CN101717824A - Fluorescent biosensing method for inhibiting and analyzing and detecting interaction between micromolecules and binding protein based on restrictive incision enzyme FokI - Google Patents
Fluorescent biosensing method for inhibiting and analyzing and detecting interaction between micromolecules and binding protein based on restrictive incision enzyme FokI Download PDFInfo
- Publication number
- CN101717824A CN101717824A CN200910227024A CN200910227024A CN101717824A CN 101717824 A CN101717824 A CN 101717824A CN 200910227024 A CN200910227024 A CN 200910227024A CN 200910227024 A CN200910227024 A CN 200910227024A CN 101717824 A CN101717824 A CN 101717824A
- Authority
- CN
- China
- Prior art keywords
- restriction enzyme
- enzyme foki
- foki
- micromolecules
- binding protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
The invention relates to a fluorescent biosensing method for inhibiting and analyzing and detecting interaction between micromolecules and binding protein based on restrictive incision enzyme FokI, which comprises an interaction between an oligonucleotides DNA chain which is modified by organic micromolecules and a protein, formation conditions for the restrictive incision enzyme FokI dipolymer and selection of inhibition locus, and real-time fluorescence quantitative detecting technology based on a Taqman probe. By utilizing specificity combination of the micromolecules modifying among the oligonucleotides DNA chain and the binding protein thereof or antibodies, the interaction between the micromolecules and the protein and the micromolecules or the binding protein thereof can be detected through a real-time quantitative analysis on enzyme incision Taqman probe fluorescence based on the inhibition effect on the incision of the restrictive incision enzyme FokI by the interaction between the micromolecules and the proteins or the antibodies. The method has the advantages of high sensitivity, simple and convenient operation, and high specificity, and can be used for study on signal transduction and molecular regulation mechanism in biomedicine, safety detection of foods and agricultural products, detection on environmental toxicant, medicine screening and the like.
Description
Technical field
Invention belongs to a kind of biosensor technique that detects organic molecule and binding protein interactions, it specifically is meant, restriction enzyme FokI dimer formation condition and the selection that suppresses the site, middle organic micromolecular oligonucleotide DNA chain of modification and proteic interaction, restriction enzyme FokI inhibition analysis and based on the real time fluorescent quantitative detection method of Taqman probe.
Background technology
Organic molecule such as organic molecule and binding protein interactions, medicine and chemical toxicant and the protein-bonded rapid screening of small molecules are extremely important for fields such as clinical diagnosis, medical research, food and public safety, drug screening, environmental monitorings with detecting.The organic molecule commonly used at present and the detection technique of binding protein interactions mainly contain surface plasma resonance, the complementary segment immunoassay of enzyme and fluorescence anisotropy analysis etc.Not high, the poor reliability of these detection technique sensitivity, and need accurate instrument, can not satisfy the demand of accurate rapid detection.
Summary of the invention
The technical problem to be solved in the present invention is, deficiency at the prior art existence, a kind of bio-sensing method that detects small molecules and binding protein interactions based on restriction enzyme FokI inhibition analysis has been proposed, this method simplicity of design, the oligonucleotide DNA chain and the Taqman probe that only need design a pair of complementation and include restriction enzyme FokI recognition site get final product, suppressing the site therebetween carries out can realizing detecting behind the small molecules mark, this method can realize that multiple goal detects simultaneously, and easy and simple to handle, quick, sensitive.
Technical scheme of the present invention is, described bio-sensing method based on restriction enzyme FokI inhibition analysis detection small molecules and binding protein interactions is: after modifying organic micromolecular oligonucleotide DNA two strands and protein-interacting in the middle of utilization includes restriction enzyme FokI is suppressed, by the fluorescence real-time change of Taqman probe, it is conjugated protein that quantitative analysis detects small molecules and proteic interaction and small molecules or its.
Below the invention will be further described
Described biological method for sensing based on restriction enzyme FokI inhibition analysis detection small molecules and binding protein interactions comprises:
(1) comprises oligonucleotide DNA double-stranded and proteic interaction and the restriction enzyme FokI inhibition analysis that middle organic molecule is modified;
(2) form restriction enzyme FokI dimer, select to suppress the site;
(3) adopt the detection by quantitative of carrying out restriction enzyme FokI inhibition analysis based on the real time fluorescent quantitative method of Taqman probe.
Below the present invention made further specify.
Double-stranded detection and the restriction enzyme FokI inhibition analysis with protein-interacting of the oligonucleotide DNA that organic molecule is modified in the middle of described comprising adopts following steps to realize:
For small molecules interaction protein-bonded with it, the detection step is: get the oligonucleotide DNA strand that contains restriction enzyme FokI of described organic molecule modification and the hybridization solution of its complementary strand and place micro tube; In micro tube, add again and comprise the protein-bonded sample solution of small molecules; Add restriction enzyme FokI reaction then, get the product of inhibited reaction;
For the detection of organic molecule, the step that adopts competing reaction to detect is: get the oligonucleotide DNA strand that contains restriction enzyme FokI of described organic molecule modification and the hybridization solution of its complementary strand and place micro tube; Add again and comprise micromolecular sample solution to be measured, mix the back and add the conjugated protein or monoclonal anti liquid solution of small molecules; Add restriction enzyme FokI reaction again, get the product of inhibited reaction.
Restriction enzyme FokI dimer suppresses any one in site selection FokI 5 bases in recognition site upstream and 3 bases in downstream.
The detection by quantitative that described restriction enzyme suppresses can adopt the Taqman fluorescence probe real-time quantitative of standard to detect.
Among the present invention, the modification of the middle organic molecule of described oligonucleotide DNA strand realizes by existing crosslinking reaction technology.For example, for the organic molecule that has carboxyl, can adopt 1-ethyl-3-(3-dimethyl aminopropyl)-carbodiimide and succinimide crosslinking reaction technology and middle base NH
2The oligonucleotide DNA strand that comprises restriction enzyme FokI recognition site of mark carries out crosslinked; For the amino organic molecule of band, can adopt 4-(N-maleimide ylmethyl) hexanaphthene-crosslinking reaction technology of 1-carboxylic acid succinimide ester and the oligonucleotide DNA strand that central marker has sulfydryl to carry out crosslinked.The crosslinking reaction product can be used the dialysis purifying.
Further, among the present invention, oligonucleotide DNA chain that described middle organic molecule is modified and proteic interactional detection and restriction enzyme FokI inhibition analysis adopt following steps to realize:
A. the step for small molecules protein-bonded interactional detection with it is: the hybridization solution of getting the above-mentioned small numerator modified oligonucleotide DNA chain of 5 μ l and its complementary strand places micro tube, add 3 μ l, 10 * restriction enzyme FokI reaction buffered soln (50mM Tris-HCl, 100mM NaCl, 10mM MgCl, 1mM DTT, pH 7.9@25 ℃), add 8 μ l then and comprise the protein-bonded sample solution of small molecules, 37 ℃ of isothermal reactions 0.5 hour, add 3 μ l restriction enzyme FokI and 6 μ l Taqman probes again, after placing 37 ℃ of reaction 2h, be warming up to 65 ℃ of reaction 20min and carry out hot deactivation to stop enzyme reaction.
B. for the detection of organic molecule, the step that adopts competing reaction to detect is: the hybridization solution of getting the above-mentioned small numerator modified oligonucleotide DNA chain of 5 μ l and its complementary strand places micro tube, 3 μ l, 10 * restriction enzyme FokI reaction buffered soln (50mM Tris-HCl, 100mM NaCl, 10mM MgCl, 1mM DTT, pH 7.9@25 ℃), add 5 μ l then and comprise micromolecular sample solution to be measured, mix the back and add certain density micromolecular conjugated protein or (mouse source) monoclonal anti liquid solution 3 μ l, the monoclonal antibody final concentration is 5 times of the small numerator modified oligonucleotide DNA chain concentration that adds; 37 ℃ of isothermal reactions 0.5 hour, add 3 μ l restriction enzyme FokI and 6 μ l Taqman probes again, place 37 ℃ of reaction 2h after, be warming up to 65 ℃ of reaction 20min and carry out hot deactivation to stop enzyme reaction.
Notice that above reaction conditions is an optimal conditions, described liquor capacity all can change at double and not change optimal result.Change ratio or reagent addition sequence can make digested Taqman probe efficient change in 1%～100%.
Among the present invention, the detection by quantitative that described restriction enzyme FokI suppresses can adopt the Taqman probe of standard, below is with the Taqman probe restriction enzyme to be suppressed the detection by quantitative step:
With 1x restriction enzyme FokI reaction buffered soln (50mM Tris-HCl, 100mM NaCl, 10mM MgCl, 1mM DTT, pH 7.9@25 ℃) will react final product and be diluted to 120 μ l, transfer in the micro-quartz curette, put into fluorescence spectrophotometer, with 495nm is excitation wavelength, and 518nm is an emission wavelength, surveys its fluorescence signal intensity.
The present invention proposes a kind of method based on restriction enzyme FokI inhibition analysis, this method simplicity of design, only need design a pair of complementary strand and the Taqman probe that includes restriction enzyme FokI recognition site and get final product, suppress the site therebetween and carry out the small molecules mark, can realize detecting; It also can be directly used in the protein-bonded detection of small molecules, also can be by the competition of oligonucleotide DNA chain and antibodies indirect detection organic molecule of small molecules in the sample solution and small molecules mark, its operation is fast and convenient, sensitive special, and being expected provides a current techique platform for clinical diagnosis, medicament research and development, medicine toxicological analysis, environmental monitoring etc.
Embodiment:
Embodiment 1: based on restriction enzyme FokI inhibition analysis detection of biological element
1) the oligonucleotide DNA chain of amino labeled and vitamin H (biotin) is crosslinked in the middle of
The vitamin H that takes by weighing 6.1mg is dissolved in 2.5mL phosphate buffer solution (0.1M NaH
2PO4, pH 7.4), add 1-ethyl-3-(3-dimethyl aminopropyl)-carbodiimide (EDC) of 1mg again, at room temperature stir 15min, add 2.8mgN-N-Hydroxysuccinimide (NHS) again, at room temperature reaction 30min.The biotin solution of getting after 260 μ l activate joins in the solution of the oligonucleotide DNA strand that 260 μ l concentration are the middle amino labeled of 10 μ M (GAACAACAACCAACATCCAAACTTCTATATATGGATGAAT (NH2) CAAC) room temperature reaction 2h under gentle agitation.The reaction back adds 3.6mg oxammonium hydrochloride termination reaction in mixed solution.
The crosslinking reaction product is moved on in the dialysis tubing of 1mL, the molecular weight cut-off of dialysis tubing is 6000D.Dialysis tubing is put into 500ml phosphate buffer soln (0.1M NaH
2PO4, pH 7.4) at 4 ℃ of dialysis 12h, change a dialyzate every 3h, dialyse with ultrapure water for the last time.Oligonucleotide DNA strand after the dialysis is in charge of in the refrigerator that is stored in-20 ℃ standby.The oligonucleotide DNA strand of-20 ℃ of above-mentioned preservations is with 10 times of aqua sterilisa dilutions and be stored in 4 ℃ of refrigerators standby as secondary storing solution.
2) detection of vitamin H
The storing solution of getting above-mentioned secondary storing solution of biotin labeled oligonucleotide DNA strand of 5 μ l and 5 μ l complementary strands is in micro tube, 10 * restriction enzyme FokI reaction buffered soln (the 50mM Tris-HCl that adds 3 μ l, 100mM NaCl, 10mM MgCl, 1mM DTT, pH 7.9@25 ℃) mix, be warming up to 95 ℃ of reaction 5min, slowly be cooled to 37 ℃ of reaction 1h, add 5 μ l vitamin H sample solution to be detected again, mixing back adding 3 μ l concentration is the Streptavidin (streptavidin) of 640nM, room temperature reaction 15min, reaction back adding 3 μ l restriction enzyme FokI (NEB company product) and 6 μ l Taqman probes are warming up to 65 ℃ of reaction 20min and carry out hot deactivation to stop enzyme reaction after 37 ℃ of enzymes are cut 2h.Add 1x restriction enzyme FokI reaction buffered soln (50mM Tris-HCl, 100mM NaCl, 10mM MgCl, 1mMDTT, pH 7.9@25 ℃) reaction mixture is diluted to 120ul, transfer in the micro-quartz curette, put into fluorescence spectrophotometer, with 495nm is excitation wavelength, and 518nm is an emission wavelength, surveys its fluorescence signal intensity.
Embodiment 2: detect folic acid-binding protein based on the restriction enzyme inhibition analysis
1) the oligonucleotide DNA strand of amino labeled and folic acid is crosslinked in the middle of
The folic acid that takes by weighing 10mg is dissolved in 2.5mL phosphate buffer solution (0.1M NaH
2PO4, pH 7.4), add 1-ethyl-3-(3-dimethyl aminopropyl)-carbodiimide (EDC) of 1mg again, at room temperature stir 15min, add 2.8mg N-hydroxy-succinamide (NHS) again, at room temperature reaction 30mm.The folic acid solution of getting after 260 μ l activate joins in the solution of the oligonucleotide DNA strand that 260 μ l concentration are the middle amino labeled of 10 μ M (GAACAACAACCAACATCCAAACTTCTATATATGGATGAAT (NH2) CAAC) room temperature reaction 2h under gentle agitation.The reaction back adds 3.6mg oxammonium hydrochloride termination reaction in mixed solution.
The crosslinking reaction product is moved on in the dialysis tubing of 1mL, the molecular weight cut-off of dialysis tubing is 6000D.Dialysis tubing is put into 500ml phosphate buffer soln (0.1M NaH
2PO4, pH 7.4) at 4 ℃ of dialysis 12h, change a dialyzate every 3h, dialyse with ultrapure water for the last time.Oligonucleotide DNA strand after the dialysis is in charge of in the refrigerator that is stored in-20 ℃ standby.The oligonucleotide DNA strand of-20 ℃ of above-mentioned preservations is with 10 times of aqua sterilisa dilutions and be stored in 4 ℃ of refrigerators standby as secondary storing solution.More than all reactions all under the condition of shading, carry out.
2) detection of folic acid-binding protein
The storing solution of getting the secondary storing solution of oligonucleotide DNA strand of the above-mentioned folic acid mark of 5 μ l and 5 its complementary strands of μ l is in micro tube, 10 * restriction enzyme FokI reaction the buffered soln that adds 3 μ l mixes, (50mM Tris-HCl, 100mM NaCl, 10mM MgCl, 1mM DTT, pH 7.9@25 ℃), be warming up to 95 ℃ of reaction 5min, slowly be cooled to 37 ℃ of reaction 1h, add 5 μ l folic acid-binding protein sample solution to be detected again, room temperature reaction 15min, reaction back adding 3 μ l restriction enzyme FokI (NEB company product) and 6 μ l Taqman probes are warming up to 65 ℃ of reaction 20min and carry out hot deactivation to stop enzyme reaction after 37 ℃ of enzymes are cut 2h.In this micro tube, add 1x restriction enzyme FokI reaction buffered soln (50mM Tris-HCl, 100mM NaCl, 10mM MgCl, 1mM DTT, pH 7.9@25 ℃) and be diluted to 120ul, mix.Transferring in the micro-quartz curette, put into fluorescence spectrophotometer, is excitation wavelength with 495nm, and 518nm is an emission wavelength, surveys its fluorescence signal intensity.
Claims (3)
1. one kind is detected the biological method for sensing of small molecules and binding protein interactions based on restriction enzyme FokI inhibition analysis, comprising:
(1) comprises oligonucleotide DNA double-stranded and proteic interaction and the restriction enzyme FokI inhibition analysis that middle organic molecule is modified;
(2) form restriction enzyme FokI dimer, select to suppress the site;
(3) adopt the detection by quantitative of carrying out restriction enzyme FokI inhibition analysis based on the real time fluorescent quantitative method of Taqman probe.
2. cut the biological method for sensing that inhibition analysis detects small molecules and its binding protein interactions according to claim 1 is described based on restriction enzyme FokI enzyme, it is characterized in that the oligonucleotide DNA that described middle organic molecule is modified is double-stranded with proteic interactional detection and restriction enzyme FokI inhibition analysis to be:
For small molecules interaction protein-bonded with it, the detection step is: get the oligonucleotide DNA strand that contains restriction enzyme FokI of described organic molecule modification and the hybridization solution of its complementary strand and place micro tube; In micro tube, add again and comprise the protein-bonded sample solution of small molecules; Add restriction enzyme FokI reaction then, get the product of inhibited reaction;
For the detection of organic molecule, adopt competing reaction to detect step: to get the oligonucleotide DNA strand that contains restriction enzyme FokI of described organic molecule modification and the hybridization solution of its complementary strand and place micro tube; Add again and comprise micromolecular sample solution to be measured, mix the back and add the conjugated protein or monoclonal anti liquid solution of small molecules; Add exonuclease I again, get the product of inhibited reaction.
3. cut the biological method for sensing that inhibition analysis detects small molecules and its binding protein interactions according to claim 1 is described based on restriction enzyme FokI enzyme, it is characterized in that restriction enzyme FokI dimer suppresses any one in site selection FokI 5 bases in recognition site upstream and 3 bases in downstream.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910227024XA CN101717824B (en) | 2009-11-25 | 2009-11-25 | Fluorescent biosensing method for inhibiting and analyzing and detecting interaction between micromolecules and binding protein based on restrictive incision enzyme FokI |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910227024XA CN101717824B (en) | 2009-11-25 | 2009-11-25 | Fluorescent biosensing method for inhibiting and analyzing and detecting interaction between micromolecules and binding protein based on restrictive incision enzyme FokI |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101717824A true CN101717824A (en) | 2010-06-02 |
| CN101717824B CN101717824B (en) | 2012-02-15 |
Family
ID=42432463
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910227024XA Expired - Fee Related CN101717824B (en) | 2009-11-25 | 2009-11-25 | Fluorescent biosensing method for inhibiting and analyzing and detecting interaction between micromolecules and binding protein based on restrictive incision enzyme FokI |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101717824B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643921A (en) * | 2012-05-09 | 2012-08-22 | 湖南大学 | Fluorescent biosensing method for analyzing and detecting mutual action of organic micromolecules and combined protein based on T7 exonuclease inhibition |
| CN102830113A (en) * | 2012-06-14 | 2012-12-19 | 青岛科技大学 | Signal amplification technology establishment based on target induced chain release and restriction enzyme digestion circulation and detection of ochracin A |
-
2009
- 2009-11-25 CN CN200910227024XA patent/CN101717824B/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643921A (en) * | 2012-05-09 | 2012-08-22 | 湖南大学 | Fluorescent biosensing method for analyzing and detecting mutual action of organic micromolecules and combined protein based on T7 exonuclease inhibition |
| CN102643921B (en) * | 2012-05-09 | 2014-11-05 | 湖南大学 | Fluorescent biosensing method for analyzing and detecting mutual action of organic micromolecules and combined protein based on T7 exonuclease inhibition |
| CN102830113A (en) * | 2012-06-14 | 2012-12-19 | 青岛科技大学 | Signal amplification technology establishment based on target induced chain release and restriction enzyme digestion circulation and detection of ochracin A |
| CN102830113B (en) * | 2012-06-14 | 2015-06-10 | 青岛科技大学 | Signal amplification technology establishment based on target induced chain release and restriction enzyme digestion circulation and detection of ochracin A |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101717824B (en) | 2012-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sato et al. | Triplex-forming peptide nucleic acid probe having thiazole orange as a base surrogate for fluorescence sensing of double-stranded RNA | |
| Zhu et al. | Building fluorescent DNA nanodevices on target living cell surfaces | |
| US20140248710A1 (en) | Three-component biosensors for detecting macromolecules and other analytes | |
| Bialy et al. | Protein‐mediated suppression of rolling circle amplification for biosensing with an aptamer‐containing DNA primer | |
| Nie et al. | A self-assemble aptamer fragment/target complex based high-throughput colorimetric aptasensor using enzyme linked aptamer assay | |
| Shvadchak et al. | Sensing peptide–oligonucleotide interactions by a two-color fluorescence label: application to the HIV-1 nucleocapsid protein | |
| Long et al. | Fluorescence resonance energy transfer based aptasensor for the sensitive and selective detection of 17β-estradiol using a quantum dot-bioconjugate as a nano-bioprobe | |
| CN104884634A (en) | Detection of non-nucleic acid analytes using strand displacement exchange reactions | |
| CN103630517B (en) | A kind of fibrin ferment detection method based on splitting aptamers and soluble conjugated polymer | |
| Sun et al. | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | |
| Zhu et al. | Label-free fluorescent aptasensing of mycotoxins via aggregation-induced emission dye | |
| Wang et al. | Simultaneously fluorescence detecting thrombin and lysozyme based on magnetic nanoparticle condensation | |
| Zhen et al. | Endonucleolytic inhibition assay of DNA/Fok I transducer as a sensitive platform for homogeneous fluorescence detection of small molecule–protein interactions | |
| Li et al. | Recent advance in the sensing of biomarker transcription factors | |
| Li et al. | Selection of aptamer targeting levamisole and development of a colorimetric and SERS dual-mode aptasensor based on AuNPs/Cu-TCPP (Fe) nanosheets | |
| CN106932564B (en) | It is used to detect kit and its application of nucleic acids in samples target based on FRET | |
| Wen et al. | DNA based click polymerization for ultrasensitive IFN-γ fluorescent detection | |
| Liong et al. | Multiplexed magnetic labeling amplification using oligonucleotide hybridization | |
| Wang et al. | A pH-responsive colorimetric detection of human telomerase RNA based on a three-dimensional DNA amplifier | |
| Rafiee et al. | Detection of HER2+ Breast Cancer Cells using Bioinspired DNA‐Based Signal Amplification | |
| Yoshida et al. | Quantitative and sensitive protein detection strategies based on aptamers | |
| Park et al. | One-pot colorimetric detection of molecules based on proximity proteolysis reaction | |
| CN101717824B (en) | Fluorescent biosensing method for inhibiting and analyzing and detecting interaction between micromolecules and binding protein based on restrictive incision enzyme FokI | |
| Fu et al. | Rapid and wash-free time-gated FRET histamine assays using antibodies and aptamers | |
| Mao et al. | Fluorescence and colorimetric analysis of African swine fever virus based on the RPA-assisted CRISPR/Cas12a strategy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120215 Termination date: 20121125 |