CN101760524A

CN101760524A - Method for quantitatively detecting mRNA of ARHGDIB gene by using fluorescent RT-PCR technology

Info

Publication number: CN101760524A
Application number: CN200810201648A
Authority: CN
Inventors: 何剑军; 夏懿
Original assignee: Shanghai Fosun Pharmaceutical Group Co Ltd
Current assignee: Shanghai Fosun Pharmaceutical Group Co Ltd; Shanghai Huatuo Medical Science Co Ltd
Priority date: 2008-10-23
Filing date: 2008-10-23
Publication date: 2010-06-30

Abstract

The invention relates to a method for quantitatively detecting the mRNA of an ARHGDIB gene by using fluorescent RT-PCR technology. In the invention, a fluorescent probe is designed for a binding part between two extons of the mRNA of human ARHGDIB gene, an optimal PCR detection scheme is screened, a corresponding one-step-process RT-PCR quantitative detection method is provided to form a corresponding kit. In the invention, a synthetic RNA is provided and a standard curve is made to perform a quantitative analysis on the mRNA. The method has the advantages of precise quantification, high detection speed, capability of eliminating interference of genome DNA, high specificity and high sensitivity, and can be used for research and clinical trials in aspect of ARHGDIB gene expression.

Description

A kind of method of using fluorescent RT-PCR technology detection by quantitative ARHGDIB gene mRNA

Technical field

The present invention relates to a kind of method of using fluorescent RT-PCR technology detection by quantitative ARHGDIB gene mRNA, belong to biology field.

Background technology

Along with finishing of human genome collection of illustrative plates, people begin to enter the genome times afterwards comprehensively, and emphasis has also turned to studies the effect of each gene in life, comprise gene grow, the effect of aspect such as heredity, disease, external form sign.Wherein, the research of expressing for RhoGDP dissociation inhibitor (GDI) beta gene (ARHGDIB gene) also gets more and more.

The detection of genetic expression has several method.Classic methods is whether the variation according to viewed biological chemistry or phenotype in cell or organism decides a certain specific gene to express.Along with the progress of macromole isolation technique make special gene product or protein molecular identification and be separated into possibility.Along with the utilization of recombinant DNA technology, might detect, analyze any gene transcription product now.There are several methods to be widely used in studying specific RNA molecule at present.These methods comprise RT-PCR, in situ hybridization, NORTHERN gel analysis, get ready or trace is got ready, the S-1 nuclease is analyzed, the research of RNA enzyme protection and gene chip etc.

The fluorescent probe PCR technology is the technology of rising and being rapidly developed this year, it is a kind of new detection technique that the fluorescent probe of will have simultaneously related fluorescence radiation group (energy donor) and quenching group (energy acceptor) produces in conjunction with round pcr, have highly sensitive, high specificity, and be difficult for taking place characteristics such as product pollution, comprise the Taqman probe technique, molecular beacon (Beacan probe) etc., because this technological operation is easy, detection speed is fast, and various aspects of performance all has superiority, at present clinical, detection of nucleic acids fields such as research are widely used.

The present invention combines RT-PCR with fluorescent probe technique, detect primer and probe by extensive screening and optimization, has realized fast and accurately the ARHGDIB gene mRNA being carried out quantitative analysis.

Summary of the invention

The method that the purpose of this invention is to provide a kind of quick, easy use fluorescent RT-PCR technology detection by quantitative ARHGDIB gene mRNA.

For addressing the above problem, the invention provides a kind of use single stage method fluorescent RT-PCR technology the ARHGDIB gene mRNA is carried out quantitative methods, according to the GeneBank sequence number is that the gene order of NC_000012 is a template, a pair of primer and specific probe have been designed, detecting length is the target mRNA of 139bp, and its primer probe sequence is respectively:

Primer 1:5`-ACCACAGAAGTCCCTGAAAGAGCT-3` (Seq No.1)

Primer 2: 5`-GGTGAGCCGGGTGACAACGAC-3` (Seq No.2)

Probe 1:5`-TCGGATCTGTCACCACAGGACCA-3` (Seq No.3)

Or probe 2:5`-TGGTCCTGTGGTGACAGATCCGA-3` (Seq No.4)

Or probe 3:5`-TGTGGTGACAGATCCGAA-3` (Seq No.5)

Or probe 4:5`-TTCGGATCTGTCACCACA-3` (Seq No.6)

The perhaps complementary sequence of above-mentioned primer sequence, perhaps above-mentioned sequence homology is greater than 75% sequence.

Designed probe has been crossed over the intron of 111098-111743 position Nucleotide in the NC_000012 gene order, mate with the exon specificity at its two ends respectively, can very effectively avoid the influence of genomic dna like this, also save use DNA enzyme simultaneously sample is digested in order to remove DNA interferential step experimental result.

The probe that uses in the aforesaid method, the fluorescence radiation group of its 5` end can be among FAM, TET, JOE, Cy3, Cy5, Cy5.5, Fluorescein, Rhodamine, Rhodamine Red, Rhodamine Green, Rhodamine 6G, Oregon Green488, Oregon Green 500, Oregon Green 514, Texas Red, TAMRA, Inosine, HEX, FITC, Acridineorange or the ROX any one; 3` end fluorescent quenching group can be any one in DABCYL, DABSYL, Eclipse, TAMRA, BHQ-1, BHQ-2, BHQ-3 or the MGB group.

The method of use fluorescent RT-PCR technology detection by quantitative ARHGDIB gene mRNA provided by the invention is to use the technology of single stage method RT-PCR, makes operation more easy, quick.Use the RNA sequence production standard curve of the synthetic of concentration known, can carry out quantitative analysis the ARHGDIB gene mRNA in the sample.The RNA sequence of its synthetic is as follows: ACCACAGAAGUCCCUGAAAGAGCUGCAGGAAAUGGACAAAGAUGAUGAGAGUCUAA UUAAGUACAAGAAAACGCUGCUGGGAGAUGGUCCUGUGGUGACAGAUCCGAAAGCC CCCAAUGUCGUUGUCACCCGGCUCACC (139bp) (Seq No.7)

The test kit that the method for use fluorescent RT-PCR technology detection by quantitative ARHGDIB gene mRNA provided by the invention forms is formed and is comprised:

Moiety (20 person-portions/box) volume

One step RT-PCR reaction buffer 380 μ l

Mixed enzyme 60 μ l

RNA standard substance 1 20 μ l

RNA standard substance 2 20 μ l

RNA standard substance 3 20 μ l

RNA standard substance 4 20 μ l

DEPC water 1ml

Wherein, One step PCR reactive component (final concentration) comprising: 50mM Tris-HCl (PH 8.3), 50mM KCl, 300uMdNTP, 3mM MgCl ₂, 200nM primer 1,200nM primer 2 and 200nM probe 1.The composition of mixed enzyme (final concentration) comprising: 0.5U AMV enzyme, 0.5U RNase Inhibitor, 0.1mg/ml BSA, 5mM DTT, 1.5U Taq enzyme, 0.05U UNG enzyme.In addition, the luminophore of the 5` of probe 1 end mark is FAM, and holding the quenching group of mark at 3` is Eclipse.

The test kit operation steps that method provided by the invention forms is as follows:

The preparation of PCR reaction solution: by the formulated PCR reaction solution of everyone part One step RT-PCR reaction buffer 19ul, mixed enzyme 3ul, and divide by 22ul/ pipe and to install in the 0.2ml PCR pipe, add an amount of total RNA to be checked then and replenish DEPC water (the RNA positive reference substance is directly got 8ul), making the reaction cumulative volume is 30ul, carrying out single stage method RT-PCR by following program detects: reaction tubes is earlier 50 ℃ of reactions 5 minutes, 95 ℃ are incubated 5 minutes then, again by 94 ℃ 20 seconds → 60 ℃ circulations in 35 seconds 40 times (60 ℃ of annealing conditions are gathered FAM passage fluorescence down).

Traditional RT-PCR uses the two-step approach amplification, time is long, the operation relative complex, and because of many steps are easily polluted, so test kit provided by the invention adopts single stage method RT-PCR technology, RT step and PCR step 1 step are finished, need not be carried out the secondary application of sample by open pipe, will lack the chance of polluting.Because the RT step is to use Auele Specific Primer to extend in the reaction system, compare with traditional random priming, the time that reverse transcription needs is shorter, usually can in 1.5 hours, finish whole RT-PCR reactions, and because test kit uses the stronger AMV reversed transcriptive enzyme of thermostability, can carry out the RT reaction at 50 ℃, the specificity of product is very high.

Description of drawings

Fig. 1 is a synthetic RNA cut back fluorescent PCR amplification curve diagram

Wherein, the synthetic RNA concentration of maximum concentration is 1E+7copies/ml, carries out 3 concentration gradients of 50 times of dilutions, the amplification curve diagram that detects with DEPC water on ABI7300.

Fig. 2 is the total RNA cut back of a clinical samples fluorescent PCR amplification curve diagram

Wherein, healthy people's whole blood sample carries out 4 concentration gradients of 10 times of dilutions, the amplification curve diagram that detects with DEPC water on ABI7300 after total RNA extracts.

Embodiment

Compare and analyze according to No. 12 karyomit(e) ARHGDIB of the human genome among GeneBank gene-correlation sequence, design and preparation primer and probe (design template GeneBank sequence number is NC_000012):

Primer 1:5`-ACCACAGAAGTCCCTGAAAGAGCT-3` (Seq No.1)

Primer 2: 5`-GGTGAGCCGGGTGACAACGAC-3` (Seq No.2)

Probe 1:5`-FAM-TCGGATCTGTCACCACAGGACCA-Eclipse-3` (Seq No.3)

Design and preparation synthetic RNA sequence:

ACCACAGAAGUCCCUGAAAGAGCUGCAGGAAAUGGACAAAGAUGAUGAGAGUCUAAUUAAGUACAAGAAAACGCUGCUGGGAGAUGGUCCUGUGGUGACAGAUCCGAAAGCCCCCAAUGUCGUUGUCACCCGGCUCACC(139bp)(Seq?No.7)

With the RNA sequence of this synthetic with the dissolving of DEPC treated water and be diluted to 1E+7copies/ml, 1E+6copies/ml, 1E+5copies/ml and 1E+4copies/ml, successively as RNA standard substance 1-4.

Press following formulated One step RT-PCR reaction buffer (final concentration): 50mM Tris-HCl (Ph 8.3), 50mMKCl, 300uM dNTP, 3mM MgCl ₂, 200nM primer 1,200nM primer 2 and 200nM probe 1.

Press following formulated mixed enzyme (final concentration): 0.5U AMV enzyme, 0.5U RNase Inhibitor, 0.1mg/ml BSA, 5mM DTT, 1.5U Taq enzyme, 0.05U UNG enzyme.

Test kit consists of:

Moiety (20 person-portions/box) volume

One step RT-PCR reaction buffer 380 μ l

Mixed enzyme 60 μ l

RNA standard substance 1 20 μ l

RNA standard substance 2 20 μ l

RNA standard substance 3 20 μ l

RNA standard substance 4 20 μ l

DEPC water 1ml

The test kit that method provided by the invention forms does not provide mRNA to extract reagent, and the user can use traditional phenol-chloroform extracting method or buy business-like RNA extraction test kit according to oneself requirement.

Detect step:

The preparation of PCR reaction solution: by the formulated PCR reaction solution of everyone part One step RT-PCR reaction buffer 19ul, mixed enzyme 3ul, and divide by 22ul/ pipe and to install in the 0.2ml PCR pipe, add an amount of RNA to be checked then and replenish DEPC water (the RNA standard substance are directly got 8ul), making the reaction cumulative volume is 30ul.

Carrying out single stage method RT-PCR by following program detects: reaction tubes is earlier 50 ℃ of reactions 5 minutes, and 95 ℃ are incubated 5 minutes then, again by 94 ℃ 20 seconds → 60 ℃ circulations in 35 seconds 40 times (60 ℃ of annealing conditions are gathered FAM passage fluorescence down).

Interpretation of result and monitoring:

According to the result of instrumental analysis, look experiment effectively in following situation: the Ct value of RNA standard substance 1-4 is equal＜and 35, and be better linearity (r＞0.9).

The quantitative values that directly reads instrumental analysis is the quantitative values of ARHGDIB gene mRNA.

When quantitative values＜1E+2copies/ml, be judged as feminine gender; When 1E+2copies/ml≤quantitative values＜1E+3copies/ml, be judged as the detection gray area, suggestion detects again.

SEQUENCE?LISTING

＜110〉Shanghai Fosun Pharmaceutical (Group) Co., Ltd.

Fuxing Medical Science-Technology Development Co., Ltd., Shanghai

Sword army, what

Virtuous, the summer

＜120〉a kind of method of using fluorescent RT-PCR technology detection by quantitative ARHGDIB gene mRNA

<160>7

<170>PatentIn?version?3.3

<210>1

<211>24

<212>DNA

＜213〉artificial sequence

<400>1

accacagaag?tccctgaaag?agct 24

<210>2

<211>21

<212>DNA

＜213〉artificial sequence

<400>2

ggtgagccgg?gtgacaacga?c 21

<210>3

<211>23

<212>DNA

＜213〉artificial sequence

<400>3

tcggatctgt?caccacagga?cca 23

<210>4

<211>23

<212>DNA

＜213〉artificial sequence

<400>4

tggtcctgtg?gtgacagatc?cga 23

<210>5

<211>18

<212>DNA

＜213〉artificial sequence

<400>5

tgtggtgaca?gatccgaa 18

<210>6

<211>18

<212>DNA

＜213〉artificial sequence

<400>6

ttcggatctg?tcaccaca 18

<210>7

<211>139

<212>RNA

＜213〉artificial sequence

<400>7

accacagaag?ucccugaaag?agcugcagga?aauggacaaa?gaugaugaga?gucuaauuaa 60

guacaagaaa?acgcugcugg?gagauggucc?uguggugaca?gauccgaaag?cccccaaugu 120

cguugucacc?cggcucacc 139

Claims

1. a method of using fluorescent RT-PCR technology detection by quantitative ARHGDIB gene mRNA is characterized in that comprising a pair of Auele Specific Primer and a specific probe, and amplification target fragment length is 139bp, and primer and probe sequence are:

Primer 1:5`-ACCACAGAAGTCCCTGAAAGAGCT-3` (Seq No.1)

Primer 2: 5`-GGTGAGCCGGGTGACAACGAC-3` (Seq No.2)

Probe 1:5`-TCGGATCTGTCACCACAGGACCA-3` (Seq No.3)

Or probe 2:5`-TGGTCCTGTGGTGACAGATCCGA-3` (Seq No.4)

Or probe 3:5`-TGTGGTGACAGATCCGAA-3` (Seq No.5)

Or probe 4:5`-TTCGGATCTGTCACCACA-3` (Seq No.6)

2. the method for use fluorescent RT-PCR technology detection by quantitative ARHGDIB gene mRNA according to claim 1, the fluorescence radiation group that it is characterized in that label probe 5` end for can FAM, TET, among JOE, Cy3, Cy5, Cy5.5, Fluorescein, Rhodamine, Rhodamine Red, Rhodamine Green, Rhodamine 6G, Oregon Green488, Oregon Green 500, Oregon Green 514, Texas Red, TAMRA, Inosine, HEX, FITC, Acridine orange or the ROX any one; 3` end fluorescent quenching group is any one in DABCYL, DABSYL, Eclipse, TAMRA, BHQ-1, BHQ-2, BHQ-3 or the MGB group.

3. the method for use fluorescent RT-PCR technology detection by quantitative ARHGDIB gene mRNA according to claim 1 is characterized in that using single stage method RT-PCR detection technique of fluorescence, and the ARHGDIB gene mRNA in the sample is carried out qualitative or quantitative analysis.

4. the method for use fluorescent RT-PCR technology detection by quantitative ARHGDIB gene mRNA according to claim 1 is characterized in that, uses artificial synthetic RNA sequence as the RNA positive reference substance, and sequence is as follows:

ACCACAGAAGUCCCUGAAAGAGCUGCAGGAAAUGGACAAAGAUGAUGAGAGUCUAAUUAAGUACAAGAAAACGCUGCUGGGAGAUGGUCCUGUGGUGACAGAUCCGAAAGCCCCCAAUGUCGUUGUCACCCGGCUCACC(139bp)(Seq?No.7)。

5. the method for use fluorescent RT-PCR technology detection by quantitative ARHGDIB gene mRNA according to claim 1 is characterized in that, can form the detection by quantitative test kit, and test kit is formed and comprised:

Moiety (20 person-portions/box) volume

One step RT-PCR reaction buffer 380 μ l

Mixed enzyme 60 μ l

RNA standard substance 120 μ l

RNA standard substance 220 μ l

RNA standard substance 320 μ l

RNA standard substance 420 μ l

DEPC water 1ml

Wherein, One step PCR reactive component (final concentration) comprising: 50mM Tris-HCl (Ph 8.3), 50mM KCl, 300uM dNTP, 3mM MgCl ₂, 200nM primer 1,200nM primer 2 and 200nM probe 1.The composition of mixed enzyme (final concentration) comprising: 0.5U AMV enzyme, 0.5U RNase Inhibitor, 0.1mg/ml BSA, 5mM DTT, 1.5U Taq enzyme, 0.05U UNG enzyme.In addition, the luminophore of the 5` of probe 1 end mark is FAM, and holding the quenching group of mark at 3` is Eclipse.

6. the method for use fluorescent RT-PCR technology detection by quantitative ARHGDIB gene mRNA according to claim 5 is characterized in that operation steps is as follows:

The preparation of PCR reaction solution: by the formulated PCR reaction solution of everyone part One step RT-PCR reaction buffer 19ul, mixed enzyme 3ul, and divide by 22ul/ pipe and to install in the 0.2ml PCR pipe, add an amount of total RNA well that extracts then and also replenish DEPC water (the RNA positive reference substance is directly got 8ul), making the reaction cumulative volume is 30ul, carrying out single stage method RT-PCR by following program detects: reaction tubes is earlier 50 ℃ of reactions 5 minutes, 95 ℃ are incubated 5 minutes then, again by 94 ℃ 20 seconds → 60 ℃ circulations in 35 seconds 40 times (60 ℃ of annealing conditions are gathered FAM passage fluorescence down).