
Shown in Fig. 1-3 and 4, observe the efficient of slow virus infection DC and detect the efficient that miSIRP α suppresses DC SIRP alpha expression by fluorescence microscope and Western-blot.When MOI=80, by the luciferase expression amount behind the fluorescence microscope slow virus infection 60hr.Simultaneously, under the degeneration condition, detect the expression of SIRP α among the DC by Western-blot, the result shows: when MOI value=80, DC＞80% is disturbed, and therefore following the experiment is based upon on this jamming effectiveness basis.
The relation of embodiment 2:SIRP α and DC existence
Material
1) LPS is available from TAKARA.
2) PI is available from Invitrogen.
Method
Be correlated with in order to verify that the survival ability of mediation DC strengthens under the SIRP alpha expression, BMDC was cultivating the 5th day, passed 2 * 10
6/ hole to 6 orifice plate adds and disturbs SIRP alpha expression and matched group slow virus infection.Behind the 24h, each organizes miSIRP α-DC, GFP-DC and PBS-DC, all under the condition of no GM-CSF, cultivate, and in 1d, 2d, 3d and 4d collecting cell, 1 * 10
5DC adds PI with the resuspended back of 100 μ l ice pre-cooling NaCl, behind 4 degree dyeing 5min on flow cytometry sample and detect the differential dyeing of PI.
The result
The result as shown in Figure 2, cultivate under the condition of no GM-CSF, DC death (PI+) ratio of downward modulation SIRP alpha expression is minimum, near the DC that normally has GM-CSF to cultivate, and the mortality rate height of cellular control unit proves that SIRP alpha expression downward modulation can strengthen the survival ability of DC.
Above experiment confirm the inhibition regulating action of SIRP α in DC existence.The survival ability of DC and the DC ability of antigen presentation and activating T cell in vivo are closely bound up, by strengthening the survival ability of DC, can prolong the time of DC antigen presentation in lymph node, and then strengthen its ability to the T cell activation.
Embodiment 3:SIRP α and DC phenotype and the sophisticated relation of function
Material
1) anti-Mus PE-MHC, PE-CD80, PE-CD86 purchase in biolegend.
2) Mus IL-12, it is company that IL-6 and TNF-α ELISA detection kit are purchased Yu Dake.
Method
1) expression of MHC and costimulatory molecules
At first behind the slow virus infection 60hr, cellular morphology is by light microscopic 400 * take pictures.Collect 1 * 10 then
5Each group (miSIRP α-DC, GFP-DC and PBS-DC) DC, with the NaCl+2%FBS buffer of 100 μ l ice pre-cooling resuspended after, MHC II, the CD80 and the CD86 that add the PE labelling, after 4 degree are hatched 30min, the remaining antibody of ice-cold NaCl flush away, sample and detect the differential dyeing of PE on flow cytometry.
2) secrete cytokines function
Behind the slow virus infection 60hr, collect each group (miSIRP α-DC, GFP-DC and PBS-DC) DC culture supernatant, by the concentration of TNF α, IL-6 and IL-12 in the ELISA detection supernatant.Concrete grammar is according to description in the test kit.
The result
From Fig. 3-1 and 2 as can be seen: behind the downward modulation SIRP alpha expression, the tree body surface of DC reaches and increases, its ripe phenotype MHC II, the expression of CD80, CD86 also raise, and has proved that SIRP α plays inhibitory action in DC engulfs the process of antigen post-treatment submission.
Excretory IL-6 of DC and TNF α can strengthen the breeder reaction of T cell to antigenic stimulus, and IL-6 can also stimulate the CTL differentiation and maturation, plays an important role in cellular immunization.And the excretory IL-12 of DC is the initial factor in the cellular immunization expression process, is essential by the activatory STAT4 of IL-12 in the overall process of Th1 cell function development, simultaneously it can also promote CTL and NK cell propagation, strengthen cytotoxic activity and induce Th1 secretion IFN γ.
Shown in Fig. 3-3, under Different L PS stimulation time, the excretory IL-12 of miSIRP α-DC is higher than matched group, but TNF secretion α and IL-6 ability significantly do not increase.MiSIRP α-DC has illustrated that to the induced strong effect of IL-12 SIRP α plays important inhibitory action in DC function maturation.
The relation of embodiment 4:SIRP α and DC transfer ability
Material:
1) anti-Mus PE-CCR5, PE-CCR7 are available from biolegend.
2) CFSE:Carboxyfluorescein Diacetate Succinimidyl ester is available from Invitrogen.
Method
1) change of the relevant phenotype of migration
Behind the slow virus infection 60hr, collect each group (miSIRP α-DC, GFP-DC and PBS-DC) DC, 1 * 10
5DC adds the CCR5 and the CCR7 of PE labelling with the resuspended back of 100 μ l ice pre-cooling NaCl+2%FBS buffer, after 4 degree are hatched 30min, and the remaining antibody of flush away, sample and detect the differential dyeing of PE on flow cytometry.
2) relation of transfer ability in SIRP α and the DC body
By experiment in vitro, our the preliminary clear and definite effect of SIRP α in DC migration phenotypic alternation for the go back to the nest change of ability of further clear and definite miSIRP α-DC lymph node, behind slow virus infection 60hr, collects 1 * 10
6Each group (miSIRP α-DC, GFP-DC and PBS-DC) DC of DC, 10min is incubated altogether with 2 μ MCFSE dyestuffs and each group DCs in external elder generation, injects at one's knees by mouse hind leg again.After injection, observed cell proportion negative by streaming counting PI dyeing, the CFSE stained positive in 2,5 and 10 days respectively.
The result
DC engulfing-processing-antigen expressed after, need go back to the nest to draining lymph node.The phenotype sign of guiding DC migration mainly is CCR5 and CCR7, and CCR5 expresses mainly relevant to the migration of antigen position with DC; And the expression of CCR7 is mainly gone back to the nest relevant with DC to lymph node.As can be seen, miSIRP α-DC surface C CR7 expression raises from Fig. 4-1, and the CCR5 expression reduces, and prompting SIRP α has the function of the inhibition regulated to the lymph node ability of going back to the nest to DC.
Shown in Fig. 4-2 and 3: detect the variation that DC moves to draining lymph node in vivo by flow cytometry.The result shows: miSIRP α-DC is 2, enter the quantity showed increased of draining lymph node in 5 and 10 days, show its in vivo the lymph node ability of going back to the nest be better than matched group, its 10th day lymph node volume also is significantly higher than matched group, illustrates that it stimulates lymphoproliferative ability to be better than matched group.
DC is to the t cell activation ability in embodiment 5:SIRP α regulation and control
Material
1) H
3: put the medicine center available from Chinese Academy of Sciences's Shanghai Applied Physics institute.
2) OVA: available from SIGMA.
3) TRP2, concrete aminoacid sequence: SVYDFFVWL, synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
4) TRP2
+-APC
+-CD8
+T-MHC Pantamer streaming antibody is available from Proimmune.
5) polyI:C: synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
6) OT-1 mice: available from U.S. JACKSON laboratory.
7) CD8 magnetic separation test kit: available from StemCell company.
8) mouse lymphocyte separating medium EZ-Sep
TMMouse 1 *: reaching section available from Shenzhen is company.
Method
1) stimulator antigen specific T-cells propagation
In order further to confirm the antigen presentation ability of miSIRP α-DC, we at first study the ability of miSIRP α-DC stimulator antigen specific T-cells propagation.We pass through H
3Mix experiment and study the propagation of T cell.Add OVA solution to 100 μ g/ml at the BMDC (100ng/ml LPS stimulates 0hr or 12hr) that respectively organizes that cultivates 7d, continue to cultivate 4 hours.Collect and respectively organize BMDC, with 4 * 10
4, 2 * 10
4, 1 * 10
4With 5 * 10
3/ hole adds BMDC in each hole of 96 orifice plates respectively; In each hole, add OT-1 mice CD8+T cell 2 * 10
5(concrete CD8+T cell magnetic separation method sees test kit for details and carries description); With complete culture solution every hole cumulative volume is mended to 200 μ l, established 3 multiple holes for every group; Continue to cultivate 96 hours, added 3H-TdR, 1 μ Ci/ hole in last 18 hours.Collecting cell, liquid scintillation counter detects the cpm value, and the result represents with 3 hole meansigma methodss.
2) SIRP α is to the persistence of DC antigen presentation capacity adjustment
Add TRP2 to supernatant at the BMDC that respectively organizes that cultivates 7d, continue to cultivate 4 hours.Collect and respectively organize BMDC, with 1 * 10
6Each is organized DC and is injected into respectively in the C57 mice palmula, and in 3 weeks thereafter, with 1 * 10
6Each is organized DC and strengthens weekly once, all around after, get the mice peripheral blood, use the mouse lymphocyte separating medium, isolate peripheral blood lymphocyte, detect mice peripheral blood T RP2 with flow cytometry method
+-APC
+-CD8
+The ratio of T-MHC cell.
The result
DC is main through following several stages in the antigen presentation process: engulf antigen-processed antigen-move to lymph node-by MHC and costimulatory molecules submission antigen and activated T cell.SIRP α by regulating DC maturation and go back to the nest and then regulated DC activating T cell function? shown in Fig. 7-1: with respect to matched group, SIRP α has significantly reduced DC to CD8
+The propagation of T cell stimulates.In order further to detect the persistence of SIRP α to DC antigen presentation capacity adjustment, we inject each processed group DC of TRP2 load in continuous 4 weeks in C57 mice body, and mice peripheral blood T RP2 is detected in 4 all backs
+-APC
+-CD8
+The ratio of T-MHC cell, result confirm DC after the downward modulation of SIRP alpha expression, and the ability of stimulator antigen specific T-cells is greater than matched group (Fig. 7-2).
The relation of embodiment 6:miSIRP α-DC vaccine and antineoplastic immune
Material
1) EG7 tumor cell line: available from the Chinese Academy of Sciences.
2) B16, B16F10 K-1735: available from the Chinese Academy of Sciences.
3) IFN γ ELISPOT detection kit.
Method
1) EG7 tumor prevention model
At first tumor model is selected the strong tumor EG7 of immunogenicity, and its specific tumour antigen is OVA.Experiment divides three groups, every group of seven mices (DC-PBS group, DC-GFP group, DC-SIRP group).1 * 10
6(OVA) is from the subcutaneous injection of C57 mice palmula behind the DC of interference SIRP α and the matched group DC load antigen.Behind the 2w, 5 * 10
5EG7 cell subcutaneous vaccination C57 back.Observed the size of a tumor in per two days, record mice life span.Get after two weeks at tumor inoculation in addition and respectively organize 2-3 mouse lymph knot, ELISPOT detects tumour-specific T cell activation situation (Fig. 6-1).
2) B16F10 tumor prevention model
In order to verify the tumour immunity function of SIRP α downward modulation back DC, we then select the relatively poor B16F10 of immunogenicity of tumor to set up tumor model.Experiment divides three groups, every group of seven mices (DC-PBS group, DC-GFP group, DC-SIRP group).1 * 10
6(TRP2) is from the subcutaneous injection of C57 mice palmula behind the DC of interference SIRP α and the matched group DC load antigen.Behind the 2w, 1 * 10
6B16F10 cell subcutaneous vaccination C57 back.Observed the size of a tumor in per two days, record mice life span.
3) EG7, B16 oncotherapy model
In order to verify the tumour immunity function of SIRP α downward modulation back DC, we then select the relatively poor B16F10 of immunogenicity of tumor to set up tumor model.Experiment divides three groups, every group of seven mices (DC+PBS group, DC-GFP group, DC-SIRP group).1 * 10
6(TRP2) is from the subcutaneous injection of C57 mice palmula behind the DC of interference SIRP α and the matched group DC load antigen.Behind the 2w, 1 * 10
6B16F10 cell subcutaneous vaccination C57 back.Observed the size of a tumor in per two days, record mice life span.
The result
DC is the important antigen presenting cell of acquired immunity in the body, and it mainly plays a role by inducing antigen-specific T cell.By above experiment, we have confirmed that SIRP α has important regulatory role to DC active antigen specific T-cells, so we think further to prove whether SIRP α can regulate and control the acquired tumour immunity of DC mediation.We at first adopt DC vaccine preform injection in the experiment, and the result confirms that with respect to matched group, miSIRP α-DC vaccine injection can thoroughly suppress the EG7 tumor growth, can prolong the life span (Fig. 6-1 and 2) of B16F10 lotus tumor C57 mice.Behind EG7 injection 2w, we separate each experimental mice CD8
+The T cell detects the secretion level of its IFN-γ, and the result shows: miSIRP α-DC vaccine injection can effectively improve CD8 in the mice with tumor body
+The IFN-γ secretion level (Fig. 6-1) of T cell.Developing of miSIRP α-fine prophylaxis of tumours of DC vaccine injection energy, but under the practical situation, tumor treatment is important more than prevention.We set up EG7 oncotherapy model for this reason: behind tumor injection 1w, and injection DC vaccine, lumbar injection PolyI:C strengthened vaccine function, after this 1 DC vaccine of the every interval of 3w 1w booster injection in second day.The result confirms that miSIRP α-DC vaccine injection can effectively suppress the EG7 growth of tumor, significantly improves mice life span (Fig. 6-3).We are confirmed (Fig. 6-4) by B16 oncotherapy model simultaneously miSIRP α-effective tumor-inhibiting action of DC vaccine.
Claims (3)
1. the application of signal adjusting protein alpha in the DC vaccine of preparation prevention and treatment tumor.
2. the application of signal adjusting protein alpha according to claim 1 in the DC vaccine of preparation prevention and treatment tumor, this DC vaccine is the tumor DC vaccine by the interference SIRP alpha expression of slow virus carrier mediation.
3. the application of signal adjusting protein alpha according to claim 2 in the DC vaccine of preparation prevention and treatment tumor, this DC vaccine makes up in order to following method:
The structure of A, slow virus expression plasmid: LV-microRNA-SIRP α, LV-GFP;
B, expression plasmid and packaging plasmid corotation 293T cell, the packing slow virus, and carry out titre and detect;
The separation and Culture of C, bone marrow dendritic cell;
D, slow virus infection bone marrow dendritic cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010125677 CN101780283A (en) | 2010-03-16 | 2010-03-16 | Application of signal adjusting protein alpha in preparation of DC vaccine for preventing and treating tumors |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010125677 CN101780283A (en) | 2010-03-16 | 2010-03-16 | Application of signal adjusting protein alpha in preparation of DC vaccine for preventing and treating tumors |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101780283A true CN101780283A (en) | 2010-07-21 |
Family
ID=42520507
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010125677 Pending CN101780283A (en) | 2010-03-16 | 2010-03-16 | Application of signal adjusting protein alpha in preparation of DC vaccine for preventing and treating tumors |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101780283A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102335427A (en) * | 2011-10-10 | 2012-02-01 | 中国人民解放军第二军医大学 | Application of signal regulatory protein alpha to preparation of macrophages for preventing and treating tumors |
| CN104174010A (en) * | 2014-08-20 | 2014-12-03 | 武汉大学 | Functions and application of SHPS1 in treatment of post-vascular injury restenosis |
| CN109071664A (en) * | 2016-04-14 | 2018-12-21 | Ose免疫疗法 | Novel anti-SIRPa antibody and its treatment use |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1569235A (en) * | 2004-04-28 | 2005-01-26 | 郭军 | Thermotherapy for treating malignant solid tumour by promoting dendritic cell vaccine function |
-
2010
- 2010-03-16 CN CN 201010125677 patent/CN101780283A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1569235A (en) * | 2004-04-28 | 2005-01-26 | 郭军 | Thermotherapy for treating malignant solid tumour by promoting dendritic cell vaccine function |
Non-Patent Citations (2)
| Title |
|---|
| 《molecular therapy》 20091231 Qiong Liu et al. Abrogation of local cancer recurrence after radiofrequency ablation by dendritic cell-based hyperthermic tumor vaccine 第17卷, 第12期 2 * |
| 《中国博士学位论文全文数据库》 20091231 刘琼 信号调节蛋白alpha在树突状细胞活化中的调节作用和射频消融术联合热休克DC疫苗抑制肿瘤复发 , 第10期 2 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102335427A (en) * | 2011-10-10 | 2012-02-01 | 中国人民解放军第二军医大学 | Application of signal regulatory protein alpha to preparation of macrophages for preventing and treating tumors |
| CN104174010A (en) * | 2014-08-20 | 2014-12-03 | 武汉大学 | Functions and application of SHPS1 in treatment of post-vascular injury restenosis |
| CN104174010B (en) * | 2014-08-20 | 2016-04-13 | 武汉大学 | The function and application of SHPS1 in treatment angiostenosis after damage |
| CN109071664A (en) * | 2016-04-14 | 2018-12-21 | Ose免疫疗法 | Novel anti-SIRPa antibody and its treatment use |
| CN109071664B (en) * | 2016-04-14 | 2023-02-21 | Ose免疫疗法 | Novel anti-SIRPa antibodies and therapeutic uses thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cintolo et al. | Dendritic cell-based vaccines: barriers and opportunities | |
| Casares et al. | CD4+/CD25+ regulatory cells inhibit activation of tumor-primed CD4+ T cells with IFN-γ-dependent antiangiogenic activity, as well as long-lasting tumor immunity elicited by peptide vaccination | |
| JP6175103B2 (en) | Methods for increasing immune response | |
| Lasarte et al. | The extra domain A from fibronectin targets antigens to TLR4-expressing cells and induces cytotoxic T cell responses in vivo | |
| CA2822114C (en) | Sirna against cbl-b and optionally il-2 and il-12 for use in the treatment of cancer | |
| Zuo et al. | An engineered oncolytic vaccinia virus encoding a single-chain variable fragment against TIGIT induces effective antitumor immunity and synergizes with PD-1 or LAG-3 blockade | |
| Liechtenstein et al. | Anti-melanoma vaccines engineered to simultaneously modulate cytokine priming and silence PD-L1 characterized using ex vivo myeloid-derived suppressor cells as a readout of therapeutic efficacy | |
| Mathers et al. | In vivo signaling through the neurokinin 1 receptor favors transgene expression by Langerhans cells and promotes the generation of Th1-and Tc1-biased immune responses | |
| Lopes et al. | New generation of DNA-based immunotherapy induces a potent immune response and increases the survival in different tumor models | |
| Zhang et al. | Genetic vaccines to potentiate the effective CD103+ dendritic cell–mediated cross-priming of antitumor immunity | |
| Draghiciu et al. | A rationally designed combined treatment with an alphavirus-based cancer vaccine, sunitinib and low-dose tumor irradiation completely blocks tumor development | |
| Fabian et al. | Therapeutic efficacy of combined vaccination against tumor pericyte-associated antigens DLK1 and DLK2 in mice | |
| Nicodemus et al. | Toll-like receptor-3 as a target to enhance bioactivity of cancer immunotherapy | |
| Jiang et al. | Immunotherapy with dendritic cells modified with tumor-associated antigen gene demonstrates enhanced antitumor effect against lung cancer | |
| Denies et al. | Immunogenicity and safety of xenogeneic vascular endothelial growth factor receptor-2 DNA vaccination in mice and dogs | |
| Ahn et al. | Oncolytic adenovirus coexpressing interleukin-12 and shVEGF restores antitumor immune function and enhances antitumor efficacy | |
| Fujii et al. | Cancer immunotherapy using artificial adjuvant vector cells to deliver NY‐ESO‐1 antigen to dendritic cells in situ | |
| CN101780283A (en) | Application of signal adjusting protein alpha in preparation of DC vaccine for preventing and treating tumors | |
| Zhang et al. | Dendritic cells transduced with lentiviral-mediated RelB-specific ShRNAs inhibit the development of experimental autoimmune myasthenia gravis | |
| Braun et al. | In vivo silencing of A20 via TLR9-mediated targeted SiRNA delivery potentiates antitumor immune response | |
| Diab et al. | Enhanced responses to tumor immunization following total body irradiation are time-dependent | |
| CN104434973A (en) | Method for intensifying functions of cytokine-induced killer cells | |
| Luo et al. | Effects of tolerogenic dendritic cells generated by siRNA-mediated RelB silencing on immune defense and surveillance functions of T cells | |
| Qiu et al. | Lentiviral-mediated shRNA against RelB induces the generation of tolerogenic dendritic cells | |
| EP3165602B1 (en) | Method for producing b cell population |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20100721 |