CN101698838B - UDP-glucuronosyltransferase isomerase, coding gene thereof and use thereof - Google Patents
UDP-glucuronosyltransferase isomerase, coding gene thereof and use thereof Download PDFInfo
- Publication number
- CN101698838B CN101698838B CN2009102042972A CN200910204297A CN101698838B CN 101698838 B CN101698838 B CN 101698838B CN 2009102042972 A CN2009102042972 A CN 2009102042972A CN 200910204297 A CN200910204297 A CN 200910204297A CN 101698838 B CN101698838 B CN 101698838B
- Authority
- CN
- China
- Prior art keywords
- sequence
- udp
- cotton
- application
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a UDP-glucuronosyltransferase isomerase, a coding gene thereof and use thereof. The UDP-glucuronosyltransferase isomerase is a protein a or a protein b, wherein the protein a has an amino acid sequence represented by the No.2 sequence in a sequence table; and the protein b is derived from the protein a by synthesizing UDP glucuronic acid with amino acid sequence represented by the No.2 sequence in the sequence table, through substituting and/or losing and or adding one or several amino acids. The invention also discloses a coding gene of the protein. The UDP-glucuronosyltransferase isomerase coding gene can be introduced into cotton to lengthen cotton fibers and improve the quality and yield of cotton fibers. The UDP-glucuronosyltransferase isomerase and the coding gene of the invention have great economic values and application prospects.
Description
Technical field
The present invention relates to UDP-glucuronosyltransferisomerase isomerase and encoding sox thereof and application.
Background technology
Cotton fiber is from ovule exterior skin cytodifferentiation and the unicellular structure of coming.Cotton fiber is the important source material of textile industry, has important economic value.Fiber quality decision its final length and intensity.Simultaneously, cotton fiber cell also is the idealized system of important biomolecule phenomenons such as research cell elongation, differentiation and cell walls synthesize.So the research elongate fiber has important economic value and theory significance.
The growth course of cotton fiber cell is the process of extraordinary elongation of cell and the extraordinary thickening of cell walls.Upland cotton length is about about 3.0cm, and upland cotton cell walls diameter is 11-22 μ m, that is to say that long-width ratio is 1000-3000.The formation of cotton fiber cell generally can be divided into four has eclipsed period each other: fiber is initial, cell elongation (primary wall formation), secondary wall deposition and ripening stage.
Cell walls is one of major organs of plant difference and animal.Primary cell wall mainly is made up of polysaccharide such as Mierocrystalline cellulose, pectin, semicelluloses.Some special cells like cotton fiber, xylem and sclerenchyma cell, can continue after stopping growing at the inner deposit secondary cell wall of primary wall, mainly contain Mierocrystalline cellulose, semicellulose and a small amount of xylogen and form.The deposition of cell walls with change growth to plant, growth and to external world the response of environment important effect is all arranged.Its final decision the sizes and shape of cell.
Plant cell wall pectin is mainly mixed by three types of polysaccharide: same polygalacturonic acid (HGA), gather rhamno-galacturonic acid I (RGI) and gather rhamno-galacturonic acid II (RGII).With polygalacturonic acid is the homopolymer of galacturonic acid.Gathering rhamno-galacturonic acid I is the different aggressiveness that multiple rhamnosyl and galacturonic acid disaccharide unit are formed, and wherein the rhamnosyl residue also is connected with ARABINANS, Polygalactan and arabogalactan.Gathering rhamno-galacturonic acid II is the same polygalacturonic acid through modifying, and is the diversified polysaccharide of syndeton, and its content in cell walls is very low.
The abundant polysaccharide of plant cell wall is to change into various nucleosides sugar by uridine diphosphoglucose through a series of, and again through the glycosyltransferase synthetic, galacturonic acid is a main sugar unit of forming pectin polysaccharide.(UDP-galacturonic acid UDP-GalA) is the synthetic activation precursor that contains the galacturonic acid polysaccharide to Uridinediphosphogalactose aldehydic acid.UDP-GalA is that (UDP-D-glucuronic acid4-epimerase is formed by uridine diphosphate glucuronate (UDP-GlcA) isomery under catalysis GAE) at UDP-glucuronosyltransferisomerase isomerase.GAE is a kind of irreversible enzyme, but also catalysis by the conversion of UDP-GalA to UDP-GlcA.
2002, Tokumoto etc. discovered that in the elongate fiber phase, cell walls matrix polysaccharide (mainly being pectin and semicellulose) accounts for the 30-50% of cell wall sugar total amount, and to the secondary wall thickening phase, this proportion quickly falls to 3%.1999, confirmations such as Chanliaud and Gidley, pectin polysaccharide can influence the character of cell walls through participating in cellulosic deposit.The same year, discoveries such as Wen, the expression that suppresses pectin methylesterase can change the proterties of pea root cell, thereby root is shortened.2003, Jones etc. used arabanase hydrolysis of pectin RGI, and the switching function of the Herba Commelinae blade pore that exsomatizes is lost.2006; The leaf cells wall construction of research Myrothamnusflabellifolius such as Moore (still can meet water through prolonged drought dehydration for several times brings back to life) finds, its repeatedly textural property of dehydration and aquation is given in the existence of being rich in the cell wall polysaccharides of ARABINANS.More than research shows that all the elongation of pectin polysaccharide pair cell and the handiness of cell walls are extremely important.
Summary of the invention
The purpose of this invention is to provide a kind of UDP-glucuronosyltransferisomerase isomerase and encoding sox thereof and application.
UDP-glucuronosyltransferisomerase isomerase provided by the present invention, be and the synthetic relevant albumen of Uridinediphosphogalactose aldehydic acid, this albumen called after GhGAE1, be following a) or b) albumen:
A) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 2;
B) in sequence table the aminoacid sequence of sequence 2 through replacing and/or disappearance and/or add one or several amino acid and synthetic relevant with Uridinediphosphogalactose aldehydic acid by a) deutero-protein.
Wherein, sequence 2 is made up of 431 amino-acid residues in the sequence table.
Above-mentioned b) aminoacid sequence is shown in the 22-431 position of sequence 2.
In order to make GhGAE1 protein a) be convenient to purifying, proteinic N-terminal or C-terminal that can the aminoacid sequence shown in the sequence 2 is formed in by sequence table connect label as shown in table 1.
The sequence of table 1. label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (being generally 5) | RRRRR |
| Poly-His | 2-10 (being generally 6) | HHHHHH |
| |
8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c- |
10 | EQKLISEEDL |
Above-mentioned b) but in GhGAE1 protein synthetic, also can synthesize its encoding sox earlier, carry out biology again and express and to obtain.Above-mentioned b) the proteinic encoding sox of the GhGAE1 in can be through lacking sequence in the sequence table 1 codon of one or several amino-acid residue in the dna sequence dna shown in the 5 ' terminal 169-1464 position; And/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.
Said proteic encoding sox also belongs to protection scope of the present invention.
Said proteic encoding sox is following 1) to 5) in arbitrary described gene:
1) its nucleotide sequence is a sequence 1 in the sequence table;
2) its encoding sequence be in the sequence table sequence 1 from 5 ' terminal 169-1464 position;
3) its nucleotide sequence be in the sequence table sequence 1 from 5 ' terminal 233-1536 position;
4) under stringent condition with 1) or 2) or 3) the dna fragmentation hybridization and the coding that limit synthesize relevant proteic dna molecular with Uridinediphosphogalactose aldehydic acid;
5) with 1) or 2) or 3) gene that limits has the homology 90% or more, and coding and Uridinediphosphogalactose aldehydic acid synthesize relevant proteic dna molecular.
Gene in the said step 5) is with 1) gene the homology more than 95% is preferably arranged.
Above-mentioned stringent condition can be at 6 * SSC, in the solution of 0.5%SDS, 68 ℃ of hybridization down, uses 2 * SSC then, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.
Amplification GhGAE1 full length gene or arbitrary segmental primer are to also belonging to protection scope of the present invention.
Total length and any segmental primer thereof of recombinant vectors, transgenic cell line and reorganization bacterium, the said gene of amplification that contains above-mentioned GhGAE1 gene is to also belonging to protection scope of the present invention.
Available existing plant expression vector construction contains the recombinant expression vector of GhGAE1 gene.Said plant expression vector comprises double base agrobacterium vector and the carrier etc. that can be used for the plant micropellet bombardment, like pCAMBIA3301, pCAMBIA1300, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN or other plant expression vector of deriving.Conventional biological methods such as the plant expression vector that carries GhGAE1 gene of the present invention can lead through Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity, agriculture bacillus mediated are transformed in vegetable cell or the tissue.
When using the gene constructed recombinant plant expression vector of GhGAE1; Before its transcription initiation Nucleotide, can add any enhancement type, composing type, organizing specific type or inducible promoter; Like cauliflower mosaic virus (CAMV) 35S promoter, general living plain gene Ubiquitin promotor (pUbi) etc., they can use separately or be used in combination with other plant promoter; In addition; When using gene constructed plant expression vector of the present invention; Also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser zones can be ATG initiator codon or neighboring region initiator codon etc.; But must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of said translation wave and initiator codon is widely, can be natural, also can be synthetic.Translation initiation region can be from transcription initiation zone or structure gene.
For the ease of transgenic plant cells or plant being identified and screening; Can process used plant expression vector, can in plant, express enzyme or the gene (gus gene, luciferase genes etc.) of luminophor, antibiotic marker thing (qingfengmeisu qiong affinity tag, kantlex affinity tag etc.) or the anti-chemical reagent marker gene (like anti-weedkiller gene) etc. that can produce colour-change with resistance as adding.
Another object of the present invention is to provide arbitrary above-mentioned albumen in application as UDP-glucuronosyltransferisomerase isomerase.
It is the application among the UDP-GlcA transforming uridine diphosphate glucuronate (UDP-GlcA) for the application in the Uridinediphosphogalactose aldehydic acid (UDP-GalA) or transforming UDP-GalA that another purpose of the present invention is to provide arbitrary above-mentioned albumen or arbitrary above-mentioned gene.
Another object of the present invention provides a kind of method of cultivating the transgenic plant of homouridine di-phosphate galacturonic acid content.
The method of the transgenic plant of cultivation homouridine di-phosphate galacturonic acid content provided by the present invention is with in the said gene transfered plant cell, obtains the transgenic plant that Uridinediphosphogalactose aldehydic acid content improves.
Wherein, said plant specifically can be cotton.
UDP-glucuronosyltransferisomerase isomerase of the present invention and encoding sox thereof can be used to cultivate the cotton that staple length increases.
It is the highest that UDP-glucuronosyltransferisomerase isomerase encoding sox of the present invention is expressed abundance at fiber quick elongating stage (blooming back 10 days); And the fiber primary cell wall of elongation contains a large amount of galacturonic acids fast; Explain that GhGAE1 is the committed step of the galacturonic acid in the synthetic pectin polysaccharide, extremely important to elongate fiber.UDP-glucuronosyltransferisomerase isomerase encoding sox of the present invention is imported in the cotton, thereby cotton fiber length is increased, improve the quality and yield of cotton fibre.UDP-glucuronosyltransferisomerase isomerase of the present invention and encoding sox thereof have great economic worth and application prospect.
Description of drawings
Fig. 1 is the expression level analysis of GhGAE1 at the cotton different development stage.
Fig. 2 is the gas chromatographic analysis of the primary wall aldehydic acid sugar composition of cotton fibre and ovule.
Fig. 3 is the influence of UDP-galacturonic acid to elongate fiber.
Fig. 4 handles the influence to the GhGAE1 gene expression dose for ethene.
Fig. 5 is the proteic vivoexpression of GhGAE1.
Fig. 6 is the proteic determination of activity of GhGAE1.
Embodiment
Agents useful for same all can obtain from commercial sources among the following embodiment.
Experimental technique among the following embodiment is ordinary method if no special instructions.
Percentage composition among the following embodiment is the quality percentage composition if no special instructions.
The clone of embodiment 1, UDP-glucuronosyltransferisomerase isomerase encoding sox
One, the clone of GhGAE1 gene
Choose wild-type upland cotton kind Xuzhou 142 (WT) (the national middle term cotton seeds storehouse of The Chinese Academy of Agriculture Science and Technologys Cotton Research Institute) the back 10 days fiber of blooming; Extract total RNA, the extraction of total RNA is undertaken by the RNAgents Total RNA Isolation System kit of Promega company.Total RNA reverse transcription of getting 5g obtains the chain of cDNA, and reaction system is following:
In reaction system, add 1 μ L (200U) SuperScript behind 42 ℃ of water-bath 1min
TMIIRT mixes gently, 42 ℃ of insulation 50min; 70 ℃ of water-bath 15min stop and should react; Obtain first chain of cDNA.
The design primer carries out pcr amplification, and primer sequence is following:
P1：5′AATAAAAACTCCCCTCCCTTTTTTTC 3′；
P2：5′TACGGAATCCTCGTCTTTCTCTTG 3′。
The pcr amplification condition is: 94 ℃ of 3min of elder generation; 94 ℃ of 1min then, 59 ℃ of 45s, 72 ℃ of 2min, 30 circulations; Last 72 ℃ of 10min.
Pcr amplification goes out the fragment of about 1584bp, is connected on the pGEM-T Easy carrier construction recombination plasmid pT-GhGAE1 after the recovery; And transformed into escherichia coli DH5 α; The extraction enzyme is cut the plasmid of identifying correct positive colony and is checked order, and sequencing result shows that the cDNA sequence that the clone obtains is shown in sequence in the sequence table 1; Its encoding sequence be in the sequence table sequence 1 from 5 ' terminal 169-1464 position, the albumen shown in the sequence 2 in the code sequence tabulation.
Two, the relation of GhGAE1 expression level and elongate fiber
Choose wild-type upland cotton kind Xuzhou 142 (WT) and lint-free nothing wadding two mutants (FL) cotton (the national middle term cotton seeds storehouse of The Chinese Academy of Agriculture Science and Technologys Cotton Research Institute) of different development stage, utilize real-time quantitative PCR to analyze the expression level of GhGAE1.
Concrete steps are following:
The extraction of RNA: according to operational manual Micro-TO-Midi Total RNA PurificationSystem (Invitrogen; USA) bloom from wild-type upland cotton kind Xuzhou 142 same day and the back 3 days ovule of blooming, 5,10,15,20 and 25 days the fiber in back of blooming, and bloom and extract total RNA respectively in the back 10 days ovule in lint-free nothing wadding two mutants and wild-type upland cotton kind Xuzhou 142.
The preparation of cDNA template: the total RNA with 5 μ g is a template, with DNA enzyme I digested genomic dna, uses SUPERSCRIPT according to operational manual then
TMArticle one, the chain synthesis system is synthesized cDNA article one chain.
Real-time quantitative PCR: design GhUBQ7 and GhGAE1 gene specific primer respectively, (Ubiquitin is UBQ) as interior mark, according to DyNAmo to choose house-keeping gene cotton ubiquitin
TM(Finnzymes, USA) operational manual carries out the expression that real-time quantitative PCR is analyzed GhGAE1 to SYBR Green Qpcr Kit.
GhUBQ7 primer 5 ' sequence: 5 '-GAAGGCATTCCACCTGACCAAC-3 ';
GhUBQ7 primer 3 ' sequence: 5 '-CTTGACCTTCTTCTTCTTGTGCTTG-3 '.
GhGAE1 primer 5 ' sequence: 5 '-ACGCCAGGGAAGTTCAAGGTCG-3 ';
GhGAE1 primer 3 ' sequence: 5 '-GCCGTGGCTGTTAAGCAGGGAT-3 '.
Reaction system is following:
Reaction parameter: 95 ℃ of preparatory sex change 20s, 42 cyclic amplifications (each circulation comprises 94 ℃ of sex change 10s, 58 ℃ of annealing 20s, 72 ℃ of extension 30s) read the fluorescence data of 78-80 ℃ of collection then; Extend 5min at last.
The real-time quantitative PCR result is as shown in Figure 1; It is very low that GhGAE1 is expressed in wild-type upland cotton kind Xuzhou 142 back 10 days ovule and the lint-free nothing wadding two mutants abundance of blooming in the back 10 days ovule of blooming; But abundance is the highest in the fiber in the wild-type upland cotton kind Xuzhou 142 of blooming back 10 days; This explanation GhGAE1 expression level in fibrocyte significantly raises, and possibly have vital role to the growth of fiber.Among Fig. 1, WT-F representes the fiber in wild-type upland cotton kind Xuzhou 142, and WT-O representes wild-type upland cotton kind Xuzhou 142 ovules, and FL-O representes lint-free nothing wadding two mutants ovule, the fate after digitized representation is thereafter bloomed.
Three, the gas chromatographic analysis of the primary wall aldehydic acid of cotton fibre and ovule sugar composition
Concrete steps are following:
1. polysaccharide decomposes: take by weighing the 10mg cell walls, add the trifluoroacetic acid (TFA) of 1.25ml 2M, the 5mg/ml inositol that adds 50 μ l is made interior mark, 120 ℃, 2h; Centrifugal.
2. get 250 μ l TFA polysaccharide lysates, change in the 15ml centrifuge tube, nitrogen dries up under the 40 degree water bath condition.
3. add the pyridine solution 100ul that contains 20mg/ml methoxamine hydrochloride (methoxyamine hydroc hloride), 37 ℃ were reacted 2 hours.
4. add 100ul silylating reagent [two (TMS) monofluoroacetamide (BSTFA)+trimethyl silane (TMS)], 37 ℃ were reacted 0.5 hour.
5. get 10 μ l reaction solutions and be used for the GC-MS analysis, the DB-5MS post, program: 160 ℃, 1min, 10 ℃/min rise to 172 ℃, and 5 ℃/min rises to 208 ℃, and 10sec drops to 200 ℃, keep 2min, and 30sec drops to 160 ℃, keeps 2min.Each sugared composition is identified according to the standard specimen RT earlier, and then is confirmed with mass spectrum.
The result is as shown in Figure 2, and through gas chromatography-mass spectrometry analysis, fiber of blooming 10 days and ovule (do not detect glucuronic acid in the cell walls of (WT-F-10, FL-O-10 and WT-O-10).Galacturonic acid content in the cell walls of the fiber of blooming 10 days (galacturonic acid 1 with galacturonic acid 2) than Senior Two in the ovule doubly more than.Among Fig. 2, WT-F representes the fiber in wild-type upland cotton kind Xuzhou 142, and WT-O representes wild-type upland cotton kind Xuzhou 142 ovules, and FL-O representes lint-free nothing wadding two mutants ovule, the fate after digitized representation is thereafter bloomed.
Four, Uridinediphosphogalactose aldehydic acid (UDP-GalA) is to the influence of elongate fiber
The material composition of ovule nutrient solution is seen table 1.
Table 1. cotton ovule tissue culture medium composition
| Composition | Each constituent concentration (mmol/L) in the nutrient solution |
| KH 2PO 4 | 2.00 |
| H 3BO 3 | 0.10 |
| Na 2MoO 4 | 0.001 |
| CaCl 2·2H 2O | 3.00 |
| KI | 0.005 |
| CoCl 2·6H 2O | 0.0001 |
| MgSO 4·7H 2O | 2.00 |
| MnSO 4·H 2O | 0.10 |
| ZnSO 4·7H 2O | 0.03 |
| CuSO 4·5H 2O | 0.0001 |
| KNO 3 | 50.00 |
| FeSO 4·7H 2O | 0.030 |
| Na 2EDTA | 0.030 |
| Nicotinic acid (Nicotinic acid) | 0.004 |
| Y factor (PyridoxineHCl) | 0.004 |
| VITMAIN B1 (ThiamineHCl) | 0.0040 |
| Inositol (inositol) | 1.00 |
| D-glucose | 100.00 |
| D-fructose | 20.00 |
The back 1 day cotton ovule of blooming is used for carrying out culture experiment, and step is following:
After wild-type upland cotton kind Xuzhou 142 cotton bolls of 1) blooming back 1 day are plucked, soaked 10-15 minute, clean 4 times with the ovule nutrient solution again with 10% Youxiaolin;
2) pincet and the scalpel that burnt with spirit lamp are carefully put into the 50ml triangular flask that the ovule nutrient solution is housed with ovule, and add the UDP-galacturonic acid of 5 μ M;
The triangular flask that 3) ovule will be housed is put in the incubator and secretly cultivates, and notes not rocking triangular flask.
Not add the UDP-galacturonic acid as contrast.
The result is as shown in Figure 3,1 representative contrast, and 2 representatives add the UDP-galacturonic acid of 5 μ M; Explain that the UDP-galacturonic acid can significantly promote elongation of fiber.
Five, ethene is handled the influence to the GhGAE1 gene expression dose
Wild-type upland cotton kind Xuzhou 142 cotton ovules are cultivated in the ovule nutrient solution, add ethene and the sealing of 0.1 μ M, 37 degree constant temperature culture.Not add the ovule that ethene cultivates in the ovule nutrient solution is contrast.Ovule respectively at collecting ethene processing and contrast in 3,6,12 hours extracts total RNA respectively, carries out real-time quantitative PCR according to the method in (two).
The result is as shown in Figure 4, explains that ethene can significantly promote the GhGAE1 expression of gene.
Six, the enzyme assay of GhGAE1
1) prokaryotic expression carrier makes up.
Because GhGAE1 is the golgi body positioning protein, consider that signal peptide possibly influence proteic prokaryotic expression, so the albumen of Design Expression 21 amino acid whose signal peptide parts of N end have been removed.Xuzhou 142cDNA is a template with wild-type upland cotton kind, carries out pcr amplification with following primer:
GhGAE1-5’primer：5’-GGATCCCACAATATGAACCGTCAATTCCA-3’；
GhGAE1-3’primer：5’-CTCGAGTTTCCCGTTACCTTCTATTTCATTC-3’。
Pcr amplification goes out the fragment of about 1316bp; Be connected to after the recovery on the pGEM-T Easy carrier; Construction recombination plasmid and transformed into escherichia coli DH5 α, the extraction enzyme is cut the plasmid of identifying correct positive colony and is checked order, and sequencing result shows; Sequence 1 is from 5 ' terminal 233-1536 position in the segmental nucleotide sequence that obtains of clone such as the sequence table, the albumen of its encoding amino acid sequence shown in the 22-431 position of sequence in the sequence table 2.
Pcr amplification product inserts between the Xhol and BamH I site of pET28a (Invitrogen), obtains pET28a-GhGAE1.
2) abduction delivering of GhGAE1
PET28a-GhGAE1 is transformed into escherichia coli expression bacterial strain BL21 (DE3) pLysS, and positive strain is at OD
600The IPTG that adds 0.8mM during for 0.6-0.8, induce 4 hours after, collect bacterium liquid.With the resuspended bacterium liquid of sodium phosphate buffer (pH=7.6); Behind the ultrasonication bacterium liquid; 10000g is centrifugal 30 minutes under 4 ℃ of conditions, gets dialysed overnight under 4 ℃ of conditions of supernatant (the dialysis tubing molecular weight cut-off is 1.2-1.4kD) to remove small-molecule substance, and dialysis back bacterium liquid is used for enzyme analysis alive.The bacterium liquid supernatant that simultaneously obtains changeing the pET28a empty carrier according to above step is lived as enzyme and is analyzed negative contrast.
As shown in Figure 5, on behalf of the IPTG inductive, 1 change the bacterium liquid supernatant of pET28a empty carrier, and on behalf of the IPTG inductive, 2 change the bacterium liquid supernatant of pET28a-GhGAE1, and the arrow indication is the GhGAE1 differential protein band of expression.
3) determination of activity
(UDP-GlcA is available from Sigma company for 3mM UDP-GlcA or 3mM UDP-GalA; UDP-GalA is available from carbohydrate compound research center (the CarboSource Services of Georgia State University; University ofGeorgia)), the 25 μ L protein fungus liquid of expressing GhGAE1 is dissolved in the potassium phosphate buffer of 500 μ L 100mM (pH 7.6) 30 ℃ of reaction 60min; Add 500 μ L chloroform termination reactions.Do negative contrast with empty carrier bacterium liquid supernatant.16, the centrifugal 5min of 000g; Collect water.With ZORBAX Eclipse XDB-C18 post (0.46 * 15cm; Agilent Technologies) analyzes water, column temperature: 40 ℃; Sample size: 30 μ L.The HPLC program: (the 100mM potassium phosphate buffer contains the 8mM 4-butyl ammonium hydrogen sulfate to 100% (volume percent) buffer A; PH 6.5) continue 5min, the 27min inside gradient increases buffer B [70% (volume percent) buffer A, 30% (volume percent) methyl alcohol; PH 6.5] until the buffer B of 77% (volume percent); 77% (volume percent) buffer B continues 5min, and flow velocity is 1mL/min, and 254nm detects product.
As shown in Figure 6, A is that HPLC detects UDP-GlcA and the reaction product of slightly carrying bacterium liquid of expressing empty carrier; B is the reaction product that HPLC detection UDP-GlcA and GhGAE1 albumen are slightly carried bacterium liquid.Can UDP-GlcA be converted into UDP-GalA it is thus clear that express the proteic bacterium liquid of slightly carrying of GhGAE1, empty carrier bacterium liquid then can not be accomplished this conversion.C is that HPLC detects UDP-GalA and the reaction product of slightly carrying bacterium liquid of expressing empty carrier; D is the reaction product that HPLC detection UDP-GalA and GhGAE1 albumen are slightly carried bacterium liquid.It is thus clear that, to express the proteic bacterium liquid of slightly carrying of GhGAE1 and also can UDP-GalA be converted into UDP-GlcA, empty carrier bacterium liquid can not be accomplished this conversion.Thereby proof GhGAE1 has the activity of UDP-glucuronosyltransferisomerase isomerase.
Sequence table
< 110>Peking University
< 120>UDP-glucuronosyltransferisomerase isomerase and encoding sox thereof and application
<130>CGGNARL82108
<160>2
<210>1
<211>1584
<212>DNA
< 213>upland cotton (Gossypium hirsutum)
<400>1
aataaaaact cccctccctt tttttctgca tctgctttta tttctttaca gctcaaaatt 60
aataattata aatcaaatca agtctctttc ttccttatcc tttcgatctg ctaatcaagt 120
catttcaaga ttttttttct gaacaagaaa aagaaaaata gtaggacaat gccgtccttg 180
gaggatgagc tgtttccgtc gacgccaggg aagttcaagg tcgacagagc acacaatatg 240
aaccgtcaat tccatcgttg cttcgcttca accagcacca tgtttttatg ggctcttttc 300
ttgatcgcat tgacggcgtc gtatttgcgc ttccagagtt tcgttgattc tggtagccga 360
tatttcagtg cttcatgggg tggtatccaa tgggaaaaac aagtccgtaa ctccgctcag 420
atccatcgtt ccggaggcat gtccgttctg gtgactggag cggctggttt cgtcggtaca 480
cacgtttccc ttgccctcaa aaaacgcgga gatggagtcg ttgggcttga caatttcaac 540
aactattacg acccttcgtt gaaaaaggcg aggaaatccc tgcttaacag ccacggcatt 600
ttggtggttg aaggcgattt gaacgacgcc aagctgttgg ctaagctttt cgacgtggtg 660
gcttttactc acgtgatgca tttggcggct caagctggag tcaggtacgc catggaaaac 720
cccaactctt atgttcacag caacatcgcc ggtctcgtca cgcttctcga aatttgcaaa 780
tccgctaatc cccagccagc cgttgtctgg gcctcctcca gttccgttta cggtctcaac 840
gaaaaggttc ctttctctga ggccgacagg accgaccagc cggctagttt gtatgccgcc 900
accaagaagg caggcgaaga aataacccac acttataatc atatctacgg tctttcaatt 960
actggattaa gatttttcac cgtgtacggt ccatggggaa ggcctgatat ggcgtatttt 1020
tcgtttacga gaaatattct gcagggaaag cccatcacca tttatcgggg aaagaatcgg 1080
gttgatttgg cccgagattt tacctacatt gacgatatcg tgaaaggctg tttgggatcg 1140
ttggatacat ccgggaaaag caccggttct ggtgggaaga aaaaggggaa cgctccatat 1200
aggattttta atttggggaa tacgtcgccg gtcaaggtgc cggagctggt gaacatcctg 1260
gaaagacatt tgaaggtgaa agccaaaagg aatatcgtag atatgcctgg aaacggtgac 1320
gttccattca ctcatgcgaa tatcagtttg gcccaaagag aattcgggta caagccctca 1380
accgatttgc aaaccgggtt gaagaagttt gttagatggt atttatctta ttatggttat 1440
aacaaccgca aaggtctaca ataaaattta tttttggttt taaatgtaag gattttcttg 1500
gtttcccatt agaatgaaat agaaggtaac gggaaaaccg aaggaaccgc aagttaaaaa 1560
caagagaaag acgaggattc cgta 1584
<210>2
<211>431
<212>PRT
< 213>upland cotton (Gossypium hirsutum)
<400>2
Met Pro Ser Leu Glu Asp Glu Leu Phe Pro Ser Thr Pro Gly Lys Phe
1 5 10 15
Lys Val Asp Arg Ala His Asn Met Asn Arg Gln Phe His Arg Cys Phe
20 25 30
Ala Ser Thr Ser Thr Met Phe Leu Trp Ala Leu Phe Leu Ile Ala Leu
35 40 45
Thr Ala Ser Tyr Leu Arg Phe Gln Ser Phe Val Asp Ser Gly Ser Arg
50 55 60
Tyr Phe Ser Ala Ser Trp Gly Gly Ile Gln Trp Glu Lys Gln Val Arg
65 70 75 80
Asn Ser Ala Gln Ile His Arg Ser Gly Gly Met Ser Val Leu Val Thr
85 90 95
Gly Ala Ala Gly Phe Val Gly Thr His Val Ser Leu Ala Leu Lys Lys
100 105 110
Arg Gly Asp Gly Val Val Gly Leu Asp Asn Phe Asn Asn Tyr Tyr Asp
115 120 125
Pro Ser Leu Lys Lys Ala Arg Lys Ser Leu Leu Asn Ser His Gly Ile
130 135 140
Leu Val Val Glu Gly Asp Leu Asn Asp Ala Lys Leu Leu Ala Lys Leu
145 150 155 160
Phe Asp Val Val Ala Phe Thr His Val Met His Leu Ala Ala Gln Ala
165 170 175
Gly Val Arg Tyr Ala Met Glu Asn Pro Asn Ser Tyr Val His Ser Asn
180 185 190
Ile Ala Gly Leu Val Thr Leu Leu Glu Ile Cys Lys Ser Ala Asn Pro
195 200 205
Gln Pro Ala Val Val Trp Ala Ser Ser Ser Ser Val Tyr Gly Leu Asn
210 215 220
Glu Lys Val Pro Phe Ser Glu Ala Asp Arg Thr Asp Gln Pro Ala Ser
225 230 235 240
Leu Tyr Ala Ala Thr Lys Lys Ala Gly Glu Glu Ile Thr His Thr Tyr
245 250 255
Asn His Ile Tyr Gly Leu Ser Ile Thr Gly Leu Arg Phe Phe Thr Val
260 265 270
Tyr Gly Pro Trp Gly Arg Pro Asp Met Ala Tyr Phe Ser Phe Thr Arg
275 280 285
Asn Ile Leu Gln Gly Lys Pro Ile Thr Ile Tyr Arg Gly Lys Asn Arg
290 295 300
Val Asp Leu Ala Arg Asp Phe Thr Tyr Ile Asp Asp Ile Val Lys Gly
305 310 315 320
Cys Leu Gly Ser Leu Asp Thr Ser Gly Lys Ser Thr Gly Ser Gly Gly
325 330 335
Lys Lys Lys Gly Asn Ala Pro Tyr Arg Ile Phe Asn Leu Gly Asn Thr
340 345 350
Ser Pro Val Lys Val Pro Glu Leu Val Asn Ile Leu Glu Arg His Leu
355 360 365
Lys Val Lys Ala Lys Arg Asn Ile Val Asp Met Pro Gly Asn Gly Asp
370 375 380
Val Pro Phe Thr His Ala Asn Ile Ser Leu Ala Gln Arg Glu Phe Gly
385 390 395 400
Tyr Lys Pro Ser Thr Asp Leu Gln Thr Gly Leu Lys Lys Phe Val Arg
405 410 415
Trp Tyr Leu Ser Tyr Tyr Gly Tyr Asn Asn Arg Lys Gly Leu Gln
420 425 430
Claims (16)
1. protein, be following a) or b) albumen:
A) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 2;
B) protein of forming by the 22-431 amino acids sequence of sequence in the sequence table 2.
2. the said proteic encoding sox of claim 1.
3. gene according to claim 2 is characterized in that: said gene is following 1) or 2) or 3) gene:
1) its nucleotide sequence is a sequence 1 in the sequence table;
2) its encoding sequence be in the sequence table sequence 1 from 5 ' terminal 169-1464 position;
3) its nucleotide sequence be in the sequence table sequence 1 from 5 ' terminal 233-1536 position.
4. the recombinant vectors that contains claim 2 or 3 said genes.
5. the transgenic cell line that contains claim 2 or 3 said genes.
6. the reorganization bacterium that contains claim 2 or 3 said genes.
7. the described albumen of claim 1 is in the application as UDP-glucuronosyltransferisomerase isomerase.
8. the described albumen of claim 1 is in that to transform uridine diphosphate glucuronate be the application in the Uridinediphosphogalactose aldehydic acid or be the application in the uridine diphosphate glucuronate transforming Uridinediphosphogalactose aldehydic acid.
9. claim 2 or 3 described genes are in that to transform uridine diphosphate glucuronate be the application in the Uridinediphosphogalactose aldehydic acid or be the application in the uridine diphosphate glucuronate transforming Uridinediphosphogalactose aldehydic acid.
10. a method of cultivating the transgenic plant of homouridine di-phosphate galacturonic acid content is with in claim 2 or the 3 said gene transfered plant cells, obtains the transgenic plant that Uridinediphosphogalactose aldehydic acid content improves.
11. method according to claim 10 is characterized in that: said plant is a cotton.
12. the application of the said albumen of claim 1 in the cotton of cultivating the staple length increase.
13. claim 2 or the 3 said genes application in the cotton of cultivating the staple length increase.
14. the application of the said recombinant vectors of claim 4 in the cotton of cultivating the staple length increase.
15. the said transgenic cell of claim 5 ties up to the application in the cotton of cultivating the staple length increase.
16. the application of the said reorganization of claim 6 bacterium in the cotton of cultivating the staple length increase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102042972A CN101698838B (en) | 2008-12-26 | 2009-10-21 | UDP-glucuronosyltransferase isomerase, coding gene thereof and use thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810246718.3 | 2008-12-26 | ||
| CN200810246718 | 2008-12-26 | ||
| CN2009102042972A CN101698838B (en) | 2008-12-26 | 2009-10-21 | UDP-glucuronosyltransferase isomerase, coding gene thereof and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101698838A CN101698838A (en) | 2010-04-28 |
| CN101698838B true CN101698838B (en) | 2012-05-23 |
Family
ID=42147303
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009102042972A Expired - Fee Related CN101698838B (en) | 2008-12-26 | 2009-10-21 | UDP-glucuronosyltransferase isomerase, coding gene thereof and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101698838B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106191018B (en) * | 2015-05-25 | 2021-09-14 | 中国医学科学院药物研究所 | Uridine-5' -diphosphate xylose synthetase derived from star-of-Bethlehem, nucleotide sequence and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1832966A (en) * | 2003-08-06 | 2006-09-13 | 意纳科有限公司 | Polysaccharides derivatives with high antithrombotic activity in plasma |
-
2009
- 2009-10-21 CN CN2009102042972A patent/CN101698838B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1832966A (en) * | 2003-08-06 | 2006-09-13 | 意纳科有限公司 | Polysaccharides derivatives with high antithrombotic activity in plasma |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101698838A (en) | 2010-04-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101698839B (en) | Uridine diphosphate xylose isomerase, coding gene thereof and use thereof | |
| KR102665118B1 (en) | Human collagen type 17 polypeptide, production method and use thereof | |
| CN111763663B (en) | Gastrodia elata glucosyltransferase gene and application thereof | |
| CN104762281B (en) | A kind of α rhamnosidases and its preparation method and application | |
| AU2020100579A4 (en) | APPLICATION OF GhPRXR1 PROTEIN AND CODING GENE THEREOF IN REGULATING AND CONTROLLING OIL CONTENT OF COTTONSEED | |
| CN112725319A (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| CN113736763B (en) | Myrosinase Rmmr and application thereof in preparation of sulforaphane and sulforaphane | |
| CN107739738A (en) | A kind of Liriodendron Cellulose-synthase gene LcCESA1 and its expressing protein and application | |
| CN101698838B (en) | UDP-glucuronosyltransferase isomerase, coding gene thereof and use thereof | |
| CN108220264B (en) | Application of glycosyltransferase in biosynthesis of salidroside | |
| CN109402080B (en) | Protein UGT142 and coding gene and application thereof | |
| Su et al. | Increased cellulose production by heterologous expression of cellulose synthase genes in a filamentous heterocystous cyanobacterium with a modification in photosynthesis performance and growth ability. | |
| CN101451126B (en) | Uridine diphosphate-4-one-6-deoxyglucose heterogeneous reductase and coding gene thereof and application | |
| CN106085892A (en) | Express the pichia pastoris engineered strain of AA9 family polysaccharide monooxygenase gene TLAA9 4 | |
| CN110628725A (en) | Citrus yellowed vein clearing virus mutant and construction method thereof | |
| CN113046378B (en) | Incision alginate lyase, coding gene and application thereof | |
| CN115992109A (en) | Gelidine glycosyltransferase protein, and coding gene and application thereof | |
| CN109810965B (en) | Beta-glucosidase from rhizoma anemarrhenae, coding gene, expression vector and application thereof | |
| CN107937358A (en) | A kind of GAP-associated protein GAP TaPaO1 for inducing plant pollen abortion and its encoding gene and application | |
| CN113969270A (en) | Application of plant infection-related protein TaCIPK14 in regulation and control of stripe rust resistance of plants | |
| CN110129362B (en) | Method for inserting tag into turnip mosaic virus P3 protein, recombinant vector and application thereof | |
| CN114164222B (en) | Garlic purple acid phosphatase AsPAP gene and application thereof in improving alliin content of garlic callus | |
| CN114250230B (en) | Application of soybean histone demethylase GmJMJ30-2 in regulation and control of plant stress tolerance | |
| CN114107260B (en) | Fucoidan sulfate degrading enzyme OUC-FaFcn1 and application thereof | |
| CN106967663A (en) | A kind of recombinant bacterial strain for crop disease control |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120523 Termination date: 20151021 |
|
| EXPY | Termination of patent right or utility model |