CN101748145A

CN101748145A - Recombinant yeast for expressing antibody or antibody analogue as well as construction method and application thereof

Info

Publication number: CN101748145A
Application number: CN200910133343A
Authority: CN
Inventors: 刘波; 吴军; 王凌雪; 巩新; 唱韶红
Original assignee: Institute of Bioengineering Chinese Academy of Military Medical Sciences
Current assignee: Institute of Bioengineering Chinese Academy of Military Medical Sciences
Priority date: 2008-12-03
Filing date: 2009-06-29
Publication date: 2010-06-23

Abstract

The invention discloses recombinant yeast for expressing an antibody or an antibody analogue as well as a construction method and application thereof. In the construction method of the recombinant yeast for expressing the antibody or the antibody analogue, an encoding gene of the antibody or an encoding gene of the antibody analogue is introduced in a yeast to obtain a recombinant bacterium; the antibody analogue is a fusion protein formed by an Fc fragment of the antibody and a protein or a protein subunit; the encoding gene of the antibody is a heavy chain encoding gene and a light chain encoding gene of the antibody, and the 5' end of the encoding gene of the antibody or the encoding gene of the antibody analogue is connected with an encoding signal peptide nucleotide sequence; and signal peptide is serum albumin signal peptide. By utilizing the recombinant yeast for expressing the antibody or the antibody analogue to prepare the antibody and the antibody analogue, the invention can solve the bottlenecks of difficult antibody production, requirements of high product purity and large amount and the like and can also exert the functions provided by the antibody Fc fragment, thereby having a favorable application potential.

Description

The recombination microzyme of expressing antibodies or antibody analog and construction process thereof and application

Technical field

The present invention relates to recombination microzyme and the construction process and the application of expressing antibodies or antibody analog.

Background technology

Genetic engineering antibody and antibody analog medicine are one of the fastest medicines of development in recent years.Often human dosage is bigger for this class medicine, and potion reaches tens of to hundreds of milligrams, antibody drug that often needs gram level amount the course of treatment of a patient, so its market demand is huge.Antibody drug is the albumen of a class formation complexity, its monomer is symmetric molecule, a heavy chain and a light chain combine with an intermolecular disulfide bond and non covalent bond, and two heavy chains are joined together to form the antibody monomer by non covalent bond and one or more disulfide linkage again.Some antibody molecule is made up of a monomer, and as IgG, some antibody can be coupled together by a plurality of monomers and form polymer, can be pentamer as IgM, and IgA can be dimer.During therefore with the gene engineering method expressing antibodies, need light chain and two peptide chains of heavy chain of expressing antibodies simultaneously, the weight chain is assembled into complete antibody molecule in cell, be secreted into outside the born of the same parents again.Antibody analog is to be merged with other albumen by the Fc of heavy chain of antibody part to obtain, and they also can form the structure of similar antibody by the intermolecular disulfide bond of Fc part.Because the complicacy of antibody protein structure, the genetic engineering antibody medicine is mostly by mammalian cell production.Though, the expression level of mammalian cell is greatly improved in recent years, but the cultivation cost that mammalian cell is high, the restriction that reaches the cultivation scale is still seriously restricting the development of such medicine, also is to cause antibody drug to treat expensive major cause.

Yeast is as the simplest eukaryote, promptly has to cultivate with low costly, is easy to scale production, and the expression level height has the posttranslational modification function again, can finish the assembling of the folding and protein complexes of protein peptide chain.In recent years, the development of yeast glycosyl engineering makes yeast possess complexity glycosyl synthesis capability again.Thereby yeast is expected to become the cheap platform of antibody drug preparation.

Summary of the invention

The purpose of this invention is to provide recombination microzyme and the construction process and the application of a kind of expressing antibodies or antibody analog.

The construction process of the recombination microzyme of expressing antibodies provided by the present invention or antibody analog is with acquisition reorganization bacterium in the encoding gene importing yeast of the encoding gene of antibody or antibody analog; Described antibody analog is the Fc fragment of antibody and the fusion rotein of albumen or protein protomer formation; The encoding gene of described antibody is the heavy chain encoding gene and the light chain encoding gene of antibody, and 5 ' end of the encoding gene of described antibody or the encoding gene of antibody analog is connected with the sequence of coded signal peptide; Described signal peptide is the serum albumin signal peptide.

Described serum albumin signal peptide can be following 1) or 2):

1) its aminoacid sequence is the sequence 1 in the sequence table;

2) with sequence table in the homology of sequence 1 greater than 50% polypeptide.

Described serum albumin signal peptide specifically can be the sequence 5 or 6 or 7 in the sequence table.Discover, influence a deficiency that important factor is the antibody-secreting ability of antibody expression level in the yeast, especially the secretion of heavy chain is the important factor of the whole antibody expression of influence, this phenomenon not only exists when whole antibody is expressed, in the expression of antibody fragment, also find to have similar phenomenon (Gasser B, Maurer M, Gach J, et a1.Engineering ofPichia pastoris for improved production of antibody fragments.BiotechnolBioeng.2006,94 (2): 353-61).

5 ' end of the encoding gene of antibody of the present invention or the encoding gene of antibody analog is connected with the nucleotide sequence of coding serum albumin signal peptide, thereby improves antibody and antibody analog expression level, thereby has important application prospects.On the serum albumin signal peptide sequence in different animals source certain difference is arranged, have only 50% as human serum albumin and xenopous laevis serum albumin signal peptide sequence homology, but the effect of enhancing antibody excretory is arranged all, therefore above-mentioned serum albumin signal peptide can derive from various animals, mammalian blood serum human serum albumin signal peptide preferably is as sero-abluminous signal peptides such as people, oxen.These sequences can be in many public datas storehouse, as can from state-run biotechnology NCBI of information center of the disclosed U.S. (http://www.ncbi.nlm.nih.gov/) or the disclosed database of European molecular biosciences laboratory EMBL (http://www.embl.org), obtaining, the DNA of these signal peptides encodes, can adopt PCR, enzyme method such as cuts from acquisitions such as the cDNA of corresponding species or its libraries, also can adopt the method for synthetic to obtain, these dna sequence dnas can be native sequences, also can especially adopt the yeast preference codon to replace the expression that original code often helps antibody with the sequence of synonym replacement.Above-mentioned serum albumin signal peptide also can be the serum albumin signal peptide that derives from each species, by the varient of acquisitions such as reorganization between species, sudden change, disappearance.These varients be meant with above-mentioned signal peptide homology greater than 50%, and have enhancing antibody or antibody analog excretory polypeptide, homology that more excellent is greater than 80%, optimum be homology greater than 95% polypeptide.The structure of these varients can adopt rite-directed mutagenesis, random mutation, cause the whole bag of tricks known in the art such as wrong PCR, DNA rearrangement.The serum albumin signal coding sequence can merge with the heavy chain gene and/or the light chain gene of antibody, also can merge with Fc antigen-4 fusion protein gene in the antibody analog.Also can between signal coding sequence and gene, add joint sequence.A gene fusion of serum albumin signal peptide and antibody, i.e. the secretion of antagonist has obvious facilitation.

Antibody is by light, two genes encodings of heavy chain, and two heavy chains and two light chains after transcribing are assembled into complete antibody monomer molecule in cell.Realize that antibody efficiently expresses the downstream that two genes can be placed same promotor respectively, contain heterogeneic expression cassette with these two then and be cloned on the plasmid, express two genes behind the transformed yeast simultaneously.In order to make these two genes in same yeast, coordinate simultaneously to express, also two genes can be placed the different promoters downstream respectively, thereby obviously improve the expression amount of antibody.Avoided owing to there are two identical promotors, and homologous recombination and the mrna instability that causes is fixed between the promotor that causes.These promotors can be the various promotors that are adapted at using in the yeast, as alcohol oxidase (AOX), FLD, glyceraldehyde dehydrogenase (GAP), PMA, lactose promotor (LAC), ADH, alcohol oxidase, PH05, PGK etc.Preferably,, all can use methanol induction as AOX and FLD with two kinds of promotors that have identical inductive condition or be composing type; GAP and PMA are constitutive promoter etc., the sequence of these promotors can be from various documents and disclosed database, as obtaining from state-run biotechnology NCBI of information center of the U.S. (http://www.ncbi.nlm.nih.gov/) or the disclosed database of European molecular biosciences laboratory EMBL (http://www.embl.org).According to these sequences, can use the known method in this area, obtain these genes as methods such as PCR, synthetic, wherein PCR is template used, can be various zymic genomic dnas or the commercialization carrier that contains these promotors.Plasmid pPIC9 (containing the AOX1 promotor), pGAP (containing the GAP promotor) etc. as American I nvitrogen company.The structure of the carrier of, heavy chain expression light with different promoters control antibody, is cut methods such as connection, PCR at the whole bag of tricks that can know altogether with this area as enzyme.Other element on the carrier can derive from various business-like carriers as the duplicate field of carrier, selection markers etc., as PUC19 (worker company is given birth in Shanghai), pPIC9 (American I nvitrogen company) etc.

Antibody analog is Fc fragment and the albumen or the protein protomer formation fusion rotein of antibody, and described fusion rotein forms the albumen of the dimeric structure of similar antibody by the disulfide linkage on the Fc.Can utilize the peculiar biological effector function of Fc section when making up antibody analog, some albumen (as cell-membrane receptor) with specific recognition and combined function is merged with antibody Fc section.

The Fc fragment of described antibody is selected from following arbitrary antibody: IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD and IgE.

The Fc antigen-4 fusion protein gene in the nucleotide sequence of above-mentioned signal peptide and encoding antibody heavy chain, light chain or the antibody analog of encoding, under the constant condition of the reading frame that keeps encoding amino acid sequence separately, merge (merging), obtain to have the antibody of above-mentioned signal peptide or the encoding gene of antibody analog with frame.This gene inserts the expression vector that suitable Yeast expression carrier obtains antibody or antibody analog.This carrier transformed yeast obtains the gene engineering yeast of expressing antibodies or antibody analog, cultivates this project yeast, can prepare antibody or antibody analog.

In order to make this carrier can transform same yeast easily, generally should have different selection markers genes on this carrier, the structure of these carriers can be used PCR, enzyme is cut, the method that this areas such as connection are known altogether, selection markers can be an amino acid, the synthetic gene of the essential composition of yeast growths such as Nucleotide, as HIS4, ADE, ARG, (Lin Cereghino, G.P., Lin Cereghino such as URA3, J., Sunga, A.J., Johnson, M.A., Lim, M., Gleeson, M.A.and Cregg, J.M. (2001) New selectable marker/auxotrophichost strain combinations for molecular genetic manipulation of Pichiapastoris.Gene, 263,159-69.), also can be various antibiotic resistant genes, as Zeocin, Kana etc.The sequence of these genes is all open on many documents and Pubmed, utilizes these sequences, is template with the yeast genes group, can obtain the synthetic gene of the essential composition of yeast growths such as above-mentioned amino acid, Nucleotide with methods such as PCR, library screenings.Various antibiotic resistant genes then can be from some resistant strains, or obtain on some business-like carriers.If the synthetic gene that adopts the essential composition of yeast growths such as amino acid, Nucleotide is as selection markers, then need to have the yeast host of corresponding genetic flaw, the yeast host of these genetic flaws can obtain with the method for conventional screening mutant strain (as, modern biotechnology collected translation yeast genetics experiment guide, work such as A. Adam Si grade, Liu Ziduo translates, 2000, Beijing, Science Press), also can obtain by the method that the location knock out the part or all of sequence of gene.

Described yeast can be any yeast, as Kluyveromyces lactis, yeast saccharomyces cerevisiae, pichia spp, debaryomyces hansenii bacterial strain.Pichia spp and Kluyveromyces lactis all are a kind of genetic manipulations that are easy to, and can efficiently express heterologous protein and possess the production host bacterium of technical scale fermentation character.They both had prokaryotic organism be easy to cultivate, cultivate with low cost, breeding is fast, be convenient to characteristics such as large scale culturing and high density fermentation, has rhetorical function behind the Eukaryotic protein translation simultaneously again, glycosylation process etc. for example.Therefore, preferred pichia spp of the host strain among the present invention and lactic acid yeast kluyveromyces.Pichia spp of the present invention and Kluyveromyces lactis can be wild-types, also can be the recombination microzymes of mannose transferase inactivation of gene.Described pichia spp can be α-1, the recombination microzyme of 6-mannose transferase gene (OCH1) deactivation.A kind of preferred α-1, the recombinant yeast pichia pastoris of 6-mannose transferase inactivation of gene is to have knocked out α-1, the pichia spp GJK0601 CGMCC No.1853 of the about 1000bp encoding sequence of 6-mannose transferase gene, its detailed construction process is at patent " α-1, the Pichi strain and the construction process thereof of 6-mannose transferase disappearance " in open, patent publication No.: CN 101195809 A.Described Kluyveromyces sp can be α-1, and 6-mannose transferase gene (OCH1) is or/and α-1, the recombinant Kluyveromyces sp of 3-mannose transferase gene (MNN1) deactivation.Specifically can be Kluyveromyces lactis α-1,6-mannose transferase (OCH1) defective bacterium (KLGE02, preserving number is CGMCC No.2400), or α-1,6-mannose transferase and α-1,3-mannose transferase (MNN1) Gene Double defective yeast (KLGE03, preserving number are CGMCCNo.2401), its detailed construction process is open in patent " a kind of recombinant Kluyveromyces sp and construction process thereof and application ", patent publication No.: CN 101285045 A.There is not the excessive glycosylation phenomenon in the glycoprotein that above-mentioned recombination yeast mutant bacteria is expressed, i.e. the glycoprotein of bacterial strain expression is low glycosylated protein, compares with the excessive glycosylation albumen that the wild-type Kluyveromyces sp is expressed, and the glycosyl on the N-sugar chain obviously reduces.Should low glycosylation glycoprotein have avoided high immunogenicity that excessive glycosylation causes, to problems such as covering of avtive spot, and eliminated unhomogeneity, thereby in clinical treatment with industrial application prospect widely arranged.This bacterial strain that obtains by the partial sequence that knocks out the mannose transferase gene is difficult for producing reverse mutation, and The stability of strain Billy is higher with the stability that methods such as point mutation make up, and more helps being applied to medical treatment and industry.

The expressing antibodies that described method makes up and the recombination microzyme of antibody analog also belong to protection scope of the present invention.

Another object of the present invention provides a kind of method for preparing antibody or antibody analog.

The method for preparing antibody or antibody analog provided by the present invention is that the recombination microzyme of cultivating described expressing antibodies or antibody analog is produced antibody or antibody analog.

Cultivate the recombination microzyme of described expressing antibodies or antibody analog, can be with shaking bottle or bio-reactor etc., bio-reactor preferably during production is as fermentor tank.Substratum should be able to provide thalline (or cell) growth and product to express required material, should comprise nitrogenous source, carbon source, VITAMIN, trace element, pH buffer composition etc., and culture medium prescription generally should obtain by test according to different Objects of Development.Cultivation can be cultivated with a stage, promptly thalli growth the time, and synthetic target protein.Also can divide two stages, the fs is mainly used in the growth of thalline, and it is synthetic that subordinate phase is mainly used in albumen.The method that described purifying prepares antibody and antibody analog is a liquid chromatography (LC), optimization protein A affinity chromatography.Can determine purification scheme according to the character of specific protein to be purified with method separation, antibody purification or the antibody analog of various albumen sepn.As saltout, the combination of technology such as precipitation, ultrafiltration, liquid chromatography (LC) and these technology.Wherein liquid chromatography (LC) can be used gel exclusion, affine, ion-exchange, chromatographic technique such as hydrophobic, anti-phase.

The recombination microzyme of expressing antibodies of the present invention or antibody analog is the recombination microzyme that obtains to produce complete antibody or antibody analog in the gene importing yeast with antibody or antibody analog.Yeast is as unicellular lower eukaryotes, promptly have prokaryotic organism be easy to cultivate, cultivate with low cost, breeding is fast, be convenient to characteristics such as large scale culturing and high density fermentation, have posttranslational modification processes such as Eukaryotic protein folding, glycosylation again, foreign protein can also be secreted in the nutrient solution, be beneficial to the characteristic of purifying.Wherein Kluyveromyces lactis and pichia spp are again one of expression systems of wherein comparative maturity, so preferred Kluyveromyces lactis of the present invention and pichia spp.The present invention utilizes the recombination microzyme of described expressing antibodies or antibody analog to prepare antibody and antibody analog, both can solve produce antibody relatively difficulty, require bottlenecks such as product purity height, quantity be big, can bring into play the function that antibody Fc section provides again, as increase antibody and the transformation period of antibody analog in blood, the target cell of performance Fc section mediation is killed and wounded and promotes cytophagy and bring out biological effect such as biologically active substance release, thereby has a good application prospect.

Description of drawings

Fig. 1 is for having the heavy chain or the light chain expression vector of human serum albumin (HSA) signal peptide.

Fig. 2 is the anti-HER 2 monoclonal antibody of Pichia anomala expression.

Fig. 3 is the assay result of anti-HER 2 humanized monoclonal antibody.

Fig. 4 is that the non-reduced SDS-PAGE of anti-HER 2 humanized monoclonal antibody 2 analyzes

Fig. 5 is that the non-reduced SDS-PAGE of anti-HER 2 humanized monoclonal antibody 1 analyzes.

Fig. 6 detects the activity of anti-HER 2 humanized monoclonal antibody 1 for the MTT colorimetry.

Fig. 7 detects the activity of anti-HER 2 humanized monoclonal antibody 2 for the MTT colorimetry

Fig. 8 is reduction and the non-reduced SDS-PAGE of Pichia anomala expression sTNFRII-IgGFc.

Fig. 9 detects the activity of antibody analog sTNFRII-IgGFc for the MTT colorimetry.

Figure 10 is the SDS-PAGE of the anti-HER 2 humanized monoclonal antibody 3 of Kluyveromyces lactis expression.

Figure 11 detects the activity of anti-HER 2 humanized monoclonal antibody 3 for the MTT colorimetry.

Figure 12 is a pKLAC1-sTNFRII-IgGFc expression vector synoptic diagram.

Figure 13 is the reduction SDS-PAGE of Kluyveromyces lactis expressing antibodies analogue sTNFRII-IgGFc.

Figure 14 detects the activity of Kluyveromyces lactis expressing antibodies analogue sTNFRII-IgGFc for the MTT colorimetry.

Embodiment

Among the following embodiment if no special instructions method therefor be ordinary method, agents useful for same all can obtain from commercial channels.Following percentage amounts is the quality percentage composition if no special instructions.

The Pyrobest enzyme that uses among the present invention, LA Taq enzyme, dNTPs, restriction enzyme, T4 ligase enzyme, dephosphorylation enzyme etc. are available from the precious biotechnology in Dalian company limited, pfu enzyme, test kit, DH5 α competent cell, primer are synthetic, order-checking etc. is provided with vast Tyke, Beijing biological gene technology company limited by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd and provides, PNGF Glycosylase, pKLAC1 plasmid etc. are available from New England BioLabs (NEB, Ipswich, MA), pPIC9, pA0815, pPICZaA are available from American I nvitrogen company.

Embodiment 1: the expression of anti-HER 2 humanized monoclonal antibody in pichia spp

1. the acquisition of the full gene of anti-HER 2 humanized monoclonal antibody

According to Genbank go up that the anti-HER 2 humanized antibody of report is light, sequence of heavy chain (Genbank:AAB49171.4, and AAB48814.1) and pichia spp preference codon, design is light, the gene of heavy chain.The nucleotides sequence of light chain is classified the sequence 3 in the sequence table as, and the nucleotides sequence of heavy chain is classified the sequence 4 in the sequence table as.

Utilize the method design primer of a step PCR, be about to gene and be divided into two sections, the last period, the forward fragment of salvage 59bp, the intersegmental overlapping 20bp of each sheet, back one section, the reverse fragment of salvage 59bp, all dna fragmentations are respectively got 1pmol, mix, and primer is as forward and reverse primer end to end, the pcr amplification spliced gene, obtain light chain gene L fragment (Chain Light is abbreviated as CL or L) and heavy chain gene H fragment (Chain Heavy is abbreviated as CH or H).One step PCR method is referring to " molecular cloning experiment guide " (second edition, Science Press, 1995) such as J. Sa nurse Brookers.

The PCR reaction conditions is: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 30sec, 60 ℃ of annealing 30sec, (the light chain gene fragment amplification extends time 40sec in 72 ℃ of extensions; The heavy chain gene fragment amplification extends time 1min30sec), carry out 55 circulations altogether, last 72 ℃ are extended 10min.

The weight chain gene purpose clip size of Anti-HER 2 is respectively 650bp and 1200bp.

The product of pcr amplification is identified with 0.8% agarose gel electrophoresis, the purpose fragment reclaims test kit with the dna fragmentation purifying and reclaims (available from ancient cooking vessel state Bioisystech Co., Ltd, Beijing), be connected to the pEASY-Blunt carrier then (available from the Beijing Quanshijin Biotechnology Co., Ltd, Beijing), make up cloning vector pEASY-L and pEASY-H.

2. the structure that has the heavy chain expression carrier of human serum albumin (HSA) signal peptide

Use primer HSA1

(5 '-CG GGATCCCAAACGATGAAGTGGGTAACCTTTATTTCCCTTCTTTTTCTCTTTAGCTCGGC-3 ') and CH03-1 (5 '-CG GAATTCTTACTTACCTGGAGACAAAGACAAAG-3 '), and HSA2 (5 '-CCAGATTCAACCAATTGAACTTCTCGACGAAACACACCCCTGGAATAAGCCGAGCT AAAGAGAAAAAG-3 '), with the heavy chain gene fragment is template, and overlapping extension PCR amplification has the heavy chain gene of HSA signal peptide.

(the used restriction enzyme of this test is all available from precious biotechnology company limited for BamHI and EcoRI double digestion, Dalian) pcr amplification product is connected with the pPIC9 carrier of same double digestion, makes up the heavy chain expression carrier pPIC9-HH (Figure 1A) that has AOX1 promotor and HSA signal peptide.

Use primer KAR2-1

(5’-CG GGATCCAAACGATGCTGTCGTTAAAACCATCTTGGCTGACTTTGGCGGCATTAATGT-3’)，KAR2-2：

(5’-CTGACTTTGGCGGCATTAATGTATGCCATGCTATTGGTCGTAGTGCCATTTGCTAAACC-3’)，KAR2-3

(5 '-CCAGATTCAACCAATTGAACTTCAGCTCTAACAGGTTTAGCAAATGGCACTACGAC C-3 ') and CH03-1 are template with the heavy chain gene fragment, and overlapping extension PCR amplification has the heavy chain gene of KAR2 signal peptide.

Use LS1

(5 '-CG GGATCCAAACGATGCTGGGTAAGAACGACCCAATGTGTCTTGTTTTGGTCTTGTTGG-3 '), LS2 (5 '-TGTCTTGTTTTGGTCTTGTTGGGATTGACTGCTTTGTTGGGTATCTGTC-3 '), LS3 (5 '-CCAGATTCAACCAATTGAACTTCACCTTGACAGATACCCAACAAAGCAG-3 ') and CH03-1 are template with the heavy chain gene fragment, and overlapping extension PCR amplification has the heavy chain gene of lysozyme of chicken signal peptide signal peptide.

(the used restriction enzyme of this test is all available from precious biotechnology company limited to use BamHI, EcoRI double digestion respectively, Dalian) pcr amplification product is connected with the pPIC9 carrier of same double digestion, makes up the heavy chain expression carrier pPIC9-KH that has AOX1 promotor and Kar2 signal peptide, the heavy chain expression carrier pPIC9-LH that has AOX1 promotor and lysozyme of chicken signal peptide respectively.

Pcr amplification has the heavy chain gene of XhoI restriction enzyme site, is template with the heavy chain gene fragment, and primer is a-factor-1 (5 '-ATA CTCGAGAAAAGAGAAGTTCAATTGGTTGAATCTGG-3 ', the line part is the XhoI restriction enzyme site) and CH03-1 (5 '-CG GAATTCTTACTTACCTGGAGACAAAGACAAAG-3 ').Be connected with the pPIC9 carrier of EcoRI double digestion pcr amplification product with XhoI, make up the heavy chain expression carrier pPIC9-α H that has AOX1 promotor and α mating factor signal peptide with same double digestion.

3. the structure that has the light chain expression vector of human serum albumin (HSA) signal peptide

With the light chain gene fragment is template, and overlapping extension PCR amplification has the light chain gene of HSA signal peptide, and primer is HSA1, HSA3

(5 '-GGAGATTGAGTCATTTGAATGTCTCGACGAAACACACCCCTGGAATAAGCCGAGCT AAAGAGAAAAAG-3 ') and CL03-2 (5 '-CG GAATTCTTAACACTCACCTCTGTTGAAAGACTTAGTA-3 ', the line part is EcoRI).

Be connected with the pPIC9 carrier of same double digestion with BamHI, EcoRI double digestion pcr amplification product, make up the light chain expression vector pPIC9-HL that has AOX1 promotor and HSA signal peptide.

With the light chain gene fragment is template, and overlapping extension PCR amplification has the light chain gene of Kar2 signal peptide, and primer is KAR2-1

(5’-CG GGATCCAAACGATGCTGTCGTTAAAACCATCTTGGCTGACTTTGGCGGCATTAATGT-3’)，KAR2-2

(5 '-CTGACTTTGGCGGCATTAATGTATGCCATGCTATTGGTCGTAGTGCCATTTGCTAA ACC-3 '), KAR2-4 (5 '-GGAGATTGAGTCATTTGAATGTCAGCTCTAACAGGTTTAGCAAATGGCACTACGAC C-3 ') and CL03-2.

With the light chain gene fragment is template, and overlapping extension PCR amplification has the light chain gene of lysozyme of chicken signal peptide, and primer is LS1:

(5 '-CG GGATCCAAACGATGCTGGGTAAGAACGACCCAATGTGTCTTGTTTTGGTCTTGTTGG-3 '), LS2 (5 '-TGTCTTGTTTTGGTCTTGTTGGGATTGACTGCTTTGTTGGGTATCTGTC-3 ') and LS4 (5 '-GGAGATTGAGTCATTTGAATGTCACCTTGACAGATACCCAACAAAGCAG-3 ') and CL03-2.

Be connected with the pPIC9 carrier of EcoRI double digestion pcr amplification product with BamHI with same double digestion, make up the light chain expression vector pPIC9-KL that has AOX1 promotor Kar2 signal peptide respectively, have the light chain expression vector pPIC9-LL of AOX1 promotor and lysozyme of chicken signal peptide.

With the light chain gene fragment is template, and pcr amplification has the light chain gene of XhoI restriction enzyme site, and primer is a-factor-1 and CL03-2.

Be connected with the pPIC9 carrier of EcoRI double digestion pcr amplification product with XhoI, make up the light chain expression vector pPIC9-α L that has AOX1 promotor and α mating factor signal peptide with same double digestion.

Contain the selection markers gene different with heavy chain on the light chain carrier in order to make, selecting with Zeocin is the resistance screening mark.According to the Zeocin resistant gene sequence that provides on the commercialization carrier pPICZaA (Invitrogen), design primer zeo-01 (5 '-TAT GATATCCCCACACACCATAGCTTCAAAAT-3 ' line part is EcoRV) and zeo-02 (5 '-TTA GATATCTGAGCATTGAGAAAGCGCCACGC-3 ' line part is EcoRV), pcr amplification obtains the Zeocin gene.

The PCR reaction conditions is: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 30sec, 60 ℃ of annealing 30sec, 72 ℃ are extended 2min, carry out 30 circulations altogether, and last 72 ℃ are extended 10min.

The product of pcr amplification identifies that with 0.8% agarose gel electrophoresis the purpose fragment reclaims test kit with the dna fragmentation purifying and reclaims (available from ancient cooking vessel state Bioisystech Co., Ltd, Beijing).

PCR product after the recovery is cut with the EcoRV enzyme, fragment after enzyme is cut is inserted same EcoRV enzyme respectively and is cut in carrier pPIC9-L, the pPIC9-KL of processing, pPIC9-LL and four carriers of pPIC9-α L, 16 ℃ of connections of T4 ligase enzyme are spent the night, transformed into escherichia coli DH5 α, screening positive clone on the LB flat board that contains zero mycin zeocin (25 μ g/m1), recombinant vectors called after pPIC9Z-L (Figure 1B), pPIC9Z-KL, pPIC9Z-LL and pPIC9Z-α L.

4. the expression of anti-HER 2 monoclonal antibody in pichia spp

PPIC9Z-L, pPIC9Z-KL, pPIC9Z-LL and pPIC9Z-α L use the BglII linearizing respectively, transform pichia spp GS115 (available from Invitrogen Corp.USA) after the linearizing, converted product coating YPDS/Zeocin substratum (1g/100ml yeast extract, the 2g/100ml peptone, 2g/100ml glucose, the 1M sorbyl alcohol, 25 μ g/ml Zeocin) on the flat board, cultivated 3-5 days for 30 ℃, after treating to grow the clone on the substratum, the picking transformant extracts genomic dna PCR and identifies positive colony at random, primers designed is respectively HSA1 and CL03-2 (the light chain gene primers designed that contains the HSA signal peptide), KAR2-1 and CL03-2 (the light chain gene primers designed of Kar2 signal peptide), LS1 and CL03-2 (the light chain gene primers designed of lysozyme of chicken signal peptide), a-factor-1 and CL03-2 (the light chain gene primers designed that contains α mating factor signal peptide), obtain positive colony Z-L, Z-KL, Z-LL and Z-α L, preparation Z-L, Z-KL, Z-LL and Z-α L competent cell, pPIC9-HH changes Z-L over to the BglII linearizing, pPIC9-KH changes Z-KL over to the BglII linearizing, pPIC9-LH changes Z-LL over to the BglII linearizing and pPIC9-α H changes Z-α L over to the BglII linearizing.Bacterium after the conversion is coated MD (YNB 1.34g/100mL, vitamin H 4 * 10 ^-5G/100mL, glucose 2g/100mL, agar 1.5g/100mL) flat board carries out preliminary screening.Cultivated 3-5 days for 30 ℃, acquisition changes the positive colony called after HLL of pPIC9Z-L and pPIC9-HH over to, acquisition changes the positive colony called after KHL of pPIC9Z-KL and pPIC9-KH over to, acquisition changes the positive colony called after LHL of pPIC9-LH and pPIC9Z-LL over to, obtains to change over to the positive colony called after α HL of pPIC9Z-α L and pPIC9-α H.

A plurality of HLL, the KHL of random choose, LHL and α HL clone cultivate and analyze the expression level of antibody with following method.

The recombinant clone that grows on the MD flat board is inoculated in 2mL YPD (1g/100ml yeast extract, 2g/100ml peptone, the 2g/100ml glucose) liquid nutrient medium, and 24h is cultivated in 28 ℃ of 200rpm joltings.Get the 1mL culture and be transferred to 20mL BMGY substratum (1g/100ml yeast extract, 2g/100ml peptone, 1g/100ml glycerine, 1.34g/100mL YNB, 4 * 10 ^-5The g/100mL vitamin H, 100mM pB, pH6.0) in (inoculum size 5%), 24h are cultivated in 28 ℃ of 200rpm joltings, add 100 μ L methyl alcohol and induce (final concentration is 0.5mL/100mL), add 100 μ L methyl alcohol every 12h afterwards, induce 72h after, 4 ℃, the centrifugal 10min of 7000rpm collects supernatant.

Supernatant is diluted 25 times with antigen coated liquid (sodium carbonate buffer pH 9.6), respectively getting 100 μ L samples then adds in the elisa plate, 4 ℃ of bags are spent the night, abandon supernatant, TBST (10mmol/L TrisHCl pH7.5,150mmol/LNaCL 0.05%Tween20) gives a baby a bath on the third day after its birth time, adds the TBST that contains 5% milk powder, in 37 ℃ of incubation 2h, TBST gives a baby a bath on the third day after its birth inferior, and goat anti-human igg-HRP (available from Huamei Bio-Engrg Co.,, China, Luoyang) with the TBST that contains 5% milk powder, dilution in 1: 1000, every hole adds 50 μ L, 37 ℃ of incubation 1h; Wash five times with TBST, discard raffinate at every turn as far as possible, every hole adds 100 μ L colour developing liquid (1.84%Na ₂HPO ₄12H ₂O, 0.5% citric acid faces with preceding 0.04% O-Phenylene Diamine and the 0.15%H of adding again ₂O ₂), 37 ℃ of lucifuge incubation 15min, last every hole adds 20 μ L stop buffer (2M H ₂SO ₄) with color development stopping, in 492nm place colorimetric.With the IgG albumen of concentration known (available from Huamei Bio-Engrg Co.,, China, Luoyang) as external standard, use the same procedure analysis, be used for calculating the content of the anti-HER 2 humanized monoclonal antibody of each recombinant yeast pichia pastoris culture supernatant with its concentration and OD value production standard curve.

The content results of anti-HER 2 humanized monoclonal antibody such as Fig. 3 in the supernatant, the content of anti-HER 2 humanized monoclonal antibody is 72.9 ± 4.2mg/L in the α HL clone supernatant liquor; The content of anti-HER 2 humanized monoclonal antibody is 93.4 ± 9.1mg/L in the HHL clone supernatant liquor, the content of anti-HER 2 humanized monoclonal antibody is 17.3 ± 2.1mg/L in the KHL clone supernatant liquor, and the content of anti-HER 2 humanized monoclonal antibody is 11.1 ± 1.1mg/L in the LHL clone supernatant liquor.Compare with α mating factor signal peptide commonly used in the yeast, the signal peptide of HSA can make the expression amount of antibody improve 28%, significant difference (P＜0.05), and Kar2 signal peptide and lysozyme of chicken signal peptide are when being used for antibody expression, signal peptide than HSA is poor, and difference is (P＜0.01) extremely significantly.

Among Fig. 3 each culture supernatant expressing antibodies level under the unlike signal peptide, A: α HL clone supernatant liquor B:HHL clone supernatant C: KHL clone supernatant liquor D:LHL clone supernatant liquor.Expression level is respectively the mean value of 5 independent clonings, and * represents that B compares significant difference (P＜0.05) with contrast A, and material expression C, D compare difference extremely significantly (P＜0.01) with contrast A.

Express supernatant and carry out SDS-PAGE, can obviously see the expression band (Fig. 2) of light chain and heavy chain.

Among Fig. 2, " 1 " is HHL clonal expression supernatant, and " 2 " are human normal immunoglobulin, and " M " is the molecular weight of albumen standard, and " H " and " L " pairing band is the heavy chain (H) and the light chain (L) of antibody.

The HHL clone adopts following method to cultivate, and antibody purification, and the antibody of acquisition is behind SDS-PAGE, electricity changes pvdf membrane, after the Coomassie brilliant blue dyeing, downcut the corresponding band of heavy chain, 5 aminoacid sequences that send National Center of Blomedical Analysls to measure the N-end with the Edman edman degradation Edman are EVQLV.Its aminoacid sequence is consistent with the theoretical sequence of heavy chain N-end, illustrates that the HSA signal peptide has correctly been excised.

Except the human serum albumin signal peptide has the enhancing antibody expressional function, the serum albumin signal peptide of other species also has similar effect, table 1 has exemplified some other species signal peptides, be example wherein, the effect that its enhancing antibody is expressed is described with xenopous laevis (Xenopuslaevis) serum albumin (XSA) signal peptide.

Primer is that XSA1, CH03-1 and XSA2 are template with the heavy chain gene fragment, and overlapping extension PCR amplification has the heavy chain gene of xenopous laevis serum albumin (XSA) signal peptide.

XSA1：5’-CGGGATCCCAAACGATGAAGTGGATCACCCTGATTTGTCTGTTAATTAGCTCCTCTTTCAT-3’；

XSA2：5’-CCAGATTCAACCAATTGAACTTCTCTTTTGAAAAGTATCCTTGATTCAATGAAAGAGGAGCTAATTAA-3’。

With primer XSA1, XSA3 and CL03-2, be template with the light chain gene fragment, overlapping extension PCR amplification has the light chain gene of XSA signal peptide.

XSA3：5’-GGAGATTGAGTCATTTGAATGTCTCTTTTGAAAAGTATCCTTGATTCAATGAAAGAGGAGCTAATTAA-3’。

The heavy chain gene and the light chain gene that has the XSA signal peptide that have the XSA signal peptide respectively with BamHI and EcoRI double digestion, be connected with the pPIC9 carrier of same double digestion, make up the light chain expression vector pPIC9Z-XL that has AOX1 promotor XSA signal peptide respectively, have the heavy chain expression carrier pPIC9-XH of AOX1 promotor XSA signal peptide.

PPIC9Z-XL BglII linearizing transforms pichia spp GS115 after the linearizing, obtain the reorganization bacterium, changes pPIC9-XH over to above-mentioned reorganization bacterium with the BglII linearizing again, obtains pichia spp XHL.

Pichia spp XHL is inoculated in 2mL YPD (1g/100ml yeast extract, 2g/100ml peptone, the 2g/100ml glucose) liquid nutrient medium, and 24h is cultivated in 28 ℃ of 200rpm joltings.Get the 1mL culture and be transferred to 20mL BMGY substratum (1g/100ml yeast extract, 2g/100ml peptone, 1g/100ml glycerine, 1.34g/100mL YNB, 4 * 10 ^-5The g/100mL vitamin H, 100mM pB, pH6.0) in (inoculum size 5%), 24h are cultivated in 28 ℃ of 200rpm joltings, add 100 μ L methyl alcohol and induce (final concentration is 0.5mL/100mL), add 100 μ L methyl alcohol every 12h afterwards, induce 72h after, 4 ℃, the centrifugal 10min of 7000rpm collects supernatant.

Pichia spp XHL expresses supernatant and carries out SDS-PAGE, can obviously see the expression band (Fig. 4) of light chain and heavy chain.The content of anti-HER 2 humanized monoclonal antibody is 88.2 ± 2.0mg/L in the XHL clone supernatant.The expression level of the antibody of other signal peptide guiding is as shown in table 1.

Among Fig. 4, " 1 " is XHL clonal expression supernatant, and " 2 " are human normal immunoglobulin, and " M " is the molecular weight of albumen standard, and " H " and " L " pairing band is the heavy chain (H) and the light chain (L) of antibody.

The expression level of the antibody of the serum albumin signal peptide guiding of table 1. different plant species

Homology is meant the homology that each signal peptide sequence is compared with the human serum albumin signal peptide sequence.

5. purifying antibody in the expression supernatant

HHL clone and XHL are cloned culture supernatant respectively with behind the NaOH accent pH to 7.0, carry out purifying (available from GE healthcare) with HiTraprProteinA FF affinity post: chromatography column is used the sodium phosphate buffer balance of 20mM pH7.0 earlier, with sample on the flow velocity of 1mL/min, behind the end of the sample, post is washed with the sodium phosphate buffer of the 20mMpH7.0 of 5 times of column volumes by elder generation, and then carry out wash-out with 0.1M citric acid solution (pH3.0), elutriant pH value transfers to neutrality with 1M Tris-HCl (pH9.0).

With the anti-HER 2 humanized monoclonal antibody 1 of albumen called after and 2 that is obtained behind the purifying in HHL clone and the XHL clone culture supernatant.

Antagonism HER2 Humanized monoclonal antibodies 1 carries out non-reduced SDS-PAGE and analyzes.

Non-reduced SDS-PAGE such as Fig. 5, its size is consistent with the relative molecular weight of non-reducing contrast IgG, is complete antibody molecule in the purification of samples, and the weight chain of this explanation yeast expression can spontaneously correctly be assembled into complete antibody molecule by intermolecular disulfide bond.

Among Fig. 5,1 is human normal immunoglobulin, and 2 is the Pichia anomala expression antibody 1 of purifying, and M is the molecular weight of albumen standard.

Use goat anti-human igg's elisa assay.Supernatant is diluted 25 times with antigen coated liquid (sodium carbonate buffer pH 9.6), respectively getting 100 μ L samples then adds in the elisa plate, 4 ℃ of bags are spent the night, abandon supernatant, TBST (10mmol/LTrisHCl pH7.5,150mmol/L NaCL 0.05%Tween20) gives a baby a bath on the third day after its birth time, adds the TBST that contains 5% milk powder, in 37 ℃ of incubation 2h, TBST gives a baby a bath on the third day after its birth inferior, and goat anti-human igg-HRP (available from Huamei Bio-Engrg Co.,, China, Luoyang) with the TBST that contains 5% milk powder, dilution in 1: 1000, every hole adds 50 μ L, 37 ℃ of incubation 1h; Wash five times with TBST, discard raffinate at every turn as far as possible, every hole adds 100 μ L colour developing liquid (1.84%Na ₂HPO ₄12H ₂O, 0.5% citric acid faces with preceding 0.04% O-Phenylene Diamine and the 0.15%H of adding again ₂O ₂), 37 ℃ of lucifuge incubation 15min, last every hole adds 20 μ L stop buffer (2M H ₂SO ₄) with color development stopping, in 492nm place colorimetric.

Anti-HER 2 humanized

monoclonal antibody

1 and 2 has specificity to combine with the goat anti-human antibody respectively, is people's antibody.The concentration of anti-HER 2 humanized monoclonal antibody 1 is 0.2mg/mL.

6. the determination of activity of yeast expression antibody

Detect anti-HER 2 humanized

monoclonal antibody

1 and 2 respectively to high expression level p185 with the MTT colorimetry ^ErbB2Breast cancer cell line SKBR3 and the low p185 that expresses ^ErbB2The effect (two strain cells all available from available from Shanghai Inst. of Life Science, CAS cell resource center, Chinese Shanghai) of breast cancer cell line MCF7 growth.Two kinds of cells all with the DMEM nutrient solution that contains 10%FBS at 37 ℃ and volume fraction 5%CO ₂The humidifying incubator in cultivate.Two kinds of cells are by 1 * 10 ⁴96 orifice plates are spread in individual/hole, be cultured to cell attachment, the anti-HER 2 humanized monoclonal antibody 1 that adds 0.0125,0.025,0.05,0.1,0.2 and 0.4 μ g/ml respectively, if the positive, feminine gender and blank, negative control adds the normal human serum IgG of respective amount, and blank adds the DMEM nutrient solution of respective amount, adds the MTT/ hole of 10 μ l 5mg/ml behind the cultivation certain hour, after cultivating 4-5h, add 10%SDS and 0.1N HCl80 μ l/ hole.After 37 ℃ of placements are spent the night, in wavelength 570nm place's photometry density value.

MTT colorimetry result such as Fig. 6 of anti-HER 2 humanized monoclonal antibody 1 show 1 couple of high expression level p185 of the anti-HER 2 humanized monoclonal antibody of purifying ^ErbB2The SKBR3 cell obvious growth restraining effect is arranged, medium effective concentration is 0.17mg/L, and to the low p185 that expresses ^ErbB2The MCF7 cell do not have obvious growth-inhibiting effect.And nonspecific human IgG does not all have effect to two kinds of cells.Illustrate that anti-HER 2 humanized monoclonal antibody 1 has at its antigen p185 ^ErbB2The specific cell lethal effect.

Among Fig. 6, A is 1 couple of high expression level p185 of anti-HER 2 humanized monoclonal antibody of different concns ^ErbB2The effect of SKBR3 cell, B is 1 couple of low p185 of expression of anti-HER 2 humanized monoclonal antibody of different concns ^ErbB2The MCF7 cytosis.

MTT colorimetry result such as Fig. 7 of anti-HER 2 humanized monoclonal antibody 2 show 2 couples of high expression level p185 of the anti-HER 2 humanized monoclonal antibody of purifying ^ErbB2The SKBR3 cell obvious growth restraining effect is arranged, medium effective concentration is 0.17mg/L, and to the low p185 that expresses ^ErbB2The MCF7 cell do not have obvious growth-inhibiting effect.And nonspecific human IgG does not all have effect to two kinds of cells.Illustrate that anti-anti-HER 2 humanized monoclonal antibody 2 has at its antigen p185 ^ErbB2The specific cell lethal effect.

Among Fig. 7, A is 2 couples of high expression level p185 of anti-HER 2 humanized monoclonal antibody of different concns ^ErbB2The effect of SKBR3 cell, B is 2 couples of low p185 of expression of anti-HER 2 humanized monoclonal antibody of different concns ^ErbB2The MCF7 cytosis.

Embodiment 2, the expression of anti-Her2 humanized antibody in Kluyveromyces lactis

1. contain the anti-HER 2 humanized antibody light chain of unlike signal peptide, the acquisition of heavy chain gene

With the carrier pPIC9-HL that embodiment 1 makes up, pcr amplification contains heavy chain of antibody gene H (Heavy chain) fragment of HSA signal peptide, and primer is HSA-KL-01 (5 '-CG ACTAGTCAAACGATGAAGTGGGTAACCTTTATTTCCCTTCTTTTTCTCTTTAGCTCGGC-3 ', the line part is the SpeI restriction enzyme site) and primer Her2-03:(5 '-CG GCGGCCGCTTACTTACCTGGAGACAAAGACAAAG-3 ', the line part is the NotI restriction enzyme site).

The PCR product reclaims test kit through the dna fragmentation purifying and reclaims.

The carrier pPIC9-HH that makes up with embodiment 1 is a template, and pcr amplification contains light chain of antibody gene (Light chain) the L fragment of HSA signal peptide, and primer is HSA-KL-01 and Her2-04 (5 '-CG GCGGCCGCTTAACACTCACCTCTGTTGAAAGACTTAGTA-3 ', the line part is the NotI restriction enzyme site).

The heavy chain gene and the light chain gene preparation method that contain Kar2 signal peptide, lysozyme of chicken signal peptide and α mating factor signal peptide are the same, and primer is as follows respectively:

The amplification that contains Kar2 signal peptide heavy chain gene utilizes primer KAR2-KL-01:(5 '-CG ACTAGTAAACGATGCTGTCGTTAAAACCATCTTGGC-3 ', the line part is the SpeI restriction enzyme site) and primer Her2-03;

The amplification that contains Kar2 signal peptide light chain gene utilizes primer KAR2-KL-01 and primer Her2-04.

The amplification that contains lysozyme of chicken signal peptide heavy chain gene utilizes primer SL-KL-01:(5 '-CG ACTAGTAAACGATGCTGGGTAAGAACGACCCAATG-3 ', the line part is the SpeI restriction enzyme site) and primer Her2-03;

The amplification that contains lysozyme of chicken signal peptide light chain gene utilizes primer SL-KL-01 and primer Her2-04.

The amplification that contains α mating factor signal peptide heavy chain gene utilizes primer a-factor-KL-01:(5 '-CG AC TAGTAAACGATGAGATTTCCTTCAATTTTTACTG-3 ', the line part is the SpeI restriction enzyme site) and primer Her2-03;

The amplification that contains α mating factor signal peptide light chain gene utilizes primer a-factor-KL-01 and primer Her2-04.

2. the structure of antibody weight chain expression vector

(1) contains the structure of the light chain of antibody expression vector of expression cassette, integration site

With granulated glass sphere preparation method (A. Adam Si etc., " yeast genetics method experiment guide ", Science Press, 2000) extract Kluyveromyces lactis ATCC8585 (American Type Culture Collection, U.S. representative microbial DSMZ, Manassas, VA 20108 USA) genomic dna, with this genomic dna is template amplification α-1, the homology arm of 6-mannose transferase (OCH1) gene both sides, as the integration site of light chain of antibody expression vector on karyomit(e), the homologous region of OCH1 both sides is respectively 2kb.

The used primer of amplification OCH1 upstream side pterion homology arm (OCH1 5 ' homology arm) is KLOCH01 and KLOCH02, and primer sequence is: 5 '-ACT GCTAGCATGTGGAAGTGATCTGTGGAGA-3 ' (the line part is the NheI recognition site) and 5 '-ATCTAGGTACCTGAGAGCTCGTTGGAAAGACTGAAGATGAAAGCA-3 ';

The used primer of amplification pterion, OCH1 downstream side homology arm (OCH1 3 ' homology arm) is KLOCH03 and KLOCH04, and primer sequence is: 5 '-CCAACGAGCTCTCAGGTACCTAGATCCATCAAATGATCACCGT-3 ' and 5 '-GAT ACGCGTGTCACATACCGATTGATCGATAC-3 ' (the line part is the MluI recognition site).

The pcr amplification condition of two homology arms is as follows: behind 94 ℃ of sex change 5min, carry out 30 circulations according to 94 ℃ of sex change 30sec, 55 ℃ of renaturation 30sec, 72 ℃ of extension 2min30sec, last 72 ℃ are extended 10min; The purpose clip size is about 2kb.The PCR product is reclaimed the purification kit purifying with DNA reclaim (available from ancient cooking vessel state Bioisystech Co., Ltd, Beijing).Utilize the method for overlapping extension PCR to merge OCH1 5 ' homology arm and 3 ' homology arm (referring to J. Sa nurse Brooker etc., " molecular cloning experiment guide " second edition, Science Press, 1995), with OCH1 5 ' homology arm and 3 ' homology arm PCR product is template, is primer with KLOCH01/04, and the pcr amplification condition is as follows: behind 94 ℃ of sex change 5min, carry out 30 circulations according to 94 ℃ of sex change 1min, 55 ℃ of renaturation 1min, 72 ℃ of extension 4min30sec, last 72 ℃ are extended 10min; The purpose clip size is about 4kb.The PCR product reclaims the purification kit purifying with DNA and reclaims.NheI/MluI double digestion (precious biotechnology company limited, Dalian) mosaic fragment, mosaic fragment after enzyme is cut is inserted among the carrier pYES2 (available from Invitrogen Corp.USA) of same double digestion processing, 16 ℃ of connections of T4 ligase enzyme are spent the night, transformed into escherichia coli DH5 α, screening positive clone on the LB flat board that contains penbritin (100 μ g/ml).Identify positive colony with the NheI/MluI double digestion, NheI and MluI enzyme are cut obtained about 4000bp and the 3000bp left and right sides segmental recombinant vectors called after pYES2-och1.

Structure contains the expression cassette of LAC4 promotor:

On recombinant vectors pYES2-och1 basis, with plasmid pKLAC1 (New England BioLabs (and NEB, Ipswich MA) are template amplification LAC4 promotor, about 1.1kb, and terminator fragment, about 700bp, two ends have XbaI and SalI restriction enzyme site.This promotor can be carried out abduction delivering with semi-lactosi, belongs to strong inducible promoter.Merge this two fragments by PCR method, thereby obtained about 1.8kb LAC4 expression cassette.Have a multiple clone site SpeI-AscI-NotI between LAC4 promotor and the terminator, be beneficial to the insertion and the replacement of secretion signal and goal gene.

The used primer of amplification LAC4 promotor is PLAC4-01 and PLAC4-02, and primer sequence is respectively: 5 '-TGC TCTAGACGGATGAAAGGGGAATCGTAT-3 ' (the line part is the XbaI recognition site) and 5 '-CC ACTAGTCTCGATGAGTATGTGTGTTTA-3 ' (the line part is the SpeI recognition site).

The used primer of amplification LAC4 terminator is PLAC4-03 and PLAC4-04, and primer sequence is respectively:

5 '-TAAACACACATACTCATCGAG ACTAGTAC GGCGCGCCT GCGGCCGCTT-3 ' (the line part is respectively the SpeI-AscI-NotI recognition site) and 5 '-TAT GAGCTCTCCCGATGTATGGGTTTGGTTGCCA-3 ' (the line part is the SacI recognition site).

Pcr amplification promotor condition is as follows: 95 ℃ of pre-sex change 5min, and 25 circulations (72 ℃ are extended 1min 30s for 94 ℃ of sex change 30s, 55 ℃ of renaturation 30s) then, 72 ℃ are extended 10min, 4 ℃ of preservations.

Pcr amplification terminator condition is as follows: 95 ℃ of pre-sex change 5min, and 25 circulations (72 ℃ are extended 1min for 94 ℃ of sex change 30s, 55 ℃ of renaturation 30s) then, 72 ℃ are extended 10min, 4 ℃ of preservations.

1% agarose carries out electrophoresis and reclaims (available from ancient cooking vessel state Bioisystech Co., Ltd, Beijing).

With LAC4 promotor and LAC4 terminator PCR product is template, with PLAC4-01/04 is primer, utilize the method for overlapping extension PCR merge LAC4 promotor and terminator (referring to J. Sa nurse Brooker etc., " molecular cloning experiment guide " second edition, Science Press, 1995).

The pcr amplification condition is as follows: behind 95 ℃ of pre-sex change 5min, according to 94 ℃ of sex change 30s, 55 ℃ of renaturation 30s, 72 ℃ of extension 2min, carry out 25 circulations, last 72 ℃ are extended 10min.

The purpose clip size is about 2kb.The PCR product reclaims the purification kit purifying with the PCR product and reclaims.

XbaI/SacI double digestion PCR product inserts among the carrier pYES2-och1 of same double digestion processing, and 16 ℃ of connections of T4 ligase enzyme are spent the night, transformed into escherichia coli DH5 α, screening positive clone on the LB flat board that contains penbritin (100 μ g/ml).Identify positive colony with the XbaI/SacI double digestion, the XbaI/SacI enzyme is cut obtained about 7000bp and the 2000bp left and right sides segmental recombinant vectors called after pYES2-och1-LAC4.

The SpeI/NotI double digestion contains light chain of antibody gene (Light chain) the L fragment of HSA signal peptide, light chain of antibody L fragment after enzyme is cut is inserted among the recombinant vectors pYES2-och1-LAC4 of same double digestion, 16 ℃ of connections of T4 ligase enzyme are spent the night, transformed into escherichia coli DH5 α, screening positive clone on the LB flat board that contains penbritin (100 μ g/ml).Identify positive colony with the SpeI/NotI double digestion, the SpeI/NotI enzyme is cut obtained about 9000bp and the 700bp left and right sides segmental recombinant vectors called after pYES2-och1-LAC4-HL.

On pYES2-och1-LAC4 carrier basis, obtain pYES2-och1-LAC4-KL (Kar2 signal peptide), pYES2-och1-LAC4-LL (lysozyme of chicken signal peptide) and pYES2-och1-LAC4-α L (α mating factor signal peptide) light chain expression vector according to the method described above.Promptly utilize the SpeI/NotI double digestion to contain light chain of antibody gene (Light chain) the L fragment of Kar2 signal peptide, lysozyme of chicken signal peptide and α mating factor signal peptide, light chain of antibody L fragment after enzyme is cut is inserted among the recombinant vectors pYES2-och1-LAC4 of same double digestion, 16 ℃ of connections of T4 ligase enzyme are spent the night, transformed into escherichia coli DH5 α, screening positive clone on the LB flat board that contains penbritin (100 μ g/ml).Identify positive colony with the SpeI/NotI double digestion, the SpeI/NotI enzyme is cut obtained about 9000bp and the 700bp left and right sides segmental recombinant vectors called after pYES2-och1-LAC4-KL, pYES2-och1-LAC4-LL, pYES2-och1-LAC4-α L.

(2) contain the structure of the heavy chain of antibody expression vector of expression cassette, integration site

With granulated glass sphere preparation method (A. Adam Si etc., " yeast genetics method experiment guide ", Science Press, 2000) extract Kluyveromyces lactis ATCC8585 (American Type Culture Collection, U.S. representative microbial DSMZ, Manassas, VA 20108 USA) genomic dna, with this genomic dna is the homology arm of template amplification URA3 gene both sides, as the integration site of heavy chain of antibody expression vector on karyomit(e), the homologous region of URA3 both sides is respectively 0.8kb.

The used primer of amplification URA3 upstream side pterion homology arm (URA3 5 ' homology arm) is KLURA3-1 and KLURA3-2, and primer sequence is respectively: 5 '-atc AgatctAgcagtagcagcacccacaag-3 ' (the line part is the BglII recognition site) and 5 '-ata GagctcAaa TctagaGtgcaactaattgacgggagt-3 ' (the line part is SacI and XbaI recognition site);

The used primer of amplification pterion, URA3 downstream side homology arm (URA3 3 ' homology arm) is KLURA3-3 and KLURA3-4, and primer sequence is: 5 '- TctagaTtt GagctcTatgagaatcagcgctccccatt-3 ' (the line part is XbaI and SacI recognition site) and 5 '-ata GtcgacGgcaatgaaatgcaaacctttcta-3 ' (the line part is the SalI recognition site).

The pcr amplification condition of two homology arms is as follows: behind 94 ℃ of sex change 5min, carry out 30 circulations according to 94 ℃ of sex change 30sec, 55 ℃ of renaturation 30sec, 72 ℃ of extension 1min, last 72 ℃ are extended 10min;

The purpose clip size is about 0.8kb.The PCR product is reclaimed the purification kit purifying with DNA reclaim (available from ancient cooking vessel state Bioisystech Co., Ltd, Beijing).

With URA3 5 ' homology arm and 3 ' homology arm PCR product is template, with KLURA3-1 and URA3-4 is primer, utilize the method for overlapping extension PCR to merge URA3 5 ' homology arm and 3 ' homology arm (referring to J. Sa nurse Brooker etc., " molecular cloning experiment guide " second edition, Science Press, 1995).

The pcr amplification condition is as follows: behind 94 ℃ of sex change 5min, carry out 30 circulations according to 94 ℃ of sex change 1min, 55 ℃ of renaturation 1min, 72 ℃ of extension 2min30sec, last 72 ℃ are extended 10min.

The purpose clip size is about 1.6kb.The PCR product reclaims the purification kit purifying with DNA and reclaims.

BglII/SalI double digestion (precious biotechnology company limited, Dalian) this PCR product inserts among the pPICZ α A (available from Invitrogen Corp.USA) of same double digestion processing, 16 ℃ of connections of T4 ligase enzyme are spent the night, transformed into escherichia coli DH5 α, screening positive clone on the LB flat board that contains zero mycin (Zeocin 25 μ g/ml are available from Invitrogen Corp.USA).Identify positive colony with the BglII/SalI double digestion, BglII and SalI enzyme are cut obtained about about 1500bp and the 2200bp left and right sides segmental recombinant vectors called after pPICZ α A-URA3.

On recombinant vectors pPICZ α A-URA3 basis, with plasmid pKLAC1 (New England BioLabs (and NEB, Ipswich MA) are template amplification LAC4 promotor, about 1.1kb, and terminator fragment, about 700bp, two ends have XbaI and SalI restriction enzyme site.This promotor can be carried out abduction delivering with semi-lactosi, belongs to strong inducible promoter.Merge this two fragments by PCR method, thereby obtained about 1.8kb LAC4 expression cassette.Have a multiple clone site SpeI-AscI-NotI between LAC4 promotor and the terminator, be beneficial to the insertion and the replacement of secretion signal and goal gene.

The used primer of amplification LAC4 promotor is PLAC4-01 and PLAC4-02, and primer sequence is:

5 '-TGC TCTAGACGGATGAAAGGGGAATCGTAT-3 ' (the line part is the XbaI recognition site) and 5 '-CC ACTAGTCTCGATGAGTATGTGTGTTTA-3 ' (the line part is the SpeI recognition site).

The used primer of amplification LAC4 terminator is PLAC4-03 and PLAC4-04, and primer sequence is:

This PCR product of XbaI/SacI double digestion inserts among the carrier pYES2-och1 of same double digestion processing, and 16 ℃ of connections of T4 ligase enzyme are spent the night, transformed into escherichia coli DH5 α, screening positive clone on the LB flat board that contains zero mycin (Zeocin 25 μ g/ml).Identify positive colony with the XbaI/SacI double digestion, the XbaI/SacI enzyme is cut obtained about 4000bp and the 2000bp left and right sides segmental recombinant vectors called after pPICZ α A-URA3-LAC4.

The SpeI/NotI double digestion has HSA signal peptide heavy chain of antibody gene fragment, heavy chain of antibody gene H fragment after enzyme is cut is inserted among the recombinant vectors pPICZ α A-URA3-LAC4 of same double digestion processing, 16 ℃ of connections of T4 ligase enzyme are spent the night, transformed into escherichia coli DH5 α, screening positive clone on the LB flat board that contains Zeocin (100 μ g/ml).Identify positive colony with the SpeI/NotI double digestion, the SpeI/NotI enzyme is cut obtained about 6000bp and the 1500bp left and right sides segmental recombinant vectors called after pPICZ α A-ura3-LAC4-H.

On pPICZ α A-ura3-LAC4 carrier basis, obtain pYES2-och1-LAC4-KH (Kar2 signal peptide), pYES2-och1-LAC4-LH (lysozyme of chicken signal peptide) and pYES2-och1-LAC4-α H (α mating factor signal peptide) heavy chain expression carrier according to the method described above.Promptly utilize the SpeI/NotI double digestion to have Kar2 signal peptide, lysozyme of chicken signal peptide, α mating factor signal peptide heavy chain of antibody gene fragment, heavy chain of antibody gene H fragment after enzyme is cut is inserted among the recombinant vectors pPICZ α A-URA3-LAC4 of same double digestion processing, 16 ℃ of connections of T4 ligase enzyme are spent the night, transformed into escherichia coli DH5 α, screening positive clone on the LB flat board that contains Zeocin (100 μ g/ml).Identify positive colony with the SpeI/NotI double digestion, the SpeI/NotI enzyme is cut obtain about 6000bp and the 1500bp left and right sides segmental recombinant vectors called after pPICZ α A-ura3-LAC4-KH, pPICZ α A-ura3-LAC4-LH, pPICZ α A-ura3-LAC4-α H).

3. the expression of anti-HER 2 monoclonal antibody in Kluyveromyces lactis

Adopt electrotransformation that recombinant vectors pYES2-och1-LAC4-L and pPICZ α A-ura3-LAC4-H are transformed among the Kluyveromyces lactis ATCC8585, the method that electricity transforms is that this area is in common knowledge (as A. Adam Si etc., " yeast genetics method experiment guide ", Science Press, 2000).Electricity carries out linearizing with above-mentioned expression vector pYES2-och1-LAC4-L and pPICZ α A-ura3-LAC4-H with SwaI before transforming.

PYES2-och1-LAC4-L elder generation electricity changes in the Kluyveromyces lactis ATCC8585 competent cell for preparing, and coats MD substratum (YNB 1.34g/100mL, vitamin H 4 * 10 ^-5G/100mL, glucose 2g/100mL, agar 1.5g/100mL) on the flat board.Cultivated 3-5 days for 30 ℃, after treating to grow the clone on the substratum, the several transformants extraction of picking genomic dna carries out PCR evaluation positive colony at random, and the PCR primer is respectively HSA-KL-01 and Her2-04 (the light chain of antibody gene identification primer that contains the HSA signal peptide); KAR2-KL-01 and Her2-04 (containing Kar2 signal peptide light chain gene primers designed); SL-KL-01 and primer Her2-04 (containing lysozyme of chicken signal peptide light chain gene primers designed); A-factor-KL-01 and Her2-04 (α mating factor signal peptide light chain gene primers designed), prepare this positive colony competent cell, change the pPICZ α A-ura3-LAC4-H after the linearizing over to prepare be integrated with in the segmental competent cell of light chain of antibody, coat YPDS/Zeocin substratum (1g/100ml yeast extract, the 2g/100ml peptone, 2g/100ml glucose, the 1M sorbyl alcohol, 25 μ g/mlZeocin) on the flat board, cultivated 3-5 days for 30 ℃, after treating to grow the clone on the substratum, 20 clones of random choose carry out abduction delivering, contain segmental each strain culture of integrative gene expression, scrape with aseptic rifle head and get about 2mm ²Monoclonal cell, place 2ml YPGal nutrient solution (1g/100ml yeast extract, 2g/100ml peptone, the 2g/100ml semi-lactosi) resuspended in, 30 ℃ of shaking culture (250-300rpm) are induced centrifuging and taking supernatant after 72 hours, are used for the Expression of Fusion Protein analysis.With pYES2 empty carrier and the common negative contrast of Kluyveromyces lactis ATCC8585 that transforms of pPICZ α A empty carrier.

The SDS-PAGE electrophoresis result as shown in figure 10, behind coomassie brilliant blue staining, the culture supernatant that changes the Kluyveromyces lactis ATCC8585 of recombinant vectors pYES2-och1-LAC4-L and pPICZ α A-ura3-LAC4-H over to can be seen the obvious expression band at 50KD and 30KD place, similar to the stripe size of positive control normal human serum IgG, conform to its theoretical molecular, the common Kluyveromyces lactis ATCC8585 that transforms of pYES2 empty carrier and pPICZ α A empty carrier does not have the band of expression at 50KD and 30KD place.

Among Figure 10,1 for changing the Kluyveromyces lactis ATCC8585 nutrient solution of recombinant vectors pYES2-och1-LAC4-L and pPICZ α A-ura3-LAC4-H over to, 2 are the human normal immunoglobulin contrast, M is the molecular weight of albumen standard, its each band corresponding molecular weight is marked in the right side, and the pairing band of CH and CL is the heavy chain and the light chain of antibody.

4. Kluyveromyces lactis is expressed purifying antibody in the supernatant

Get after culture supernatant that 100ml changes the Kluyveromyces lactis ATCC8585 of recombinant vectors pYES2-och1-LAC4-CL and pPICZ α A-ura3-LAC4-H over to transfers pH to 7.0, with HiTrap rProteinA FF affinity post (available from GE Healthcare Life Science, USA, 17-5079-02) carry out purifying: chromatography column is used the sodium phosphate buffer balance of 20mM pH7.0 earlier, with sample on the flow velocity of 1mL/min, behind the end of the sample, sodium phosphate buffer with the 20mM pH7.0 of 5 times of column volumes is washed post, and then carry out wash-out with 0.1M citric acid solution (pH3.0), elutriant pH value transfers to the neutral anti-Her2 humanized antibody 3 that obtains purifying with 1M Tris-HCl (pH9.0).Anti-Her2 humanized antibody 3 reduces and non-reduced SDS-PAGE analyzes.

Reduction and non-reduced SDS-PAGE result are consistent with the result of Pichia anomala expression antibody, in the anti-Her2 humanized antibody 3 of reductive purifying the size of weight chain with contrast IgG in the relative molecular weight of weight chain consistent basically, near theoretical value 55KD.Anti-Her2 humanized antibody 3 relative molecular weights of non-reducing purifying are greater than 96kD, and are consistent with the relative molecular weight of non-reducing contrast IgG.The reduction electrophoresis result shows the weight chain that contains antibody in the anti-Her2 humanized antibody 3 of purifying respectively, and non-reduced electrophoresis result shows, contain complete antibody molecule in the anti-Her2 humanized antibody 3 of purifying, the weight chain of this proof yeast expression can spontaneously correctly be assembled into complete antibody molecule by intermolecular disulfide bond.

5. the N terminal amino acid of Kluyveromyces lactis expressing antibodies order-checking

The anti-Her2 humanized antibody 3 of purifying is transferred to albumen on the pvdf membrane by the method for electrotransfer then through the SDS-PAGE electrophoresis.Pvdf membrane is through coomassie brilliant blue staining and decolouring, deliver to Instrument Testing Center, Scientific and Technological Department, Academy of M laboratory the protein band of heavy chain is carried out-terminal amino acid residue sequence analysis (method is with reference to Wang Jiazheng, Fan Ming chief editor " protein technical manual " (Science Press, 2000)).

The mode of utilizing the N-end to check order is verified the aminoacid sequence of this protein band, sequencing result shows, the sequence of this proteic N-terminal five amino acid is: L-glutamic acid, Xie Ansuan, glutamine, leucine, Xie Ansuan (EVQLV), the consensus amino acid sequence of synantibody heavy chain N-terminal illustrates that it is the heavy chain of antibody.

6. the determination of activity of the anti-Her2 humanized antibody 3 of Kluyveromyces lactis expression

Detect yeast expression antibody respectively to high expression level p185 with the MTT colorimetry ^ErbB2Breast cancer cell line SKBR3 (available from Chinese Academy of Sciences typical case culture collection council Shanghai cell bank) and low expression p185 ^ErbB2The effect of breast cancer cell line MCF7 (available from Chinese Academy of Sciences typical case culture collection council Shanghai cell bank) growth.

With well-grown SKBR3 and MCF7 cell dissociation 2min, remove Digestive system with 0.25% pancreatin (GIBCO),, behind the cell counting count board counting, cell is diluted to 1 * 10 with the DMEM substratum that contains 10%FBS with DMEM substratum (GIBCO) cell dispersion ⁵/ ml obtains cell suspension; Get 96 porocyte culture plates of aseptic cleaning, every hole adds 100 μ l cell suspensions, is positioned over 37 ℃, 5%CO ₂Be cultured to cell attachment (about 24h) in the cell culture incubator of water-vapo(u)r saturation.With the anti-Her2 humanized antibody 2 of DMEM substratum dilution purifying to the final concentration that contains 10%FBS is 4 μ g/ml, on 96 orifice plates, carry out the gradient dilution of anti-Her2 humanized antibody 2 then successively with the DMEM substratum that contains 10%FBS, be initiated with 1/10 of original liquid concentration, carry out 1/2 dilution then successively, dilute altogether seven times, each point is established three multiple holes.Do feminine gender and blank simultaneously, negative hole is the normal human serum IgG that contains same concentrations, and blank does not add any sample.The anti-Her2 humanized antibody 2 of the above-mentioned gradient for preparing is transferred to 96 orifice plates, put back to continuation cultivation certain hour (SKBR3 cell cultures 72h in the cell culture incubator after building lid, MCF7 cell cultures 30h), every hole adds 20 μ L MTT solution (5mg/mL), 37 ℃ are continued to cultivate 4h, and every hole adds 80 μ L stop buffers (20%SDS, 0.1N HCl), 37 ℃ are continued overnight incubation, crystallisate are fully dissolved; The 570nm place measures each hole absorbance value on enzyme-linked immunosorbent assay instrument, the record result.

MTT colorimetry detected result illustrates 3 couples of high expression level p185 of anti-HER 2 humanized monoclonal antibody that Kluyveromyces lactis is expressed as shown in figure 11 ^ErbB2The SKBR3 cell restraining effect is arranged, behind antibody purification and SKBR3 and the MCF7 cytosis certain hour, the MTT colorimetric detection is found, 3 couples of high expression level p185 of the anti-HER 2 humanized monoclonal antibody of purifying ^ErbB2The SKBR3 cell obvious growth restraining effect is arranged, and to the low p185 that expresses ^ErbB2The MCF7 cell do not have obvious growth-inhibiting effect.And nonspecific human IgG does not all have effect to two kinds of cells, illustrates that anti-Her2 antibody has at its antigen p185 ^ErbB2The specific cell lethal effect.

Among Figure 11, A: be 3 couples of high expression level p185 of anti-HER 2 humanized monoclonal antibody of different concns ^ErbB2The effect of SKBR3 cell; B: be 3 couples of low p185 that express of anti-HER 2 humanized monoclonal antibody of different concns ^ErbB2The MCF7 cytosis.

Embodiment 3, the expression of antibody analog sTNFRII-IgGFc in pichia spp

1.sTNFRII-IgGFc antigen-4 fusion protein gene clone

Get healthy people's acid acid citrate dextrose (ACD) anti-freezing venous blood, after the dilution of Hanks liquid, with the centrifugal acquisition lymphocyte of lymphocyte separation medium, using the 1640 cultivation keynote cell count of (the Hyclone company) that contain 10% foetal calf serum is 5 * 10 ⁶Individual/mL, place 1640 the fresh culture of using lipopolysaccharides (LPS, 20 μ g/mL) (Sigma company) and 10% foetal calf serum behind the cell culture incubator incubation 2h instead, continue to cultivate centrifugal enrichment cell behind the 5h; TRIzol (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) method is extracted total RNA (operating according to the TRIzol specification sheets); Total RNA obtains cDNA (RT-PCR test kit, Shanghai Sangon Biological Engineering Technology And Service Co., Ltd operate according to the test kit explanation) behind reverse transcription, be template with this cDNA then, utilizes primer N1 (5 '-AT CTCGAGAAAAGAGCCTTGCCCGCCCAGGTGGCAT-3 ') and C1 (5 '-AGTTTTGTCACAAGATTTGGGCTCGTCGCCAGTGCTCCCTTCAGC-3 '), angle respectively with pfu polysaccharase (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) PCR and to get sTNFRII, and the C end that makes sTNFRII with on contain the sequence of the N end parts of antibody Fc.

The pcr amplification condition is as follows: 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 30sec, 55 ℃ of annealing 30sec, 72 ℃ are extended 1min30sec, circulate 30 times; Last 72 ℃ are extended 10min;

Utilize primer N2 (5 '-GCTGAAGGGAGCACTGGCGACGAGCCCAAATCTTGTGACAAAACT-3 ') and C2 (5 '-AC equally GAATTCTTATCATTTACCCGGAGACAGGGAGAG-3 '), be that template PCR angles and gets antibody Fc with this cDNA, and the N end that makes antibody Fc with on contain the sequence of the C end parts of sTNFRII.

The PCR reaction conditions is as follows: 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 30sec, 55 ℃ of annealing 30sec, 72 ℃ are extended 1min30sec, circulate 30 times; Last 72 ℃ are extended 10min;

With two PCR products having joint is template, and N1 and C2 are primer, and two PCR products that obtain are carried out external splicing by the method for overlapping extension PCR.

The PCR reaction conditions is as follows: 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 30sec, 55 ℃ of annealing 30sec, 72 ℃ are extended 3min, circulate 30 times; Last 72 ℃ are extended 10min.

The correct PCR product that checks order is the sTNFRII-IgGFc antigen-4 fusion protein gene, it is carried out the XhoI/EcoRI double digestion, enzyme is cut among the expression plasmid of yeast pPIC9 that contains the alpha factor signal peptide homing sequence that inserts same double digestion processing in the back, is built into pichia pastoris phaff secretion expression carrier pPIC9-α-TNFR/Fc (being abbreviated as pPIC9-α TF).

2. the structure that has the antibody analog sTNFRII-IgGFc expression vector of human serum albumin (HSA) signal peptide

Fragment HSA3AS (5 '-ATGCCACCTGGGCGGGCAAGGCTCGACGAAACACACCCCTGGAATAAGCCGAGCTA AAGAGAAAAAG-3 ') with pPIC9-sTNFRII-IgGFc and synthetic is a template, with primer HSA 1 and C2 is primer, and overlapping extension PCR amplification has the sTNFRII-IgGFc gene of HSA signal peptide.

The pPIC9 carrier of cutting with BamHI/EcoRI double digestion pcr amplification product and same enzyme is connected, and makes up the sTNFRII-IgGFc expression vector pPIC9-H-TNFR/Fc (being abbreviated as pPIC9-HTF) that has the HSA signal peptide.

3. the acquisition of the pichia spp of expressing antibodies analogue sTNFRII-IgGFc

After above-mentioned pPIC9-α TF and pPIC9-HTF carrier used the linearizing of StuI restriction endonuclease respectively, transform pichia spp GS115, and coat the MD flat board.Cultivated 3-5 days for 30 ℃, obtain pichia spp α TF and HTF clone respectively.Pichia spp α TF and HTF clone are inoculated into respectively in the 2mL YPD liquid nutrient medium, and 24h is cultivated in 28 ℃ of 200rpm joltings.Get the 1mL culture and be transferred to (inoculum size 5%) in the 20mL BMGY substratum, 24h is cultivated in 28 ℃ of 200rpm joltings, adds 100 μ L methyl alcohol and induces (final concentration is 0.5%), add 100 μ L methyl alcohol every 12h afterwards, induce 72h after, 4 ℃, the centrifugal 10min of 7000rpm collects supernatant.Pichia spp α TF and HTF are expressed supernatant respectively with 25 times of antigen coated liquid dilutions, respectively getting 100 μ L samples then adds in the elisa plate, 4 ℃ of bags are spent the night, abandon supernatant, TBST (10mmol/L Tri s.HCl pH7.5,150mmol/L NaCL 0.05%Tween20) gives a baby a bath on the third day after its birth time, adds the TBST that contains 5% milk powder, in 37 ℃ of incubation 2h, TBST gives a baby a bath on the third day after its birth inferior, and goat anti-human igg-HRP (available from Huamei Bio-Engrg Co.,, China, Luoyang) with the TBST that contains 5% milk powder, dilution in 1: 1000, every hole adds 50 μ L, 37 ℃ of incubation 1h; Wash five times with TBST, discard raffinate at every turn as far as possible, every hole adds 100 μ L colour developing liquid (1.84%Na ₂HPO ₄12H ₂O, 0.5% citric acid faces with preceding 0.04% O-Phenylene Diamine and the 0.15%H of adding again ₂O ₂), 37 ℃ of lucifuge incubation 15min, last every hole adds 20 μ L stop buffer (2M H ₂SO ₄) with color development stopping, in 492nm place colorimetric.

Present the pichia spp α TF of colour-change and HTF clone's supernatant and be used for following experiment.

4. the purifying of Pichia anomala expression sTNFRII/Fc positive colony supernatant

Behind the supernatant accent pH to 7.0 with pichia spp α TF and HTF clone, carry out purifying with HiTrap rProteinA FF affinity post: chromatography column is used the sodium phosphate buffer balance of 20mM pH7.0 earlier, with sample on the flow velocity of 1mL/min, behind the end of the sample, post is washed with the sodium phosphate buffer of the 20mM pH7.0 of 5 times of column volumes by elder generation, and then carry out wash-out with 0.1M citric acid solution (pH3.0), elutriant pH value transfers to neutrality with 1M Tris-HCl (pH9.0).Protein concentration behind the purifying adopts Bradford protein quantification test kit to measure, behind the purifying albumen be the sTNFRII-IgGFc fusion rotein.STNFRII-IgGFc fusion rotein concentration is 2mg/L in the pichia spp α TF supernatant.STNFRII-IgGFc fusion rotein concentration is 18mg/L in the HTF mono-clonal supernatant.

Through Protein A affinity column again the sTNFRII-IgGFc fusion rotein behind the purifying carry out 10%SDS-PAGE, the coomassie brilliant blue staining result as shown in Figure 8, position from protein band, reductive fusion rotein size is between 66kD and 80kD, and non-reducing fusion rotein size illustrates the dimer of this fusion rotein for being connected to form by intermolecular disulfide bond less than 116kD.

Among Fig. 8,1 is non-reduced electrophoresis, and 2 are the reduction electrophoresis, and M is the molecular weight of albumen standard.

5. the Western blotting of Pichia anomala expression sTNFRII/Fc identifies

STNFRII-IgGFc fusion rotein behind the purifying reduce and irreducibility 10%SDS-PAGE after, proteinic SDS-PAGE method be this area in common knowledge (as D.R. Ma Xieke etc., " protein purification and identification experiment guide ", Science Press, 1999), transfer to nitrocellulose filter, detect, develop the color by ECL with goat anti-human igg-HRP.

Western blotting result shows that in the sTNFRII-IgGFc fusion rotein behind the reductive purifying, there is a specific band near position molecular weight 66kD, and monomeric theoretical molecular 56kD is big slightly than fusion rotein; This monomer band disappears in the sTNFRII-IgGFc fusion rotein behind non-reduced purifying, and occurs a specific band at molecular weight greater than the 97kD place.

6. Pichia anomala expression fusion rotein sTNFRII/Fc suppresses the cytotoxic activation analysis of TNF-α

Well-grown L929 cell (available from Shanghai Inst. of Life Science, CAS cell resource center) is diluted to 2 * 10 with 1640 substratum that contain 10% foetal calf serum ⁵Individual/ml, every hole adds 100 μ L cell suspensions, is positioned over 37 ℃, 5%CO ₂Cultivate 24h in the cell culture incubator of water-vapo(u)r saturation.

1640 substratum (containing 2 μ g/mL dactinomycins) dilution TNF-α (ProSciIncorporated with 10% foetal calf serum, USA, XW-RP3118) to final concentration be 50U/mL, on 96 orifice plates, carry out the gradient dilution of fusion rotein sTNFRII/Fc then successively, be initiated with 1/10 of original liquid concentration, carry out 1/4 dilution then successively.The cells and supernatant in 96 orifice plates is abandoned in suction, and the above-mentioned gradient fusion rotein sTNFRII/Fc for preparing is transferred to 96 orifice plates, continues to cultivate 24h, and incubation time is as the criterion with the basic death of positive control cell; Every hole adds 20 μ LMTT, and the 570nm place measures each hole absorbance value on enzyme-linked immunosorbent assay instrument, the record result.

The MTT experimental result as shown in Figure 9, the sTNFRII-IgGFc fusion rotein behind the purifying can suppress the lethal effect of TNF-α to the L929 cell preferably.

Embodiment 4: the expression of antibody analog sTNFRII-IgGFc in Kluyveromyces lactis

1. the structure of the sTNFRII-IgGFc expression vector of serum albumin signal peptide guiding

With pPIC9-HTF and synthetic fragment HSA3AS is template, has the sTNFRII-IgGFc gene of HSA signal peptide with primer HSA5 and the overlapping extension PCR amplification of C2.The nucleotide sequence of primer HSA5 and C2 is as follows: HSA5:

5 ' CG AAGCTTCAAACGATGAAGTGGGTAACCTTTATTTCCCTTCTTTTTCTCTTTAGCTCGGC-3 ', the line part is the HindIII enzyme recognition site; C2:

5’ATGCCACCTGGGCGGGCAAGGCTCGACGAAACACACCCCTGGAATAAGCCGAGCTAAAGAGAAAAAG3’。Is connected with the pKLAC1 carrier of HindIII/EcoRI double digestion pcr amplification product with same double digestion, the sTNFRII-IgGFc expression vector pKLAC1-H-TNFR/Fc (being abbreviated as pKLAC1-HTF) that structure has a HSA signal peptide (Figure 12).

With pPIC9-α TF is template, and pcr amplification has the sTNFRII-IgGFc gene of XhoI restriction enzyme site, and primer is a-factor-1 (5 '-ATA CTCGAGAAAAGAGAAGTTCAATTGGTTGAATCTGG-3 ', the line part is the XhoI restriction enzyme site) and primer C2.

PKLAC1 (the New England BioLabs (NEB that cuts with XhoI and EcoRI double digestion pcr amplification product and same enzyme, Ipswich, MA) carrier connects, and makes up the sTNFRII-IgGFc expression vector pKLAC1-α-TNFR/Fc (being abbreviated as pKLAC1-α TF) that has LAC4 promotor and α mating factor signal peptide.

2. the Kluyveromyces lactis of expressing antibodies analogue sTNFRII/Fc

The competent cell of preparation Kluyveromyces lactis ATCC8585, with expression vector pKLAC1-HTF, pKLAC1-α TF and plasmid pKLAC1 are (available from New England BioLabs (NEB, Ipswich, MA)) with electric respectively changing in the competent cell of Kluyveromyces lactis ATCC8585 after the BstXI linearizing, bacterium liquid after the electric shock is coated and contained 5mmol/L ethanamide YCB nutrient agar (1mol/L sodium phosphate, 1.17g/100mlYCB, 2g/100ml agar, the 5mmol/L ethanamide, wherein YCB is the basic carbon source substratum of yeast, below all glad through Bioisystech Co., Ltd of section available from Beijing) on the flat board, 30 ℃ of upsets were cultivated 3-4 days, after treating to grow the clone on the substratum, the several transformants extraction of picking genomic dna carries out PCR evaluation positive colony at random, and the PCR primers designed is respectively HSA1 and C2 (the sTNFRII-IgGFc gene identification primer that has the HSA signal peptide); A-factor-1 and C2 (the sTNFRII-IgGFc gene identification primer that has α mating factor signal peptide) obtain Kluyveromyces lactis α TF, Kluyveromyces lactis HTF and Kluyveromyces lactis KLAC1 (changeing the yeast of pKLAC1 carrier) and scrape respectively with aseptic rifle head and get about 2mm ²Kluyveromyces lactis α TF, Kluyveromyces lactis HTF and Kluyveromyces lactis KLAC1 cell, place 2ml YPGal nutrient solution (1g/100ml yeast extract respectively, the 2g/100ml peptone, the 2g/100ml semi-lactosi) resuspended in, 30 ℃ of shaking culture (250-300rpm) are induced centrifuging and taking supernatant after 72 hours.

3. Kluyveromyces lactis is expressed the purifying of sTNFRII/Fc supernatant

Kluyveromyces lactis α TF, after the supernatant of Kluyveromyces lactis HTF and Kluyveromyces lactis KLAC1 is transferred pH to 7.0, carry out purifying with HiTrap rProteinA FF affinity post: chromatography column is used the sodium phosphate buffer balance of 20mM pH7.0 earlier, with sample on the flow velocity of 1mL/min, behind the end of the sample, post is washed with the sodium phosphate buffer of the 20mMpH7.0 of 5 times of column volumes by elder generation, and then carry out wash-out with 0.1M citric acid solution (pH3.0), elutriant pH value adopts Bradford protein quantification test kit to measure with the protein concentration that 1M Tris-HCl (pH9.0) transfers to behind the neutral purifying, behind the purifying albumen be the sTNFRII-IgGFc fusion rotein, sTNFRII-IgGFc fusion rotein concentration is the 16mg/mL supernatant in the Kluyveromyces lactis HTF supernatant, and sTNFRII-IgGFc fusion rotein concentration is 2mg/mL in the Kluyveromyces lactis α TF supernatant.

Through Protein A affinity column again the sTNFRII-IgGFc fusion rotein behind the purifying carry out 10%SDS-PAGE, the coomassie brilliant blue staining result as shown in figure 13, from the position of protein band, reductive fusion rotein size is between 66kD and 80kD.

Among Figure 13,1: the reduction electrophoresis; M: molecular weight of albumen standard.

4. the Western blotting of the sTNFRII/Fc of Kluyveromyces lactis HTF expression identifies

5. Kluyveromyces lactis expressed fusion protein sTNFRII/Fc suppresses the cytotoxic activation analysis of TNF-α

The MTT experimental result as shown in figure 14, the sTNFRII-IgGFc fusion rotein behind the purifying can suppress the lethal effect of TNF-α to the L929 cell preferably.

Sequence table

＜110〉Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A

＜120〉recombination microzyme of expressing antibodies or antibody analog and construction process thereof and application

<160>1

<210>1

<211>24

<212>PRT

＜213〉artificial sequence

<220>

<230>

<400>1

Met?Lys?Trp?Val?Thr?Phe?Ile?Ser?Leu?Leu?Phe?Leu?Phe?Ser?Ser?Ala

1 5 10 15

Tyr?Ser?Arg?Gly?Val?Phe?Arg?Arg

20

<210>2

<211>72

<212>DNA

＜213〉artificial sequence

<220>

<230>

<400>2

atgaagtggg?taacctttat?ttcccttctt?tttctcttta?gctcggctta?ttccaggggt 60

gtgtttcgtc?ga 72

<210>3

<211>645

<212>DNA

＜213〉artificial sequence

<220>

<230>

<400>3

gacattcaaa?tgactcaatc?tccatcttct?ttgtctgctt?ctgttggtga?cagagttact 60

attacttgta?gagcttctca?agacgttaac?actgctgttg?cttggtacca?acaaaagcca 120

ggtaaggctc?caaagttgtt?gatttactct?gcttctttct?tgtactctgg?tgttccatct 180

agattctctg?gttctagatc?tggtactgac?ttcactttga?ctatttcttc?tttgcaacca 240

gaggacttcg?ctacttacta?ctgtcaacaa?cactacacta?ctccaccaac?tttcggtcaa 300

ggtactaagg?ttgagattaa?gagaactgtt?gctgctccat?ctgttttcat?tttcccacca 360

tctgacgagc?aattgaagtc?tggtactgct?tctgttgttt?gtttgttgaa?caacttctac 420

ccaagagagg?ctaaggttca?atggaaggtt?gacaacgctt?tgcaatctgg?taactctcaa 480

gagtctgtta?ctgagcaaga?ctctaaggac?tctacttact?ctttgtcttc?tactttgact 540

ttgtctaagg?ctgactacga?gaagcacaag?gtttacgctt?gtgaggttac?tcaccaaggt 600

ttgtcttctc?cagttactaa?gtctttcaac?agaggtgagt?gttaa 645

<210>4

<211>1353

<212>DNA

＜213〉artificial sequence

<220>

<230>

<400>4

gaagttcaat?tggttgaatc?tggtggtggt?ttggttcaac?caggtggttc?tttgagattg 60

tcttgtgctg?cttctggttt?caacattaag?gacacttaca?ttcactgggt?tagacaagct 120

ccaggtaagg?gtttggaatg?ggttgctaga?atttacccaa?ctaacggtta?cactagatac 180

gctgactctg?ttaagggtag?attcactatt?tctgctgaca?cttctaagaa?cactgcttac 240

ttgcaaatga?actctttgag?agctgaagac?actgctgttt?actactgttc?tagatggggt 300

ggtgacggtt?tctacgctat?ggactactgg?ggtcaaggta?ctttggttac?tgtttcttct 360

gcttctacta?agggtccatc?tgttttccca?ttggctccat?cttctaagtc?tacttctggt 420

ggtactgctg?ctttgggttg?tttggttaag?gactacttcc?cagaaccagt?tactgtttct 480

tggaactctg?gtgctttgac?ttctggtgtt?cacactttcc?cagctgtttt?gcaatcttct 540

ggtttgtact?ctttgtcttc?tgttgttact?gttccatctt?cttctttggg?tactcaaact 600

tacatttgta?acgttaacca?caagccatct?aacactaagg?ttgacaagaa?ggttgaacca 660

aagtcttgtg?acaagactca?cacttgtcca?ccatgtccag?ctccagaatt?gttgggtggt 720

ccatctgttt?tcttgttccc?accaaagcca?aaggacactt?tgatgatttc?tagaactcca 780

gaagttactt?gtgttgttgt?tgacgtttct?cacgaagacc?cagaagttaa?gttcaactgg 840

tacgttgacg?gtgttgaagt?tcacaacgct?aagactaagc?caagagaaga?acaatacaac 900

tctacttaca?gagttgtttc?tgttttgact?gttttgcacc?aagactggtt?gaacggtaag 960

gaatacaagt?gtaaggtttc?taacaaggct?ttgccagctc?caattgaaaa?gactatttct 1020

aaggctaagg?gtcaaccaag?agaaccacaa?gtttacactt?tgccaccatc?tagagacgaa 1080

ttgactaaga?accaagtttc?tttgacttgt?ttggttaagg?gtttctaccc?atctgacatt 1140

gctgttgaat?gggaatctaa?cggtcaacca?gaaaacaact?acaagactac?tccaccagtt 1200

ttggactctg?acggttcttt?cttcttgtac?tctaagttga?ctgttgacaa?gtctagatgg 1260

caacaaggta?acgttttctc?ttgttctgtt?atgcacgaag?ctttgcacaa?ccactacact 1320

caaaagtctt?tgtctttgtc?tccaggtaag?taa 1353

<210>5

<211>24

<212>PRT

＜213〉artificial sequence

<220>

<230>

<400>5

Met?Lys?Trp?Val?Thr?Phe?Ile?Ser?Leu?Leu?Leu?Leu?Phe?Ser?Ser?Ala

1 5 10 15

Tyr?Ser?Arg?Gly?Val?Phe?Arg?Arg

20

<210>6

<211>24

<212>PRT

＜213〉artificial sequence

<220>

<230>

<400>6

Met?Lys?Trp?Val?Thr?Phe?Leu?Leu?Leu?Leu?Phe?Val?Ser?Gly?Ser?Ala

1 5 10 15

Phe?Ser?Arg?Gly?Val?Phe?Arg?Arg

20

<210>7

<211>24

<212>PRT

＜213〉artificial sequence

<220>

<230>

<400>7

Met?Lys?Trp?Ile?Thr?Leu?Ile?Cys?Leu?Leu?Ile?Ser?Ser?Ser?Phe?Ile

1 5 10 15

Glu?Ser?Arg?Ile?Leu?Phe?Lys?Arg

20

Claims

1. the method for the recombination microzyme of construction expression antibody or antibody analog is that the encoding gene of antibody or the encoding gene of antibody analog are imported acquisition reorganization bacterium in the yeast; Described antibody analog is the Fc fragment of antibody and the fusion rotein of albumen or protein protomer formation; The encoding gene of described antibody is the heavy chain encoding gene and the light chain encoding gene of antibody, and 5 ' end of the encoding gene of described antibody or the encoding gene of antibody analog is connected with coded signal peptide nucleotide sequence; Described signal peptide is the serum albumin signal peptide.

2. method according to claim 1 is characterized in that: described serum albumin signal peptide is the mammalian blood serum human serum albumin signal peptide.

3. method according to claim 1 and 2 is characterized in that: described serum albumin signal peptide is following 1) or 2):

1) its aminoacid sequence is the sequence 1 in the sequence table;

4. method according to claim 3 is characterized in that: described serum albumin signal peptide is the sequence 5 or 6 or 7 in the sequence table.

5. method according to claim 4 is characterized in that: the Fc fragment of described antibody is selected from following arbitrary antibody: IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD and IgE.

6. method according to claim 5 is characterized in that: described yeast is pichia spp or Kluyveromyces lactis.

7. the recombination microzyme that makes up by arbitrary described method in the claim 1 to 6.

8. a method for preparing antibody or antibody analog is to cultivate the described recombination microzyme of claim 7 to produce complete antibody or antibody analog.

9. antibody or the antibody analog of producing by the described method of claim 8.