CN101712998A - Detection method of genetic relationship among eggplants based on SRAP marks - Google Patents
Detection method of genetic relationship among eggplants based on SRAP marks Download PDFInfo
- Publication number
- CN101712998A CN101712998A CN200910309226A CN200910309226A CN101712998A CN 101712998 A CN101712998 A CN 101712998A CN 200910309226 A CN200910309226 A CN 200910309226A CN 200910309226 A CN200910309226 A CN 200910309226A CN 101712998 A CN101712998 A CN 101712998A
- Authority
- CN
- China
- Prior art keywords
- srap
- eggplant
- primer
- sibship
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a detection method of genetic relationship among eggplants based on SRAP marks, belonging to the technical field of crop breeding. The method comprises the following steps of: step 1, extracting DNA of eggplants; step 2, carrying out SRAP-PCR amplification to obtain amplification products; step 3, carrying out electrophoresis on the amplification products to obtain electrophoresis gel; step 4, carrying out silver staining development on the electrophoresis gel; and step 5, carrying out cluster analysis on the electrophoresis result to determine the genetic relationship among different varieties of eggplants. The method of the invention has the advantages of simple and easy implementation, low cost and high efficiency; and each SRAP primer averagely detects 0.75 polymorphic site in cultivated species.
Description
Technical field
The present invention relates to a kind of detection method of crop breeding technical field, specifically is a kind of detection method of the eggplant sibship based on SRAP (Sequence-related amplified polymorphism, sequence be correlated with amplification polymorphism) mark.
Background technology
Be quantitative character with the human economy closely-related most Main Agronomic Characters of living in agriculture production, these proterties are voriability, by a large amount of, effect is small and the Gene Handling that can add, and is subject to Effect of Environmental.These proterties rely on breeding scholar's field observation usually owing to there is little difference when parental apolegamy, this has limited the crop breeding of new variety to a great extent.And the invention of molecular marking technique helps to put in order the sibship between the breeding material, has advanced breeding process greatly.Human inheritance scholar D.R.L.Botstein equals at first to propose in 1980 RFLP (restrictionfragment length polymorphism, restriction fragment length polymorphism) technology is promptly by the digestion with restriction enzyme genomic dna, utilizes isotope-labeled probe and enzyme to cut product then and hybridizes and disclose its dna polymorphism.1985, the birth of poly-polymerase chain reaction (PCR) technology made direct amplification in vitro DNA become possibility to detect its polymorphism.Novel molecular mark based on these two kinds of technology continues to bring out (the random amplified polymorphic DNA as RAPD subsequently, randomly amplified polymorphic DNA), AFLP (amplified fragments length polymorphism, amplified fragment length polymorphism), SSR (simple sequence repeats, simple sequence repeats) and SRAP (sequence-related amplifiedpolymorphism, SRAP).But studies show that the DNA amount that the RAPD mark needs is few, routine analyzer is simple, but be the dominant marker, can not distinguish and isozygoty and heterozygous, and poor repeatability, also exists certain difficult in actual applications; The RFLP mark exists needs the DNA sample size big, the loaded down with trivial details and low shortcoming of polymorphism recall rate of schedule of operation; SSR belongs to the codominant marker, the reliability height, and repeatability is good, and resolving power is strong, but the SSR mark comparatively small amt of having developed on the eggplant.The SRAP technology is by Li and the Quiros two primer molecule Mk systems in the PCR-based of calendar year 2001 invention.This technology is rich in GC at gene extron, and intron is rich in the characteristics of AT, carries out special design of primers.Wherein, forward primer carries out specific amplified to exon, and reverse primer carries out specific amplified to including subregion and promoter region.Because exon sequence is normally guarded in Different Individual, because intron, promotor and intervening sequence make a variation very big between different plant species even Different Individual, the regional sequence that is rich in AT sees in promotor and the intron usually, thereby makes amplified fragments present polymorphism.Forward primer 5 ' hold is that the core sequence of one section 14 base is formed, wherein preceding 10 bases are " filling " sequence (filler sequence), there is not any special composition, then be the CCGG sequence, with being 3 selectivity bases after the CCGG, the variation of selectivity base is combined into a cover forward primer with identical core sequence.The composition and the forward primer of reverse primer are similar, but " filling " sequence latter linked be AATT; Be 3 selectively variable bases after the AATT sequence, be positioned at primer 3 ' end.Because this method amplified fragments is open reading frame (the open reading frame) zone of guarding, and the eggplant hereditary basis is very narrow, so Li, G and Sun, Z.D etc. have developed more SRAP primer.Because the SRAP technology has advantages such as simple, efficient, high codominance, high, the easy order-checking of repeatability, has been used for genetic map construction and the hereditary sibship analysis of wild cabbage, summer squash, buffalograss, cotton etc. now.
Find through literature search prior art,
Karihaloo, J.L etc. have delivered 767～770 pages of " Theoretical and Applied Genetics " the 6th phases of (theory and applied genetics) nineteen ninety-five and have been entitled as " Random amplified polymorphic DNA variation inthe eggplant, Solanum melongena L. (Solanaceae) " (utilizing the variation of RAPD technology for detection eggplant) literary composition, comment in 22 pairs of RAPD primers in the literary composition and amplify 130 bands altogether, but have only 4 in cultivar, to there are differences, illustrate that thus the RAPD technology is relatively poor in the polymorphism of detection eggplant especially cultivar;
Mace, E.S etc. have delivered 626～633 pages of " Theoretical and Applied Genetics " (theory and applied genetics) 1999 the 34th phases and have been entitled as " AFLP analysis of genetic relationships among thecultivated eggplant, Solanum melongena L., and wild relatives (Solanaceae) " (eggplant cultivar and wild species genetic affinity aflp analysis) literary composition, commenting AFLP in the literary composition is a kind of instrument of effectively evaluating heredity sibship, but the AFLP technology is had relatively high expectations to template DNA, cost is higher, complex operation step is unfavorable for using in practice;
Stagel, A etc. have delivered 357～370 pages of " BMC Genomics " (BMC genomics) 2008 the 7th phases and have been entitled as " Gene-based microsatellite development for mapping and phylogeny studies ineggplant " (for eggplant collection of illustrative plates and phylogenetics are researched and developed microsatellite markers based on gene) literary composition, author designed 50 pairs of primers, wherein there are 39 pairs can amplify product, but have only 11 pairs can present polymorphism at cultivar.Because the est sequence that can obtain from network seldom, designs a large amount of SSR primers usually and need make up genomic library, and each clone is checked order, although simple to operate, it is higher to expend cost, is unfavorable for promoting.
Summary of the invention
The objective of the invention is to overcome the deficiencies in the prior art, a kind of detection method of the eggplant sibship based on the SRAP mark is provided.Method of the present invention is simple, and cost is low, the efficient height, and each SRAP primer average detected in cultivar goes out 0.75 polymorphic site.
The present invention realizes by following technical scheme, the present invention includes following steps:
Step 1, the DNA of extraction eggplant;
Step 2, the SRAP-PCR amplification obtains amplified production;
Described combining form proterties and genealogical relationship are distinguished, and are meant: if the two is identical, then be commaterial, or come from same ancestors, otherwise, then there is not sibship.This method can illustrate the sibship distance between each strain very clear and intuitively
In the step 2, described SRAP-PCR amplification is specially: adopt 10 μ L reaction systems to carry out the SRAP amplification, wherein, 10 μ L reaction systems are specially: 2.0mmolL
-1MgCl
2, 200 μ molL
-1DNTPs, 0.5 μ molL
-1Primer, Taq polysaccharase 0.5U, 40～50ng template DNA is adjusted final volume to 10 μ L with redistilled water, and reaction mixture covers with 20 μ L paraffin oils; The pcr amplification program is: 94 ℃ 3 minutes; 94 ℃ 45 seconds, 35 ℃ 45 seconds, 72 ℃ 1 minute, 5 circulations; 94 ℃ 45 seconds, 50 ℃ 45 seconds, 72 ℃ 1 minute, 35 circulations; Last 72 ℃ 7 minutes.
In the step 2, described SRAP-PCR amplification the primer is selected from multiple in the following combination of primers:
| OD8GA34 | OD26GA34 |
| OD10GA19 | SA7GA5 |
| OD12GA5 | SA7GA12 |
| OD15GA11 | SA8GA3 |
| OD15GA33 | SA14GA2 |
| OD22GA19 | SA17GA5 |
| OD22GA34 | SA18PM18 |
| OD26GA30 | SA21GA5 |
Wherein, shown in the described primer table specific as follows:
| The primer title | 5’-3’ | The primer title | 5’-3’ |
| OD8 | CACAAGTCGCTGAGAAGG | GA2 | TTGAACTGGCAGAAAGGGT |
| OD10 | AGGAGGGAAAGGTCTGGT | GA3 | TCATCTCAAACCATCTACAC |
| OD12 | TTGAATATCCAGTGTAAGGTT | GA5 | GGAACCAAACACATGAAGA |
| OD15 | GCGAGGATGCTACTGGTT | GA11 | CATTGTGGTGGTTATTGTCA |
| 0D22 | TACACCAGCCAAGGATGC | GA12 | CACCACCATCATCATATCTT |
| SA7 | CGCAAGACCCACCACAA | GA19 | TTAAGGGCATAAAACATGGAT |
| SA8 | GGATGAAGCGACAAGTC | GA30 | CTCTCCACCGCACATATC |
| SA14 | TTACCTTGGTCATACAACATT | GA33 | GTTATGGGAAATTAGGTGAG |
| SA17 | ATAAGAATCAGCAGACGCAT | GA34 | CCAAATGGAACAAAATGATG |
| SA18 | ACGAGTTGCGGAAGTGG | PM18 | AAGCGATCAAAGCGGGTG |
| SA21 | GAATGCAGGAGAACACGTT |
Compared with prior art, the present invention has following beneficial effect: method of the present invention is simple, and cost is low, the efficient height, and each SRAP primer average detected in cultivar goes out 0.75 polymorphic site.
Description of drawings
Fig. 1 is the cluster analysis figure of 15 kinds of different eggplant strain sibships among the embodiment 1;
Fig. 2 is the cluster analysis figure of 15 kinds of different eggplant strain sibships among the embodiment 2;
Fig. 3 is the cluster analysis figure of 15 kinds of different eggplant strain sibships among the embodiment 3.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, for example the Sambrook equimolecular is cloned: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
The eggplant kind that relates in following examples all can obtain by disclosed commercially available channel, and is all putting down in writing in the disclosed periodical literature.
Embodiment 1
With 15 parts of eggplant product is test materials, specifically as shown in table 1.Cultivate as follows: selected 55 ℃ of water seed soakings for use 15 minutes; Change over to then and continue in 30 ℃ the normal-temperature water to soak 8～10 hours.Impregnated seed is wrapped with clean gauze, be put in vernalization in the dark in 30 ℃ of illumination boxs.After treating 3～4 days, can stop vernalization when seeing the broken mouth of 70～80% seed, broadcast, water permeable back and beat the dark hole of 0.5cm, seed is broadcast in the hole, cover the thick peat composed of rotten mosses of 0.5cm then by in the peat composed of rotten mosses, vermiculite and fertilizer (volume ratio 4: 4: 1) the blended matrix.Obturaging with black film is placed on the seedbed about 30 ℃, and eggplant seed is unearthed after 4～5 days, forwards 25 ℃ of day temperature then to, night 18 ℃ of temperature indoor 2 weeks of cultivation of artificial climate, get eggplant true leaf extraction DNA when waiting two leaves wholeheartedly.
Table 1
| Numbering | Family name | Family name | Latin name |
| 1 | Lueyang milk eggplant | Lueyang?Milk?Qie | S.melongera?L. |
| 2 | Local red eggplant | Hong?Qie | S.melongera?L. |
| 3 | The blue or green eggplant in Guangdong | Guangdong?Qing?Qie | S.melongera?L. |
| 4 | Red eggplant | Hong?Qie | S.melongera?L. |
| 5 | The Malaya eggplant | Malaysia?Qie | S.melongera?L. |
| 6 | Garden, Shenxian County eggplant | Shenxian?Yuan?qie | S.melongera?L. |
| 7 | Purple pocket eggplant | Zi?Hebao?Qie | S.melongera?L. |
| 8 | The pocket eggplant | Hebao?Qie | S.melongera?L. |
| 9 | The kiln hood eggplant | Yaotou?Qie | S.melongera?L. |
| Numbering | Family name | Family name | |
| 10 | Standing grain line eggplant | Hexian?Qie | S.melongera?L. |
| 11 | Prosperous step purple long eggplant | Wangbu?Zi?Chang?Qie | S.melongera?L. |
| 12 | The kermes eggplant | Yanzhi?Qie | S.melongera?L. |
| 13 | The wild red eggplant | Hong?Qie | S.aethiopicum?L. |
| 14 | The white eggplant in Wugang | Wugan?Bai?Qie | S.melongera?L. |
| 15 | The Kweiyang eggplant | Guiyang?Qie | S.surattense?Burm.f. |
Step 1, the extraction of DNA
Extracting genome DNA and purifying are with reference to the CTAB method.DNA after the extraction is diluted to 20ng μ L, 4 ℃ of preservations.
Step 2, the SRAP-PCR amplification
Adopt 10 μ L reaction systems to carry out SRAP amplification: 2.0mmolL
-1MgCl
2(magnesium chloride), 200 μ molL
-1DNTPs (deoxyribonucleoside triphosphate), 0.5 μ molL
-1Primer, Taq polysaccharase 0.5U, 40～50ng template DNA is adjusted final volume to 10 μ L with redistilled water, and reaction mixture covers with 20 μ L paraffin oils.The pcr amplification program is 94 ℃ of pre-sex change 3 minutes; 94 ℃ of sex change 45 seconds, 35 ℃ of renaturation 45 seconds, 72 ℃ were extended 5 circulations 1 minute; 94 ℃ of sex change 45 seconds, 50 ℃ of renaturation 45 seconds, 72 ℃ were extended 35 circulations 1 minute; Last 72 ℃ were extended 7 minutes.
Agents useful for same 25mmolL
-1MgCl
2, 10mmolL
-1DNTP, 5U μ L
-1Taq polysaccharase, primer and electrophoresis agents useful for same are all available from Shanghai bio-engineering corporation.
In the SRAP-PCR amplification, the primer of employing is specially following combination, sees Table 2:
Table 2
| OD8GA34 | SA7GA5 |
| OD10GA19 | SA7GA12 |
| OD12GA5 | SA8GA3 |
| OD15GA33 | SA14GA2 |
| OD22GA19 | SA17GA5 |
| OD26GA30 | SA18PM18 |
| OD26GA34 |
Wherein, described primer is specifically as shown in table 3:
Table 3
Pcr amplification product separates by 6% denaturing polyacrylamide gel vertical electrophoresis.Be added on sample hole on the offset plate, electrophoresis under the permanent power of 60W after 1: 1 volume mixture of amplified production and sample-loading buffer, sex change.
(1) fixing: will the band glass plate of glue put into 0.5% the Glacial acetic acid that fills that 2L newly prepares and the Setup Box of 10% dehydrated alcohol mixed solution, jog is 20 minutes on shaking table, and dimethylbenzene cyanogen color all fades away on the glue face;
(2) washing: be put in the washing box that fills distilled water jog 3 minutes;
(3) silver dyes: washing finishes, and puts into the AgNO that fills 2L 0.2%
3In the colouration box of staining fluid, jog 30 minutes;
(4) prepare the developing solution of 2L 1.5%NaOH and 0.5% formaldehyde in advance, shake up stand-by;
(5) washing again: take out offset plate from colouration box, be put in the washing box and clean, the time is no more than 10 seconds.
(6) develop: rapidly offset plate is put into Delevoping cartridge after the washing and develop, until band clearly occurring;
(7) photographic fixing: use 2L 0.75% anhydrous Na at last
2CO
3The stop bath photographic fixing.Take out offset plate, flushing with clean water, silver dyes end.
13 pairs of combination of primers produce 62 difference bands altogether.With tape recording is arranged on the same amplification site on the electrophoretogram is 1, and no tape recording is 0, makes 0,1 matrix diagram input computer.Adopt NTSYS-pc software (version 2 .1), calculate the Jaccard similar matrix, it is tree-shaped to make up cluster according to the UPGMA method, as shown in Figure 1.These 15 parts of materials can be divided three classes substantially as can be seen from Figure 1, and the first kind comprises 1,3,7,8,9,10,14, and wherein 1 and No. 14 genetic similarity is 1.00, illustrates that sibship is nearest.Second class comprises 2,4,5,6,11, No. 12, constitutes the 3rd classes 13 and No. 15, and the genetic similarity of it and other strain is respectively 0.20,0.10, thus with the sibship of the first kind and second class farthest.In a word, the sibship distance between each strain can be described by this method very clear and intuitively, for parental apolegamy in the breeding provides theoretical foundation.
Embodiment 2
With 15 parts of eggplant product is test materials, specifically as shown in table 4, and culturing process is with embodiment 1.
Table 4
| Numbering | Family name | Family name | Latin name |
| 1 | The smalt eggplant | Da?Qing?Qie | S.melongera?L. |
| 2 | Purple long eggplant | Zi?Chang?Qie | S.melongera?L. |
| 3 | Two red eggplants | Er?Hong?Qie | S.melongera?L. |
| 4 | Red eggplant early | Zao?Hong?Qie | S.melongera?L. |
| 5 | The long eggplant in Danzhai | Danzhai?Chang?Qie | S.melongera?L. |
| 6 | Dedu line length eggplant | Dedu?Xian?Chang?Qie | S.melongera?L. |
| 7 | The Heilungkiang eggplant | Heilongjiang?Qie | S.melongera?L. |
| 8 | Short melon | Ai?Gua | S.melongera?L. |
| 9 | The black line eggplant | He?Xian?Qie | S.melongera?L. |
| 10 | Nanfeng County line eggplant | Nanfeng?Xian?Qie | S.melongera?L. |
| 11 | The early in the morning little long eggplant in Jinan | Jinan?Zao?Xiao?Chang?Qie | S.melongera?L. |
| 12 | Hang eggplant | Diao?Qie | S.melongera?L. |
| Numbering | Family name | Family name | Latin |
| 13 | Suzhou ox horn eggplant | Suzhou?Niujiao?Qie | S.melongera?L. |
| 14 | The long eggplant in Fujian | Min?Chang?Qie | S.melongera?L. |
| 15 | The olecranon eggplant | Yingzui?Qie | S.melongera?L. |
Step 1, the extraction of DNA is with embodiment 1.
Step 2, the SRAP-PCR amplification, with embodiment 1, difference is being that the primer combination is as shown in table 5:
Table 5
16 pairs of combination of primers produce 80 difference bands altogether.With tape recording is arranged on the same amplification site on the electrophoretogram is 1, and no tape recording is 0, makes 0,1 matrix diagram input computer.Adopt NTSYS-pc software (version 2 .1), calculate the Jaccard similar matrix, it is tree-shaped to make up cluster according to the UPGMA method, as shown in Figure 2.These 15 parts of materials all are cultivars, and its average genetic similarity is 0.89.These 15 parts of materials can be divided three classes substantially as can be seen from Figure 2, and the first kind comprises that 1,3,4,14, the second classes comprise 2,5,6,7,9,10,11,12 and No. 13, having three groups in second class is not distinguished, be respectively (2,6,7), (9,10), (12,13).Distinguish them, then need combining form proterties and genealogical relationship to distinguish.If the two is identical, may be commaterial then, or comes from same ancestors.And 8 and No. 15 formation the 3rd classes.This method can illustrate the sibship distance between each strain very clear and intuitively, for parental apolegamy in the breeding provides theoretical foundation.
With 15 parts of eggplant product is test materials, specifically sees Table 6, and culturing process is with embodiment 1.
Table 6
Step 1, the extraction of DNA is with embodiment 1.
Step 2, the SRAP-PCR amplification, with embodiment 1, difference is being that the primer combination is as shown in table 7:
Table 7
| OD8GA34 | OD26GA34 |
| OD10GAl9 | SA7GA5 |
| OD12GA5 | SA7GA12 |
| OD15GA11 | SA8GA3 |
| OD15GA33 | SA14GA2 |
| OD22GA19 | SA17GA5 |
| OD22GA34 | SA18PM18 |
| OD26GA30 | SA21GA5 |
16 pairs of combination of primers produce 80 difference bands altogether.With tape recording is arranged on the same amplification site on the electrophoretogram is 1, and no tape recording is 0, makes 0,1 matrix diagram input computer.Adopt NTSYS-pc software (version 2 .1), calculate the Jaccard similar matrix, it is tree-shaped to make up cluster according to the UPGMA method, as shown in Figure 3.These 15 parts of materials can be divided three classes substantially as can be seen from Figure 3.The first kind is 15, and the average similarity coefficient of itself and other strain is 0.49; Second class is 12, and the average similarity coefficient of itself and other strain is 0.54; Other 13 parts of materials are the 3rd class.Thereby very clear and sibship distance between each strain is described intuitively, for parental apolegamy in the breeding provides theoretical foundation.
Sequence table
＜110〉Shanghai Communications University
＜120〉based on the detection method of the eggplant sibship of SRAP mark
<160>21
<170>PatentIn?version?3.3
<210>1
<211>18
<212>DNA
＜213〉artificial sequence
<400>1
cacaagtcgc?tgagaagg????18
<210>2
<211>18
<212>DNA
＜213〉artificial sequence
<400>2
aggagggaaa?ggtctggt????18
<210>3
<211>21
<212>DNA
＜213〉artificial sequence
<400>3
ttgaatatcc?agtgtaaggt?t????21
<210>4
<211>18
<212>DNA
＜213〉artificial sequence
<400>4
gcgaggatgc?tactggtt????????18
<210>5
<211>18
<212>DNA
＜213〉artificial sequence
<400>5
gcgaggatgc?tactggtt????????18
<210>6
<211>17
<212>DNA
＜213〉artificial sequence
<400>6
cgcaagaccc?accacaa?????????17
<210>7
<211>17
<212>DNA
＜213〉artificial sequence
<400>7
ggatgaagcg?acaagtc?????????17
<210>8
<211>21
<212>DNA
＜213〉artificial sequence
<400>8
ttaccttggt?catacaacat?t????21
<210>9
<211>21
<212>DNA
＜213〉artificial sequence
<400>9
ttaccttggt?catacaacat?t????21
<210>10
<211>17
<212>DNA
＜213〉artificial sequence
<400>10
acgagttgcg?gaagtgg??????17
<210>11
<211>19
<212>DNA
＜213〉artificial sequence
<400>11
gaatgcagga?gaacacgtt????19
<210>12
<211>19
<212>DNA
＜213〉artificial sequence
<400>12
ttgaactggc?agaaagggt????19
<210>13
<211>20
<212>DNA
＜213〉artificial sequence
<400>13
tcatctcaaa?ccatctacac????20
<210>14
<211>19
<212>DNA
＜213〉artificial sequence
<400>14
ggaaccaaac?acatgaaga?????19
<210>15
<211>20
<212>DNA
＜213〉artificial sequence
<400>15
cattgtggtg?gttattgtca????20
<210>16
<211>20
<212>DNA
＜213〉artificial sequence
<400>16
caccaccatc?atcatatctt????20
<210>17
<211>21
<212>DNA
＜213〉artificial sequence
<400>17
ttaagggcat?aaaacatgga?t????21
<210>18
<211>18
<212>DNA
＜213〉artificial sequence
<400>18
ctctccaccg?cacatatc????????18
<210>19
<211>18
<212>DNA
＜213〉artificial sequence
<400>19
ctctccaccg?cacatatc????????18
<210>20
<211>20
<212>DNA
＜213〉artificial sequence
<400>20
ccaaatggaa?caaaatgatg????20
<210>21
<211>18
<212>DNA
＜213〉artificial sequence
<400>21
aagcgatcaa?agcgggtg??????18
Claims (4)
1. the detection method based on the eggplant sibship of SRAP mark is characterized in that, comprises the steps:
Step 1, the DNA of extraction eggplant;
Step 2, the SRAP-PCR amplification obtains amplified production;
Step 3 to the amplified production electrophoresis, gets running gel;
Step 4 is carried out silver to running gel and is dyed colour developing;
Step 5 is distinguished sibship between each kind eggplant to electrophoresis result combining form proterties and genealogical relationship.
2. the detection method of the eggplant sibship based on the SRAP mark according to claim 1 is characterized in that described combining form proterties and genealogical relationship are distinguished, be meant: if the two is identical, then be commaterial, or come from same ancestors, otherwise, then do not have sibship.
3. the detection method of the eggplant sibship based on the SRAP mark according to claim 1, it is characterized in that in the step 2, described SRAP-PCR amplification is specially: adopt 10 μ L reaction systems to carry out the SRAP amplification, wherein, 10 μ L reaction systems are specially: 2.0mmolL-1 MgCl2,200 μ molL-1 dNTPs, 0.5 μ molL-1 primer, Taq polysaccharase 0.5U, 40～50ng template DNA is adjusted final volume to 10 μ L with redistilled water, and reaction mixture covers with 20 μ L paraffin oils; The pcr amplification program is: 94 ℃ 3 minutes; 94 ℃ 45 seconds, 35 ℃ 45 seconds, 72 ℃ 1 minute, 5 circulations; 94 ℃ 45 seconds, 50 ℃ 45 seconds, 72 ℃ 1 minute, 35 circulations; Last 72 ℃ 7 minutes.
4. according to the detection method of claim 1 or 3 described eggplant sibships based on the SRAP mark, it is characterized in that in the step 2, described SRAP-PCR amplification the primer is selected from multiple in the following combination of primers:
Wherein, shown in the described primer table specific as follows:
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910309226A CN101712998A (en) | 2009-11-03 | 2009-11-03 | Detection method of genetic relationship among eggplants based on SRAP marks |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910309226A CN101712998A (en) | 2009-11-03 | 2009-11-03 | Detection method of genetic relationship among eggplants based on SRAP marks |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101712998A true CN101712998A (en) | 2010-05-26 |
Family
ID=42416995
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910309226A Pending CN101712998A (en) | 2009-11-03 | 2009-11-03 | Detection method of genetic relationship among eggplants based on SRAP marks |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101712998A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101974629A (en) * | 2010-10-26 | 2011-02-16 | 西南大学 | Method for investigating origin of species of allopolyploid by virtual synthetic species |
| CN101984446A (en) * | 2010-10-22 | 2011-03-09 | 云南省烟草农业科学研究院 | Estimating method of genetic similarity index of codominance molecular marker based on relative correlation coefficient |
| CN103184217A (en) * | 2011-12-30 | 2013-07-03 | 北京林业大学 | Poa pratensis SRAP molecular marking method |
| CN110373495A (en) * | 2019-09-03 | 2019-10-25 | 广东省农业科学院蔬菜研究所 | For identifying the primer and its application of ' rich treasured ' eggplant hybrid seed purity |
-
2009
- 2009-11-03 CN CN200910309226A patent/CN101712998A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101984446A (en) * | 2010-10-22 | 2011-03-09 | 云南省烟草农业科学研究院 | Estimating method of genetic similarity index of codominance molecular marker based on relative correlation coefficient |
| CN101984446B (en) * | 2010-10-22 | 2012-07-04 | 云南省烟草农业科学研究院 | Estimating method of genetic similarity index of codominance molecular marker based on relative correlation coefficient |
| CN101974629A (en) * | 2010-10-26 | 2011-02-16 | 西南大学 | Method for investigating origin of species of allopolyploid by virtual synthetic species |
| CN103184217A (en) * | 2011-12-30 | 2013-07-03 | 北京林业大学 | Poa pratensis SRAP molecular marking method |
| CN103184217B (en) * | 2011-12-30 | 2014-09-24 | 北京林业大学 | Poa pratensis SRAP molecular marking method |
| CN110373495A (en) * | 2019-09-03 | 2019-10-25 | 广东省农业科学院蔬菜研究所 | For identifying the primer and its application of ' rich treasured ' eggplant hybrid seed purity |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zeng et al. | Stripe rust resistance and genes in Chinese wheat cultivars and breeding lines | |
| Köhnemann et al. | The validation of a 15 STR multiplex PCR for Cannabis species | |
| CN106282394A (en) | The method of high throughput testing Semen Maydis south rust resistance gene type and test kit thereof | |
| CN102443624A (en) | Method for simultaneously sequencing multi-sample CDR3 (complementary determining region 3) receptor library with high flux | |
| CN101712998A (en) | Detection method of genetic relationship among eggplants based on SRAP marks | |
| Liu et al. | Isolation, characterization and mapping of genes differentially expressed during fibre development between Gossypium hirsutum and G. barbadense by cDNA-SRAP | |
| Bidartondo et al. | Fungal diversity in molecular terms: profiling, identification, and quantification in the environment | |
| CN104988148B (en) | A kind of swamp type water buffalo SSR primers and its application | |
| CN103013986A (en) | Hot pepper SSR markers developed by using EST sequence redundancy, and method thereof | |
| CN112662806B (en) | Rhynchosia SSR molecular marker primer composition and application thereof | |
| Zhang et al. | Combining irrigation scheme and phosphorous application levels for grain yield and their impacts on rhizosphere microbial communities of two rice varieties in a field trial | |
| Sui et al. | Soil Acidobacterial community composition changes sensitively with wetland degradation in northeastern of China | |
| Luchi et al. | Powerful qPCR assays for the early detection of latent invaders: interdisciplinary approaches in clinical cancer research and plant pathology | |
| CN100402666C (en) | Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit | |
| CN110541039A (en) | SSR primer group developed based on Spodoptera frugiperda whole genome sequence and application thereof | |
| CN106676176A (en) | Method for performing SSR analysis on tetraploid alfalfa by utilizing multiple PCR | |
| Zhang et al. | Identification of cashmere and wool by DNA barcode | |
| Pang et al. | Identification of genes that were differentially expressed and associated with fiber yield and quality using cDNA-AFLP and a backcross inbred line population | |
| Polat et al. | Mining and utilization of mushroom ESTs for microsatellites | |
| Xin et al. | Population genetic analysis of 6 Y-STR loci in Chinese northwestern Qinchuan yellow cattle breed | |
| CN102443633A (en) | Method for real time quantitative PCR detection of hematopoietic chimeras and designing of genetic marker primers of hematopoietic chimeras | |
| CN113046465A (en) | SNP loci obviously associated with cold resistance of wheat and application of SNP loci in genetic breeding | |
| Melo et al. | Development of microsatellite markers in Pterodon pubescens and transferability to Pterodon emarginatus, two Brazilian plant species with medicinal potential | |
| Liu et al. | Developmental validation of a novel 8‐dye fluorescent typing system with 59 Y‐STRs and 3 Y‐indels for forensic applications | |
| Dong et al. | Compositional shifts and assembly in rhizosphere-associated fungal microbiota throughout the life cycle of Japonica rice under increased nitrogen fertilization |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20100526 |