CN101724065A - Human epididymal expression sperm binding protein HEL-202 as well as encoding gene and application thereof - Google Patents

Abstract

The invention belongs to the biotechnology and the medical field and discloses a new human epididymal specific expression sperm binding protein HEL-202 as well as preparation and application thereof. The invention discloses an amino acid sequence of the HEL-202 protein and provides a recombinant expression vector which carries a DNA sequence used for encoding the protein. The protein is located at the back part of the head of a mature sperm and mainly has trace expression in an epididymis tissue and a testis tissue indicated by RT-PCR. A band of about 25 KD is detected in the epididymis by using western blot. The HEL-202 protein can be used as a target protein for developing an immunological contraceptive and clinically diagnosing and treating male infertility. A method for detecting a corresponding gene or protein based on development of the HEL-202 protein can be widely used for the research field of reproductive medicine.

Description

Human epididymis expression sperm binding protein HEL-202 and encoding gene thereof and application

Technical field

The invention belongs to biotechnology and medical field.Specifically, the present invention relates to a kind of new human epididymis expression sperm binding protein HEL-202 and encoding gene and application

Background technology

This century, the mankind's development was faced with the problem of two sternnesses: on the one hand, global population is estimated will reach 9,000,000,000 in the year two thousand fifty in rapid expansion; On the other hand, according to World Health Organization's investigation, about 15% Mr. and Mrs exist sterile problem, and the sickness rate of developed country's infertility soared at nearest 10 years, and European developed country can be up to 30%, and wherein male factor accounts for half.World Health Organization's prediction, along with the increase of paathogenic factors such as environmental pollution and sexually transmitted disease (STD), in this century, infertility will become the third-largest disease that is only second to tumour and cardiovascular and cerebrovascular disease.But male sterility does not cause enough attention of society and medical circle, and the progress of therefore relevant male reproductive health is slow, lags significantly behind other subject.The effective ways that lack molecular biology aspect Clinics and Practices infertility.Because the sperm development obstacle can not natural fertilization, needs the doctor to obtain the offspring by being the tube baby.Utilize this kind technology to obtain the offspring, not only expended valuable time and fund, and have a lot of unhealthful latencies, the natural combination of smart ovum, the advantage in the normal growing process of having lost selected hereditary offspring's chance.Brought heavy spirit and economical load for family and society.

The sharp increase of whole world population has caused resource to exhaust and environmental degradation, becomes the serious threat of human health and existence.Our times population surpasses 6,000,000,000, estimates that according to the expert maximum population's capacity that Chinese resource environment can support is 15-16 hundred million.At present can be also very limited for the human contraceptives of selecting, also differ far away from the standard of " efficient, safe, reversible ".Develop safe and effective, the advanced practical new technology that avoids conception and control birth, product innovation, requiring with the personalization of the contraception medication of satisfying different crowd, different levels is the general trend of technical development of avoiding conception and controling birth both at home and abroad in recent years.

Epididymis is the vitals of spermioteleosis, and the sperm that testis produces need could obtain to move, be fertilized, defend and keep biological functions such as normal embryo development and defence by interacting with epididymis tube chamber microenvironment.Kind of secretory protein and sperm interaction surplus in the of nearly 200 participate in the spermioteleosis process, but people knows little about it to these proteic functions in the epididymis.The research of the epididymal proteins relevant with spermioteleosis will help to promote the progress of male genetic medical science, for the diagnosis of male infertility and treatment and development of new contraceptive provide the candidate molecular target, might bring new thinking and breakthrough to the male contraception of epididymis link simultaneously.

Summary of the invention

First purpose of the present invention provides a kind of new human epididymis expression sperm binding protein HEL-202.

A kind of human epididymis expression sperm binding protein HEL-202, it have the aminoacid sequence of sequence 2 in the sequence table or with the amino acid residue sequence of sequence 2 through replacement, disappearance or the interpolation of one or several amino-acid residue and have identical active by sequence 2 deutero-protein or polypeptide with the amino acid residue sequence of sequence 2.

People's epididymis secretory protein called after of the present invention: HEL-202 is made up of 243 amino-acid residues.HEL-202 albumen has 1 N glycosylation site and 8 phosphorylation sites, comprises 5 casein kinase i I phosphorylation sites and 3 protein kinase C phosphorylation sites.In addition, this albumen also has 1 leucine zipper pattern, 1 Tropomyosins label, 1 BAR functional domain, 1 EB1-C terminal (EB1-C) functional domain and 1 Glutamic acid-rich district.

Second purpose of the present invention provides the gene of coding human epididymal expression albumen HEL-202.It is one of following nucleotide sequences:

The dna sequence dna of sequence 1 in the sequence table, the GenBank number of registration is: EU668324;

The polynucleotide of SEQ ID No.2 protein sequence in the code sequence tabulation;

The dna sequence dna that limits with sequence in the sequence table 1 has 90% above homology, and coding identical function protein DNA sequence.

SEQID No.1 in the sequence table, total length c dna sequence dna is 1281bp, is positioned on No. 1 karyomit(e) of people, 243 amino acid of encoding, proteins encoded is HEL-202, contains signal peptide, its open reading frame is 732bp, is a complete reading frame.

A third aspect of the present invention, provide and adopted the genetic engineering technique preparation to have the method for human epididymis expression sperm binding protein HEL-202 active polypeptide, it comprises the carrier that contains above-mentioned polynucleotide sequence, and the host cell that is transformed or transduce by this carrier.

A fourth aspect of the present invention provides and above-mentioned human epididymis expression sperm binding protein HEL-202 specificity bonded antibody, and the auxiliary diagnosis of the infertility of developing thus that is used for the epididymal function caused by abnormal.

A fifth aspect of the present invention, the method that whether has human epididymis expression sperm binding protein HEL-202 in the sample that detects is provided, it comprises: with the specific antibody acting in conjunction under certain condition of testing sample and secretory protein, observe whether form immune complex, have immune complex to form just to point out and have secretory protein in the sample.

A sixth aspect of the present invention provides the purposes of albumen of the present invention and its encoding sequence.Albumen for example of the present invention can be used as the molecular target of diagnosis infertility, or be used for the treatment of infertility as the active drug composition, or as the target molecule of development of new contraceptive, or be used to screening and promote the active agonist of human epididymis expression sperm binding protein HEL-202, or be used to the active antagonist of screening inhibition human epididymis expression sperm binding protein HEL-202, or be used to the peptide finger print identification.Encoding sequence or its fragment according to human epididymis expression sperm binding protein HEL-202 can design primer or probe and be used for PCR or nucleic acid hybridization, perhaps are used to prepare gene chip.Albumen of the present invention also can be used for pharmaceutical composition, as the effective active composition, is used to produce a kind of medicine that resists diseases such as cause pathogeny imcrobe infection and tumour with this.

A seventh aspect of the present invention provides a kind of pharmaceutical composition, and described composition comprises albumen of the present invention, nucleotide sequence, construction or cell, and pharmaceutically acceptable carrier.

Albumen of the present invention can be expressed at the epididymis internal specific, is positioned the sperm rear head zone, therefore may be relevant with motion.Because it is a kind of natural protein polypeptide, can predict and may have less side effect, other advantages of the present invention can be known from the following detailed description.

Description of drawings

The immunofluorescence location of Fig. 1 .HEL-202 albumen on people's sperm

Red fluorescence shows sperm nucleus; Green fluorescence shows the location of HEL-202 albumen on sperm;

The A group: positive control, A3 show that the HEL-75 protein binding is in whole sperm (article is delivered);

B group: negative control.

The C group: HEL-202 albumen location, C3. shows that the HEL-202 protein binding is in the sperm rear head zone.

Scale: 5mm.

Fig. 2 HEL-202 gene organization expression map

1 caput epididymidis, 2 bodies of epididymis, 3 cauda epididymidiss, 4 testis, 5 hearts, 6 livers, 7 spleens, 8 kidneys, 9 stomaches, 10 negative controls

The western blot result that Fig. 3 .HEL-202 albumen is expressed at epididymal fluid

M:Marker; 1: positive control, HEL-75 albumen; 2: negative control, mice serum; 3:HEL-202 albumen

Albumen of the present invention has comprised the variant form of the same or similar inhibition biological active of having of described polypeptide or function, these variant forms comprise (but being not limited to): the amino acid sequence with respect to native protein has several (to be generally 1-50, preferably 1-30,1-20 more preferably, best 1-10) amino acid whose disappearance, insertion and replacement. In addition, described disappearance or insertion (increase) also can occur in the C end and/or the N end (has in 20 usually, preferably be in 10, more preferably be 5 with interior amino acid deletions or increase), in the art, when replacing with the close or similar amino acid of performance, usually can not change amino acid whose function, it is known in the art that the amino acid whose preservative replacement table of functional similarity is provided. Following 5 groups contain the mutually amino acid of conservative substitution separately; Aliphatic series: glycine (G), alanine (A), valine (V), leucine (L), isoleucine (I); Aromatics: phenylalanine (F), tyrosine (Y), tryptophan (W); Sulfur-bearing: methionine (M), cysteine (C); Alkalescence: arginine (R), lysine (K), histidine (H); Acid: aspartic acid (D), glutamine (Q). In addition, this term has also comprised fragment or the derivative of albumen, and condition is that this fragment or derivative have kept desirable protein biological activity.

Nucleotide sequence of the present invention can use pcr amplification method, recombination method or artificial synthetic method to obtain usually. For the pcr amplification method, can be disclosed according to the present invention relevant nucleotide sequence, especially open reading frame sequence designs primer, with the prepared cDNA library of conventional method well known by persons skilled in the art as template, amplification and must be about sequence. This normally is cloned into carrier with it, changes cell over to again, separates then obtaining relevant sequence from the host cell after the propagation by conventional method.

Among the present invention, use conventional method well known by persons skilled in the art to comprise to encode the nucleotide sequence of albumen of the present invention to be inserted in the carrier, these methods include but not limited to the extracorporeal recombinant DNA technology, recombinant technique etc. in the body.

Above-mentioned carrier can be used for transforming or transfection is suitable protokaryon and eukaryotic, so that it can express coded albumen of the present invention, host cell can be prokaryotic, such as bacterial cell, or the eukaryotic such as low, such as yeast cells; Or higher eucaryotic cells, such as insect cell etc. Adoptable conversion, transfection method include, but are not limited to: calcium phosphate precipitation, microinjection, electroporation, liposome-mediated etc.

Albumen of the present invention if need, can utilize its physics, chemical separating by the whole bag of tricks and the purifying expression product with other characteristics at cell inner expression, and these methods are well-known to those skilled in the art. The example of these methods includes but not limited to: conventional renaturation processes, process the combination of (salt analysis method), centrifugal, the broken bacterium of infiltration, the broken bacterium of sound wave, super centrifugal, sieve chromatography, adsorption chromatography, ion-exchange chromatography, high performance liquid chroma-tography and other various chromatographic techniques and these methods with conventional protein precipitant.

The present invention comprises that also albumen or its fragment are had specific polyclonal antibody and monoclonal antibody, also comprises having immunocompetent antibody fragment or chimeric antibody, as has mouse-anti body binding specificity but still keep antibody from people's antibody moiety.

Antibody of the present invention can be prepared by the known various technology of those skilled in that art. For example, the gene outcome of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody, and antibody of the present invention also can be monoclonal antibody. This type of monoclonal antibody can utilize hybridoma technology to prepare.

The inventor finds further that by research this protein localization is in mature sperm back of head zone (Fig. 1), and RT-PCR result shows that this gene mainly has trace expression (Fig. 2) at epididymis and testis tissue. The inventor at expression in escherichia coli people HEL-202 albumen, use its immune mouse, obtained its polyvalent antibody. The inventor detects a 25KD left and right sides band (Fig. 3) with Western blot at the epididymis body.

Drug regimen of the present invention can be made various formulations according to various needs, usually pharmaceutical composition can be made injectable agent, for example liquid solution or suspension; Also can be made into before injection, be fit to allocate in solution or the suspension, the solid form of solution carrier, liposome is also included within the definition of pharmaceutically acceptable carrier, pharmaceutical composition of the present invention can by the doctor according to patient's kind, age, body weight and roughly the factor such as disease condition, administering mode determine the useful dosage of patient is used, in order to improve the medication effect, albumen of the present invention also can use jointly with other drug.

Below in conjunction with instantiation, further set forth the present invention, should understand these examples only is used for explanation the present invention and is not used in and limits the scope of the invention, unless description is arranged in addition, enforcement of the present invention will be adopted molecular biology, microbiology, recombinant DNA and immunologic routine techniques, and these all are known to those skilled in the art. These technology have complete description below in the document: Sambrook " molecular cloning experiment guide " second edition (1989) for example; " dna clone " I and II volume (D.N.Glover edits, 1985); " oligonucleotides is synthetic " (M.J.Gait edits, 1984); " nucleic acid hybridization " (B.D.Hames and S. J. Higgins edits. 1984); " protein purification; Principle and put into practice " the 2nd edition (Spring-Verlag, N.Y.), and " experiment immunization learn handbook I-IV volume (D.C.Weir and C.C.Blackwell edit 1986) or, can carry out according to the specification that the reagent manufacturer provides.

Embodiment

Embodiment 1. adopts genetic engineering technique to prepare human epididymal expression albumen HEL-202

Gene clone and sequential analysis

The large scale sequencing screening is carried out in people's epididymis cDNA library that this laboratory makes up, obtained expressed sequence tag (EST), utilize the Unigene database to carry out electronic cloning, obtain people HEL-202 full-length cDNA.Use Expasy Translate tool (http://us.expasy.orghttp: //us.expasy.org), InterProScan (http://www.ebi.ac.uk/Tools/http: //www.ebi.ac.uk/Tools/) and Protein Stakes-of-wood roteinblast (http://www.ncbi.nlm.nih.gov/BLAST/http: //www.ncbi.nlm.nih.gov/BLAST/) wait prediction HEL-202 peptide sequence and supposition function.SignalP (http://www.cbs.dtu.dkhttp: //www.cbs.dtu.dk), location in PSORTII and WoLFPSORT software analysis such as (http://psort.nibb.ac.jp) this proteic signal peptide of prediction and the born of the same parents.ProfileScan (http://myhits.isb-sib.ch/cgi-bin/PFSCANhttp: //myhits.isb-sib.ch/cgi-bin/PFSCAN) prediction N holds glycosylation and phosphorylation site.

To the people HEL-202 full-length cDNA that obtains, according to information biology prediction HEL-202 coding region, do you design a pair of special primer: F01:5 '-TTGGTACCGACGACGACGACAAG ATGGAGGCCATCAAGAAAAAG? ', F02:5 '-GCGGCGAATTC TATAGAGGTCATGTCATTG-3 ', upstream and downstream primer two ends are introduced restriction endonuclease sites KpnI and EcoRI respectively.Primer is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.The people's epididymis cDNA library that makes up with this laboratory is a template, pcr amplification HEL-202 gene fragment.The PCR reaction conditions: 94 ℃ of pre-sex change 10min, (94 ℃, 40s; 55 ℃, 45s; 70 ℃, 30s) 30 circulations, 70 ℃ are extended 10min, 4 ℃ of preservations.After reaction finished, 1.0% agarose gel electrophoresis detected and Separation and Recovery purpose fragment, inserted the evaluation of checking order among the cloning vector pMD-18T.

Reorganization HEL-202 protein expression and purifying

Order-checking identifies that back HEL-202 gene is cloned among the expression vector pET-32b (+) by KpnI and EcoRI site, and it is consistent to make itself and fusion tag read frame.Recombinant expression vector pET32b (+)-HEL-202 changes E.coli BL21 (DE3) competent cell over to, utilize bacterium colony PCR screening positive clone, engineering strain is at 1mM IPTG, after inducing 4h under 32 ℃ of conditions, the recombinant protein that the N end has His-tag carries out separation and purification by " two step nickel affinity chromatography methods " to reorganization HEL-202 albumen.Briefly, " the first step affinity chromatography " is used for purification of Recombinant Trx-HEL-202 fusion rotein.Fusion rotein recombinant enterokinase cracking then discharges fusion tag.At last, reorganization HEL-202 albumen is reclaimed in utilization " the second step affinity chromatography ".Recombinant protein behind the purifying carries out quantitatively preserving with lyophilize then with Bradford (Bradford 1976) method.

The preparation of embodiment 2. anti-HEL-202 polyclonal antiserums

How anti-with the preparation of reorganization HEL-202 protein immunization BALB/C mice.Briefly, every mouse was injected the complete freund adjuvant (CFA) of 50 μ g recombinant proteins and equivalent in the 1st day.Injected incomplete freund adjuvant (IFA) booster immunization of 25 μ g recombinant proteins and equivalent then at the 15th, 30 and 45 day.Get blood from eyeball on the 60th day, and analyzed tiring and specificity of antibody with ELASA and western blot behind the separation of serum.Elisa assay shows that antibody titer reaches 1: 10000.Westernblot shows that the natural HEL-202 that extracts to recombinant protein with from people's epididymal fluid has good specificity.

The research of embodiment 3. people HEL-202 mRNA distribution expression patterns

In order to determine the expression pattern of HEL-202, adopt sxemiquantitative RT-PCR to analyze the HEL-202 gene, testis, the heart, liver, spleen, lung, kidney, the differential expression in the tissue such as stomach at people's caput epididymidis, body, tail.With TRIzol (Tiangen, Beijing, China) extracted total RNA, reverse transcription becomes cDNA to the total RNA of 1ug with 0.3ugoligodT18 (Promega) with 20UAMV reversed transcriptive enzyme (Promega).Then, 2ul synthetic cDNA utilizes gene specific primer to carry out pcr amplification.The 20ul reaction system contains: 2ul 10 * PCR buffer (with MgCl ₂), 2ul dNTP Mix (10mmol/L), each draws ul (25umol/L) 1ul, 1ul Taq archaeal dna polymerase (2.5U/ul), 2ulcDNA template and 11ulddH ₂O.The program of PCR reaction is: 94 ℃, and 10min; 94 ℃, 1min; 54 ℃ of (to HEL-202)/49 ℃ (30s of β-actin); 72 ℃, 1min (35 circulation); 72 ℃ are extended 7min.The expression of β-actin is as confidential reference items.All pcr amplification products 1.5% agarose electrophoretic analysis.RT-PCR result shows that this gene mainly has trace expression at epididymis and testis tissue.

Embodiment 4. people HEL-202 albumen are in the immunofluorescence location of tissue

Get people's testis, epididymis tissue freezing section, carry out immunofluorescence dyeing, wherein one anti-is mouse-anti rHEL-202 how anti-(1: 400), and two anti-ly are FITC-mark sheep anti-mouse igg (1: 200), and nucleus dyes with PI.Sections all after the dyeing are used Laser Scanning Confocal Microscope (LeicaTCSSP2 AOBS) observations then with 80% glycerine mounting.Experiment is anti-as negative control with blood serum substituting before the mouse immune one simultaneously.

Embodiment 5. people's epididymal proteins extracts and Western blot

The total protein extract 20ug that will extract from people's epididymal fluid separates with 15%SDS-PAGE, and wet then forwarding to carried out western blot on the pvdf membrane.Mouse-anti people HEL-202 is how anti-to be one anti-(1: 5000), and two anti-ly are HRP-mark sheep anti-mouse igg (1: 500).The activity of horseradish peroxidase is analyzed Westernblot with enhancement type HRP-DAB substrate colouring reagents box and is shown anti-people HEL-202 resists the natural HEL-202 that extracts to recombinant protein with from people's epididymal fluid to have good specificity more.

Embodiment 6. people HEL-202 albumen are in the immunofluorescence location of sperm

Collect and coat on the slide glass of 1% gelatin bag quilt after sperm washs with PBS, dry naturally, fix 10 minutes with methyl alcohol then.The slide glass that contains sperm at room temperature sealed 1 hour with 3%BSA, added mouse-anti HEL-202 then and resisted (1: 200) more, and 4 ℃ are spent the night.Mice serum is done negative control before the immunity.With PBST (PBScontaining0.1%Tween-20) washing three times, add corresponding FITC-mark sheep anti-mouse igg two anti-(1: 200).Slide glass is used 80% glycerine mounting then with PBST washing three times.With Olympus BX-52 microscopic examination, the HEL-202 protein binding is in a son back zone of sperm, and is relevant with fertilization.

The anti-microbial activity of embodiment 7.HEL-202 recombinant protein

Utilization clone's colony-forming unit (CFU) is analyzed anti-microbial activity.Briefly, the E.coli XL-1blue of incubated overnight grows into 10mM PBS (pH7.4) dilution of logarithmic phase (OD600=0.4-0.5) back.About 2 * 10 ⁶The CFU/ml bacterium is mixing with the HEL-202 of 12.5～100ug/ml, 37 ℃ of cultivations.15,30,60 and 120min after beginning to cultivate is respectively in sampling.Sample is done serial dilution with 10mMPBS (pH7.4), and each extent of dilution is got 100ul and is coated the LB agar plate, and 37 ℃ of overnight incubation are to forming single bacterium colony.Statistics bacterium colony number, anti-microbial activity represents that with the percentage ratio of bacteria living formula is: % survival=(albumen handle back survival clone number/handle clone's number of surviving in the back without albumen) * 100.Experiment replaces albumen to handle bacterium as negative control with 10mMPBS (pH 7.4).

Embodiment 8 HEL-202 and sperm motility and relation research in vitro fertilization

Utilize HEL-202 to resist sealing normal people sperm more, carry out sperm motility and analysis in vitro fertilization then.Experiment is carried out according to the method that vitro life standard reagent box provides.Briefly, sperm uses SpermRinse-30 in 37 ℃, 5%CO earlier ₂Cultivate capacitation in 1 hour.Added mouse-anti rHEL-202 according to 1: 200 then and resist more, in 37 ℃, 6%CO ₂Cultivate and sealed in 2 hours.Sperm separated into two parts after the sealing, a part directly utilize computer aided system to analyze the mobility of sperm.Another part is with G-Fert washing 2 times, and to be adjusted to final concentration be 1.0 * 10 ⁷Cells/ml.Add the 100ul sample of sperm in the culture dish of 35mm, cover paraffin oil then and put into 37 ℃, 6%CO ₂With stand-by in the saturated humidity incubator.Handle the after ripening ovocyte through G-MOPS and add during preprepared fertilization drips, at 37 ℃, 6%CO ₂Observe the fertilization situation with cultivating in the saturated humidity incubator, write down the fetal development situation every day.More than all the experiment use simultaneously the immunity before mice serum as negative control.

Sequence table

＜110〉Li Jianyuan

＜120〉human epididymis expression sperm binding protein HEL-202 and encoding gene thereof and application

<160>2

<170>PatentIn?version?3.5

<210>1

<211>1281

<212>DNA

＜213〉Genus Homo ethnic group (homo sapiens)

<220>

<221>CDS

<222>(84)..(815)

<400>1

cactcaggca?gcagcccctt?ctttcttgcc?ccagtctcca?gttctccagt?gttcacaggt 60

gagcctacca?acagccactg?ctc?atg?atg?gag?gcc?atc?aag?aaa?aag?atg?cag 113

Met?Met?Glu?Ala?Ile?Lys?Lys?Lys?Met?Gln

1 5 10

atg?ctg?aag?tta?gac?aag?gag?aat?gct?ctg?gat?cgg?gca?gag?caa?gct 161

Met?Leu?Lys?Leu?Asp?Lys?Glu?Asn?Ala?Leu?Asp?Arg?Ala?Glu?Gln?Ala

15 20 25

gaa?gct?gag?cag?aag?cag?gca?gaa?gaa?aga?agt?aaa?cag?ctg?gag?gat 209

Glu?Ala?Glu?Gln?Lys?Gln?Ala?Glu?Glu?Arg?Ser?Lys?Gln?Leu?Glu?Asp

30 35 40

gag?ctg?gca?gcc?atg?cag?aag?aag?ctg?aaa?ggg?aca?gag?gat?gag?ctg 257

Glu?Leu?Ala?Ala?Met?Gln?Lys?Lys?Leu?Lys?Gly?Thr?Glu?Asp?Glu?Leu

45 50 55

gac?cgt?gct?cag?gag?cgc?ctg?gcc?act?gcc?ctg?caa?aag?ctg?gaa?gaa 305

Asp?Arg?Ala?Gln?Glu?Arg?Leu?Ala?Thr?Ala?Leu?Gln?Lys?Leu?Glu?Glu

60 65 70

gct?gaa?aaa?gct?gct?gat?gag?agt?gag?aga?ggt?atg?aag?gtt?att?gaa 353

Ala?Glu?Lys?Ala?Ala?Asp?Glu?Ser?Glu?Arg?Gly?Met?Lys?Val?Ile?Glu

75 80 85 90

aac?cgg?gcc?tta?aaa?gat?gaa?gaa?aag?atg?gaa?ctc?cag?gaa?atc?caa 401

Asn?Arg?Ala?Leu?Lys?Asp?Glu?Glu?Lys?Met?Glu?Leu?Gln?Glu?Ile?Gln

95 100 105

ctc?aaa?gaa?gct?aag?cac?att?gca?gaa?gag?gca?gat?agg?aag?tat?gaa 449

Leu?Lys?Glu?Ala?Lys?His?Ile?Ala?Glu?Glu?Ala?Asp?Arg?Lys?Tyr?Glu

110 115 120

gag?gtg?gct?cgt?aag?ttg?gtg?atc?att?gaa?gga?gac?ttg?gaa?cgc?aca 497

Glu?Val?Ala?Arg?Lys?Leu?Val?Ile?Ile?Glu?Gly?Asp?Leu?Glu?Arg?Thr

125 130 135

gag?gaa?cga?gct?gag?ctg?gca?gag?tct?aag?tgt?tct?gag?ctg?gag?gag 545

Glu?Glu?Arg?Ala?Glu?Leu?Ala?Glu?Ser?Lys?Cys?Ser?Glu?Leu?Glu?Glu

140 145 150

gag?ctg?aag?aat?gtc?acc?aac?aac?ctc?aag?tct?ctt?gag?gct?cag?gcg 593

Glu?Leu?Lys?Asn?Val?Thr?Asn?Asn?Leu?Lys?Ser?Leu?Glu?Ala?Gln?Ala

155 160 165 170

gag?aag?tac?tct?caa?aaa?gaa?gat?aaa?tat?gag?gaa?gaa?atc?aag?att 641

Glu?Lys?Tyr?Ser?Gln?Lys?Glu?Asp?Lys?Tyr?Glu?Glu?Glu?Ile?Lys?Ile

175 180 185

ctt?act?gat?aaa?ctc?aag?gag?gca?gag?acc?cgt?gct?gag?ttt?gct?gag 689

Leu?Thr?Asp?Lys?Leu?Lys?Glu?Ala?Glu?Thr?Arg?Ala?Glu?Phe?Ala?Glu

190 195 200

aga?tcg?gta?gcc?aag?cta?gaa?aag?aca?att?gat?gac?ctg?gaa?gat?gag 737

Arg?Ser?Val?Ala?Lys?Leu?Glu?Lys?Thr?Ile?Asp?Asp?Leu?Glu?Asp?Glu

205 210 215

ctc?tat?gcc?cag?aaa?ctg?aag?tac?aag?gcc?att?agc?gag?gag?ctg?gac 785

Leu?Tyr?Ala?Gln?Lys?Leu?Lys?Tyr?Lys?Ala?Ile?Ser?Glu?Glu?Leu?Asp

220 225 230

cac?gcc?ctc?aat?gac?atg?acc?tct?ata?taa?ttatcaccgt?ttctgctctg 835

His?Ala?Leu?Asn?Asp?Met?Thr?Ser?Ile

235 240

ttctggatct?gcccccttta?ctcctcgggg?aacccaaggc?cccactctcg?ctctggattc 895

catttgggtc?agcctggctg?gtccccaagg?cattaggatg?ggggagcaaa?aagcaactta 955

tgtattttct?tccaccccca?ccccaaatta?aaatgttaag?ctgctggaag?cctcatgcca 1015

ccctgcattt?gtgtcattga?caaagctgtt?gctgtcccta?agaaggagcc?ttgggggtgt 1075

gatgtgggga?agagctattg?taggctcccc?ctcctctgac?ttatgtaatc?aaagccactt 1135

ttgtgtgtgt?ctattttttc?ttgacattta?aactcagctg?atctgattct?accagagtga 1195

tggatttagt?acaggttact?caggatagta?attttagtta?tactcctcaa?gctgaacaag 1255

attaaattcc?ttatttccag?gttctt 1281

<210>2

<211>243

<212>PRT

＜213〉Genus Homo ethnic group (homo sapiens)

<400>2

Met?Met?Glu?Ala?Ile?Lys?Lys?Lys?Met?Gln?Met?Leu?Lys?Leu?Asp?Lys

1 5 10 15

Glu?Asn?Ala?Leu?Asp?Arg?Ala?Glu?Gln?Ala?Glu?Ala?Glu?Gln?Lys?Gln

20 25 30

Ala?Glu?Glu?Arg?Ser?Lys?Gln?Leu?Glu?Asp?Glu?Leu?Ala?Ala?Met?Gln

35 40 45

Lys?Lys?Leu?Lys?Gly?Thr?Glu?Asp?Glu?Leu?Asp?Arg?Ala?Gln?Glu?Arg

50 55 60

Leu?Ala?Thr?Ala?Leu?Gln?Lys?Leu?Glu?Glu?Ala?Glu?Lys?Ala?Ala?Asp

65 70 75 80

Glu?Ser?Glu?Arg?Gly?Met?Lys?Val?Ile?Glu?Asn?Arg?Ala?Leu?Lys?Asp

85 90 95

Glu?Glu?Lys?Met?Glu?Leu?Gln?Glu?Ile?Gln?Leu?Lys?Glu?Ala?Lys?His

100 105 110

Ile?Ala?Glu?Glu?Ala?Asp?Arg?Lys?Tyr?Glu?Glu?Val?Ala?Arg?Lys?Leu

115 120 125

Val?Ile?Ile?Glu?Gly?Asp?Leu?Glu?Arg?Thr?Glu?Glu?Arg?Ala?Glu?Leu

130 135 140

Ala?Glu?Ser?Lys?Cys?Ser?Glu?Leu?Glu?Glu?Glu?Leu?Lys?Asn?Val?Thr

145 150 155 160

Asn?Asn?Leu?Lys?Ser?Leu?Glu?Ala?Gln?Ala?Glu?Lys?Tyr?Ser?Gln?Lys

165 170 175

Glu?Asp?Lys?Tyr?Glu?Glu?Glu?Ile?Lys?Ile?Leu?Thr?Asp?Lys?Leu?Lys

180 185 190

Glu?Ala?Glu?Thr?Arg?Ala?Glu?Phe?Ala?Glu?Arg?Ser?Val?Ala?Lys?Leu

195 200 205

Glu?Lys?Thr?Ile?Asp?Asp?Leu?Glu?Asp?Glu?Leu?Tyr?Ala?Gln?Lys?Leu

210 215 220

Lys?Tyr?Lys?Ala?Ile?Ser?Glu?Glu?Leu?Asp?His?Ala?Leu?Asn?Asp?Met

225 230 235 240

Thr?Ser?Ile

Claims (10)

1. human epididymis expression sperm binding protein HEL-202, it is characterized in that, it have the aminoacid sequence of sequence 2 in the sequence table or with the aminoacid sequence of sequence 2 through replacement, disappearance or the interpolation of one or several amino-acid residue and have with the identical active sequence 2 deutero-protein of amino acid residue sequence of sequence 2 with by chemical process synthetic protein.

2. the encoding gene of a human epididymis expression sperm binding protein HEL-202, it is one of following nucleotide sequences:

The nucleotide sequence of sequence 1 in the sequence table;

The dna sequence dna that limits with sequence in the sequence table 1 has 90% above homology, and the proteic dna sequence dna of coding identical function.

3. the eucaryon and the prokaryotic expression carrier that contain the described gene of claim 2.

4. the clone that contains the described gene of claim 2.

5. be the reagent of activeconstituents at the prepared various antibody of the described protein of claim 1 and with this antibody.

6. the pharmaceutical composition that provides at the described protein of claim 1, described composition comprises albumen of the present invention, nucleotide sequence, construction or cell, and pharmaceutically acceptable carrier.

7. the application of albumen according to claim 1 in the infertility diagnosis.

8. the application of albumen according to claim 1 in the infertility treatment.

9. the application of gene according to claim 2 in the new contraceptive of exploitation.

10. the application of albumen according to claim 1 in the new microbiotic of preparation.

Images