CN101717776B - GhPRP5 gene specifically expressed in cotton fiber and promoter thereof - Google Patents

Abstract

The invention discloses a GhPRP5 gene specifically expressed in cotton fiber. The cDNA of the GhPRP5 gene contains an open reading frame of 546bp and a proline-rich protein for coding 182 amino acids. The molecular weight of the GhPRP5 gene is 20.57KD and the isoelectric point of the GhPRP5 gene is 8.84.The GhPRP5 contains one proline-rich 19-peptide repetitive sequence. The GhPRP5, which is different from the known 'proline repetitive sequences' in five groups of vegetable PRP proteins, is a new PRP protein. The GhPRP5 gene can be expressed at a high level in cells of cotton fiber 5 to 10 days after the blossoming of a cotton plant, so the inhibition of the expression of the GhPRP5 gene leads to the delay in the extension of the fiber. Therefore, the gene is proved to play a significant role in the polar growth of the cotton fiber. A 5'-upstream promoter sequence of the gene is separated by using a genome walking method. The promoter has specific expression activity in epidermal hairs of tobacco and Arabidopsis thaliana leaves, which proves that the promoter has cotton fiber specificity. The separated GhPRP5 gene and the promoter provide genetic elements for the improvement of the quality of the cotton fiber and molecular breeding.

Description

Cotton fibre specific expression gene GhPRP5 and promotor thereof

Technical field

The present invention relates to cotton gene.Specifically be coding proline rich albumen (proline-richprotein) the gene GhPRP5 of a fiber specifically expressing and clone and the expression activity and the Function Identification of promotor thereof.

Background technology

Cotton is the important cash crop of China, and is closely bound up with China 200,000,000 peasants' income and 1,900 ten thousand textile workers' employment.Along with textile industry fast development and living standards of the people improve constantly, textile industry and related industries thereof are more and more high to the requirement of cotton fibre quality.It is the first that China's gined cotton ultimate production the first in the world, SR also occupy the cotton state of five big products, but the Cotton in China fibrous quality is poor, can not be as the raw materials for production of some high added value high quality textile products.Therefore, annual more than 100 ten thousand tons of the import high-quality gined cottons that need of China cause overstocking of homemade raw cotton.The fibrous quality problem has become one of major obstacle of restriction Cotton in China industry Sustainable development.

The ultimate aim of cotton genetic improvement is to improve the yield and quality of cotton fiber.The yield and quality of cotton fibre not only receives Effect of Environmental, and receives the particularly regulation and control of fiber specific expression gene of genes involved.At present, except utilizing the conventional breeding means, also progressively use genetic engineering that cotton fibre quality is carried out genetic improvement both at home and abroad.With excellent agronomic characters, the good character that particularly fibrous quality is relevant is introduced the cotton main breed, not only can improve output of cotton and fibrous quality, reduces production costs, and can alleviate the disadvantageous effect to environment.And this work carry out at first depend on to the identification of cotton fiber development related gene and controlling element thereof with separate.Through key function gene and core controlling elements such as clone fibre strength, fineness and length; Analyze the biological function of mutual work, expression of gene regulation and control and expression product between the fiber development related gene; Illustrate the molecular mechanism that fiber is grown; Disclose the hereditary basis that the cotton fibre quality proterties forms, for efficient fibres modified quality provides theoretical foundation and gene element.In the quality-improving of cotton fibre, specific promoter is first-selected genetically engineered element, its decision genetic expression intensity, time and fiber-specific.In order to make foreign gene in destination organization, be able to give full expression to, different traits needs different promotors.The important goal gene that is used for improveing cotton fibre quality need be at the cotton fibre specifically expressing, thereby must use this expression of gene of fiber-specific promoters driven, reaches the target of fibres modified quality.And, the disadvantageous effect that the tissue specific expression of external source target gene also can avoid foreign gene that non-purpose tissue growth is grown.Use the cotton fibre specific expression promoter; Can be at the specified phase expression alien gene of cotton fiber development; Acceleration is to the improvement of the important indicator of fibrous quality such as intensity, fineness, length etc., can also increase that new quality trait is crease-resistant, nonshrink to fiber, color and luster etc.Existing research proves that clone's cotton fibre specific expression promoter is the prerequisite of genetic engineering approach improvement cotton fibre.Therefore, the clone of high specific, highly active promotor and functional gene and identification research are the important contents of cotton fibre quality improvement and molecular breeding.It is reported that country such as the U.S., Japan, Australia and Israel all has a large amount of cotton fiber development genes and the patent of corresponding promotor.

The protein of proline rich (Proline-Rich Proteins; PRPs) represent one type of proline rich (proline; Pro) and oxyproline (hydroxyproline; Hyp) structural protein, this proteinoid extensively exist in dicotyledons such as soybean, Radix Dauci Sativae and alfalfa and monocotyledons such as plants such as corn and wheat, and are considered to work in the primary wall structure aspects of building around the specific cells type.The characteristics that this proteinoid is the most general are exactly that Pro residue content is high, have at least two successive Pro to be arranged in the amino acid chain.They are considered to extraneous injury inductive gene product at first in Radix Dauci Sativae storage root, they are expressing the different aspect of involved in plant development research demonstration afterwards in a lot of plants.For example, seed germination, beanpod forms, early stage dross etc.The PRP expression of gene also is hurt, fungi, ethene, cell cultures, arid and illumination effect.

Summary of the invention

The object of the present invention is to provide a PRP gene (GhPRP5) and a promotor thereof that new cotton fibre is special; Analyze and disclose gene and promoter expression activity and function; Explore its molecular mechanism to the fiber developmental regulation; And then use this gene element improvement cotton fibre quality, create the cotton improved seeds.

In up-to-date research, the inventor has separated more than 10,000 cotton cDNAs from cotton fibre cDNA library, and through bioinformatic analysis, obtaining more than 100 maybe the proteic gene of encoding cell wall.Utilize the dot blot technology; Preliminary screening goes out the cell wall protein gene of the special or high level expression of 15 fibers from these candidate genes, and further utilizes the express spectra of Northernblotting hybridization technique and these candidate genes of quantitative RT-PCR technology double verification.To one of them cotton fiber specific gene, inventor's called after GhPRP5.GhPRP5cDNA comprises the open reading frame of 546bp, one the 182 amino acid whose protein of encoding, and its molecular weight is 20.57KD, iso-electric point (pI) is 8.84, is rich in Pro (13.2%), Lys (13.7%), Glu (8.8%); BLASTN does not analyze and finds and the higher gene order of its homology, and has only the homology of 3%-15% between other sequences.BLASTP analyzes and shows that its proteic homology of plant PRP with existing report is also lower, shows that this albumen is the protein of a new proline rich.GhPRP5 does not contain the Tumor-necrosis factor glycoproteins of regular proline rich; But 19 peptides (PCYFGGPPPPPYYWPYGRP) that contain a proline rich; It is different that the proline(Pro) that exists in this Tumor-necrosis factor glycoproteins and the existing plant PRP albumen repeats motif (proline-rich repeats), hints that new functional unit contains in these protein.Repeating motif with the proteic proline(Pro) of five big types of PRP of present report has than big-difference, shows that this albumen is a new plant PRP albumen.Utilize the quantitative RT-PCR technology that the express spectra of this gene in the cotton different tissues analyzed, the result shows GhPRP5 gene specifically expressing in cotton fiber cell, in other tissue of cotton, express very faint or almost detect less than.Further research GhPRP5 finds at the expression of cotton fiber development different steps; This gene begins to express at cotton fiber development early stage (blooming back 2 days); In the back 5 days cotton fiber cell of blooming, express the strongest; Expression amount descends to some extent in the back 10 days cotton fibre of blooming, and (blooming back 15-20 days) its expression maintains a lower level in the elongate fiber later stage.Northern hybridization analysis result is consistent with the RT-PCR analytical results.

Be the further tissue specific expression regulation and control of research GhPRP5 gene, the inventor has separated the promotor of this gene.Promotor is separated employing genomic walking test kit (Genome Walker Universal Kit; BD Biosciences Clontech Cat.No.638904), at first sets up cotton gene group walker kit; Then according to GhPRP5 gene order designs C P1 and CP2 primer; This cotton gene group walker kit of pcr amplification separates the 5 '-upstream sequence that has obtained the GhPRP5 gene, and this sequence length is 2217bp.Utilize PlantCARE ( Http:// bioinformatics.psb.ugent.be/webtools/plantcare/html/) find when analyzing the cis-acting elements in the promotor that remove the CAAT box that exists eukaryote typical case promotor to be had, outside the TATA box, this promotor also contains some other cis-acting elements, as the light response element ( AAAACGTTTA, ATTAATTTTACA, ATTAAT, TTTCAAA), dormin (ABA) response element ( CACGTG), element responsive to ethylene ( ATTTCAAA), Whitfield's ointment (salicylic acid) response element ( CCATCTTTTT), the Plant hormones regulators,gibberellins response element ( TCTGTTG), wound reply (wound-responsive) element ( TCATTACGAA), and some other controlling element (for example, Elicitor-responsiveelement AAACCAATT, the anaerobic induction element TGGTTT, MeJA-responsiveness CGTCA-motif, MYB bindingsite involved in drought-inducibility CGGTCA, CAACTG, TAACTG).Because Arabidopis thaliana and tobacco leaf epidermal hair and cotton fibre (kind fur) all have homology in origin, structure and heredity, and some investigators have successfully utilized these two allos systems to detect the activity of cotton fibre specific promoter both at home and abroad.Therefore, the present invention also uses Arabidopis thaliana and tobacco is studied the GhPRP5 promoter activity.We have made up the fusion expression vector of GhPRP5 promotor and gus reporter gene, utilize agriculture bacillus mediated DNA transfer techniques that it is imported Arabidopis thaliana and tobacco, obtain transfer-gen plant.Histochemical stain result to transgenic arabidopsis and tobacco plant shows; GhPRP5 promoters driven gus gene is specifically expressing in Arabidopis thaliana leaf epidermis hair; The intensive expression activity is also arranged in the tobacco leaf epidermal hair; Confirmed that this promotor is that cotton fibre is special, can be used as the gene regulating element of genetically engineered improvement cotton fibre quality.

Use RNA and interfere (RNAi) technology, studied the function of GhPRP5 gene in cotton fiber development and quality trait form.Made up the RNA interference vector of GhPRP5, and converting cotton, 48 strain transgenic cotton plants obtained.PCR detects and shows that foreign DNA has imported the cotton gene group.To GhPRP5 expression of gene analysis revealed in these transfer-gen plants, the expression of GhPRP5 is suppressed.Because this expression of gene amount significantly reduces, the cotton fiber cell elongation of most of transgenic cotton plants is slow, and staple length shortens, and shows that GhPRP5 gene pairs cotton fiber development plays an important role.

Advantage of the present invention:

1, the full length cDNA sequence of a new cotton fibre specifically expressing GhPRP5 gene is provided; Correlated series among the protein sequence of its gene order and translation and the international common material storehouse Genbank is only less than 15% homology, and it contains the Tumor-necrosis factor glycoproteins of new proline rich.

2, the GhPRP5 promoter sequence of a new cotton fibre specifically expressing is provided, analyzed its cis-acting elements that contains and in Arabidopis thaliana and tobacco epidermal hair specifically expressing, for fibrous quality improvement provides special controlling element.

3, this gene is at cotton fibre high level expression elongating stage, if suppress this genetic expression, then cotton fiber development is obstructed, and length shortens, and explains that this gene plays an important role in the cotton fiber development process.

The present invention further sets forth through following accompanying drawing and enforcement, but does not limit the scope of the invention.

Description of drawings:

The dot blot of Fig. 1 cotton candidate cell wall-held protein gene.

Utilizing 10dpa (10days post anthesis, expression was bloomed back 10 days) cotton fibre cDNA is probe, and 186 candidate cell wall-held protein gene dot blot experimental results are shown 15 gene predominant expressions.

The expression of Fig. 2 Northern hybridization analysis GhPRP5

Among the figure: 1-root, 2-cotyledon, 3-leaf, 4-hypocotyl, 5-petal, 6-flower pesticide, 7-5dpa (day post anthesis, the fate of blooming) fiber, 8-10dpa fiber, 9-15dpa fiber, 10-10dpa ovule, 11-15dpa ovule.

Fig. 3 fluorescence quantitative RT-RCR is analyzed the expression of GhPRP5 in a cotton tissue

Among the figure: 1-root, 2-hypocotyl, 3-cotyledon, 4-petal, 5-flower pesticide, 6-fiber, 7-ovule.

Fig. 4 fluorescence quantitative RT-RCR is analyzed GhPRP5 in the expression figure in cotton development stage: 1-2dpa (day post anthesis, the back fate of blooming) fiber; The 2-5dpa fiber; The 3-10dpa fiber; The 4-15dpa fiber; The 5-20dpa fiber.

Fig. 5 tobacco petiole GUS active mass chemical staining is analyzed

The petiole epidermal hair is all dyed blueness, and other histocyte is not colored, and is illustrated in gus gene specifically expressing in the epidermal hair cell under the regulation and control of GhPRP5 promotor, thereby confirms that this promotor is a fiber-specific in cotton.

The GUS active mass chemical staining of tissue such as Fig. 6 Arabidopsis leaf is analyzed

Epidermal hair is all dyed blueness, and other histocyte is not colored, and is illustrated in gus gene specifically expressing in the epidermal hair cell under the regulation and control of GhPRP5 promotor, thereby confirms that this promotor is a fiber-specific in cotton.Among the figure: Arabidopis thaliana seedling true leaf A.10d; B. Arabidopis thaliana becomes seedling lotus throne leaf; The amplification of C.B figure; D. Arabidopis thaliana becomes the seedling stem; E. bennet; F. calyx sheet.

Fig. 7 transgenic cotton plant phenotype analytical

Among the figure: .A is at the transfer-gen plant of culturing room's growth; B. the cotton boll of transgenic cotton plant diminishes, and fiber shortens.

Embodiment:

The clone of a new cotton PRP gene GhPRP5 expresses and promotor is separated expression analysis

1. cotton GhPRP5cDNA clone identifies

From cotton fibre cDNA library, separated more than 10,000 cotton cDNAs, through bioinformatic analysis, obtaining more than 180 maybe the proteic gene of encoding cell wall.Utilize the dot blot technology (to press Li Xuebao, Huang Gengqing, Xu Wenliang, Wang Xiulan, Wang Hong, 2005.Cotton cells wall-held protein gene isolation is identified and expression analysis.Central China Normal University's journal (natural science edition); 39 (4): the method for 509-513 is carried out); Preliminary screening goes out the cell wall protein gene of 15 fiber high level expressions from these candidate genes; To the comparison of checking order again of each sequence, find a proteic gene of coding proline rich, called after GhPRP5.

2.Northern the expression of hybridization analysis GhPRP5

(1) extraction of total tissue RNA (is pressed Li XB; Cai L; Cheng NH, Liu JW, 2002.Molecularcharacterization of the cotton GhTUB1 gene that preferentially expressed in fiber.Plant Physiol.130:666-674 carries out).

(2) Northern hybridization (is pressed Li XB; Cai L; Cheng NH, Liu JW, 2002.Molecular characterizationof the cotton GhTUB1 gene that preferentially expressed in fiber.Plant Physiol.130:666-674 carries out).

3. real-time fluorescence quantitative RT-PCR is analyzed the GhPRP5 expression of gene

(1) extraction of total tissue RNA (is pressed Li XB; Cai L; Cheng NH, Liu JW, 2002.Molecularcharacterization of the cotton GhTUB1 gene that preferentially expressed in fiber.Plant Physiol.130:666-674 carries out).

(2) real-time fluorescence quantitative RT-PCR research expression of gene is (according to Li XB; Fan XP; Wang XL; Cai L, Yang WC, 2005.The Cotton ACTIN1 gene is functionally expressed in fibers and participatesin fiber elongation.Plant Cell 17:859-875 carries out).At first, the total RNA (2 μ g/ appearance) with cotton different tissues (root, hypocotyl, cotyledon, petal, flower pesticide, the back 2 days fibers of blooming, 5 days fibers, 10 days fibers and 10 days ovules, 15 days fibers, 20 days fibers etc.) becomes cDNA with SuperScriptTM II RNase H-Reverse Transcriptase (InvitrogenLife Technologies) reverse transcription; Then, be template with cDNA, (TOYOBO Japan) carries out the quantitative PCR reaction with the primer (GhPRP5RTP1 and GhPRP5RTP2) of gene specific and Real-time PCR Master Mix.Cotton polyubiquitin gene (GhUBI1) is as the interior mark of RT-PCR reaction, and each round-robin amplification of target gene is all by the SYBR-Green fluoroscopic examination.The horizontal relative value of each expression of gene by formula Y=10 Δ Ct/3.57 * 100% is calculated (Δ Ct=CtGhUBI1-CtGhPRP5 wherein; 3.57 be the inverse that utilizes slope among the typical curve y=-0.28x+9.87 of GhUBI1 preparation, expression genetic expression differs 10 times PCR cycle number).Repeat the statistical study experimental result 3 times.

4. the separation of promotor

(1) (BD Biosciences Clontech, method Cat.No.638904) have been separated GhPRP5 gene 5 '-upstream 932bp fragment with CP1 with the CP2 primer from cotton gene group walker kit according to Genome Walker Universal Kit; Further according to the method for Genome Walking Kit (Takara, code D316), use primer Sp1 again, Sp2, Sp3 have separated the segmental upstream sequence of 932bp, long 1285bp.Above-mentioned two fragment combined lengths are 2217bp.

(2) with the cotton genomic dna be template, design primers F lp1 and Flp2 respectively at segmental 5 ' end of 2217bp and 3 ' end, pcr amplification goes out the fragment of whole 2217bp length.This project the primer sees the following form 1:

Table 1

Primer	Sequence (5 ' to 3 ')
		?GhPRP5RTP1	GAG?AAT?TCT?GAG?AAG?GAA?CCT
?GhPRP5RTP2	TAACTGAATGACAATAATTCAAG
		?GhUBIRTP1	CTGAATCTTCGCTTTCACGTTATC
?GhUBIRTP2	GGGATGCAAATCTTCGTGAAAAC
		?CP1	GCAAAGTACTTGCTTCACCTTCTTGTAG
?CP2	GGTCGACCTTCAGCACCATTATCGTC
		?Sp1	TCGCAATATATGGCATACGGTATTCCTC
?Sp2	TTGTCATCTCGTCGATGTATCAAACTTG
		?Sp3	TAATAGTACCATCTCATTAATCCGCAGC
?Flp1	CTTGTCGACTCAAATTGCAGCAGGCGACCA
		?Flp2	GGGGGATCCCTCAAGCTGTTATATGTTGAA

5. the expression analysis of promotor

The cis-acting elements of promotor according to plantCARE ( Http:// bioinformatics.psb.ugent.be/webtools/plantcare/html/) carry out, the result sees table 2.Make up the GhPRP5promoter:GUS fusion expression vector, electric shocking method transforms Agrobacterium GV3101 and LBA4404 respectively, distinguishes arabidopsis thaliana transformation and tobacco then.The active histochemical stain analysis of GUS is according to Li XB; Cai L; Cheng NH; Liu JW, the method that 2002.Molecular characterization of the cotton GhTUB1 gene that preferentially expressed in fiber.Plant Physiol.130:666-674 introduces is carried out.

6.GhPRP5 functional analysis

The RNA that has made up GhPRP5 interferes (RNAi) expression vector, and converting cotton through the transformation experiment more than 1 year, obtains 48 strain transgenic cotton plants altogether.These transfer-gen plants are transplanted to the land for growing field crops, grow, analyze inhibition degree and fibrous quality and other economical character of GhPRP5 genetic expression in the transfer-gen plant then to blossoming and bearing fruit.Interpretation of result shows that the expression of GhPRP5 receives remarkable inhibition.Because this expression of gene amount significantly reduces, the cotton fiber cell elongation of most of transgenic cotton plants is slow, and staple length shortens, and shows that GhPRP5 gene pairs cotton fiber development plays an important role.

The cis-acting elements that contains in the table 2 GhPRP5 promotor

Putative Cis-element motifs	Location	Motif?sequence	Function
				5UTR Py-rich stretch	-432，-497	TTTCTTCTCT，	conferring?high transcription?levels
ABRE	+1249	CACGTG	abscisic?acid responsiveness
				ACE	+1022，+1141	AAAACGTTTA	light?responsiveness
ARE	-1379	TGGTTT	essential?for?the anaerobic?induction
				AT1-motif	-1028	ATTAATTTTACA	light?responsiveness
Box?4	+330，+428，+1034	ATTAAT	light?responsiveness
				Box1	+137，+338，+935	TTTCAAA	light?responsiveness
CAT-box	+1232	GCCACT	related?to?meristem expression
				CGTCA-motif	+1139，-1177	CGTCA	MeJA-responsiveness
ELI-box3	-1037	AAACCAATT	elicitor-responsive
				ERE	+934	ATTTCAAA	ethylene-responsive
G-box	+485，+1248， +1249，+1333， -1024，-1291	CACGTT，ACACGTGT， CACATGG	light?responsiveness
				GA-motif	+216，-158，-172	AAAGATGA	light?responsive
GARE-motif	+439	AAACAGA	gibberellin-responsive
				GATA-motif	+262	GATAGGG	light?responsive
GT-1?motif	+856	GGTTAA	light?responsive
				I-box	+262，+1118	GATAGGG	light?responsive
MBS	+302，+973，+989	CGGTCA，CAACTG， TAACTG	MYB?binding?site involved?in drought-inducibility
				O2-site	+701，+790，+1181	GATGACATGG	zein?metabolism regulation
Skn-1motif	+304，-796，-832	GTCAT	required?for?endosperm expression
				TCA-motif	+9，+158	CCATCTTTTT	salicylic?acid responsiveness
TCT-motif	+1177，-1139	TGACG	MeJA-responsiveness
				WUN-motif	+1014	TCATTACGAA	wound-responsive?e
as-2-motif	-1101	GATAatGATG	shoot-specific expression?and?light responsiveness

1, cotton fibre specific expression gene GhPRP5, the cDNA sequence of this gene (comprises that ORFs and 3 ' holds untranslated district; Open reading frame and 3 '-untranslated region, be called for short ORF and 3 '-UTR) as follows:

1?ATGGGGGAGA?AGGTGACGAT?AATGGTGCTG?AAGGTCGACC?TTCAGTGTAG?ACGCTGCTAC

61?AAGAAGGTGA?AGCAAGTACT?TTGCAAATTC?CCTCAAATAC?GAGACCAGAT?ATACGACGAG

121?AAGGCCAACA?CGGTGACAAT?CAAGGTAGTT?TGCTGCGATC?CAGAGAAGAT?GAGGGGCAAG

181?ATACGTTGCA?AGGGTGGCGA?TTCCATCAAG?AGCATTGAGA?TCAAACCACC?TCCAAAGCCC

241?AAGGACCCCG?AGAATTCTGA?GAAGGAACCT?GAAAAGAAAA?CAGAGAAGCC?TACAGAGTCC

301?GAGAAGAAGT?CTGAAAAGCC?CAAAGAAACA?CCACCAAAGT?CACCGGCGAA?ACAGGCTTCT

361?CCTCCGGAAG?GCTTTTGTTG?CACGGATTGT?TATCATGGTC?ATCGTGGTGG?CCCTTGCTAC

421?TTTGGTGGAC?CACCTCCGCC?CCCATACTAT?TGGCCTTATG?GTAGGCCAGT?TTATGTTAAC

481?TGGGGCGGCT?GCGGCGGAAG?CACCTACTGT?TATTGTTTTG?AAGAAAACCC?ACAATGCTCA

541?GTCATGTAAG?TTGTAGCATG?GCACATGTGG?GACGCTCATA?ATAAAGTTAT?TTTACGTTTC

601?TCCCTTGAAT?TATTGTCATT?CAGTTAAAAT?ACAACGTTGA?ATGTTTTCAT?GTTTTATACA

The coding region (ORF) of 661 TTGTATTTAC AAAATTGTTT GATAAAAAAA AAAAAAAAAA AAAAAAAAAA A genes from initiator codon ATG to terminator codon TAA (1-549bp).

2.GhPRP5 the protein sequence of gene coding region translation is following:

1?MGEKVTIMVL?KVDLQCRRCY?KKVKQVLCKF?PQIRDQIYDE?KANTVTIKVV?CCDPEKMRGK

61?IRCKGGDSIK?SIEIKPPPKP?KDPENSEKEP?EKKTEKPTES?EKKSEKPKET?PPKSPAKQAS

121?PPEGFCCTDC?YHGHRGGPCY?FGGPPPPPYY?WPYGRPVYVN?WGGCGGSTYC?YCFEENPQCS

181?VM

3.GhPRP5 upstream region of gene promoter sequence (comprising 5 ' untranslated district of end and promoter fragment) is as follows:

1?TCAAATTGCA?GCAGGCGACC?ATGGGTTTTG?GCTTAGATCT?TCATGAAGAT?CGATGGAATT

61?GGTGAGGTCT?CATTTCATTA?TATCTTGAGA?GAGGGAAATG?GCTTGGCGGG?TGCATTGGTT

121?AAAGGGGGAA?TTTTTCGAAC?CAGCTTATTC?AAAGCATGGT?GGTAGCAGAT?GTCAGGGTTT

181?TTTTTTCTTT?TCCTGTTGGG?TTTATTTTAT?ATGTTAACAG?TGGAATTTTG?TTTAATTTTA

241?GAGTTAAAAA?TTATCATATA?TTTTAATTCA?CATTTAAAAA?AAAAGATATA?TAATAACTTT

301?TTAGATCCCA?CCACACCTCT?AGTCTGATAA?GATTCAAACT?AACACCACAA?TATTTTAAAA

361?TATATTTTCT?TAATTTAATT?TTATAAAGAT?CCAAAAAAGA?TAAATTACAA?TATAGTTCAC

421?ACTAAAATAG?TGTTGCTTTT?ATTTTGATCA?CTTTAATTTT?TTTTGTCAAT?TTAGTCACCA

481?CTAAAATGAT?CACTTAATTA?TTAAACCTTT?AACGAATTGC?TTAGTGGACT?AACAAAAAAA

541?GAGAAAAAAA?TATTTTTTAA?TCCCTTTAAA?AATTACAAAT?TTTTTAAGTC?AATCTCTTAA

601?ATTTCCATCA?AAAACCCATA?TAAAATAGCA?TAAAAAAATG?TTAAATCCAA?CCTTCAATAT

661?GCTTCCACTG?TCGTCTTCTC?CTTCGTTCCC?CCTTCCATCT?CAACATTGAG?GTAAATTTTT

721?AATTACCCAT?GTTTTCCCAT?TTGTTTATTT?TTCAACTAAA?TAATTTAGTT?GCACTTGTTT

781?TTTAAATGCC?CCATAATTAT?TCATGTTCTC?TCATTTATGA?ATTTTCCAAC?TAAATAGTTT

841?AGTTCCACTA?GTTTTTCAAA?TGTACCATAA?TTATTCATCT?TTTTCTAATT?ATCTATTTTC

901?CAACCAAAGT?CAAGGGGAGT?TTGGTTGGAT?GGAAGGAAGA?AGTAAAAAAT?AGAAAGAAAA

961?TAAATTTTGA?GTTCGCTTGA?TAGGGAAGAC?AAATGAAAGG?AAAGAAAATT?ATGAAAAGCG

1021?GTCATTTTTT?ATCCTATTGT?ATAAAAATTA?ATTCTTTCAA?ATTGGAATGA?TTATAGAAGT

1081?GTATGCTTAT?TCAAATTATG?TATTTTTTAA?ATATTTTTTT?CTTTTTCATT?TTCCAACTCT

1141?ACGAATTAAT?AGAAGAAACA?GAAAATTATT?TTTCTTTCTA?TTTAATCATT?TTTTTACTAA

1201?GCACGACTAT?AAAAGAGAAA?AAAGAAATTC?TATCTTTTCA?ATATTTTTTC?ACTCCATCAA

1261?GTAAAACCTT?AATTTTAGTC?CACCATCCAT?TGCTGAGCCA?GCTGAGAAAA?TAATACAAGT

1321?AAATACTAGT?ACAACCAACA?AACAAGGAAA?GGGACCGAGC?AAGTTTGATG?CGGCTTTGGG

1381?TATGGACTAA?TATCTTCGAA?TCAGATGCTG?CGGATTAGAT?GAGATGGTAC?TATTACTGGC

1441?CACAAATGGT?GATGAAAAAT?AGACCTTTAG?TTACTGGCTG?TAAGAGTGCC?GACAGTAGTT

1501?AACATCGATG?AGATGACAAT?TTCACCACAA?GTTTGATACA?TCGACGAGAT?GACAATTTTA

1561?AGCTTACCAA?ATGGTTAACA?TTTATTTATA?TATGGTAGGG?ATATTTGGCG?AGGAATACCG

1621?TATGCCATAT?ATTGCGACAG?GAGCAAATGT?ATTTCAAATC?TATTTTCCAC?TGTTATACAT

1681?ATGCAATGAT?AACTGATAAA?TGAGCCAACT?GAATGAATTA?AATTATGAAC?CCATTACGAA

1741?AACGTGTAAA?ATTAATTGGT?TTAGCCTTGC?AATGAATCCA?TCTTTGTATA?CATTGTACAA

1801?ACATCGTGCT?TAAATTACAT?CAATATCCCT?ACTTGATATG?GCTAAGACTT?GAATCCGTCA

1861?ACGTTTTAAC?TAAACTTCAG?GGTGTTGCAT?GGTTGACGAA?GACATGGAAG?ACTTGAACAT

1921?GGAAATAGAC?AAACGCCGCA?CGATTCGAGC?CACTTGGCCC?TGGGACACGT?GTACGATTGG

1981?TCCAATGCCG?CATTACACCA?ATCAATAACC?ACATGGCTTA?ATTTTGATGT?GATGTGCCAA

2041?TAACGCCTGC?ACATGGATAG?TGCATGTAGG?ACTAATGCAT?TTATTTCGAA?ACCTTAAACC

2101?ACTACTAGGC?AGCTTACCTG?CCTGCCTTAA?CTTTATAAGG?CTCTTGGCTC?CAAAATTATT

2161?TCTTCATTTC?ACCGGTTTGC?AACTTTTCTT?TTCAGTTTCA?ACATATAACA?GCTTGAG

Claims (1)

1.GhPRP5 the upstream region of gene promotor, its sequence is following:

1 TCAAATTGCA?GCAGGCGACC?ATGGGTTTTG?GCTTAGATCT?TCATGAAGAT?CGATGGAATT

61 GGTGAGGTCT?CATTTCATTA?TATCTTGAGA?GAGGGAAATG?GCTTGGCGGG?TGCATTGGTT

121 AAAGGGGGAA?TTTTTCGAAC?CAGCTTATTC?AAAGCATGGT?GGTAGCAGAT?GTCAGGGTTT

181 TTTTTTCTTT?TCCTGTTGGG?TTTATTTTAT?ATGTTAACAG?TGGAATTTTG?TTTAATTTTA

241 GAGTTAAAAA?TTATCATATA?TTTTAATTCA?CATTTAAAAA?AAAAGATATA?TAATAACTTT

301 TTAGATCCCA?CCACACCTCT?AGTCTGATAA?GATTCAAACT?AACACCACAA?TATTTTAAAA

361 TATATTTTCT?TAATTTAATT?TTATAAAGAT?CCAAAAAAGA?TAAATTACAA?TATAGTTCAC

421 ACTAAAATAG?TGTTGCTTTT?ATTTTGATCA?CTTTAATTTT?TTTTGTCAAT?TTAGTCACCA

481 CTAAAATGAT?CACTTAATTA?TTAAACCTTT?AACGAATTGC?TTAGTGGACT?AACAAAAAAA

541 GAGAAAAAAA?TATTTTTTAA?TCCCTTTAAA?AATTACAAAT?TTTTTAAGTC?AATCTCTTAA

601 ATTTCCATCA?AAAACCCATA?TAAAATAGCA?TAAAAAAATG?TTAAATCCAA?CCTTCAATAT

661 GCTTCCACTG?TCGTCTTCTC?CTTCGTTCCC?CCTTCCATCT?CAACATTGAG?GTAAATTTTT

721 AATTACCCAT?GTTTTCCCAT?TTGTTTATTT?TTCAACTAAA?TAATTTAGTT?GCACTTGTTT

781 TTTAAATGCC?CCATAATTAT?TCATGTTCTC?TCATTTATGA?ATTTTCCAAC?TAAATAGTTT

841 AGTTCCACTA?GTTTTTCAAA?TGTACCATAA?TTATTCATCT?TTTTCTAATT?ATCTATTTTC

901 CAACCAAAGT?CAAGGGGAGT?TTGGTTGGAT?GGAAGGAAGA?AGTAAAAAAT?AGAAAGAAAA

961 TAAATTTTGA?GTTCGCTTGA?TAGGGAAGAC?AAATGAAAGG?AAAGAAAATT?ATGAAAAGCG

1021?GTCATTTTTT?ATCCTATTGT?ATAAAAATTA?ATTCTTTCAA?ATTGGAATGA?TTATAGAAGT

1081?GTATGCTTAT?TCAAATTATG?TATTTTTTAA?ATATTTTTTT?CTTTTTCATT?TTCCAACTCT

1141?ACGAATTAAT?AGAAGAAACA?GAAAATTATT?TTTCTTTCTA?TTTAATCATT?TTTTTACTAA

1201?GCACGACTAT?AAAAGAGAAA?AAAGAAATTC?TATCTTTTCA?ATATTTTTTC?ACTCCATCAA

1261?GTAAAACCTT?AATTTTAGTC?CACCATCCAT?TGCTGAGCCA?GCTGAGAAAA?TAATACAAGT

1321?AAATACTAGT?ACAACCAACA?AACAAGGAAA?GGGACCGAGC?AAGTTTGATG?CGGCTTTGGG

1381?TATGGACTAA?TATCTTCGAA?TCAGATGCTG?CGGATTAGAT?GAGATGGTAC?TATTACTGGC

1441?CACAAATGGT?GATGAAAAAT?AGACCTTTAG?TTACTGGCTG?TAAGAGTGCC?GACAGTAGTT

1501?AACATCGATG?AGATGACAAT?TTCACCACAA?GTTTGATACA?TCGACGAGAT?GACAATTTTA

1561?AGCTTACCAA?ATGGTTAACA?TTTATTTATA?TATGGTAGGG?ATATTTGGCG?AGGAATACCG

1621?TATGCCATAT?ATTGCGACAG?GAGCAAATGT?ATTTCAAATC?TATTTTCCAC?TGTTATACAT

1681?ATGCAATGAT?AACTGATAAA?TGAGCCAACT?GAATGAATTA?AATTATGAAC?CCATTACGAA

1741?AACGTGTAAA?ATTAATTGGT?TTAGCCTTGC?AATGAATCCA?TCTTTGTATA?CATTGTACAA

1801?ACATCGTGCT?TAAATTACAT?CAATATCCCT?ACTTGATATG?GCTAAGACTT?GAATCCGTCA

1861?ACGTTTTAAC?TAAACTTCAG?GGTGTTGCAT?GGTTGACGAA?GACATGGAAG?ACTTGAACAT

1921?GGAAATAGAC?AAACGCCGCA?CGATTCGAGC?CACTTGGCCC?TGGGACACGT?GTACGATTGG

1981?TCCAATGCCG?CATTACACCA?ATCAATAACC?ACATGGCTTA?ATTTTGATGT?GATGTGCCAA

2041?TAACGCCTGC?ACATGGATAG?TGCATGTAGG?ACTAATGCAT?TTATTTCGAA?ACCTTAAACC

2101?ACTACTAGGC?AGCTTACCTG?CCTGCCTTAA?CTTTATAAGG?CTCTTGGCTC?CAAAATTATT

2161?TCTTCATTTC?ACCGGTTTGC?AACTTTTCTT?TTCAGTTTCA?ACATATAACA?GCTTGAG?。

Images