CN101759784B - Polypeptide for localizing proteins on cell walls and application thereof - Google Patents
Polypeptide for localizing proteins on cell walls and application thereof Download PDFInfo
- Publication number
- CN101759784B CN101759784B CN2008102410109A CN200810241010A CN101759784B CN 101759784 B CN101759784 B CN 101759784B CN 2008102410109 A CN2008102410109 A CN 2008102410109A CN 200810241010 A CN200810241010 A CN 200810241010A CN 101759784 B CN101759784 B CN 101759784B
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- sequence
- cell walls
- fragment
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses polypeptide for localizing proteins on cell walls and application thereof. The amino acid sequence of the polypeptide is the sequence 1 in the sequence table. The nucleotide sequence of the DNA molecule for coding the polypeptide is the sequence 2 in the sequence table. The polypeptide is fused with GFP to successfully localize GFP on the cell walls. The polypeptide not only provides a method of directional expression for the foreign proteins but also provides tools for localizing the expressed proteins on the cell surfaces to be used for biotransformation. The polypeptide provides a good platform for studying the functions of the gene proteins of aspergillus fumigatus.
Description
Technical field
The present invention relates to albumen is positioned the polypeptide and the application thereof of cell walls.
Background technology
It is that a kind of conservative post-translational glycosylation is modified that the GPI of eukaryotic cell internal protein (glycosylphosphatidylinositol) modifies, and can with protein positioning on cytolemma, also be a kind of approach of protein transport simultaneously.The protein that GPI modifies has one section hydrophobic N-end signal peptide and one section C-end hydrophobic signal peptide usually; Wherein to be that protein is secreted outward necessary for N-end signal peptide, and C-end signal peptide is the signal modified of GPI then, contains an omega-amino acid that is positioned at C-end 17-25 position.By the catalysis of transaminase complex body that GPI is covalently bound to ω-site in endoplasmic reticulum.The GPI albumen of higher eucaryote finally is positioned on the cytolemma, and many GPI albumen also are located on the cell walls in fungi, and the localized protein of cytolemma and cell walls has different functions.
The proteic cellular localization signal of yeast GPI there is certain understanding at present; Research to model animals cereuisiae fermentum (Saccharomyces cerevisiae) shows; Some the GPI albumen that is positioned cytolemma can partly rupture at the sugar chain of GPI; Make the β-1 on albumen and the cell walls through the residual saccharide residue on the albumen then, the 6-VISOSE connects, thereby albumen is navigated on the cell walls.Discover that if in 4 amino-acid residues at ω-upper reaches, site 2 basic aminoacidss are arranged in the yeast gpi signal peptide, then protein will be located in cytolemma; If do not have basic aminoacids or basic aminoacids by the hydrophobic amino acid substitution, protein will be positioned on the cell walls; If the proteic C-end of GPI is rich in Serine and Threonine (being higher than 30%) also can make albumen be positioned cell walls, explain that the proteic signal for locating of GPI maybe be a kind of incessantly.In addition, some GPI albumen often all have distribution on cytolemma and cell walls, and are at present also disputable to these proteic location.Although also need carry out deep research to the proteic signal for locating of yeast GPI, the cellular localization function of gpi signal peptide has been successfully applied to the localization and expression of foreign protein in yeast cell surface.
Compare with yeast GPI albumen, also very limited to the proteic understanding of the GPI of filamentous fungus.Aspergillus fumigatus (Aspergillus fumigatus) is a kind of filamentous fungus that extensively is present in occurring in nature, and its cell walls is synthetic closely related with GPI albumen.Evidence suggests also the same proteinic transhipment and the location of participating in of GPI albumen of filamentous fungus, but have different significantly with yeast with yeast.
Summary of the invention
The purpose of this invention is to provide a kind of polypeptide and application thereof that albumen is positioned cell walls.
The polypeptide that provides according to the invention, its aminoacid sequence are the sequence 1 in the sequence table, said polypeptide called after AfMP1.
The dna molecular of coding said polypeptide also belongs to protection scope of the present invention.
The dna molecular of coding said polypeptide specifically can be following 1) or 2) or 3):
1) its nucleotide sequence is the sequence 2 in the sequence table;
The dna sequence dna hybridization that 2) under stringent condition, can limit with sequence in the sequence table 2 and the dna molecular of the said polypeptide of coding claim 1;
3) with 1) dna molecular have the homology 90% or more, and the dna molecular of the said polypeptide of claim 1 of encoding.
Gene in the said step 3) is with 1) gene the homology more than 95% is preferably arranged.
Above-mentioned stringent condition can be at 6 * SSC, in the solution of 0.5%SDS, 68 ℃ of hybridization down, uses 2 * SSC then, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.
Contain the recombinant expression vector of said dna molecular or the bacterium of recombinating, the said dna molecular total length of amplification or its any segmental primer to also belonging to protection scope of the present invention.
Polypeptide of the present invention and GFP albumen merge, and successful is positioned GFP albumen on the cell walls.Polypeptide of the present invention is not merely the method that foreign protein provides orientation expression, and for being used for bio-transformation at cell surface localization and expression albumen instrument is provided.The polypeptide that albumen is positioned cell walls of the present invention provides a good platform for research Aspergillus fumigatus gene protein function.
Description of drawings
Fig. 1 is the identification of strains result.
Fig. 2 is the proteic expression of GFP in the Aspergillus fumigatus.
Fig. 3 is the proteic location of fluorescence microscope GFP.
Embodiment
The GFP albumen of embodiment 1, fusion AfMP1 polypeptide is positioned on the cell walls
One, makes up the pchiGFP expression vector
Extract the genomic dna of Aspergillus fumigatus YJ407 CGMCC 0386 (ZL99105415.6), the process for extracting of genomic dna is with reference to " molecular cloning experiment guide ".
Design primer ChiG-N and ChiG-C, the nucleotide sequence of ChiG-N and chiG-C is following:
Primer ChiG-N:5 '-G
GAATTCGAGCCATTGCCTACATCCTTCAC-3 ' (the line part is the EcoRI enzyme recognition site);
Primer ChiG-C:5 '-GG
GGTACCGCGCGCGCCTCCAGATCAGTAC-3 ' (the line part is the KpnI enzyme recognition site).
With the Aspergillus fumigatus genomic dna is template pcr amplified fragment A, and Segment A comprises the 1.5kb promotor (P of Aspergillus fumigatus chitinase gene (AfchiB1)
ChiB1) and N-end signal peptide.
PCR reaction system: 10 * pyrobest Buffer, 5 μ L, each 1 μ L (20 μ mol/L) of primer ChiG-N and ChiG-C, dna profiling 0.5 μ L (1 μ g/ μ L); DNTPs (each 2.5mM) 4 μ L; Pyrobestenzyme (TAKARA, 5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 3min; 94 ℃ of sex change 1min, 50 ℃ of annealing 45s, 72 ℃ are extended 1min30s, totally 30 circulations; 72 ℃ of last 10min that extend.
PCR product (Segment A) reclaims test kit with dna gel and reclaims, and method is with reference to its specification sheets.
Segment A is connected on the pGEM-T Easy carrier, construction recombination plasmid pGEM-ChiB1, and transformed into escherichia coli DH5 α, and pGEM-ChiB1 checks order to recombinant plasmid, and sequencing result shows that the nucleotide sequence of Segment A is shown in sequence in the sequence table 3.
With KpnI and BamHI double digestion digestion pMCB17 carrier (Fernandez-Abalos; J.M.; Et al.; Plant-adapted green fluorescent protein is a versatile vital reporter for geneexpression, protein localization and mitosis in the filamentous fungus, Aspergillus nidulans.Mol Microbiol; 1998.27 (1): p.121-30) (Institute of Microorganism, Academia Sinica); Reclaim test kit with vast Tyke, Beijing biotech company glue and buy the fragment of receiving about 800bp back, obtain the fragment B through KpnI/BamHI digestion, fragment B comprises the GFP2-5 gene.
Fragment B is connected on the pGEM-T Easy carrier, and construction recombination plasmid and transformed into escherichia coli DH5 α check order to recombinant plasmid, the nucleotide sequence that sequencing result shows fragment B like sequence in the sequence table 5 from shown in 5 ' terminal the 1st to the 714th.。
With BamHI and HindIII double digestion digestion PAN7-1 carrier (Punt; P.J., et al., Transformationof Aspergillus based on the hygromycin B resistance marker from Escherichiacoli.Gene; 1987.56 (1): p.117-24) (Institute of Microorganism, Academia Sinica); Reclaim the wherein fragment about 700bp, obtain the fragment C through BamHI/HindIII digestion, fragment C comprises the TrpC terminator of Aspergillus nidulans.
Fragment C is connected on the pGEM-T Easy carrier, and construction recombination plasmid and transformed into escherichia coli DH5 α check order to recombinant plasmid, and sequencing result shows that the nucleotide sequence of fragment B is shown in sequence in the sequence table 4.
With the Segment A of EcoRI/KpnI double digestion, be connected with the pUC19 carrier that the EcoRI/HindIII enzyme is cut with the fragment B of KpnI/BamHI digestion and the fragment C of BamHI/HindIII digestion, make up recombinant vectors pchiGFP.
Two, make up pchiGFP-AfMP1
Extract the genomic dna of Aspergillus fumigatus YJ407 CGMCC 0386.The process for extracting of Aspergillus fumigatus genomic dna is with reference to " molecular cloning experiment guide ".
Primer GFP-N-1:G
GGTACCATGAGTAAAGGAGAAGAACTTTTCAC (the line part is the KpnI enzyme recognition site);
Primer MP1-mid-5:5 '-ATGGATGAACTATACAAAGGCGGCTCCGGCTCC-3 ';
Primer MP1-mid-3:5 '-GGAGCCGGAGCCGCCTTTGTATAGTTCATCCAT-3 ';
Primer MP1-C:5 '-CG
GGATCCTTAGAGAGCGACGGCGATGGC-3 ' (the line part is the BamHI enzyme recognition site).
With the Aspergillus fumigatus genomic dna is template pcr amplified fragment D, and fragment D comprises the C end parts of 153bp Aspergillus fumigatus AfMP1 gene.
PCR reaction system: 10 * pyrobest Buffer, 5 μ L, each 1 μ L (20 μ mol/L) of primer MP1-mid-5 and MP1-C, dna profiling 0.5 μ L (1 μ g/ μ L); DNTPs (each 2.5mM) 4 μ L; Pyrobestenzyme (TAKARA, 5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 3min; 94 ℃ of sex change 1min, 56 ℃ of annealing 1min, 72 ℃ are extended 1min, totally 30 circulations; 72 ℃ of last 10min that extend.
PCR product (fragment D) reclaims test kit with dna gel and reclaims, and method is with reference to its specification sheets.
Fragment D is connected on the pGEM-T Easy carrier, and construction recombination plasmid and transformed into escherichia coli DH5 α check order to recombinant plasmid, and sequencing result shows the nucleotide sequence of fragment D shown in sequence in the sequence table 2, the albumen shown in the sequence 1 in the code sequence tabulation.
With the pchiGFP plasmid is template pcr amplified fragment E, and fragment E comprises 714bp GFP2-5 gene fragment.
PCR reaction system: 10 * pyrobest Buffer, 5 μ L, each 1 μ L (20 μ mol/L) of primer GFP-N-1 and MP1-mid-3, dna profiling 0.1 μ L (1 μ g/ μ L); DNTPs (each 2.5mM) 4 μ L; Pyrobestenzyme (TAKARA, 5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 3min; 94 ℃ of sex change 1min, 58 ℃ of annealing 45s, 72 ℃ are extended 1min30s, totally 30 circulations; 72 ℃ of last 10min that extend.
PCR product (fragment E) reclaims test kit with dna gel and reclaims, and method is with reference to its specification sheets.
With fragment D and fragment E is template pcr amplified fragment F, and fragment F comprises 867bp GFP/MP1 and merges fragment.
PCR reaction system: 10 * pyrobest Buffer, 5 μ L; Each 1 μ L of primer GFP-N-1 and MP1-C, fragment D 1 μ L (0.1 μ g/ μ L), fragment E 1 μ L (0.1 μ g/ μ L); DNTPs (each 2.5mM) 4 μ L; Pyrobestenzyme (TAKARA, 5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 3min; 94 ℃ of sex change 1min, 60 ℃ of annealing 45s, 72 ℃ are extended 1min, totally 20 circulations; 72 ℃ of last 10min that extend.
PCR product (fragment F) reclaims test kit with dna gel and reclaims, and method is with reference to its specification sheets.
Fragment F is connected on the pGEM-T Easy carrier; Construction recombination plasmid and transformed into escherichia coli DH5 α; Recombinant plasmid is checked order, and sequencing result shows the nucleotide sequence of fragment F shown in sequence in the sequence table 5, the albumen shown in the sequence 5 in the code sequence tabulation; From 5 ' terminal the 1st to the 714th coding GFP albumen, the albumen shown in the sequence 1 in 5 ' terminal the 715th to the 867th code sequence tabulation.
Fragment F with the KpnI/BamHI double digestion is connected with the pchiGFP carrier of KpnI/BamHI double digestion, makes up recombinant vectors pchiGFP-AfMP1.
Three, the expression of GFP in the Aspergillus fumigatus
PCDA14 (d ' Enfert; C., Selection of multiple disruption events inAspergillus fumigatus using the orotidine-5 '-decarboxylase gene, pyrG.as aunique transformation marker.Curr Genet; 1996.30 (1): p.76-82) (Institute of Microorganism, Academia Sinica) and pchiGFP-AfMP1 cotransformation Aspergillus fumigatus CEA17 (d ' Enfert; .CurrentGenetics, 1996, Jun; 30 (1): 76-82.) (Institute of Microorganism, Academia Sinica), method is following:
Inoculation 10
8-10
9Aspergillus fumigatus CEA17 spore 37 ℃, was cultivated 5 hours in 50ml YG substratum (yeast extract 5g/L, glucose 20g/L, agar 15g/L); Centrifugal 6000rpm 10 minutes, reclaims spore, with sterilization washing secondary; Add 40ml cell walls Digestive system (ammonium sulfate 52.8g/L, Tripotassium Citrate 16.2g/L, yeast extract 5g/L, sucrose 5g/L; 4g/L Lysing enzyme (Sigma), pH6.0), 33 ℃, the slow cracking of 100rpm 3 hours.The centrifugal supernatant that goes, (ammonium sulfate 52.8g/L, sucrose 10g/L pH6.0) wash secondary with washings.Protoplastis is suspended from 1ml storage liquid (KCl 44.4g/L, CaCl
27.35g/L, MOPS 2g/L, pH6.0), 4 ℃ of preservations.Get 100 μ l protoplastiss and 4 μ g pCDA14 and 4 μ g pchiGFP (perhaps pChiGFP-S) and add 50 μ l PEG, 6000 solution (PEG6000 250g/L, CaCl again
27.35g/L, KCl 44.4g/L, Tris 1.21g/L, pH7.5), place 15 minutes on ice after, add 1ml PEG 6000 solution, room temperature 20 minutes.37 ℃ of insulation Plate solution (agarose 3.5g/L, ammonium sulfate 52.8g/L, sucrose 342g/L are dissolved in 100ml MM) keep liquid state, add the 3.5ml mixing; Be layered on height and ooze solid selection substratum (agar 15g/L, ammonium sulfate 52.8g/L, sucrose 340g/L; Be dissolved in 1000ml MM) on, cultivated 2-3 days for 30 ℃, see tangible bacterium colony after; Screen with MM, rapid extraction DNA carries out PCR again, and amplification AfMP1 fragment is identified (Figure 1A).With pCDA14 and pChiGFP carrier cotransformation Aspergillus fumigatus CEA17 as contrast.
MM: glucose 10g/L, Sodium Glutamate 1g/L, salts solution 20ml/L [Repone K 26g/L, bitter salt 26g/L, potassium hydrogenphosphate 76g/L; Trace element (50ml/L ten hydrated sodium borate 40mg/L, Salzburg vitriol 400mg/L, two ferrous sulfate hydrate 800mg/L; Two anhydrous manganese 800mg/L; Two molybdic acid hydrate sodium 800mg/L, Zinc vitriol 8g/L)], pH6.8.
Among Figure 1A, " 1 " is molecular weight standard, and " 2 " are the AfMP1 fragment of amplification.
Four, Southern blot identifies transformant
The concrete experimental technique of Southern blot is seen " molecular cloning ".
Behind plasmid pchiGFP-AfMP1 and the pCDA14 cotransformation CEA17 bacterial strain, screening obtains positive colony, one of them called after MP1-1.The Southern results of hybridization confirms that through analyzing fusion gene has been incorporated in the genomic dna of MP1-1 bacterial strain shown in Figure 1B.
Five, Western blot detects the expression of GFP.
Western blot detects the expression of GFP.The antibody anti-GFP antibody that Western blot uses is available from Clontech company, catalog number (Cat.No.) 632375.
The MP1-1 bacterial strain extracts membranin at 37 ℃ after cultivating 48 hours, can detect the GFP band with anti-GFP antibody, and Western blot result is as shown in Figure 2 to be shown, GFP can be in MP1-1 normal expression.Two protein bands appear on the Westernblot result of MP1-1, possibly be GPI glycosylation modified due to because contain potential GPI glycosylation site (sequence 1 is from the terminal 26-28 of nitrogen position in the sequence table) on the AfMP1 peptide section that merges with GFP.
1 is the SDS-PAGE electrophoresis result among Fig. 2, and 2 is the molecular weight of albumen standard, and 3 is Western blot result.
Six, fluorescent microscope is observed the MP1-1 bacterial strain down
With MP1-1 bacterial strain in 200ml CM 37 ℃, 200rpm cultivates, fluorescence microscope.
CM: glucose 10g/L, peptone 2g/L, yeast extract 1g/L; Enzymic hydrolysis casein 1.5g/L, salts solution 20ml/L [Repone K 26g/L, bitter salt 26g/L, potassium hydrogenphosphate 76g/L, trace element (50ml/L ten hydrated sodium borate 40mg/L; Salzburg vitriol 400mg/L, two ferrous sulfate hydrate 800mg/L, two anhydrous manganese 800mg/L; Two molybdic acid hydrate sodium 800mg/L, Zinc vitriol 8g/L)], pH6.8.
The fluorescence microscope result is as shown in Figure 3, fusion rotein can be in Aspergillus fumigatus stably express.The MP1-1 bacterial strain is handled the fluorescent signal that makes hyphal cell dehydration, cytolemma cell walls separate back discovery GFP/MP1 the mycelia of mycelial growth initial stage (8h), logarithmic growth mid-term (30h), plateau (60h) and decline phase (140h) with the 0.5M sorbyl alcohol mainly to be distributed on the cell walls.And the GFP albumen that the Aspergillus fumigatus of pCDA14 and pchiGPF cotransformation is expressed is distributed in outside the born of the same parents.
"-" expression is not handled with sorbyl alcohol among Fig. 3; "+" expression sorbyl alcohol is handled. Digital 8h, 24,30h, 60h and 140h are the different time of mycelial growth on the figure.
Sequence table
< 110>Institute of Microorganism, Academia Sinica
< 120>albumen is positioned the polypeptide and the application thereof of cell walls
<130>CGGNARW82099
<160>5
<210>1
<211>50
<212>PRT
< 213>Aspergillus Aspergillus fumigatus (Aspergillus fumigatus)
<400>1
Gly Gly Ser Gly Ser Gly Ser Gly Ser Ser Thr Gly Thr Ala Thr Ala
1 5 10 15
Ser Thr Ser Thr Asn Leu Leu Ser Thr Gly Ala Ala Ser Lys Glu His
20 25 30
Phe Ser Tyr Ser Leu Gly Gly Ala Val Val Ala Ala Ala Ile Ala Val
35 40 45
Ala Leu
50
<210>2
<211>153
<212>DNA
< 213>Aspergillus Aspergillus fumigatus (Aspergillus fumigatus)
<400>2
ggcggctccg gctccggctc cggctccagc actggtactg ccactgcctc caccagcacc 60
aacctcctct ccactggcgc cgccagcaag gagcacttca gctactccct cggcggtgcc 120
gtcgtcgcgg ccgccatcgc cgtcgctctc taa 153
<210>3
<211>1817
<212>DNA
< 213>Aspergillus Aspergillus fumigatus (Aspergillus fumigatus)
<400>3
aaagcgacac ctacggatag aagtgttcta atgacaagcg gcttgttcaa gctatttagc 60
tgtcctcaac tggaaagatt agaacagctt cagacattaa ctagatatgc ctccctgcaa 120
cagcctcgct attgggaagt tcattaatta tgaacatcgc agccttttct aatctactcc 180
gtatccttcc ctctacttat gacttgtttt tccataactg agaagcgaca tgaaacggac 240
tttatggatt cactagaaaa gctaatggat acagaatctc gacatccagc catggcaggt 300
accctggttt ataatgagcc attgcctaca tccttcacaa ctcaattgtg tttttattat 360
tcctgctttc tcttccggta gcaggccgac gcatgagtgc gtgtcgtctc cgaaacaaac 420
tgttgcaaaa tggctaacta tttcctgatt acggcctcgt ggtcatcggt gtgattctca 480
tcatctggac ggtttactgg tttatcaagg ggcagaagag attctcacgt cagcatgtcc 540
tctcgacaac caccaccata gttaactcat ctgcatcgct gtgaaacagc ggcagaccaa 600
tctgcactga tgcactggat gtgaggtact ctctttctgt gccattgacg gactaggtat 660
caaatcggtt cagcggagaa gttctcaact tcatgagtat gacacgtgcg agctactcca 720
tatgttcgcc tctcagacat tactgactcc taaatggaag gacacgcaaa gtaaacctag 780
atggaatggc gtccccccat atttcgactg acacgtatgc atcggaatag ctgaccagga 840
aataggggtt cggcagcatc accccgtact gcactccatc gcgcggggtc aaccccagtg 900
tgtcttcaag accctgtcag gaagatatta acaacattgg tatgttacat tacattactc 960
aagggttgaa aagccgtaat ctcggctgtt gccaattcta ctgcccagtt gacaaaatga 1020
tagcgggagt gatagtgaca tcccttgggc tcggcggcaa cggtcacgtc gcatagcgtc 1080
acgctccctt tcagctgctg caaacccctt ttgacccatt aaacagtgga atgataaccc 1140
caaagggcat gtgcttcgat atacacgtcc tcatgtcgtt acatcgaact gagattacgg 1200
agacccctca cgcgactaag cgccttggcg accctccacg cggggagtca cattgccttt 1260
tctgcaccaa gtgaagctct cattgggcag ataagcccag ctccctttca tctgccgacg 1320
tcgcatgcag gatggtcagg tacgtgaaac ctggcctgtg actcgagatt actgcaagat 1380
cgacggccgt cggatcaccg gaacctggtt cttcactgaa tcgctgcctt atctcttcat 1440
ctgatttgat ccctatcttg tgacacgttg ccatcagggt tactagtgat agggctctgg 1500
ttaatattat atctacaacg cgacgatggg acttgaccag ggagcgacgc tgtgtggtga 1560
gtgttgtaga tgtcgaatga aggcagggat gaagaccagg agattcagag ataaataggg 1620
agcgtttctt gtggtattta caatgcacag aacgactcat ccgacaagct catacatcga 1680
caagctcgac tgaaacgaca acaatgcgct ttgcaacttc caccatcgtc aaggtcgccc 1740
ttctgcttag cagtctttgt gtcgacgccg cagtgatgtg gaatcgtgat accagtagta 1800
ctgatctgga ggcgcgc 1817
<210>4
<211>769
<212>DNA
< 213>Aspergillus Aspergillus fumigatus (Aspergillus fumigatus)
<400>4
acttaacgtt actgaaatca tcaaacagct tgacgaatct ggatataaga tcgttggtgt 60
cgatgtcagc tccggagttg agacaaatgg tgttcaggat ctcgataaga tacgttcatt 120
tgtccaagca gcaaagagtg ccttctagtg atttaatagc tccatgtcaa caagaataaa 180
acgcgttttc gggtttacct cttccagata cagctcatct gcaatgcatt aatgcattga 240
ctgcaaccta gtaacgcctt caggctccgg cgaagagaag aatagcttag cagagctatt 300
ttcattttcg ggagacgaga tcaagcagat caacggtcgt caagagacct acgagactga 360
ggaatccgct cttggctcca cgcgactata tatttgtctc taattgtact ttgacatgct 420
cctcttcttt actctgatag cttgactatg aaaattccgt caccagccct gggttcgcaa 480
agataattgc atgtttcttc cttgaactct caagcctaca ggacacacat tcatcgtagg 540
tataaacctc gaaatcattc ctactaagat ggtatacaat agtaaccatg gttgcctagt 600
gaatgctccg taacacccaa tacgccggcc gaaacttttt tacaactctc ctatgagtcg 660
tttacccaga atgcacaggt acacttgttt agaggtaatc cttctttcta gaagtcctcg 720
tgtactgtgt aagcgcccac tccacatctc cactcgacct gcaggcatg 769
<210>5
<211>867
<212>DNA
< 213>artificial sequence
<220>
<230>
<400>5
atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60
gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc aacatacgga 120
aaacttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180
gtcactactt tcacctatgg tgttcaatgc ttttcaagat acccagatca tatgaagcgg 240
cacgacttct tcaagagcgc catgcctgag ggatacgtgc aggagaggac catcttcttc 300
aaggacgacg ggaactacaa gacacgtgct gaagtcaagt ttgagggaga caccctcgtc 360
aacaggatcg agcttaaggg aatcgatttc aaggaggacg gaaacatcct cggccacaag 420
ttggaataca actacaactc ccacaacgta tacatcatgg ccgacaagca aaagaacggc 480
atcaaagcca acttcaagac ccgccacaac atcgaagacg gcggcgtgca actcgctgat 540
cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600
ctgtccacac aatctgccct ttcgaaagat cccaacgaaa agagagacca catggtcctt 660
cttgagtttg taacagctgc tgggattaca catggcatgg atgaactata caaaggcggc 720
tccggctccg gctccggctc cagcactggt actgccactg cctccaccag caccaacctc 780
ctctccactg gcgccgccag caaggagcac ttcagctact ccctcggcgg tgccgtcgtc 840
gcggccgcca tcgccgtcgc tctctaa 867
Claims (7)
1. a peptide species, its aminoacid sequence is the sequence 1 in the sequence table.
2. the dna molecular of coding claim 1 said polypeptide.
3. dna molecular according to claim 2 is characterized in that: the nucleotide sequence of said dna molecular is the sequence 2 in the sequence table.
4. the recombinant expression vector that contains claim 2 or 3 said dna moleculars.
5. the reorganization bacterium that contains claim 2 or 3 said dna moleculars.
6. the said polypeptide of claim 1 is in the application that target protein is navigated in the cell walls.
7. claim 2 or 3 said dna moleculars are in the application that target protein is navigated in the cell walls.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102410109A CN101759784B (en) | 2008-12-24 | 2008-12-24 | Polypeptide for localizing proteins on cell walls and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102410109A CN101759784B (en) | 2008-12-24 | 2008-12-24 | Polypeptide for localizing proteins on cell walls and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101759784A CN101759784A (en) | 2010-06-30 |
| CN101759784B true CN101759784B (en) | 2012-05-30 |
Family
ID=42491180
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008102410109A Expired - Fee Related CN101759784B (en) | 2008-12-24 | 2008-12-24 | Polypeptide for localizing proteins on cell walls and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101759784B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110760537A (en) * | 2018-07-27 | 2020-02-07 | 中国农业科学院饲料研究所 | Recombinant expression vector for rapidly screening recombinant strain and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1269405A (en) * | 1999-04-06 | 2000-10-11 | 中国科学院微生物研究所 | Chitinase produced by fumigacin |
-
2008
- 2008-12-24 CN CN2008102410109A patent/CN101759784B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1269405A (en) * | 1999-04-06 | 2000-10-11 | 中国科学院微生物研究所 | Chitinase produced by fumigacin |
Non-Patent Citations (1)
| Title |
|---|
| 陈晓敏等.：烟曲霉蛋白质分泌载体的构建及酸性磷酸酯酶的细胞定位.《微生物学报》.2008,第48卷(第10期),1330-1338. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101759784A (en) | 2010-06-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cao et al. | The Flo8 transcription factor is essential for hyphal development and virulence in Candida albicans | |
| Baladrón et al. | Eng1p, an endo-1, 3-β-glucanase localized at the daughter side of the septum, is involved in cell separation in Saccharomyces cerevisiae | |
| Hull et al. | Sex-specific homeodomain proteins Sxi1α and Sxi2 a coordinately regulate sexual development in Cryptococcus neoformans | |
| JP5662370B2 (en) | Protein fusion factor library for recombinant protein production and protein fusion factor obtained from the same | |
| Zhang et al. | Knocking out Bcsas1 in Botrytis cinerea impacts growth, development, and secretion of extracellular proteins, which decreases virulence | |
| US20240150416A1 (en) | Compositions and Methods for Producing High Secreted Yields of Recombinant Proteins | |
| Martínez et al. | Role of Pir1 in the construction of the Candida albicans cell wall | |
| US11370815B2 (en) | Compositions and methods for producing high secreted yields of recombinant proteins | |
| De Groot et al. | Different temporal and spatial expression of two hydrophobin-encoding genes of the edible mushroom Agaricus bisporus | |
| CN101759784B (en) | Polypeptide for localizing proteins on cell walls and application thereof | |
| CN101759783B (en) | Polypeptide for localizing proteins on cell membranes and application thereof | |
| CN109134662B (en) | Visual antibacterial peptide fusion protein, and preparation method and application thereof | |
| CN101759782B (en) | Polypeptide for localizing proteins on cell membranes and/or cell walls and application thereof | |
| CN102260331B (en) | Pichia pastoris wall protein Gcw34, surface display system constructed by same and construction method of surface display system | |
| CN102180954A (en) | Pichia pastoris wall protein and surface display system constructed by same and construction method of surface display system | |
| KR100915670B1 (en) | A novel YlMPO1 gene derived from Yarrowia lipolytica and a process for preparing a glycoprotein not being mannosylphosphorylated by using a mutated Yarrowia lipolytica in which YlMPO1 gene is disrupted | |
| Manalil et al. | Comparative analysis of the Metarhizium anisopliae secretome in response to exposure to the greyback cane grub and grub cuticles | |
| CN102260336B (en) | Pichia pastoris wall protein Gcw5, surface display system constructed by same and construction method of surface display system | |
| CN102260334B (en) | Pichia pastoris wall protein Gcw21 as well as surface display system and building method | |
| CN102276703B (en) | Pichia pastoris wall protein Gcw51, and surface display system and construction method thereof | |
| Ikeuchi et al. | Two new components of 9 and 14 kDa from spinach photosystem I complex | |
| CN102276704B (en) | Pichia pastoris wall protein Gcw28, and surface display system and construction method thereof | |
| CN102276705B (en) | Pichia pastoris wall protein Gcw17, surface display system constructed by same and construction method of surface display system | |
| CN102260330B (en) | Pichia pastoris wall protein Gcw42, surface display system constructed by same and construction method of surface display system | |
| CN102260329B (en) | Pichia pastoris wall protein Gcw45, and surface display system and construction method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120530 Termination date: 20201224 |