CN101717831A - Kit and DNA probe for detecting potato virus and preparation method of probe sequence (1) - Google Patents
Kit and DNA probe for detecting potato virus and preparation method of probe sequence (1) Download PDFInfo
- Publication number
- CN101717831A CN101717831A CN200910073290A CN200910073290A CN101717831A CN 101717831 A CN101717831 A CN 101717831A CN 200910073290 A CN200910073290 A CN 200910073290A CN 200910073290 A CN200910073290 A CN 200910073290A CN 101717831 A CN101717831 A CN 101717831A
- Authority
- CN
- China
- Prior art keywords
- solution
- pstvd
- concentration
- viroid
- pgm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kit and DNA probe for detecting potato viroid and a preparation method of probe sequence (1) relate to a kit for detecting viroid, a DNA probe for detection and a preparation method of probe sequence. The invention solves the defects that the existing potato viroid detection technology has low detection sensitivity and complicated operation and needs the professional to perform laboratory tests, and also solves the defect that the existing DNA probe used for detecting the potato viroid can cause low detection sensitivity. The kit of the invention comprises a solution I, a solution VI, a solution VII, a solution VIII, a solution IX, a solution XI, a solution XII, a solution XIII and a solution XIV. The DNA probe of the invention is a double probe. The kit of the invention has high sensitivity and easy operation, and the sensitivity of the DNA probe of the invention is 500 times of the sensitivity of the current simple probe.
Description
Technical field
The test kit of detection type virus of the present invention and the detection preparation method of dna probe and probe sequence.
Background technology
China's existing potato viroid (PSTVd) detection technique mainly contains two kinds: a kind of R-PAGE of being method (coming and going the two-dimensional polyacrylamide gel electrophoresis method), it is lower that this method existence detects sensitivity, the defective that the operation more complicated needs the professional chamber of experimentizing to detect; Another kind is the RT-PCR method, and there is the high problem of cost that detects in this method.The used dna probe of existing in addition detection potato viroid is all monomer probe or fragment probe, and this class dna probe has also caused the low defective of detection sensitivity.
Summary of the invention
The present invention exists in order to solve existing potato viroid detection technique that to detect sensitivity lower, the defective that the operation more complicated needs the professional chamber of experimentizing to detect, and the existing used dna probe of potato viroid that detects caused the low defective of detection sensitivity, and test kit that detects the potato viroid and dna probe and the probe sequence preparation method 1. who detects the potato viroid are provided.
The present invention detects the test kit of potato viroid and is made up of 1 part solution I, 1 part solution VI, 1 part solution VII, 1 part solution VIII, 1 part solution I X, 1 part solution XI, 1 part solution XII, 1 part solution XIII and 1 part solution X IV according to volume parts; Wherein solution I is made by sodium-chlor and trisodium citrate mixing solutions, and sodium chloride concentration is that 3mol/L, trisodium citrate concentration are 0.3mol/L in the solution I, and its pH value is 7.0; The concentration of salmon sperm dna is 10mg/mL among the solution VI; Solution VII is that solution V and solution IV are formed according to 101: 1 mixed of volume ratio; The solution V of every 10mL is that the NaCl concentration of the solution III of solution II, 0.5mL of 20% sodium dodecyl sulfate solution, 0.5mL and surplus is that the aqueous solution of 5mol/L is formed by methane amide, the 3.5mL mass concentration of 5mL; Na in the solution II
2HPO
4Concentration be 0.684mol/L, NaH
2PO
4Concentration be 0.316mol/L; The mass concentration of ficoll in the solution III-400 is 2%, and the mass concentration of polyvinylpyrrolidone-360 is 2%, N, and the mass concentration of the two silica-based ethanamides of front three of O-is 2%; The solution VII of every 40mL is the solution I by 4mL, and the mass concentration of 0.4mL is that the water of 10% sodium dodecyl sulfate solution and surplus is formed; The solution VIII of every 40mL is by the solution I of 0.2mL, and the mass concentration of 0.4mL is that the water of 10% sodium dodecyl sulfate solution and surplus is formed; The concentration of maleic acid is that the concentration of 0.1mol/L, NaCl is 0.15mol/L among the solution I X, and the pH value is 7.5; Form by 2% skimmed milk, 2% Triton X-100 and 96% solution X according to percent by volume among the solution X I; The solution X of every 100mL is the solution 1mL of 10mmol/L by Tris-HCl concentration, and NaCl concentration is the solution 3mL of 150mmol/L, and the TWeen-20 of 50 μ L and the water of surplus are formed; Solution X II is that the ammoniumper chlorate with digoxigenin labeled with 0.5 μ L is dissolved among the 10mL solution X I formulated; The concentration of Tris-HCl is 0.1mol/L among the solution XIII, and the concentration of NaCl is 0.1mol/L, and the pH value is 9.5; Solution X IV is that 10 μ L CDP-Star are dissolved in the solution XIII of 1mL is formulated.
The dna probe that detects the potato viroid is the binary probe; The binary probe has one of following sequence:
①、TCTAGATCCCTGAAGCGCTCCTCCGAGCCGCCTTCTTTTTTCTTTTCT
GCTCAGGAGGTCAGGTGTGAACCACAGGAACCACGAGTTTAGTTCCGA
GGAACCAACTGCGGTTCCAAGGGCTAAACACCCTCGCCCCGAAGCAAA
GAAAGATAGAGAAAAAGCGGTTCTCGGGAGCTTCAGTTGTTTCTACCGG
GTAGTAGCCGAAGCGACAGCGCAAAGGGGGCGAGGGGTGGTCCTGCGG
GCGCGAGGAAGGACACCCGAAGAAAGGAAGGGTGAAAACCCTGTTTCG
GCGGGAATTACTCCTGTCGGCCGCTGGGCGCTCCCCACCGTCCTTATTGC
CAGTTCGCTCCAGGTTTCCCGGGGGATCCCTGAAGCGCTCCTCCGAGCC
GCCTTCTTTTTTCTTTTCTGCTCAGGAGGTCAGGTGTGAACCACAGGAAC
CACGAGTTTAGTTCCGAGGAACCAACTGCGGTTCCAAGGGCTAAACACC
CTCGCCCCGAAGCAAAGAAAGATAGAGAAAAAGCGGTTCTCGGGAGCT
TCAGTTGTTTCTACCGGGTAGTAGCCGAAGCGACAGCGCAAAGGGGGCG
AGGTGTGGTCCTGCGGGCGCGAGGAAAGACACCCGAAGAAAGGAAGG
GTGAAAACCCTGTTTCGGCGGGAATTACTCCTGTCGGCCGCTGGGCGCT
CCCCACCGTCCTTATTGCCAGTTCGCTCCAGGTTTCCCGGGAGCTC；
2., " T " of sequence 20%～35% in 1. Dig-dUTP of being labeled replaces at random, and has the potato viroid dna probe function 1. identical with sequence;
3., sequence 1. in 50 replaced at random with interior base, and have the potato viroid dna probe function 1. identical with sequence.
The probe sequence preparation 1. that the present invention detects the potato viroid prepares by the following method: one, the total nucleic acid of extracting with the PSTVd positive is a template, with 5 '-GGATCCCTGAAGCGCTCCTCCGAGCCG-3 ' is forward primer, with 5 '-GAGCTCCCGGGAAACCTGGAGCGAACTGG-3 ' is that reverse primer carries out the RT-PCR amplification; Two, be connected in the pGM-T carrier after the amplified production recovery with step 1, utilize BamHI/Sac I double digestion to identify the insertion situation then, positive recombinant vectors called after pGM-T-PSTVd-M
1Three, the total nucleic acid of extracting with the positive potato sample that contains PSTVd, to extract product is template, with 5 '-TCTAGATCCCTGAAGCGCTCCTCCGAGCCG-3 ' is forward primer, with 5 '-GGATCCCCCGGGAAACCTGGAGCGAAC-3 ' is that reverse primer carries out the RT-PCR amplification, product is connected in the pGM-T carrier after reclaiming, carry out Xba I/BamHI double digestion and identify, positive colony and called after pGM-T-PSTVd-M that screening is oppositely inserted
2Four, with BamH I/SacI double digestion pGM-T-PSTVd-M
2Recombinant plasmid is connected to special endonuclease bamhi the pGM-T-PSTVd-M of BamHI/Sac I double digestion
1On the carrier, make up PSTVd binary carrier; Five, by Xba I/Sac I double digestion evaluation and screening PSTVd binary carrier, positive recombinant vectors called after pGM-T-PSTVd-M
dSix, according to the pGM-T-PSTVd-M that inserts the viroid binary
dThe sequences Design forward primer 5 of carrier both sides '-GCCGCGGGAATTCGAT-3 ' and reverse primer 5 '-TCCAACGCGTTGGGAGC-3 ', utilize Dig-dUTP to be marker, carry out pcr amplification; Promptly obtain detecting the binary probe of potato viroid.
Test kit of the present invention has the following advantages: 1, simple to operate; 2, highly sensitive, can reach 0.05pg.
The dna probe that the present invention detects the potato viroid has the following advantages: utilize round pcr, PSTVd binary cDNA probe with the digoxigenin labeled preparation, pass through chemiluminescence reaction, carry out interpretation as a result, its detection sensitivity is the highest, can reach 0.05pg, is 100 times of monomer probe in detecting sensitivity under the equal conditions, be 1000 times of fragment probe in detecting sensitivity, the sensitivity of prepared binary probe in detecting is 500 times of report detection sensitivity such as Salazar.
Description of drawings
Fig. 1 is the figure as a result of the probe in detecting potato viroid of embodiment 16, wherein 1 to represent sensitivity be 5ng, 2 to represent sensitivity be 500pg, 3 to represent sensitivity be 50pg, 4 to represent sensitivity be 5pg, 5 to represent sensitivity be 0.5pg, and 6 to represent sensitivity be 0.05pg, and 7 to represent sensitivity be 0.005pg; Fig. 2 is the figure as a result of existing monomer probe in detecting potato viroid, and wherein 1 to represent sensitivity be 5ng, and 2 to represent sensitivity be 500pg, and 3 to represent sensitivity be 50pg; Fig. 3 is the figure as a result of existing fragment probe in detecting potato viroid, and wherein 1 to represent sensitivity be 5ng, and 2 to represent sensitivity be 500pg, and 3 to represent sensitivity be 50pg.
Embodiment
Technical solution of the present invention is not limited to following cited embodiment, also comprises the arbitrary combination between each embodiment.
Embodiment one: present embodiment detects the test kit of potato viroid and is made up of 1 part solution I, 1 part solution VI, 1 part solution VII, 1 part solution VIII, 1 part solution I X, 1 part solution XI, 1 part solution XII, 1 part solution XIII and 1 part solution XIV according to volume parts; Wherein solution I is made by sodium-chlor and trisodium citrate mixing solutions, and sodium chloride concentration is that 3mol/L, trisodium citrate concentration are 0.3mol/L in the solution I, and its pH value is 7.0; The concentration of salmon sperm dna is 10mg/mL among the solution VI; Solution VII is that solution V and solution IV are formed according to 101: 1 mixed of volume ratio; The solution V of every 10mL is that the NaCl concentration of the solution III of solution II, 0.5mL of 20% sodium dodecyl sulfate solution, 0.5mL and surplus is that the aqueous solution of 5mol/L is formed by methane amide, the 3.5mL mass concentration of 5mL; Na in the solution II
2HPO
4Concentration be 0.684mol/L, NaH
2PO
4Concentration be 0.316mol/L; The mass concentration of ficoll in the solution III-400 is 2%, and the mass concentration of polyvinylpyrrolidone-360 is 2%, N, and the mass concentration of the two silica-based ethanamides of front three of O-is 2%; The solution VII of every 40mL is the solution I by 4mL, and the mass concentration of 0.4mL is that the water of 10% sodium dodecyl sulfate solution and surplus is formed; The solution VIII of every 40mL is by the solution I of 0.2mL, and the mass concentration of 0.4mL is that the water of 10% sodium dodecyl sulfate solution and surplus is formed; The concentration of maleic acid is that the concentration of 0.1mol/L, NaCl is 0.15mol/L among the solution I X, and the pH value is 7.5; Form by 2% skimmed milk, 2% Triton X-100 and 96% solution X according to percent by volume among the solution X I; The solution X of every 100mL is the solution 1mL of 10mmol/L by Tris-HCl concentration, and NaCl concentration is the solution 3mL of 150mmol/L, and the TWeen-20 of 50 μ L and the water of surplus are formed; Solution X II is that the ammoniumper chlorate with digoxigenin labeled with 0.5 μ L is dissolved among the 10mL solution X I formulated; The concentration of Tris-HCl is 0.1mol/L among the solution X III, and the concentration of NaCl is 0.1mol/L, and the pH value is 9.5; Solution XIV is that 10 μ L CDP-Star are dissolved in the solution XIII of 1mL is formulated.
The compound method of present embodiment salmon sperm dna is: take by weighing salmon sperm dna 200mg and place the 50ml beaker, the TE Buffer that adds 20m1 mixes.
Embodiment two: the dna probe that present embodiment detects the potato viroid is the binary probe; The binary probe has one of following sequence:
①、TCTAGATCCCTGAAGCGCTCCTCCGAGCCGCCTTCTTTTTTCTTTTCT
GCTCAGGAGGTCAGGTGTGAACCACAGGAACCACGAGTTTAGTTCCGA
GGAACCAACTGCGGTTCCAAGGGCTAAACACCCTCGCCCCGAAGCAAA
GAAAGATAGAGAAAAAGCGGTTCTCGGGAGCTTCAGTTGTTTCTACCGG
GTAGTAGCCGAAGCGACAGCGCAAAGGGGGCGAGGGGTGGTCCTGCGG
GCGCGAGGAAGGACACCCGAAGAAAGGAAGGGTGAAAACCCTGTTTCG
GCGGGAATTACTCCTGTCGGCCGCTGGGCGCTCCCCACCGTCCTTATTGC
CAGTTCGCTCCAGGTTTCCCGGGGGATCCCTGAAGCGCTCCTCCGAGCC
GCCTTCTTTTTTCTTTTCTGCTCAGGAGGTCAGGTGTGAACCACAGGAAC
CACGAGTTTAGTTCCGAGGAACCAACTGCGGTTCCAAGGGCTAAACACC
CTCGCCCCGAAGCAAAGAAAGATAGAGAAAAAGCGGTTCTCGGGAGCT
TCAGTTGTTTCTACCGGGTAGTAGCCGAAGCGACAGCGCAAAGGGGGCG
AGGTGTGGTCCTGCGGGCGCGAGGAAAGACACCCGAAGAAAGGAAGG
GTGAAAACCCTGTTTCGGCGGGAATTACTCCTGTCGGCCGCTGGGCGCT
CCCCACCGTCCTTATTGCCAGTTCGCTCCAGGTTTCCCGGGAGCTC；
2., " T " of sequence 20%～35% in 1. Dig-dUTP of being labeled replaces at random, and has the potato viroid dna probe function 1. identical with sequence;
3., sequence 1. in 50 replaced at random with interior base, and have the potato viroid dna probe function 1. identical with sequence.
Embodiment four: the dna probe that present embodiment detects the potato viroid is the binary probe; The binary probe has following sequence:
①、TCTAGATCCCTGAAGCGCTCCTCCGAGCCGCCTTCTTTTTTCTTTTCT
GCTCAGGAGGTCAGGTGTGAACCACAGGAACCACGAGTTTAGTTCC
GAGGAACCAACTGCGGTTCCAAGGGCTAAACACCCTCGCCCCGAAGCA
AAGAAAGATAGAGAAAAAGCGGTTCTCGGGAGCTTCAGTTGTTTCTACC
GGGTAGTAGCCGAAGCGACAGCGCAAAGGGGGCGAGGGGTGGTCCTGC
GGGCGCGAGGAAGGACACCCGAAGAAAGGAAGGGTGAAAACCCTGTT
TCGGCGGGAATTACTCCTGTCGGCCGCTGGGCGCTCCCCACCGTCCTTAT
TGCCAGTTCGCTCCAGGTTTCCCGGGGGATCCCTGAAGCGCTCCTCCGA
GCCGCCTTCTTTTTTCTTTTCTGCTCAGGAGGTCAGGTGTGAACCACAGG
AACCACGAGTTTAGTTCCGAGGAACCAACTGCGGTTCCAAGGGCTAAAC
ACCCTCGCCCCGAAGCAAAGAAAGATAGAGAAAAAGCGGTTCTCGGGA
GCTTCAGTTGTTTCTACCGGGTAGTAGCCGAAGCGACAGCGCAAAGGGG
GCGAGGTGTGGTCCTGCGGGCGCGAGGAAAGACACCCGAAGAAAGGA
AGGGTGAAAACCCTGTTTCGGCGGGAATTACTCCTGTCGGCCGCTGGGC
GCTCCCCACCGTCCTTATTGCCAGTTCGCTCCAGGTTTCCCGGGAGCTC。
Embodiment five: the dna probe that present embodiment detects the potato viroid is the binary probe, the Dig-dUTP that " T " of 20%～35% in the probe sequence is labeled replaces at random, and have with embodiment four in the 1. identical potato viroid dna probe function of sequence.
Embodiment six: the dna probe that present embodiment detects the potato viroid is the binary probe, and 50 are replaced at random with interior base in the probe sequence, and have with embodiment four in the 1. identical potato viroid dna probe function of sequence.
Embodiment seven: the dna probe sequence preparation method 1. that present embodiment detects the potato viroid prepares by the following method: one, the total nucleic acid of extracting with the PSTVd positive is a template, with 5 '-GGATCCCTGAAGCGCTCCTCCGAGCCG-3 ' is forward primer, with 5 '-GAGCTCCCGGGAAACCTGGAGCGAACTGG-3 ' is that reverse primer carries out the RT-PCR amplification; Two, be connected in the pGM-T carrier after the amplified production recovery with step 1, utilize BamHI/Sac I double digestion to identify the insertion situation then, positive recombinant vectors called after pGM-T-PSTVd-M
1Three, with 5 '-TCTAGATCCCTGAAGCGCTCCTCCGAGCCG-3 ' is forward primer, with 5 '-GGATCCCCCGGGAAACCTGGAGCGAAC-3 ' is that reverse primer carries out the RT-PCR amplification, product is connected in the pGM-T carrier after reclaiming, carry out the XbaI/BamHI double digestion and identify, positive colony and called after pGM-T-PSTVd-M that screening is oppositely inserted
2Four, with BamHI/SacI double digestion pGM-T-PSTVd-M
2Recombinant plasmid is connected to special endonuclease bamhi the pGM-T-PSTVd-M of BamHI/Sac I double digestion
1On the carrier, make up PSTVd binary carrier; Five, by XbaI/Sac I double digestion evaluation and screening PSTVd binary carrier, positive recombinant vectors called after pGM-T-PSTVd-M
dSix, according to the pGM-T-PSTVd-M that inserts the viroid binary
dThe sequences Design forward primer 5 of carrier both sides '-GCCGCGGGAATTCGAT-3 ' and reverse primer 5 '-TCCAACGCGTTGGGAGC-3 ', utilize Dig-dUTP to be marker, carry out pcr amplification; Promptly obtain detecting the binary probe of potato viroid.Other is identical with embodiment two.
Embodiment eight: the difference of present embodiment and embodiment seven is: the PCR reaction system of 20 μ L in the step 1 is by 5 * RT-PCR Buffer of 5 μ L, the MgCl of 1 μ L
2, 1 μ L reverse primer, the RNA inhibitor of 0.1 μ L, the RNA masterplate of 2 μ L, the Taq enzyme of 1 μ L and the double distilled water of surplus of forward primer, 0.75 μ L of dUTP, 0.75 μ L form; Amplification reaction condition is 50 ℃ of 30min of reverse transcription, pre-95 ℃ of 15min of sex change, and 72 ℃ of 10min are extended in 94 ℃ of 1min of sex change, 55 ℃ of 1min of annealing, 72 ℃ of 1min totally 30 circulations of extension.Other step and parameter are identical with embodiment seven.
Embodiment nine: the difference of present embodiment and embodiment seven is: 20 μ L identification systems in the step 2 are by the N that contains of 10 * Buffer k, the 2 μ L of 1 μ L, and the two silica-based ethanamide mass concentrations of front three of O-are Sac I, the vector plasmid (pGM-T-PSTVd-M of 15 μ L of BamH I, the 0.5 μ L of 0.1% solution, 0.7 μ L
1) and the double distilled water of surplus form; The identification reaction condition is 37 ℃ of 12h, adopts 1% agarose electrophoresis to identify.Other step and parameter are identical with embodiment seven.
Clip size after identifying in the present embodiment is 364nt.
Embodiment ten: the difference of present embodiment and embodiment seven is: the PCR reaction system of 20 μ L in the step 3 is by 5 * RT-PCR Buffer of 5 μ L, the MgCl of 1 μ L
2, the Taq enzyme of 5 * solution (Q), 1 μ L of RNA masterplate, 5 μ L of RNA inhibitor, 2 μ L of reverse primer, 0.1 μ L of forward primer, 0.75 μ L of dUTP, 0.75 μ L of 1 μ L and the double distilled water of surplus form; Amplification reaction condition is 50 ℃ of 30min of reverse transcription, pre-95 ℃ of 15min of sex change, and 72 ℃ of 10min are extended in 94 ℃ of 1min of sex change, 55 ℃ of 1min of annealing, 72 ℃ of 1min totally 30 circulations of extension.Other step and parameter are identical with embodiment seven.
Embodiment 11: the difference of present embodiment and embodiment seven is: 20 μ L identification systems are by the BamH I of Xba I, the 1 μ L of 10 * Buffer k, the 1 μ L of 1 μ L, the vector plasmid (pGM-T-PSTVd-M of 5 μ L in the step 3
2) and the double distilled water of surplus form; The identification reaction condition is 37 ℃ of 12h, adopts 1% agarose electrophoresis to identify.Other step and parameter are identical with embodiment seven.
Clip size after identifying in the present embodiment is 408bp.
Embodiment 13: the difference of present embodiment and embodiment seven is: the aseptic deionized water of the special endonuclease bamhi of the T4 ligase enzyme of 10 * T4 ligase enzyme Buffer, the 1 μ L of pGM-T vector, the 1 μ L of 10 μ L linked systems, 1 μ L, 1 μ L and surplus is formed in the step 4; The ligation condition is under 16 ℃ of conditions, reaction 12h.Other step and parameter are identical with embodiment seven.
Embodiment 14: the difference of present embodiment and embodiment seven is: 20 μ L identification systems are by the Sac I of Xba I, the 1 μ L of 10 * Buffer k, the 1 μ L of 2 μ L, the vector plasmid (pGM-T-PSTVd-M of 5 μ L in the step 5
d) and the double distilled water of surplus form; The identification reaction condition is 37 ℃ of 12h, adopts 1% agarose electrophoresis to identify.Other step and parameter are identical with embodiment seven.
Clip size after identifying in the present embodiment is 726bp.
Embodiment 15: the difference of present embodiment and embodiment seven is: the PCR reaction system of 20 μ L in the step 6 is by 10 * PCR BF of 2 μ L, the MgCl of 1 μ L
2, 1 μ L the forward primer, the reverse primer of 0.5 μ L, the pGM-T-PSTVd-M of 1 μ L of DIG-dUTP, 0.5 μ L
d, the Taq enzyme of 0.5 μ L and surplus double distilled water form; Amplification reaction condition is 94 ℃ of 2min of pre-sex change, and 72 ℃ of 10min are extended in 94 ℃ of 30s of sex change, 57 ℃ of 30s of annealing, 72 ℃ of 30s of extension, totally 30 circulations.Other step and parameter are identical with embodiment seven.
Embodiment 16: the sequence that present embodiment detects the binary probe of potato viroid is:
TCTAGATCCCTGAAGCGCTCCTCCGAGCCGCCTTCTTTTTTCTTTTCTGCT
CAGGAGGTCAGGTGTGAACCACAGGAACCACGAGTTTAGTTCCGAGGA
ACCAACTGCGGTTCCAAGGGCTAAACACCCTCGCCCCGAAGCAAAGAA
AGATAGAGAAAAAGCGGTTCTCGGGAGCTTCAGTTGTTTCTACCGGGTA
GTAGCCGAAGCGACAGCGCAAAGGGGGCGAGGGGTGGTCCTGCGGGCG
CGAGGAAGGACACCCGAAGAAAGGAAGGGTGAAAACCCTGTTTCGGCG
GGAATTACTCCTGTCGGCCGCTGGGCGCTCCCCACCGTCCTTATTGCCAG
TTCGCTCCAGGTTTCCCGGGGGATCCCTGAAGCGCTCCTCCGAGCCGCC
TTCTTTTTTCTTTTCTGCTCAGGAGGTCAGGTGTGAACCACAGGAACCAC
GAGTTTAGTTCCGAGGAACCAACTGCGGTTCCAAGGGCTAAACACCCTC
GCCCCGAAGCAAAGAAAGATAGAGAAAAAGCGGTTCTCGGGAGCTTCA
GTTGTTTCTACCGGGTAGTAGCCGAAGCGACAGCGCAAAGGGGGCGAG
GTGTGGTCCTGCGGGCGCGAGGAAAGACACCCGAAGAAAGGAAGGGT
GAAAACCCTGTTTCGGCGGGAATTACTCCTGTCGGCCGCTGGGCGCTCC
CCACCGTCCTTATTGCCAGTTCGCTCCAGGTTTCCCGGGAGCTC。
Binary probe with present embodiment preparation detects the potato viroid, detects and carries out according to following steps: (1) nylon membrane is handled: A, draw 1.2cm * 1.2cm grid with pencil on nylon membrane; B, soaked 5 minutes, soak the 30min desciccator diaphragm with solution I with sterilized water; C, probe sex change: probe is at 99 ℃, sex change 5-10 minute, is placed in the ice 10 minutes immediately; D, sample sex change: sample is at 99 ℃, sex change 5～10 minutes; E, point sample, fixing: in the nylon membrane grid, the nylon membrane behind the point sample was placed on the UV-crosslinked instrument pros and cons each crosslinked 1 minute with 3～4 μ L sample spot, and energy is 1200; (2) prehybridization: A, the nylon membrane after will fixing are placed in the hybridization bag of three side sealing mouth; B, add 68 ℃ solution VI5mL, get rid of bubble, seal, be placed on 68 ℃ of water-baths concussion hybridization 1.5 hours; (3) hybridization: hybridization bag is taken out from water-bath, cut off one jiao of solution VI that removes side by side in the hybridization bag, get solution VI5mL and add sex change probe (1-3 μ l/ film), mixing adds in the hybridization bag, seals.Being placed on 68 ℃ of water-bath concussion hybridization spends the night; (4) wash film: A, cut off hybridization bag, take out nylon membrane, put into the plate that solution VII is housed, concussion washing at room temperature 2 times, each 5 minutes; B, nylon membrane relayed among 50 ℃ the solution VIII 55 ℃ of water-baths concussion washings 2 times, each 15 minutes; C, nylon membrane transferred in the plate that 20mL solution I X is housed the concussion washing 5 minutes; (5) signal detection, all are hatched process and all carry out under 15～25 ℃ of stirrings: A, soaked in solution I X 5 minutes; B, in 20～30mL solution X I, hatched 30 minutes; C, in 10mL solution X II, hatched 30 minutes; D, in 20～30mL solution I X the washing 2 times, each 15 minutes; E, in 15mL solution X III balance 2～5 minutes; F, nylon membrane is clipped in the middle of the two-layer preservative film, the upper strata preservative film is mentioned, add the solution X IV0.5-1mL of new configuration along one side of nylon membrane, slowly put down preservative film then, make the even mulch film of solution X IV surface.In room temperature static 5 minutes; G, preservative film is mentioned gently with tweezers, allow excessive solution X IV flow out, and blot the outer solution X IV of film with filter paper, in the darkroom, carry out exposure, development, photographic fixing and amount to 15～30 minutes (designed solution I, solution VI, solution VII, solution VIII, solution I X, solution X I, solution X II, solution X III and solution X IV solution composition detects even tell test kit with embodiment one with corresponding solution composition in the embodiment one in the above testing process) with X-ray sheet compressing tablet.
Photographic fixing as shown in Figure 1, as can be seen from Figure 1 the detection probes of present embodiment is highly sensitive,
Find out from the contrast of Fig. 1 and Fig. 2 (monomer probe in detecting) and Fig. 1 and Fig. 3 (fragment probe in detecting),
The sensitivity of the binary probe of present embodiment is apparently higher than prior art.
Sequence table
＜110〉Plant De-toxin Nursery Stock Inst., Heilongjiang Prov. Academy of Agriculture Sc
＜120〉detect test kit of potato viroid and dna probe and the probe sequence preparation side 1. of detection potato viroid
Method
<160>7
<210>1
<211>28
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to forward primer with the design of PSTVd viroid positive gene.
<400>1
ggatccctga?agcgctcct?ccgagccg?28
<210>2
<211>29
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to reverse primer with the design of PSTVd viroid positive gene.
<400>2
gagctcccgg?gaaacctgga?gcgaactgg?29
<210>3
<211>30
<212>DNA
＜213〉artificial sequence
<220>
＜223〉extract the used forward primer of positive potato sample total nucleic acid that contains PSTVd.
<400>3
tctagatccc?tgaagcgctc?ctccgagccg?30
<210>4
<211>27
<212>DNA
＜213〉artificial sequence
<220>
＜223〉extract the used reverse primer of positive potato sample total nucleic acid that contains PSTVd.
<400>4
ggatcccccg?ggaaacctgg?agcgaac?27
<210>5
<211>16
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the pGM-T-PSTVd-M that inserts the viroid binary
dThe sequences Design forward primer of carrier both sides.
<400>5
gccgcgggaa?ttcgat?16
<210>6
<211>17
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the pGM-T-PSTVd-M that inserts the viroid binary
dThe sequences Design reverse primer of carrier both sides.
<400>6
tccaacgcgt?tgggagc?17
<210>7
<211>726
<212>DNA
＜213〉artificial sequence
<220>
＜223〉dna probe sequence that is used to detect the potato viroid 1..
<400>7
tctagatccc?tgaagcgctc?ctccgagccg?ccttcttttt?tcttttctgc?tcaggaggtc?60
aggtgtgaac?cacaggaacc?acgagtttag?ttccgaggaa?ccaactgcgg?ttccaagggc?120
taaacaccct?cgccccgaag?caaagaaaga?tagagaaaaa?gcggttctcg?ggagcttcag?180
ttgtttctac?cgggtagtag?ccgaagcgac?agcgcaaagg?gggcgagggg?tggtcctgcg?240
ggcgcgagga?aggacacccg?aagaaaggaa?gggtgaaaac?cctgtttcgg?cgggaattac?300
tcctgtcggc?cgctgggcgc?tccccaccgt?ccttattgcc?agttcgctcc?aggtttcccg?360
ggggatccct?gaagcgctcc?tccgagccgc?cttctttttt?cttttctgct?caggaggtca?420
ggtgtgaacc?acaggaacca?cgagtttagt?tccgaggaac?caactgcggt?tccaagggct?480
aaacaccctc?gccccgaagc?aaagaaagat?agagaaaaag?cggttctcgg?gagcttcagt?540
tgtttctacc?gggtagtagc?cgaagcgaca?gcgcaaaggg?ggcgaggtgt?ggtcctgcgg?600
gcgcgaggaa?agacacccga?agaaaggaag?ggtgaaaacc?ctgtttcggc?gggaattact?660
cctgtcggcc?gctgggcgct?ccccaccgtc?cttattgcca?gttcgctcca?ggtttcccgg?720
gagctc?726
Claims (10)
1. test kit that detects the potato viroid is characterized in that the test kit that detects the potato viroid is made up of 1 part solution I, 1 part solution VI, 1 part solution VII, 1 part solution VIII, 1 part solution I X, 1 part solution XI, 1 part solution XII, 1 part solution XIII and 1 part solution X IV according to volume parts; Wherein solution I is made by sodium-chlor and trisodium citrate mixing solutions, and the concentration of sodium-chlor is that the concentration of 3mol/L, trisodium citrate is 0.3mol/L in the solution I, and its pH value is 7.0; The concentration of salmon sperm dna is 10mg/mL among the solution VI; Solution VII is that solution V and solution IV are formed according to 101: 1 mixed of volume ratio; The solution V of every 10mL is that the NaCl concentration of the solution III of solution II, 0.5mL of 20% sodium dodecyl sulfate solution, 0.5mL and surplus is that the aqueous solution of 5mol/L is formed by methane amide, the 3.5mL mass concentration of 5mL; Na in the solution II
2HPO
4Concentration be 0.684mol/L, NaH
2PO
4Concentration be 0.316mol/L; The mass concentration of ficoll in the solution III-400 is 2%, and the mass concentration of polyvinylpyrrolidone-360 is 2%, N, and the mass concentration of the two silica-based ethanamides of front three of O-is 2%; The solution VII of every 40mL is the solution I by 4mL, and the mass concentration of 0.4mL is that the water of 10% sodium dodecyl sulfate solution and surplus is formed; The solution VIII of every 40mL is by the solution I of 0.2mL, and the mass concentration of 0.4mL is that the water of 10% sodium dodecyl sulfate solution and surplus is formed; The concentration of maleic acid is that the concentration of 0.1mol/L, NaCl is 0.15mol/L among the solution I X, and the pH value is 7.5; Form by 2% skimmed milk, 2% Triton X-100 and 96% solution X according to percent by volume among the solution X I; The solution X of every 100mL is the solution 1mL of 10mmol/L by Tris-HCl concentration, and NaCl concentration is the solution 3mL of 150mmol/L, and the TWeen-20 of 50 μ L and the water of surplus are formed; Solution X II is that the ammoniumper chlorate with digoxigenin labeled with 0.5 μ L is dissolved among the 10mL solution X I formulated; The concentration of Tris-HCl is 0.1mol/L among the solution XIII, and the concentration of NaCl is 0.1mol/L, and the pH value is 9.5; Solution X IV is that 10 μ L CDP-Star are dissolved in the solution XIII of 1mL is formulated.
2. dna probe that detects the potato viroid, the dna probe that it is characterized in that detecting the potato viroid is the binary probe; The binary probe has one of following sequence:
①、TCTAGATCCCTGAAGCGCTCCTCCGAGCCGCCTTCTTTTTTCTTTTCT
GCTCAGGAGGTCAGGTGTGAACCACAGGAACCACGAGTTTAGTTCCGA
GGAACCAACTGCGGTTCCAAGGGCTAAACACCCTCGCCCCGAAGCAAA
GAAAGATAGAGAAAAAGCGGTTCTCGGGAGCTTCAGTTGTTTCTACCGG
GTAGTAGCCGAAGCGACAGCGCAAAGGGGGCGAGGGGTGGTCCTGCGG
GCGCGAGGAAGGACACCCGAAGAAAGGAAGGGTGAAAACCCTGTTTCG
GCGGGAATTACTCCTGTCGGCCGCTGGGCGCTCCCCACCGTCCTTATTGC
CAGTTCGCTCCAGGTTTCCCGGGGGATCCCTGAAGCGCTCCTCCGAGCC
GCCTTCTTTTTTCTTTTCTGCTCAGGAGGTCAGGTGTGAACCACAGGAAC
CACGAGTTTAGTTCCGAGGAACCAACTGCGGTTCCAAGGGCTAAACACC
CTCGCCCCGAAGCAAAGAAAGATAGAGAAAAAGCGGTTCTCGGGAGCT
TCAGTTGTTTCTACCGGGTAGTAGCCGAAGCGACAGCGCAAAGGGGGCG
AGGTGTGGTCCTGCGGGCGCGAGGAAAGACACCCGAAGAAAGGAAGG
GTGAAAACCCTGTTTCGGCGGGAATTACTCCTGTCGGCCGCTGGGCGCT
CCCCACCGTCCTTATTGCCAGTTCGCTCCAGGTTTCCCGGGAGCTC；
2., " T " of sequence 20%～35% in 1. Dig-dUTP of being labeled replaces at random, and has the potato viroid dna probe function 1. identical with sequence;
3., sequence 1. in 50 replaced at random with interior base, and have the potato viroid dna probe function 1. identical with sequence.
3. the dna probe sequence preparation method 1. of the described detection of claim 2 potato viroid, it is characterized in that 1. the dna probe sequence that detects the potato viroid prepares by the following method: one, the total nucleic acid of extracting with the PSTVd positive is a template, with 5 '-GGATCCCTGAAGCGCTCCTCCGAGCCG-3 ' is forward primer, with 5 '-GAGCTCCCGGGAAACCTGGAGCGAACTGG-3 ' is that reverse primer carries out the RT-PCR amplification; Two, be connected in the pGM-T carrier after the amplified production recovery with step 1, utilize BamHI/Sac I double digestion to identify the insertion situation then, positive recombinant vectors called after pGM-T-PSTVd-M
1Three, the total nucleic acid of extracting with the positive potato sample that contains PSTVd, to extract product is template, with 5 '-TCTAGATCCCTGAAGCGCTCCTCCGAGCCG-3 ' is forward primer, with 5 '-GGATCCCCCGGGAAACCTGGAGCGAAC-3 ' is that reverse primer carries out the RT-PCR amplification, product is connected in the pGM-T carrier after reclaiming, carry out the XbaI/BamHI double digestion and identify, positive colony and called after pGM-T-PSTVd-M that screening is oppositely inserted
2Four, with BamHI/SacI double digestion pGM-T-PSTVd-M
2Recombinant plasmid is connected to special endonuclease bamhi the pGM-T-PSTVd-M of BamHI/Sac I double digestion
1On the carrier, make up PSTVd binary carrier; Five, by XbaI/Sac I double digestion evaluation and screening PSTVd binary carrier, positive recombinant vectors called after pGM-T-PSTVd-M
dSix, according to the pGM-T-PSTVd-M that inserts the viroid binary
dThe sequences Design forward primer 5 of carrier both sides '-GCCGCGGGAATTCGAT-3 ' and reverse primer 5 '-TCCAACGCGTTGGGAGC-3 ', utilize Dig-dUTP to be marker, carry out pcr amplification; Promptly obtain detecting the binary probe of potato viroid.
4. the dna probe sequence preparation method 1. of detection potato viroid according to claim 3, the PCR reaction system that it is characterized in that 20 μ L in the step 1 is by 5 * RT-PCRBuffer of 5 μ L, the MgCl of 1 μ L
2, 1 μ L reverse primer, the RNA inhibitor of 0.1 μ L, the RNA masterplate of 2 μ L, the Taq enzyme of 1 μ L and the double distilled water of surplus of forward primer, 0.75 μ L of dUTP, 0.75 μ L form; Amplification reaction condition is 50 ℃ of 30min of reverse transcription, pre-95 ℃ of 15min of sex change, and 72 ℃ of 10min are extended in 94 ℃ of 1min of sex change, 55 ℃ of 1min of annealing, 72 ℃ of 1min totally 30 circulations of extension.
5. the dna probe sequence preparation method 1. of detection potato viroid according to claim 3, it is characterized in that 20 μ L identification systems in the step 2 by the N that contains of 10 * Buffer k, the 2 μ L of 1 μ L, the two silica-based ethanamide mass concentrations of front three of O-are Sac I, the pGM-T-PSTVd-M of 15 μ L of BamH I, the 0.5 μ L of 0.1% solution, 0.7 μ L
1And the double distilled water of surplus is formed; The identification reaction condition is 37 ℃ of 12h, adopts 1% agarose electrophoresis to identify.
6. the dna probe sequence preparation method 1. of detection potato viroid according to claim 3, the PCR reaction system that it is characterized in that 20 μ L in the step 3 is by 5 * RT-PCRBuffer of 5 μ L, the MgCl of 1 μ L
2, 1 μ L reverse primer, the RNA inhibitor of 0.1 μ L, the RNA masterplate of 2 μ L, the Taq enzyme of 1 μ L and the double distilled water of surplus of forward primer, 0.75 μ L of dUTP, 0.75 μ L form; Amplification reaction condition is 50 ℃ of 30min of reverse transcription, pre-95 ℃ of 15min of sex change, and 72 ℃ of 10min are extended in 94 ℃ of 1min of sex change, 55 ℃ of 1min of annealing, 72 ℃ of 1min totally 30 circulations of extension.
7. the dna probe sequence preparation method 1. of detection potato viroid according to claim 3 is characterized in that 20 μ L identification systems are by BamH I, the pGM-T-PSTVd-M of 5 μ L of Xba I, the 1 μ L of 10 * Buffer k, the 1 μ L of 1 μ L in the step 3
2And the double distilled water of surplus is formed; The identification reaction condition is 37 ℃ of 12h, adopts 1% agarose electrophoresis to identify.
8. the dna probe sequence preparation method 1. of detection potato viroid according to claim 3 is characterized in that the 10 * T4 ligase enzyme damping fluid of pGM-T vector, the 1 μ L of 10 μ L linked systems, 1 μ L in the step 4, the T4 ligase enzyme of 1 μ L, the special endonuclease bamhi of 1 μ L and the aseptic deionized water composition of surplus; The ligation condition is 16 ℃ of 12h.
9. the dna probe sequence preparation method 1. of detection potato viroid according to claim 3,, it is characterized in that 20 μ L identification systems are by Sac I, the pGM-T-PSTVd-M of 5 μ L of XbaI, the 1 μ L of 10 * Buffer k, the 1 μ L of 2 μ L in the step 5
dAnd the double distilled water of surplus is formed; The identification reaction condition is 37 ℃ of 12h, adopts 1% agarose electrophoresis to identify.
10. the dna probe sequence preparation method 1. of detection potato viroid according to claim 3, the PCR reaction system that it is characterized in that 20 μ L in the step 6 is by 10 * PCR BF of 2 μ L, the MgCl of 1 μ L
2, 1 μ L the forward primer, the reverse primer of 0.5 μ L, the pGM-T-PSTVd-M of 1 μ L of DIG-dUTP, 0.5 μ L
d, the Taq enzyme of 0.5 μ L and surplus double distilled water form; Amplification reaction condition is 94 ℃ of 2min of pre-sex change, and 72 ℃ of 10min are extended in 94 ℃ of 30s of sex change, 57 ℃ of 30s of annealing, 72 ℃ of 30s of extension, totally 30 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910073290A CN101717831A (en) | 2009-11-27 | 2009-11-27 | Kit and DNA probe for detecting potato virus and preparation method of probe sequence (1) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910073290A CN101717831A (en) | 2009-11-27 | 2009-11-27 | Kit and DNA probe for detecting potato virus and preparation method of probe sequence (1) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101717831A true CN101717831A (en) | 2010-06-02 |
Family
ID=42432470
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910073290A Pending CN101717831A (en) | 2009-11-27 | 2009-11-27 | Kit and DNA probe for detecting potato virus and preparation method of probe sequence (1) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101717831A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102226195A (en) * | 2011-05-12 | 2011-10-26 | 湖南农业大学 | Method for cloning viroid complete-genome sequence |
| CN114032338A (en) * | 2021-12-20 | 2022-02-11 | 黑龙江省农业科学院经济作物研究所 | Probe for detecting PSTVd by nucleic acid dot hybridization method, preparation method thereof, kit and detection method |
-
2009
- 2009-11-27 CN CN200910073290A patent/CN101717831A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102226195A (en) * | 2011-05-12 | 2011-10-26 | 湖南农业大学 | Method for cloning viroid complete-genome sequence |
| CN114032338A (en) * | 2021-12-20 | 2022-02-11 | 黑龙江省农业科学院经济作物研究所 | Probe for detecting PSTVd by nucleic acid dot hybridization method, preparation method thereof, kit and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108456747A (en) | A kind of multiple PCR detection kit differentiating pig circular ring virus | |
| CN103215379B (en) | Diarrhea virus detection kit and method | |
| CN110241240A (en) | Detection primer, kit and the quantitative approach of cable bacterium Candidatus Electronema | |
| CN107653348A (en) | For detecting the primer and probe of the type of pig circular ring virus 3, PCR kit for fluorescence quantitative and method, application | |
| CN102220417B (en) | Method for detecting food pathogen by electrochemical luminescence gene sensor on basis of magnetic in-situ amplification | |
| CN101717831A (en) | Kit and DNA probe for detecting potato virus and preparation method of probe sequence (1) | |
| CN105256073A (en) | Type-3 duck hepatitis A virus TaqMan fluorescent quantitation RT-PCR detection reagent kit and method | |
| CN111621592A (en) | Primer composition for detecting novel coronavirus and detection method | |
| CN105624329A (en) | Real-time fluorescence nucleic acid isothermal amplification detection kit for human herpesvirus 1 | |
| CN106222298B (en) | LAMP detection kit, detection method and application of RNA virus | |
| CN102154454A (en) | Method for detecting transgenosis constituents in plant by GeXP multi-PCR (polymerase chain reaction) technology and application thereof | |
| CN103589782B (en) | Kit for detecting genetically modified soybean | |
| CN104593504B (en) | Composite PCR (polymerase chain reaction) amplification fluorescence detection kit for 27 plant transgenic loci | |
| CN106636474B (en) | Six kinds of viral primer sets of Multiple immunizations fluoroscopic examination mouse, kit and method | |
| CN103589781B (en) | Detection kit for genetically modified corn | |
| CN105256072A (en) | Type-1 duck hepatitis A virus TaqMan fluorescent quantitation RT-PCR detection reagent kit and method | |
| CN103698516A (en) | Novel isothermal loop-mediated yersinia pestis nucleic acid mark detection reagent | |
| CN113774162A (en) | Novel coronavirus isothermal amplification primer, detection method and application | |
| CN108660256B (en) | Joint gene detection kit and detection method for potato yellow dwarf virus | |
| CN103397108A (en) | HCLV (hog cholera lapinized virus) fluorescent quantitation RT-PCR (reverse transcription-polymerase chain reaction) detection kit | |
| CN103215389B (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| CN103215386B (en) | Isothermal amplification method for enterovirus EV nucleic acid | |
| CN109735658A (en) | A kind of fluorescence quantitative RT-PCR detecting method of newcastle disease virus | |
| CN102230022A (en) | RT-LMAP (reverse transcription loop-mediated isothermal amplification) agent for detecting Arabis mosaic virus as well as preparation method and application thereof | |
| CN107974516A (en) | For detecting primer and probe, the PCR kit for fluorescence quantitative and methods and applications of porcine circovirus 2 type |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20100602 |