CN101760559A - Amplified fluorescence detection reagent for rtA181V idiovariation of HBV virus - Google Patents
Amplified fluorescence detection reagent for rtA181V idiovariation of HBV virus Download PDFInfo
- Publication number
- CN101760559A CN101760559A CN200810201647A CN200810201647A CN101760559A CN 101760559 A CN101760559 A CN 101760559A CN 200810201647 A CN200810201647 A CN 200810201647A CN 200810201647 A CN200810201647 A CN 200810201647A CN 101760559 A CN101760559 A CN 101760559A
- Authority
- CN
- China
- Prior art keywords
- rta181v
- probe
- hbv
- sequence
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The present invention relates to an amplified fluorescence detection reagent for rtA181V idiovariation of HBV viruses. The present invention is characterized in that a pair of primers and a pair of special probes respectively marked with two fluorescent dyes are designed for rtA181V idiovariation (from 181GCT to GTT). A bi-color fluorescent quantitation PCR technique is utilized in a monotube so that quantitative detection can be performed respectively to total HBV DNA of viruses and the DNA of HBV viruses with rtA181V idiovariation. A variant rtA181V DNA template is artificially designed in the present invention for making a quantitative standard curve of total HBV DNA and variant DNA. The method can rapidly and simply detect HBV DNA and the DNA of HBV viruses with rtA181V idiovariation simultaneously in definite quantity, and has high particularity and sensitivity.
Description
Technical field
The present invention relates to two-color fluorescence PCR amplification detection kit fast a kind of and HBV virus rtA181V sudden change easily.
Background technology
(HBV) is all over the world popular for hepatitis B virus, estimates that the whole world has 2,000,000,000 people to infect, and wherein chronic infection person 3.5 hundred million, and China accounts for half, and the whole world has 1,200,000 people to die from the HBV infection every year approximately.This kind infection finally can develop into liver cirrhosis, liver cancer, is to occupy the 9th disease in the human diseases cause of death announced of current WHO.Therefore the antiviral therapy at HBV is subjected to extensive attention.Along with the deep understanding to the 26S Proteasome Structure and Function of HBV polysaccharase, some nucleoside medicines (as: lamivudine LAM, Adefovir ADV) that effectively suppress the HBV dna replication dna progressively become the new selection of anti-HBV treatment.Because the HBV polysaccharase has higher mispairing tendency and lacks the check and correction ability as other retroviral reversed transcriptive enzymes, therefore along with the lasting viral quasispecies that infects increases year by year, under the selective pressure of nucleoside medicine, the resistance variant will increase gradually, the final wild strain that substitutes becomes dominant strain, thereby causes the appearance of clinical drug-resistant phenomenon.
Lamivudine is the L-nucleoside analog, once is the most effective medicine of treatment hepatitis B, is extensive use of in the whole world, has become the most salable prescription drugs in China.But the medicine incidence of lamivudine is very high, and in the time of 1 year, the resistance incidence is about 14%～32% in treatment, and treatment time prolongs the resistance incidence and raises, and the resistance incidence reaches 60%～70% when treating 5 years.And Adefovir resistance variant sites concentrate on P gene D district rtN236T and (or) B district rtA181V, do not have the crossing drug resistant phenomenon with lamivudine.The relative lamivudine resistance of Adefovir resistance incidence is much lower, the III clinical trial phase result of the negative chronic viral hepatitis B of Adefovir treatment HBeAg shows that cumulative genotype resistance incidence is about 0,3%, 11%, 18% and 29% when treating 1,2,3,4,5 year.Therefore, Adefovir more and more is applied in the antiviral therapy of HBV, and common and other drug carries out drug combination.
At present, the technology and the product that does not still have both at home and abroad fast, sensitive detect the Adefovir medicament-resistant mutation use detections that suddenly change of the method for gene sequencing usually, but one side, sequencing reaction sensitivity is hanged down and is caused false negative rate higher.On the other hand, because HBV persister and sensitive strain often coexist as among the patients serum, for the detection of HBV drug resistant mutant genes, this method has fatal defective.A tree name is understood, and when persister was lower than 50%, with the decline of resistance strain ratio, the false negative rate of gene sequencing rapidly increased, and can not detect being lower than 20% mutator gene usually.
Both at home and abroad, all the someone uses the technology of ntPCR-RFLP that the rtA181V site mutation is detected, but this technological operation complexity, length consuming time and cost an arm and a leg and cause the PCR product pollution easily can't be promoted and clinical application.
The TaqMan round pcr is as a kind of quick diagnosis technology, has advantages such as specificity height, highly sensitive, easy and simple to handle and price be more cheap, in scientific research be widely used clinically.Use the method for specific probe hybridization to carry out the design of rt181 detection in Gene Mutation in conjunction with conventional TaqMan technology, because A → V remove to take place in the rt181 site (is GCT → GTT) makes a variation, finding that also A → T is arranged (is GCT → ACT) variation, be difficult to avoid false positive, be unfavorable for designing primer or probe, and equally with sequencing technologies can't accurately judge the symbiotic relationship of virus.
The present invention has carried out ingenious improvement to traditional TaqMan round pcr, not only can carry out quantitative analysis to the viral DNA of rt181V variation, simultaneously, has finished the detection by quantitative of HBV DNA in same PCR pipe.
Summary of the invention
The purpose of this invention is to provide the fluorescent quantitative PCR detection technique that a kind of quick, easy HBV virus rtA181V suddenlys change.
For achieving the above object, the technical solution used in the present invention is: use a pair of Auele Specific Primer and a pair of specific probe, amplification target fragment length is 94bp, and primer sequence is:
Primer 1:5`-GGCTTTCGCAAGATTCCTA-3` (Seq No.1)
Primer 2: 5`-GGAAAGCCCTACGAACCA-3` (Seq No.2)
The perhaps complementary sequence of above-mentioned primer sequence, perhaps above-mentioned sequence homology is greater than 75% sequence.
Two probe direction of design are opposite, and except that sudden change detection site and 3 ' end (sudden change detection site sequence can be complementary, can be not complementary yet, require decision according to detecting) all the other regional complementarities; The Tm value of probe 1 and probe 2 is close, simultaneously also with the Tm value close (mutual difference is all less than 3 ℃) of two primers, 3 ' of two probes are held and all extend 2-4 base except that complementary sequences; Probe 1 has used " GTT " at rt181 codon site correspondence position, owing to confirmed that G and T are in the PCR reaction, can form stable divalent hydrogen ion key (A=G), thereby GTT and wild strain (rt181A) and variant (rt181V) respective complementary sequence all can be hybridized pairing, produce the amplified fluorescence signal, can be used for detecting total HBV viral DNA, probe 2 can match with variant (rt181V) corresponding sequence specific hybrid, produce the amplified fluorescence signal, being used to detect the rtA181V variation (is GCT → GTT).Probe sequence is:
Probe 1:5`-TTTCTCCTGGTTCAGTTTACTAGT-3` (Seq No.3)
Probe 2:5`-TAAACTGAACCAGGAGAAACG-3` (Seq No.4)
The perhaps complementary sequence of above-mentioned primer sequence, perhaps above-mentioned sequence homology is greater than 75% sequence.
The fluorescent quantitative PCR detection kit of above-mentioned HBV virus rtA181V sudden change, the fluorescence radiation group of probe is for being labeled as any two kinds of combinations among FAM, TET, JOE, Cy3, Cy5, Cy5.5, Fluorescein, Rhodamine, RhodamineRed, Rhodamine Green, Rhodamine 6G, Oregon Green 488, Oregon Green 500, Oregon Green 514, Texas Red, TAMRA, Inosine, HEX, FITC, Acridine orange or the ROX; The fluorescent quenching group is any one or more than one the combination among DABCYL, DABSYL, TAMRA, BHQ-1, BHQ-2 or the BHQ-3.
The fluorescent quantitative PCR detection kit of above-mentioned HBV virus rtA181V sudden change adopts multicolor fluorescence PCR quantitative measurement technology, and the HBV viral DNA to total HBV viral DNA and generation rtA181V sudden change carries out quantitative analysis simultaneously in a reaction tubes.
The fluorescent quantitative PCR detection kit of above-mentioned HBV virus rtA181V sudden change, the oligonucleotide fragment of the artificial design of use suitably dilutes the dna virus quantitative criterion product as total DNA of HBV and rtA181V sudden change, and the sequence of oligonucleotide is as follows:
Mutant template: seq-M:
GGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCCTGGTTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCC(94bp)(Seq?No.5)
The fluorescent quantitative PCR detection kit of above-mentioned HBV virus rtA181V sudden change, the reactive component that uses comprises 10mM Tris-HCl (Ph 8.3), 50mM KCl, 300 μ M d (AGC) TP, 300 μ M dUTP, 5mMMgCl2,200nM primer 1,200nM primer 2,200nM probe 1 and 200nM probe 2,1U Taq enzyme, 0.05UUNG enzyme, in addition, test kit also comprises the cut back of synthetic mutant template seq-M.Carrying out real-time fluorescence PCR by following program detects: reaction tubes is earlier 50 ℃ of reactions 2 minutes, and 95 ℃ of insulations are 5 minutes then, again by 94 ℃ 20 seconds → 60 ℃ circulated in 35 seconds 40 times (gathering the fluorescence of correspondent probe mark channel under 60 ℃ of annealing conditions simultaneously).
The present invention and existing HBV viral DNA rtA181V sudden change detection method and traditional TaqMan technology are compared, and have following beneficial technical effects:
(1) compare with traditional TaqMan technology: shorten the length of probe, it is close with primer that the Tm value is dropped to, and to strengthen the specificity of probe to the mutational site, guaranteed susceptibility simultaneously.High 6-10 ℃ of the relative primer of Tm value of traditional TaqMan technical requirements probe, be in order to guarantee probe preferential and template annealing hybridization than primer, stop the combination of probe to prevent primer from extending to the probe joint position fast, thereby reducing sensitivity, but this design makes probe lower to the selection specificity of template, can not differentiate the sudden change of single base at all.The present invention has guaranteed higher sensitivity by the adjusting of concentration and probe concentration, can realize the mutant DNA of 1000copies/ml is detected, in addition, two probes of the present invention's design are reverse sequence, with the positive and negative chain combination of template, there is not competitive relation respectively, can reducing sensitivity.Because the Tm value and the primer of probe are close, by optimizing the specificity of annealing temperature and raising reaction conditions, probe can be hybridized with complete paired template, the enzyme of the extension by primer is cut and is produced the amplified fluorescence signal, and can not hybridize, thereby do not produce the amplified fluorescence signal with the template that morphs.
(2) compare with other technologies: the present invention has carried out whole detections in a reaction tubes, extracts to detect from the HBV viral nucleic acid to finish, and only needs 2 hours, operates very simply, and product is covered, and the pollution of PCR product can not take place.And the present invention can carry out quantitative analysis to the nucleic acid of mutated viruses by the artificial template construct typical curve of design, and ntPCR-RFLP and sequencing technologies all can not obtain quantitative results.In addition, the present invention also can finish the mensuration of HBV viral level simultaneously, and other technologies can not meet the demands, and needs again HBV virus to be carried out quantitative analysis in addition.By the detection by quantitative of HBV virus total amount and rtA181V mutated viruses, can also detect the content of rtA181V mutated viruses.
The invention provides a kind of technology that accurately fast HBV virus rtA181V sudden change carrying out fluorescent quantitation is detected.The present invention simultaneously also can be used for the detection of other transgenations.
Embodiment
Design and preparation primer, probe sequence (at HBV DNA P gene-correlation sequences Design, the GeneBank sequence number is AF182802, down together):
Primer 1:5`-GGCTTTCGCAAGATTCCTA-3` (Seq No.1)
Primer 2: 5`-GGAAAGCCCTACGAACCA-3` (Seq No.2)
Probe 1:5`FAM-TTTCTCCTG
GTTCAGTTTACTAGT-BHQ13` (Seq No.3)
Probe 2:5`TET-TAAACTG
AACCAGGAGAAACG-BHQ13` (Seq No.4)
Synthetic mutant template: seq-M:
GGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCCTG
GTTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCC(94bp)(Seq?No.5)
Above-mentioned primer and probe are all synthetic in precious biotechnology (Dalian) company limited.
The consisting of of the amplified fluorescence detection reagent of HBV virus rtA181V sudden change (20 person-portion):
Composition title volume
Extracting solution A 1ml
Extracting solution B 1ml
PCR reaction buffer 460 μ l
PCR reaction enzymes 40 μ l
Positive criteria product 20 μ l
Positive reference substance 50 μ l
Negative control product 50 μ l
Wherein, PCR reaction buffer (use final concentration) comprising: 10mM Tris-HCl (PH 8.3), 50mM KCl, 300 μ M d (AGC) TP, 300 μ M dUTP, 5mM MgCl
2, 200nM primer 1,200nM primer 2,200nM probe 1 and 200nM probe 2; PCR reaction enzymes (final concentration) comprising: 1U Taq enzyme, 0.05U UNG enzyme; The positive criteria product contain the synthetic mutant template seq-M of proper concn, and positive reference substance is the clinical serum of A181V sudden change male, and the negative control product are the HBVDNA sera negative.
The operation steps of test kit is as follows:
(1) preparation of typical curve standard point
Use ddH2O with positive criteria product gradient dilution to 10,100,1000 times, at this moment, total HBV DNA (being the rt181V mutant DNA) opinion concentration is followed successively by 10
7Copies/ml, 10
6Copies/ml, 10
5Copies/ml and 10
4Copies/ml is as the quantitative criterion product of total DNA of HBV virus and rt181V mutant DNA.
(2) viral nucleic acid extracts
Get test serum sample 50 μ l, add 50 μ l nucleic acid extraction liquid A.Vibration mixing 15s.13, the centrifugal 10min of 000rpm abandons supernatant.The nucleic acid extraction liquid B 50 μ l that add abundant mixing, vibration mixing, 100 ℃ of water-bath 10min, 13, the centrifugal 3min of 000rpm.Getting supernatant uses for pcr amplification.
(3) preparation of fluorescent PCR reaction solution:
Formulated PCR reaction solution by everyone part PCR reaction buffer 23ul, PCR reaction enzymes 2ul, and divide by 25ul/ pipe and to install in the 0.2ml PCR pipe, add the good quantitative criterion product of 5ul nucleic acid extraction product to be checked and dilution then, carrying out real-time fluorescence PCR by following program detects: reaction tubes is earlier 50 ℃ of reactions 2 minutes, 95 ℃ are incubated 5 minutes then, again by 40 times (gathering FAM and TET passage fluorescence under 60 ℃ of annealing conditions simultaneously) of 94 ℃ 20 seconds → 60 ℃ circulations in 35 seconds.
(4) quality monitoring and interpretation of result:
According to the result of instrumental analysis, look experiment effectively in following situation: the Ct value of standard substance cut back is equal＜and 35, and be better linearity (r＞0.9); Positive reference substance Ct value all＜35; Negative control product Ct value all＜35;
The quantitative values that reads the FAM passage is the quantitative values of HBV DNA.
The quantitative values that reads the TET passage is the quantitative values of rt181V mutant DNA.
When quantitative values＜100copies/ml, be judged as feminine gender; When 100copies/ml≤quantitative values＜1000copies/ml, be judged as the detection gray area, suggestion detects again.
The test kit performance index:
The lowest detection amount
The inspection HBV of institute nucleic acid quantification examination criteria product carry out HBV DNA nucleic acid quantification to it in getting, and are diluted to 1 * 10 respectively with the HBV negative serum
4IU/ml, 1 * 10
3IU/ml and 1 * 10
2IU/ml, each cut back all use test kit duplicate detection of the present invention 10 times, and the detection Ct value of statistics FAM fluorescence, result show that test kit can stable detection go out 1 * 10
3The HBVDNA of IU/ml concentration (10/10);
Mutant template with synthetic is diluted to proper concn with the TE damping fluid, measures the OD value under 260 wavelength, according to OD
260Value calculate the concentration of nucleotide sequence, be diluted to 1 * 10 with the TE damping fluid
4Copies/ml, 1 * 10
3Copies/ml and 1 * 10
2Copies/ml, cut back all use test kit duplicate detection of the present invention 10 times, and the detection Ct value of statistics TET fluorescence, result show that test kit can stable detection go out 1 * 10
3The synthetic mutant template seq-M (10/10) of copies/ml concentration;
Specificity
The HBV nucleic acid quantification specificity reference material of using test kit centering inspection of the present invention to be provided detects, and the result is all negative, and specificity is 100%.
Accuracy
Using test kit of the present invention is 2.4 * 10 to concentration
5The positive reference material of the HBV DNA of IU/ml repeats 10 times and detects, and it is CV＜3% that statistics detects the Ct value;
Using test kit of the present invention is 7.2 * 10 to concentration
5The synthetic mutant template seq-M of copies/ml repeats 10 times and detects, and it is CV＜3% that statistics detects the Ct value;
The detection of clinical samples
The hepatitis B patient serum of 25 examples being taken for a long time Adefovir pharmacological agent carries out the nucleic acid sequencing analysis of rt181 site, and uses this test kit to carry out HBV DNA and mutant DNA detection by quantitative, and the quantitative values of HBV DNA all＞5 * 10
4IU/ml, the sudden change recall rate is 32% (8/25), with the coincidence rate of sequencing result be 96% (24/25), incongruent 1 routine sample, gene sequencing result is rt181A, and test kit HBV DNA quantitative values of the present invention is 4.6 * 10
6IU/ml, rt181V mutant DNA quantitative values is 3.3 * 10
4Copies/ml, prompting wild-type HBV DNA is a dominant strain, and mutant DNA only accounts for the small portion of total HBV DNA, sequencing technologies can not be differentiated and detect.
Above-mentioned experimental result shows that test kit of the present invention is simple to operate, can finish the detection by quantitative of HBV DNA detection by quantitative and rtA181V mutant DNA in single tube simultaneously, have highly sensitive, the characteristics of high specificity.
SEQUENCE?LISTING
＜110〉Shanghai Fosun Pharmaceutical (Group) Co., Ltd.
Fuxing Medical Science-Technology Development Co., Ltd., Shanghai
Sword army, what
Virtuous, the summer
＜120〉amplified fluorescence detection reagent of a kind of HBV virus rtA181V sudden change
<160>5
<170>Patentln?version?3.3
<210>1
<211>19
<212>DNA
＜213〉artificial sequence
<400>1
ggctttcgca?agattccta 19
<210>2
<211>18
<212>DNA
＜213〉artificial sequence
<400>2
ggaaagccct?acgaacca 18
<210>3
<211>24
<212>DNA
＜213〉artificial sequence
<400>3
tttctcctgg?ttcagtttac?tagt 24
<210>4
<211>21
<212>DNA
＜213〉artificial sequence
<400>4
taaactgaac?caggagaaac?g 21
<210>5
<211>94
<212>DNA
＜213〉artificial sequence
<400>5
ggctttcgca?agattcctat?gggagtgggc?ctcagtccgt?ttctcctggt?tcagtttact 60
agtgccattt?gttcagtggt?tcgtagggct?ttcc 94
Claims (6)
1. the amplified fluorescence detection reagent of HBV virus rtA181V sudden change is characterized in that comprising a pair of Auele Specific Primer and a pair of specific probe, and amplification target fragment length is 94bp, and primer sequence is:
Primer 1:5`-GGCTTTCGCAAGATTCCTA-3` (Seq No.1)
Primer 2: 5`-GGAAAGCCCTACGAACCA-3` (Seq No.2)
The perhaps complementary sequence of above-mentioned primer sequence, perhaps above-mentioned sequence homology is greater than 75% sequence.
Two probe direction of design are opposite, and except that sudden change detection site and 3 ' end (sudden change detection site sequence can be complementary, can be not complementary yet, require decision according to detecting) all the other regional complementarities; The Tm value of probe 1 and probe 2 is close, simultaneously also with the Tm value close (mutual difference is all less than 3 ℃) of two primers, 3 ' of two probes are held and all extend 2-4 base except that complementary sequences; Probe 1 has used " GTT " at rt81 codon site correspondence position, in fluorescent PCR detects, all can hybridize pairing to wild strain (rt81A) and variant (rt81V) corresponding sequence, produce the amplified fluorescence signal, can be used for detecting total HBV viral DNA, probe 2 can with variant (rt81V) corresponding sequence specific hybrid pairing, produce the amplified fluorescence signal, being used to detect the rtA181V variation (is GCT → GTT).Probe sequence is:
Probe 1:5`-TTTCTCCTG
GTTCAGTTTACTAGT-3` (Seq No.3)
Probe 2:5`-TAAACTG
AACCAGGAGAAACG-3` (Seq No.4)
The perhaps complementary sequence of above-mentioned primer sequence, perhaps above-mentioned sequence homology is greater than 75% sequence.
2. the amplified fluorescence detection reagent of HBV virus rtA181V according to claim 1 sudden change is characterized in that the fluorescence radiation group of label probe can be any two kinds of combinations among FAM, TET, JOE, Cy3, Cy5, Cy5.5, Fluorescein, Rhodamine, Rhodamine Red, Rhodamine Green, Rhodamine 6G, Oregon Green 488, OregonGreen 500, Oregon Green 514, Texas Red, TAMRA, Inosine, HEX, FITC, Acridineorange or the ROX; The fluorescent quenching group is any one or more than one the combination among DABCYL, DABSYL, TAMRA, BHQ-1, BHQ-2 or the BHQ-3.
3. the amplified fluorescence detection reagent of HBV virus rtA181V according to claim 1 sudden change, it is characterized in that adopting multicolor fluorescence PCR quantitative measurement technology, the HBV viral DNA to total HBV viral DNA and generation rtA181V sudden change carries out quantitative analysis simultaneously in a reaction tubes.
4. according to the amplified fluorescence detection reagent of the described HBV virus of claim 1 rtA181V sudden change, it is characterized in that using the oligonucleotide fragment of artificial design suitably to dilute dna virus quantitative criterion product as total DNA of HBV and rtA181V sudden change, the sequence of oligonucleotide is as follows:
Mutant template: seq-M:
GGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCCTG
GTTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCC(94bp)(Seq?No.5)。
5. the amplified fluorescence detection reagent of HBV virus rtA181V according to claim 1 sudden change is characterized in that the PCR reaction system comprises 10mMTris-HCl (PH8.3), 50mM KCl, 300 μ M d (AGC) TP, 300 μ M dUTP, 5mMMgCl
2, 200nM primer 1,200nM primer 2,200nM probe 1 and 200nM probe 2,1U Taq enzyme, 0.05U UNG enzyme, in addition, test kit also comprises the quantitative criterion product that use mutant template seq-M preparation.
6. the amplified fluorescence detection reagent of HBV virus rtA181V according to claim 1 sudden change, it is characterized in that, carrying out real-time fluorescence PCR by following program detects: reaction tubes is earlier 50 ℃ of reactions 2 minutes, 95 ℃ of insulations are 5 minutes then, again by 94 ℃ 20 seconds → 60 ℃ circulated in 35 seconds 40 times (gathering the fluorescence of correspondent probe mark channel under 60 ℃ of annealing conditions simultaneously).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810201647A CN101760559A (en) | 2008-10-23 | 2008-10-23 | Amplified fluorescence detection reagent for rtA181V idiovariation of HBV virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810201647A CN101760559A (en) | 2008-10-23 | 2008-10-23 | Amplified fluorescence detection reagent for rtA181V idiovariation of HBV virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101760559A true CN101760559A (en) | 2010-06-30 |
Family
ID=42491937
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200810201647A Pending CN101760559A (en) | 2008-10-23 | 2008-10-23 | Amplified fluorescence detection reagent for rtA181V idiovariation of HBV virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101760559A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106367528A (en) * | 2016-08-26 | 2017-02-01 | 厦门大学 | Detection method of hepatitis B virus drug-resistant mutation |
-
2008
- 2008-10-23 CN CN200810201647A patent/CN101760559A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106367528A (en) * | 2016-08-26 | 2017-02-01 | 厦门大学 | Detection method of hepatitis B virus drug-resistant mutation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kirishima et al. | Detection of YMDD mutant using a novel sensitive method in chronic liver disease type B patients before and during lamivudine treatment | |
| CN101338343B (en) | Method for detecting hepatitis B virus DNA and G1896A mutation thereof and kit | |
| JP2010042001A (en) | Oligonucleotide for detection of hepatitis b virus | |
| Zhang et al. | Tetra-primer ARMS-PCR combined with GoldMag lateral flow assay for genotyping: simultaneous visual detection of both alleles | |
| CN104293932B (en) | Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR | |
| CN106367528A (en) | Detection method of hepatitis B virus drug-resistant mutation | |
| Lalonde et al. | Sensitive oligonucleotide ligation assay for low-level detection of nevirapine resistance mutations in human immunodeficiency virus type 1 quasispecies | |
| CN116769939A (en) | Primer combination for detecting fluoroquinolone drug-resistant mutation of mycobacterium tuberculosis | |
| CN100422344C (en) | Fluorescent PCR detecting method for hepatitis B virus gene parting and reagent kit | |
| CN101760558A (en) | Amplified fluorescence detection reagent for rtN236T idiovariation of HBV virus | |
| CN101760559A (en) | Amplified fluorescence detection reagent for rtA181V idiovariation of HBV virus | |
| CN109457049B (en) | Composition, kit and method for genotyping detection of hepatitis B virus | |
| CN104962641B (en) | One kind detection HLA B*13:The multiple real time fluorescence PCR method of 01 allele | |
| CN101004415B (en) | Method for measuring drug fast variation of hepatitis b virus to Adefovir | |
| CN103320531B (en) | A kind of novel method that simultaneously can detect multiple HBV resistant mutational site | |
| CN100393888C (en) | Method for detecting gene mutation using PCR blocking and fluorescent probe | |
| Yang et al. | INNO-LiPA HBV genotyping is highly consistent with direct sequencing and sensitive in detecting B/C mixed genotype infection in Chinese chronic hepatitis B patients and asymptomatic HBV carriers | |
| CN101565756B (en) | Detection kit for nucleoside analogue drug-resistant correlated mutation of hepatitis B viruses | |
| CN104004837B (en) | PCR (polymerase chain reaction) primer, primer group, probe and kit for detecting mycobacterium tuberculosis and detection method | |
| Sun et al. | Multiplex locked nucleic acid probes for analysis of hepatitis B virus mutants using real-time PCR | |
| Ding et al. | Detection of hepatitis B virus genotypes A to D by the fluorescence polarization assay based on asymmetric PCR | |
| Geng et al. | Dual-probe assay for detection of lamivudine-resistance hepatitis B virus by real-time PCR | |
| CN102286634B (en) | Technology for quickly detecting southern rice black-streaked stunt virus of plant by RT-LAMP (Reverse Transcription-Loop-mediated Isothermal Amplification) method | |
| CN107034312B (en) | Nucleotide composition, kit and application thereof | |
| CN101195843A (en) | HBV DNA gene parting fluorescence PCR multicenter detecting method and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20100630 |