CN101671711A - Method for preparing ultra-low molecular weight heparin - Google Patents

Abstract

The invention discloses a method for preparing ultra-low molecular weight heparin. The method comprises the steps: using maltose binding protein-heparinase I fusion protein to degrade the heparin in substrate, and obtaining the ultra-low molecular weight heparin; the maltose binding protein-heparinase I fusion protein has amino acid residue sequence of SEQ ID No: 1 in a sequence table; and the dosage of the maltose binding protein-heparinase I fusion protein is 0.4-4.0 IU/g of the heparin, preferentially 1.6IU/g of the heparin. Therefore, the ultra-low molecular weight heparin produced by utilizing the fusion protein has ideal average molecular weight and narrow molecular weight distribution range, thus having great industrial application value.

Description

A kind of method for preparing ultra-low molecular weight heparin

Technical field

The present invention relates to biological technical field, particularly a kind of method for preparing ultra-low molecular weight heparin.

Background technology

Heparin is the mucopolysaccharide that is alternately formed with 1 → 4 glycosidic link by hexuronic acid (L-iduronic acid, D-glucuronic acid) and D-Glucosamine Sulphate, linear chain-like structure with six sugar or eight sugared repeating units, its molecular weight is between 3000-37000, and molecular-weight average is 15000.Since 1916 found heparin first, its application as anti-freezing reagent and anti-bolt reagent aspect medical more and more was subjected to people's attention.In addition, heparin also have anti-inflammatory, antianaphylaxis, antiviral, anticancer, transfer various biological function such as blood fat.But, because heparin has anticoagulating active, thus use heparin to cause bleeding in a large number and side effect such as induced platelet minimizing, thus limited heparin application clinically greatly.

Low molecular weight heparin (being called for short LMWH) (Robert J.Linhardt, PH.D.And Nur SibelGuany, M.S, Seminar in Thrombosis and Hemostasis, 1999,25 (3): 5-16) be some lower-molecular-weight components that when separating unfractionated heparin, obtain, or the small molecule segment that produces after the heparin cracking, length is about 1/3 of unfractionated heparin.The LMWHs molecular weight is between 3000-8000Da, and molecular-weight average is about 5000Da.Compare with unfractionated heparin, find by the inside and outside experiment of body, under Isodose, the anticoagulation of LMWHs is less than heparin, but its body is interior and external anti thrombotic action obviously is better than heparin.

Ultra-low molecular weight heparin (Ultra Low Molecular Weight Heparin, hereinafter to be referred as uLMWH) notion, though there is not clear and definite definition, but should be meant that disaccharides is above and be lower than a series of oligosaccharides (number-average molecular weight is below 2500) of low molecular weight heparin molecular-weight average, although ultra-low molecular weight heparin has very high anti-Xa factor activity, its anti-IIa factor active is very low.People find that also some comprise that the oligosaccharides of disaccharides also has some physiologically active.

(Maetzke J such as Maetzke, Hinrichs R, Schneider L A.et.al.Unexpecteddelayed-type hypersensitivity skin reaction to theultra-low-molecular-weight heparin fondarinux.Allergy.2005 60:413-415) finds delaying type can occur above quick symptom after some patient has used heparin and LMWH.Using nadroparin (LMWH that obtains with the nitrous acid edman degradation Edman) to occur the reaction of local skin itch after three days as an old lady of 59 years old.And using ultra-low molecular weight heparin-fondaparinux not cause side reaction, the molecular-weight average of this fondaparinux only has 1.7KD.

Early stage research is just found, the hemorrhage effect of heparin and its anticoagulation are also uncorrelated, because heparin disaccharides and tetrose that enzymolysis obtains do not have anticoagulating active, but effective aspect the normal hemostatic mechanism of destruction equally, in view of the above, people propose such hypothesis, and promptly heparin and heparin fragment can disturb tetanic spasm by the acceptor on smooth muscle cell surface.The variation of calcium ion concn plays an important role in Muscle contraction in the smooth muscle cell, and calcium ion is by the turnover of the calcium channel on cytolemma cell.Shijo (Shinjo S, Ivarne L S, Oliverira V, et.al.Heparin and heparan sulfate disaccharides bind to the exchangerinhibitor peptide region of Na+/Ca2+exchanger and reduce the cytosoliccalcium of smmoth muscle cell lines.J.Biol.Chem.2002,227:48227-48233) etc. discovery have only heparin and Suleparoid disaccharides can with Na ⁺/ Ca ²⁺Passage interacts, and causes that calcium ion leaks, thereby has reduced calcium ion concn (about 80%) in the smooth muscle cell significantly.This characteristic of heparin disaccharides and relevant oligosaccharides may be at the treatment atrial fibrillation, and there is using value aspects such as stenocardia.

The heparin disaccharides can also suppress the cell migration of NF-(kappa) B cell-stimulating and regulate signal conduction in the cell.Hecht etc. experimentize with the heparin disaccharides that enzymolysis produces, find that three sulfation disaccharides can suppress the immune response of T-cell medium, and regulate T-cell, scavenger cell, the intestinal epithelial cells excretory tumour caries factor (TNF-α), interleukin-8 (IL-8), IL-1B.Parallel laboratory test shows that low sulfation heparin disaccharides does not then show above-mentioned physiological function.Therefore the preparation of this compounds also is the problem that is worth research.

At present, the preparation method of LMWH and uLMWH (Zhang Wanzhong, Wang Yunshan, Ma Runyu, Su Zhiguo, state's biochemical drug magazine, 2001,22 (1): 48-51) mainly contain chemical cracking method and enzyme liberating method.Chemical degradation method is the method for industrial normal employing, mainly contains nitrous acid edman degradation Edman, β-cancellation edman degradation Edman, hydrogen peroxide degradation method, Periodic acid, hypochlorous acid, sulfuric acid-chlorsulfonic acid and gamma-irradiation method etc.But chemical cracking heparin reaction is violent, complex process, and reaction control is difficult, makes that some functional group in the heparin molecule is destroyed more or less in reaction process, thereby some bioactive functions is in various degree by more or less destruction.And the enzyme liberating method reaches the environment nontoxicity owing to reaction conditions gentleness, productive rate height, and operation is easy, control easy, becomes many glycobiology research workers' research focus.United States Patent (USP) (Nielsen, US 5106734,1992) utilizes the absorbance control quality product at 235nm place, can prepare the low molecule heparin product with ideal average molecular weight.(Yu Guangli, Wang Qun, Guan Huashi, Xu Jiamin, Robert J.Linhardt, Qingdao Marine University's journal, 2002,32 (2): 231-235) utilize heparinase that ox lung heparin is controlled enzymolysis, obtained the pure product of oligosaccharides of the polymerization degree 2～20 such as Yu Guangli.(high Ningguo such as high Ningguo, Cheng Xiulan, Yang Jing, Zhang Shuzheng, the microorganism journal, 1999,39 (1): 64-67) filtered out a kind of sheath amine alcohol liver bacterium that can produce heparinase, and utilize the enzyme liberating heparin produced, obtained a series ofly having anti-proliferation of smooth muscle activity and the anti-freezing very low Heparin Oligosaccharides of living.But, used heparinase need be through the purification step of multistep in these methods, yield is lower, the cost that causes enzyme very expensive (commodity Heparinase I price that the yellow liver bacterium of heparin that Canadian IBEX company provides produces price $200/0.1IU) has greatly limited the development that enzyme process prepares Low molecular heparin.Utilizing recombinant bacterial strain to produce Heparinase I is an extremely promising approach, but the as easy as rolling off a log formation inclusion body of the Heparinase I of generally recombinating needs complicated renaturation process could form activated protein.In addition, in the enzymic degradation heparin process, by conditions such as control degradation times, analysis can prepare ultra-low molecular weight heparin theoretically, but does not have relevant technical study report so far.

Summary of the invention

The object of the present invention is to provide a kind of method for preparing ultra-low molecular weight heparin.

Method provided by the invention is with maltose binding protein-Heparinase I fusion rotein degraded heparin, obtains ultra-low molecular weight heparin; The aminoacid sequence of described maltose binding protein-Heparinase I fusion rotein is as the SEQ ID № in the sequence table: shown in 1; The consumption of described maltose binding protein-Heparinase I fusion rotein is the 0.4-4.0IU/g heparin, preferably the 1.6IU/g heparin.

Above-mentioned maltose binding protein-Heparinase I fusion rotein prepares in accordance with the following methods: with plasmid pMal-hepA transformed into escherichia coli TB1, obtain containing the recombination bacillus coli TB1 (pMal-hepA) of pMal-hepA, cultivate recombination bacillus coli TB1 (pMal-hepA), abduction delivering obtains maltose binding protein-Heparinase I fusion rotein;

Described plasmid pMal-hepA will have SEQ ID № in the sequence table: the recombinant vectors that obtains between the BamHI of the described maltose binding protein of 2 dna sequence dna-Heparinase I fusion rotein encoding gene insertion pMal-p2x or pMal-c2x carrier and PstI recognition site.

Above-mentioned heparin is from heparin solution, and the concentration of heparin in heparin solution is 1-100g/L, preferably 50g/L.

Above-mentioned heparin solution is prepared with the following method: the heparin of 0.05-5g is joined 50ml contain 3.5mMCaCl ₂In the water of 200mM NaCl, regulate pH to 7.0 with 1M HCl solution then.

The condition of above-mentioned degraded is: temperature 10-45 ℃, and time 9-24h.

The condition of above-mentioned degraded is following 1) or 2) or 3) or 4) or 5) or 6):

1) temperature is 25-35 ℃, and the time is 9-24h;

2) temperature is 30 ℃, and the time is 9-24h;

3) temperature is 30 ℃, and the time is 9h;

4) temperature is 30 ℃, and the time is 14h;

5) temperature is 30 ℃, and the time is 19h;

6) temperature is 30 ℃, and the time is 24h

According to different requirements, can select the different reaction times, obtain the ultra-low molecular weight heparin of different molecular weight.

Above-mentioned degraded is stopping during for 200-280 when the absorbancy of reaction solution under 235nm, preferably stops during for 210-270 in absorbancy.

Above-mentioned degraded stops making reaction terminating by regulating pH to 2.0.

Also comprise following purification step after the above-mentioned degraded:

Reaction solution when 1) degraded stops is that 0.2 micron cellulose membrane filters through the aperture, obtains filtrate just;

2) the first filtrate that step 1) is obtained is that the ultra-filtration membrane of 3000-5000Da filters with molecular weight cut-off, obtains time filtrate;

3) with step 2) the inferior filtrate and the volume that obtain be that time filtrate volume 2-3 ethanol doubly mixes, and be centrifugal, receive and precipitate;

4) the precipitation washing with acetone that step 3) is obtained, evaporated under reduced pressure obtains the ultra-low molecular weight heparin of purifying.

Arbitrary above-mentioned heparin is meant the heparin soluble salt; Arbitrary above-mentioned ultra-low molecular weight heparin is meant the ultra-low molecular weight heparin soluble salt.

The ultra-low molecular weight heparin of indication of the present invention is meant that molecular weight is the ultra-low molecular weight heparin of 600-2500Da, is meant that specifically molecular weight is the ultra-low molecular weight heparin of 1852.9-2305.2Da.

Method of the present invention adopts maltose binding protein-Heparinase I fusion rotein to prepare ultra-low molecular weight heparin, because maltose binding protein has the ability that improves its fusion vector albumen solubility, therefore recombinant expressed MBP-HepA activity is very high; Thereby improved the efficient of degraded heparin; Method of the present invention on the other hand can adopt the bacterial cell disruption crude enzyme liquid to react, in subsequent technique, adopt the method for filtration and ultrafiltration to obtain final product, therefore this reaction has greatly reduced production cost, and the finished product weight recovery can reach more than 90%.In addition, utilize the affine adsorptive power of maltose binding protein (MBP), can be easy to realize the directed immobilization of Heparinase I, make the use repeatedly of enzyme become possibility, thereby improve enzyme reaction efficient, reduce the use cost of enzyme; Thereby further reduce the production cost of ultra-low molecular weight heparin.

The degree of carrying out that the present invention comes monitoring reaction by the absorbance that detects the 235nm place, thus controlling reaction time can be easy to obtain the narrow ultra-low molecular weight heparin of range of molecular weight distributions.Because production, immobilization and the use cost of MBP-HepA can significantly reduce, the method for therefore utilizing this fusion rotein production to have the narrow ultra-low molecular weight heparin of ideal average molecular weight and range of molecular weight distributions has huge industrial application value.

Description of drawings

Fig. 1 is the building process synoptic diagram of expression vector pMal-hepA.

Fig. 2 is the Heparinase I gene electrophoretogram that pcr amplification obtains from the heparin Flavobacterium.

Fig. 3 is the absorbancy graphic representation over time at 235nm place in the reaction process.

Fig. 4 produces uLMWH membrane bioreactor synoptic diagram for fusion heparinase.

Fig. 5 is that 270 o'clock termination reactions are filtered the resulting ultra-low molecular weight heparin product of purification process photo for absorbancy.

Embodiment

The invention will be further described below in conjunction with specific embodiment, but the present invention is not limited to following examples.

Among the following embodiment, if no special instructions, be ordinary method.

The fusion rotein of embodiment 1, maltose binding protein-Heparinase I (MBP-HepA) obtains

One, expresses the structure of the engineering bacteria of MBP-HepA

1, the structure that contains the expression vector pMal-hepA of Heparinase I encoding gene

The building process of expression vector pMAL-hepA as shown in Figure 1, detailed process is as follows: amplification Heparinase I gene from the genome DNA of heparin Flavobacterium (Flavabacterium heparinum) (buying from IAM), used upstream and downstream primer is respectively 5 ' GCCT GGATCCCAGCAAAAAAAATCCGGTAAC3 ' (base of band underscore is the enzyme recognition site of BamHI), 5 ' CTTA AAGCTTTTACTATCTGGCAGTTTCGCTGTAC 3 ' (base of band underscore is the HindIII enzyme recognition site) introduces BamHI and HindIII enzyme recognition site respectively.

The reaction system of pcr amplification is: 50ng template DNA, every kind of primer of 100pmol, 1 * amplification buffer (sky, Beijing is a Bioisystech Co., Ltd), every kind of dNTP of 200 μ mol/L, the high Pfu enzyme of protecting of 1 unit; Amplification program is: 95 degrees centigrade of sex change 5 minutes, and 50-60 (51,53,55,57 or 59 ℃) degree centigrade primer annealing 45 seconds, 72 degrees centigrade of primer extensions 90 seconds, after 30 circulations, 72 degrees centigrade are extended and finished reaction in 5 minutes.

This PCR result shows that amplification obtains the Heparinase I gene fragment of 1.1kb as shown in Figure 2.Order-checking shows, this fragment have in sequence table sequence 2 from 5 ' end 1180-2271 position nucleotide sequence.Among Fig. 2, it is 51,53,55,57 or 59 ℃ of amplifications that swimming lane 2-6 is respectively the primer annealing temperature, swimming lane 1 is molecular weight marker (stripe size is followed successively by 15kb, 10kb, 7500bp, 5000bp, 2500bp, 1000bp, 750bp), and arrow indication place is the 1.1kb target fragment.

Behind the above-mentioned PCR product usefulness BamHI and HindIII double digestion that obtains, be inserted into respectively between the BamHI and HindIII enzyme recognition site of pMal-p2x or pMal-c2x carrier (available from NEB company), obtain pMa1-c2x recombinant vectors or pMal-p2x recombinant vectors, with pMal-c2x recombinant vectors or pMal-p2x recombinant vectors difference transformed into escherichia coli JM109, with 5 ' GCCTGGATCCCAGCAAAAAAAATCCGGTAAC3 ' and 5 ' CTTAAAGCTTTTACTATCTGGCAGTTTCGCTGTAC 3 ' is primer, by bacterium colony PCR screening transformant, extraction can obtain pMal-c2x recombinant vectors or the pMal-p2x recombinant vectors in the transformant of 1.1kb PCR product, respectively by BamHI and the checking of HindIII double digestion.To obtain the segmental plasmid of 1.1kb by BamHI and HindIII double digestion and check order, will have the pMal-c2x recombinant vectors or the pMal-p2x recombinant vectors called after pMal-hepA from the Heparinase I gene fragment shown in 5 ' end 1180-2271 position of sequence 2 in the sequence table.In pMal-hepA, two successive termination codon TAGTAA are arranged between hepA gene and the lacZ α gene, expressed the MBP-hepA fusion rotein after, can stop protein translation effectively and can not express lacZ α albumen.

2, express the structure of the engineering bacteria of MBP-HepA

PMal-hepA transformed into escherichia coli TB1 (available from NEB company) with above-mentioned checking, obtain recombinant bacterial strain, recombinant bacterial strain is extracted plasmid, carry out the enzyme evaluation of cutting and check order, qualification result is shown the correct recombinant bacterial strain called after TB1/pMal-hepA that has changed pMal-hepA over to.

Two, the abduction delivering of the fusion rotein of maltose binding protein-Heparinase I (MBP-HepA)

1, the abduction delivering of the fusion rotein of maltose binding protein-Heparinase I (MBP-HepA)

Picking TB1/pMal-hepA bacterium colony is in 5mL LB substratum from flat board, 37 ℃ of cultivations (12～14h) overnight, by volume percentage composition is that 1% inoculum size inserts and contains in the 100mL LB substratum of penbritin Amp (final concentration is 100 μ g/mL) then, cultivate 3 hours (being that strain culturing is to logarithmic phase) for 37 ℃, add 1mM IPTG, in 15 ℃, 200rpm carried out inducing culture 21 hours, the nutrient solution that obtains is at 4 ℃, and the centrifugal 10min of 10000rpm collects thalline.

The TB1/pMal-hepA thalline pH that above-mentioned collection is obtained is 7.4, contain the 0.017mol/L Tris damping fluid washing thalline 2 times of 0.2M NaCl, the ratio that adds 1ml Tris damping fluid in the centrifugal thalline that obtains of every 2ml bacterium liquid, thalline is suspended in pH is 7.4, contain in the 0.017mol/L Tris damping fluid of 0.2M NaCl, ultrasonication in ice bath (output rating is 300W, each ultrasonic 3 seconds and intermittently 3 seconds processing 99 times).Cytoclasis liquid is at 4 ℃, and the centrifugal 30min of 13000rpm gets fusion rotein (MBP-HepA) crude enzyme liquid that supernatant liquor gets acellular maltose binding protein-Heparinase I.

2, MBP-HepA slightly proposes the measurement of enzyme liquid vigor

The detection of slightly carrying the enzyme activity of enzyme liquid is adopted the optical absorption method of 232nm, the enzyme of 1IU to live and is defined as the reaction effectiveness that 30 ℃ of per minutes produce 1 μ mol unsaturated link(age).The configuration of heparin substrate solution: the Tris damping fluid (17mMTris, 44mM NaCl, the 3.5mM CaCl that the commodity heparin (purchasing in the biochemical medicine company of Hebei Changshan limited-liability company) of 2.5g are dissolved in 100ml pH 7.4 ₂) in, obtaining heparin concentration is the heparin substrate solution of 25g/L.

Taking heparin substrate solution 0.5ml, the crude enzyme liquid of gained in the step 1 of adding step 2, other volume replenishes with the Tris damping fluid, and final reaction solution volume is 1.5ml, surveys the absorbancy changes delta A of inherent 232nm of unit time ₂₃₂Extinction coefficient epsilon=3800M ^-1Measurement result shows that the vigor of the crude enzyme liquid that said extracted obtains is the 4000IU/L crude enzyme liquid.

Embodiment 2, production ultra-low molecular weight heparin and detection thereof

One, produces ultra-low molecular weight heparin

1, the device of the production of ultra-low molecular weight heparin of the present invention

The reaction unit of the fusion rotein production ultra-low molecular weight heparin of maltose binding protein and Heparinase I comprises reactor 1, ultra-filtration equipment 2 and the container for storing liquid 3 of belt stirrer as shown in Figure 4; Wherein.Ultra-filtration equipment 2 is cross-current type ultra-filtration membrane (reflux stream to filtrate flow to quadrature), comprises ultra-filtration membrane 4, phegma outlet 5, filtrate outlet 7, reaction solution inlet 8.The outlet of the reaction solution of reactor 1 is connected with the reaction solution inlet 8 of ultra-filtration equipment 2 by pump, and the phegma of ultra-filtration equipment 2 exports 5 and is connected with reactor 1, and the filtrate outlet 7 of ultra-filtration equipment 2 is connected with container for storing liquid 3.Except that top main device, comprise that also an aperture is 0.2 micron the first filter device of cellulose membrane vacuum.Used cellulose membrane is available from the inferior scavenging material in last Haixing County factory in the first filter device of cellulose membrane vacuum, and diameter is 50 millimeters.Used container is a 250mL glassiness Erlenmeyer flask.Used vacuum pump is a diaphragm-type vacuum pump, and available from Japanese Ai Fake (ULVAC) company, model is DTC-21.

Ultra-filtration equipment 2 is available from U.S. Mi Libo (Millipore) company in the present embodiment, and model is Biomax 5, and wherein, the molecular weight cut-off of ultra-filtration membrane 4 is 5000 dalton.Reactor 1 is the vial of 150mL strap clamp layer, and the internal layer diameter is 4.8cm, and outer diameter is 7.8cm, highly is 10.5cm, and stirrer diameter is 2.0cm; Container for storing liquid 3 is a 100mL glassiness Erlenmeyer flask.

When above-mentioned reactor is worked, after substrate and enzyme react in reactor 1 and finish, with the aperture be 0.2 micron the cellulose membrane vacuum just filter device carry out filter just, afterwards first filtrate is shifted back reactor 1, pump into reaction solution inlet 8 in the ultra-filtration equipment 2 by pump, travel up to phegma along the space that ultra-filtration membrane 4 surrounds and export 5 reflux and filter, phegma flows back to by phegma outlet 5 and continues to be pumped to reaction solution inlet 8 continuous pump around circuits filtrations in the ultra-filtration equipment 2 in the reactor 1, in this process, part molecule and liquid leach by ultra-filtration membrane 4, enter in the container for storing liquid 3 by filtrate outlet 7 by ultrafiltrated, the liquid that container for storing liquid 3 obtains is ultrafiltrated.

2, the production of ultra-low molecular weight heparin

With commodity heparin (the commodity heparin also is a heparin sodium) (purchasing in the biochemical medicine company of Hebei Changshan limited-liability company) is raw material, the commodity heparin is joined 50mL contain 3.5mM CaCl ₂In the ultrapure water solution of 200mM NaCl, regulate pH to 7.0 with 1M HCl solution then, the concentration that is made into heparin is the solution of 50g/L, promptly obtains heparin solution.

The reactor 1 of reaction unit of the step 1 of present embodiment step 1 will respectively the heparin solution of the above-mentioned preparation of 4 parts of 50mL be placed respectively, be heated to 30 ℃ of constant temperature, adding enzyme that 1mL embodiment 1 obtains respectively lives and reacts (consumption of maltose binding protein-Heparinase I fusion rotein is (1ml*4000IU/L)/(50ml*50g/L)=1.6IU/g heparin) for the crude enzyme liquid of 4000IU/L, carrying out along with reaction, heparin is degraded gradually, 4 of generation, the unsaturated glycosidic link of 5-increases, absorbancy under 235nm constantly increases, at set intervals the A of monitoring reaction liquid ₂₃₅(detected result as shown in Figure 3), Fig. 3 shows, the A of initial reaction stage reaction solution ₂₃₅Increase in time and increasing, the two linearly sexual intercourse, the reaction later stage is along with the increase A of time ₂₃₅Gradually constant.A wherein ₂₃₅Be 210.3 o'clock, reacted 9 hours; A wherein ₂₃₅Be 230.2 o'clock, reacted 14 hours; A wherein ₂₃₅Be 250.1 o'clock, reacted 19 hours; A wherein ₂₃₅Be 270.1 o'clock, reacted 24 hours.

Respectively with these group reaction liquid at different A ₂₃₅(specifically as shown in table 1) with salt acid for adjusting pH value to 2.0 termination reaction after, be that 0.2 micron tunica fibrosa carries out just obtaining different A after the filter with the aperture ₂₃₅The time termination reaction the first filtrate of reaction solution, then reaction solution is pumped in the ultra-filtration equipment 2 of above-mentioned reaction unit and to obtain different A after with ultra-filtration membrane (molecular weight cut-off is 5000 dalton) first filtrate being filtered ₂₃₅The time termination reaction the inferior filtrate of reaction solution.Add in each group time filtrate respectively after 2.5 times of volume of ethanol mix, the centrifugal supernatant collecting precipitation of abandoning will add the washing with acetone evaporated under reduced pressure respectively in will precipitating then and promptly obtains different A ₂₃₅The time termination reaction ultra-low molecular weight heparin product powder that obtains.

Two, product detects

The heparin product powder that step 1 among the embodiment 2 obtains is got 20mg, be dissolved in the water of 2ml, make the testing sample solution that concentration is 10mg/mL.

Product molecular-weight average and distribution detection method thereof are as follows:

Testing sample solution adopt efficient exclusion chromatography measure its molecular-weight average and distribution thereof (Ahsan A, Jeske W, Mardiguian J, J.Pharm.Sci.1994,83:197-201).The gel chromatographic columns that adopts is TSK-Gel G3000SW, and used damping fluid is pH 5.0, contains the Na of quality percentage composition 2.84% ₂SO ₄Damping fluid.Specific operation process is as follows:

Use Tianjin, island chromatographic instrument (LC-10A), the outlet of chromatographic column connects UV-detector, and the UV-detector outlet connects differential refraction detector.35 ℃ of column temperatures, flow velocity 0.5mL/min, the detection wavelength is 235nm.Get low molecular weight heparin standard substance (10mg/mL, the moving phase preparation) 25 μ L sample introductions, write down two detector color atlass simultaneously, accurately measure sample and arrive time difference of two detectors, two color atlas time alignments are obtained the calibration curve of chromatographic column, and the retention time of using in the correction is as the criterion with the retention time of differential refraction detector.Calculate as follows:

$r=\frac{\mathrm{\ΣRI}}{\mathrm{\ΣUV}}---\left(1\right)$

$f=\frac{\mathrm{Mna}}{r}---\left(2\right)$

$\mathrm{Mi}=\frac{{\mathrm{fRI}}_i}{{\mathrm{UV}}_i}---\left(3\right)$

Wherein: ∑ RI and ∑ UV234 are respectively in the differential refraction detector color atlas in the total area at effective peak and the UV-detector color atlas the effectively total area at peak.The number-average molecular weight 3700 (EPCRS) that Mna is; RI _iAnd UV234 _iBe respectively the peak height of i time point two detector color atlass, Mi is the molecular weight of i time point.

Evenly select 5-7 Mi to do linear regression, obtain the linear equation of molecular weight logarithmic value and retention time, promptly obtain the typical curve of chromatographic column, guarantee correlation coefficient r＞0.99 with the corresponding residence time (Rti).

With testing sample solution 25 μ L sample introductions, write down the differential refraction detector color atlas then, press weight-average molecular weight Mw, number-average molecular weight Mn and the molecular weight distribution D thereof of following formula calculation sample:

$\mathrm{Mw}=\frac{\mathrm{\Σ}({\mathrm{RI}}_i*M_i)}{\mathrm{\Σ}{\mathrm{RI}}_i}---\left(4\right)$

$\mathrm{Mn}=\frac{\mathrm{\Σ}{\mathrm{RI}}_i}{\mathrm{\Σ}({\mathrm{RI}}_i/M_i)}---\left(5\right)$

$D=\frac{\mathrm{Mw}}{\mathrm{Mn}}---\left(6\right)$

The result is as shown in table 1, works as A ₂₃₅When being in 210-270, can access the ultra-low molecular weight heparin product that meets the molecular weight requirement, show that fusion heparinase I can effectively be used for the cleaner production of ultra-low molecular weight heparin, and at A ₂₃₅When being in 210-270, the distribution coefficient that obtains ultra-low molecular weight heparin is also less, illustrates to obtain the narrow ultra-low molecular weight heparin of range of molecular weight distributions in this scope.Wherein, absorbance A ₂₃₅Be that 270.1 o'clock termination reactions are filtered the resulting ultra-low molecular weight heparin product of purification process photo as shown in Figure 5.

The different A of table 1 ₂₃₅The time termination reaction gained uLMWH product parameters relatively

A during termination reaction 235	Number-average molecular weight M n	Weight-average molecular weight M w	Distribution coefficient D	Product yield
					??210.3	??2305.2	??2651.0	?1.15	??94.11％
??230.2	??2167.2	??2427.2	?1.12	??95.12％
					??250.1	??1877.2	??2102.5	?1.12	??95.17％
??270.1	??1852.9	??2056.7	?1.11	??97.23％

Sequence table

＜110〉Tsing-Hua University

＜120〉a kind of method for preparing ultra-low molecular weight heparin

<130>CGGNARL92531

<160>2

<210>1

<211>756

<212>PRT

＜213〉artificial sequence

<220>

<223>

<400>1

Met?Lys?Ile?Glu?Glu?Gly?Lys?Leu?Val?Ile?Trp?Ile?Asn?Gly?Asp?Lys

1???????????????5???????????????????10??????????????????15

Gly?Tyr?Asn?Gly?Leu?Ala?Glu?Val?Gly?Lys?Lys?Phe?Glu?Lys?Asp?Thr

20??????????????????25??????????????????30

Gly?Ile?Lys?Val?Thr?Val?Glu?His?Pro?Asp?Lys?Leu?Glu?Glu?Lys?Phe

35??????????????????40??????????????????45

Pro?Gln?Val?Ala?Ala?Thr?Gly?Asp?Gly?Pro?Asp?Ile?Ile?Phe?Trp?Ala

50??????????????????55??????????????????60

His?Asp?Arg?Phe?Gly?Gly?Tyr?Ala?Gln?Ser?Gly?Leu?Leu?Ala?Glu?Ile

65??????????????????70??????????????????75??????????????????80

Thr?Pro?Asp?Lys?Ala?Phe?Gln?Asp?Lys?Leu?Tyr?Pro?Phe?Thr?Trp?Asp

85??????????????????90??????????????????95

Ala?Val?Arg?Tyr?Asn?Gly?Lys?Leu?Ile?Ala?Tyr?Pro?Ile?Ala?Val?Glu

100?????????????????105?????????????????110

Ala?Leu?Ser?Leu?Ile?Tyr?Asn?Lys?Asp?Leu?Leu?Pro?Asn?Pro?Pro?Lys

115??????????????????120??????????????????125

Thr?Trp?Glu?Glu?Ile?Pro?Ala?Leu?Asp?Lys?Glu?Leu?Lys?Ala?Lys?Gly

130?????????????????135?????????????????140

Lys?Ser?Ala?Leu?Met?Phe?Asn?Leu?Gln?Glu?Pro?Tyr?Phe?Thr?Trp?Pro

145?????????????????150?????????????????155?????????????????160

Leu?Ile?Ala?Ala?Asp?Gly?Gly?Tyr?Ala?Phe?Lys?Tyr?Glu?Asn?Gly?Lys

165?????????????????170?????????????????175

Tyr?Asp?Ile?Lys?Asp?Val?Gly?Val?Asp?Asn?Ala?Gly?Ala?Lys?Ala?Gly

180?????????????????185?????????????????190

Leu?Thr?Phe?Leu?Val?Asp?Leu?Ile?Lys?Asn?Lys?His?Met?Asn?Ala?Asp

195?????????????????200?????????????????205

Thr?Asp?Tyr?Ser?Ile?Ala?Glu?Ala?Ala?Phe?Asn?Lys?Gly?Glu?Thr?Ala

210?????????????????215?????????????????220

Met?Thr?Ile?Asn?Gly?Pro?Trp?Ala?Trp?Ser?Asn?Ile?Asp?Thr?Ser?Lys

225?????????????????230?????????????????235?????????????????240

Val?Asn?Tyr?Gly?Val?Thr?Val?Leu?Pro?Thr?Phe?Lys?Gly?Gln?Pro?Ser

245?????????????????250?????????????????255

Lys?Pro?Phe?Val?Gly?Val?Leu?Ser?Ala?Gly?Ile?Asn?Ala?Ala?Ser?Pro

260?????????????????265?????????????????270

Asn?Lys?Glu?Leu?Ala?Lys?Glu?Phe?Leu?Glu?Asn?Tyr?Leu?Leu?Thr?Asp

275?????????????????280?????????????????285

Glu?Gly?Leu?Glu?Ala?Val?Asn?Lys?Asp?Lys?Pro?Leu?Gly?Ala?Val?Ala

290?????????????????295?????????????????300

Leu?Lys?Ser?Tyr?Glu?Glu?Glu?Leu?Ala?Lys?Asp?Pro?Arg?Ile?Ala?Ala

305?????????????????310?????????????????315?????????????????320

Thr?Met?Glu?Asn?Ala?Gln?Lys?Gly?Glu?Ile?Met?Pro?Asn?Ile?Pro?Gln

325?????????????????330?????????????????335

Met?Ser?Ala?Phe?Trp?Tyr?Ala?Val?Arg?Thr?Ala?Val?Ile?Asn?Ala?Ala

340?????????????????345?????????????????350

Ser?Gly?Arg?Gln?Thr?Val?Asp?Glu?Ala?Leu?Lys?Asp?Ala?Gln?Thr?Asn

355?????????????????360?????????????????365

Ser?Ser?Ser?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Leu?Gly?Ile

370?????????????????375?????????????????380

Glu?Gly?Arg?Ile?Ser?Glu?Phe?Gly?Ser?Gln?Gln?Lys?Lys?Ser?Gly?Asn

385?????????????????390?????????????????395?????????????????400

Ile?Pro?Tyr?Arg?Val?Asn?Val?Gln?Ala?Asp?Ser?Ala?Lys?Gln?Lys?Ala

405?????????????????410?????????????????415

Ile?Ile?Asp?Asn?Lys?Trp?Val?Ala?Val?Gly?Ile?Asn?Lys?Pro?Tyr?Ala

420?????????????????425?????????????????430

Leu?Gln?Tyr?Asp?Asp?Lys?Leu?Arg?Phe?Asn?Gly?Lys?Pro?Ser?Tyr?Arg

435?????????????????440?????????????????445

Phe?Glu?Leu?Lys?Ala?Glu?Asp?Asn?Ser?Leu?Glu?Gly?Tyr?Ala?Ala?Gly

450?????????????????455?????????????????460

Glu?Thr?Lys?Gly?Arg?Thr?Glu?Leu?Ser?Tyr?Ser?Tyr?Ala?Thr?Thr?Asn

465?????????????????470?????????????????475?????????????????480

Asp?Phe?Lys?Lys?Phe?Pro?Pro?Ser?Val?Tyr?Gln?Asn?Ala?Gln?Lys?Leu

485?????????????????490?????????????????495

Lys?Thr?Val?Tyr?His?Tyr?Gly?Lys?Gly?Ile?Cys?Glu?Gln?Gly?Ser?Ser

500?????????????????505?????????????????510

Arg?Ser?Tyr?Thr?Phe?Ser?Val?Tyr?Ile?Pro?Ser?Ser?Phe?Pro?Asp?Asn

515?????????????????520?????????????????525

Ala?Thr?Thr?Ile?Phe?Ala?Gln?Trp?His?Gly?Ala?Pro?Ser?Arg?Thr?Leu

530?????????????????535?????????????????540

Val?Ala?Thr?Pro?Glu?Gly?Glu?Ile?Lys?Thr?Leu?Ser?Ile?Glu?Glu?Phe

545?????????????????550?????????????????555?????????????????560

Leu?Ala?Leu?Tyr?Asp?Arg?Met?Ile?Phe?Lys?Lys?Asn?Ile?Ala?His?Asp

565?????????????????570?????????????????575

Lys?Val?Glu?Lys?Lys?Asp?Lys?Asp?Gly?Lys?Ile?Thr?Tyr?Val?Ala?Gly

580?????????????????585?????????????????590

Lys?Pro?Asn?Gly?Trp?Lys?Val?Glu?Gln?Gly?Gly?Tyr?Pro?Thr?Leu?Ala

595?????????????????600?????????????????605

Phe?Gly?Phe?Ser?Lys?Gly?Tyr?Phe?Tyr?Ile?Lys?Ala?Asn?Ser?Asp?Arg

610?????????????????615?????????????????620

Gln?Trp?Leu?Thr?Asp?Lys?Ala?Asp?Arg?Asn?Asn?Ala?Asn?Pro?Glu?Asn

625?????????????????630?????????????????635?????????????????640

Ser?Glu?Val?Met?Lys?Pro?Tyr?Ser?Ser?Glu?Tyr?Lys?Thr?Ser?Thr?Ile

645?????????????????650?????????????????655

Ala?Tyr?Lys?Met?Pro?Phe?Ala?Gln?Phe?Pro?Lys?Asp?Cys?Trp?Ile?Thr

660?????????????????665?????????????????670

Phe?Asp?Val?Ala?Ile?Asp?Trp?Thr?Lys?Tyr?Gly?Lys?Glu?Ala?Asn?Thr

675?????????????????680?????????????????685

Ile?Leu?Lys?Pro?Gly?Lys?Leu?Asp?Val?Met?Met?Thr?Tyr?Thr?Lys?Asn

690?????????????????695?????????????????700

Lys?Lys?Pro?Gln?Lys?Ala?His?Ile?Val?Asn?Gln?Gln?Glu?Ile?Leu?Ile

705?????????????????710?????????????????715?????????????????720

Gly?Arg?Asn?Asp?Asp?Asp?Gly?Tyr?Tyr?Phe?Lys?Phe?Gly?Ile?Tyr?Arg

725?????????????????730?????????????????735

Val?Gly?Asn?Ser?Thr?Val?Pro?Val?Thr?Tyr?Asn?Leu?Ser?Gly?Tyr?Ser

740?????????????????745?????????????????750

Glu?Thr?Ala?Arg

755

<210>2

<211>2271

<212>DNA

＜213〉heparin Flavobacterium (Flavabacterium heparinum)

<400>2

atgaaaatcg?aagaaggtaa?actggtaatc?tggattaacg?gcgataaagg?ctataacggt????60

ctcgctgaag?tcggtaagaa?attcgagaaa?gataccggaa?ttaaagtcac?cgttgagcat????120

ccggataaac?tggaagagaa?attcccacag?gttgcggcaa?ctggcgatgg?ccctgacatt????180

atcttctggg?cacacgaccg?ctttggtggc?tacgctcaat?ctggcctgtt?ggctgaaatc????240

accccggaca?aagcgttcca?ggacaagctg?tatccgttta?cctgggatgc?cgtacgttac????300

aacggcaagc?tgattgctta?cccgatcgct?gttgaagcgt?tatcgctgat?ttataacaaa????360

gatctgctgc?cgaacccgcc?aaaaacctgg?gaagagatcc?cggcgctgga?taaagaactg????420

aaagcgaaag?gtaagagcgc?gctgatgttc?aacctgcaag?aaccgtactt?cacctggccg????480

ctgattgctg?ctgacggggg?ttatgcgttc?aagtatgaaa?acggcaagta?cgacattaaa????540

gacgtgggcg?tggataacgc?tggcgcgaaa?gcgggtctga?ccttcctggt?tgacctgatt????600

aaaaacaaac?acatgaatgc?agacaccgat?tactccatcg?cagaagctgc?ctttaataaa????660

ggcgaaacag?cgatgaccat?caacggcccg?tgggcatggt?ccaacatcga?caccagcaaa????720

gtgaattatg?gtgtaacggt?actgccgacc?ttcaagggtc?aaccatccaa?accgttcgtt????780

ggcgtgctga?gcgcaggtat?taacgccgcc?agtccgaaca?aagagctggc?aaaagagttc????840

ctcgaaaact?atctgctgac?tgatgaaggt?ctggaagcgg?ttaataaaga?caaaccgctg????900

ggtgccgtag?cgctgaagtc?ttacgaggaa?gagttggcga?aagatccacg?tattgccgcc????960

actatggaaa?acgcccagaa?aggtgaaatc?atgccgaaca?tcccgcagat?gtccgctttc????1020

tggtatgccg?tgcgtactgc?ggtgatcaac?gccgccagcg?gtcgtcagac?tgtcgatgaa????1080

gccctgaaag?acgcgcagac?taattcgagc?tcgaacaaca?acaacaataa?caataacaac????1140

aacctcggga?tcgagggaag?gatttcagaa?ttcggatccc?agcaaaaaaa?atccggtaac????1200

atcccttacc?gggtaaatgt?gcaggccgac?agtgctaagc?agaaggcgat?tattgacaac????1260

aaatgggtgg?cagtaggcat?caataaacct?tatgcattac?aatatgacga?taaactgcgc????1320

tttaatggaa?aaccatccta?tcgctttgag?cttaaagccg?aagacaattc?gcttgaaggt????1380

tatgctgcag?gagaaacaaa?gggccgtaca?gaattgtcgt?acagctatgc?aaccaccaat????1440

gattttaaga?aatttccccc?aagcgtatac?caaaatgcgc?aaaagctaaa?aaccgtttat????1500

cattacggca?aagggatttg?tgaacagggg?agctcccgca?gctatacctt?ttcagtgtac????1560

ataccctcct?ccttccccga?caatgcgact?actatttttg?cccaatggca?tggtgcaccc????1620

agcagaacgc?ttgtagctac?accagaggga?gaaattaaaa?cactgagcat?agaagagttt????1680

ttggccttat?acgaccgcat?gatcttcaaa?aaaaatatcg?cccatgataa?agttgaaaaa????1740

aaagataagg?acggaaaaat?tacttatgta?gccggaaagc?caaatggctg?gaaggtagaa????1800

caaggtggtt?atcccacgct?ggcctttggt?ttttctaaag?ggtattttta?catcaaggca????1860

aactccgacc?ggcagtggct?taccgacaaa?gccgaccgta?acaatgccaa?tcccgagaat????1920

agtgaagtaa?tgaagcccta?ttcctcggaa?tacaaaactt?caaccattgc?ctataaaatg????1980

ccctttgccc?agttccctaa?agattgctgg?attacttttg?atgtcgccat?agactggacg????2040

aaatatggaa?aagaggccaa?tacaattttg?aaacccggta?agctggatgt?gatgatgact????2100

tataccaaga?ataagaaacc?acaaaaagcg?catatcgtaa?accagcagga?aatcctgatc????2160

ggacgtaacg?atgacgatgg?ctattacttc?aaatttggaa?tttacagggt?cggtaacagc????2220

acggtcccgg?ttacttataa?cctgagcggg?tacagcgaaa?ctgccagatg?a?????????????2271

Claims (9)

1, a kind of method for preparing ultra-low molecular weight heparin is with maltose binding protein-Heparinase I fusion rotein degraded heparin, obtains ultra-low molecular weight heparin; The aminoacid sequence of described maltose binding protein-Heparinase I fusion rotein is as the SEQ ID № in the sequence table: shown in 1; The consumption of described maltose binding protein-Heparinase I fusion rotein is the 0.4-4.0IU/g heparin, preferably the 1.6IU/g heparin.

2, method according to claim 1, it is characterized in that: described maltose binding protein-Heparinase I fusion rotein prepares in accordance with the following methods: with plasmid pMal-hepA transformed into escherichia coli TB1, obtain containing the recombination bacillus coli TB1 (pMal-hepA) of pMal-hepA, cultivate recombination bacillus coli TB1 (pMal-hepA), abduction delivering obtains maltose binding protein-Heparinase I fusion rotein;

Described plasmid pMal-hepA will have SEQ ID № in the sequence table: the recombinant vectors that obtains between the BamHI of the described maltose binding protein of 2 dna sequence dna-Heparinase I fusion rotein encoding gene insertion pMal-p2x or pMal-c2x carrier and PstI recognition site.

3, method according to claim 1 and 2 is characterized in that: described heparin is from heparin solution, and the concentration of heparin in heparin solution is 1-100g/L, preferably 50g/L.

4, method according to claim 3 is characterized in that: described heparin solution is prepared with the following method: the heparin of 0.05-5g is joined 50ml contain 3.5mM CaCl ₂In the water of 200mM NaCl, regulate pH to 7.0 with 1M HCl solution then.

5, according to the arbitrary described method of claim 1-4, it is characterized in that: the condition of described degraded is: temperature 10-45 ℃, and time 9-24h.

6, method according to claim 5 is characterized in that: the condition of described degraded is following 1) or 2) or 3) or 4) or 5) or 6):

1) temperature is 25-35 ℃, and the time is 9-24h;

2) temperature is 30 ℃, and the time is 9-24h;

3) temperature is 30 ℃, and the time is 9h;

4) temperature is 30 ℃, and the time is 14h;

5) temperature is 30 ℃, and the time is 19h;

6) temperature is 30 ℃, and the time is 24h

7, according to the arbitrary described method of claim 1-6, it is characterized in that: described degraded is stopping during for 200-280 when the absorbancy of reaction solution under 235nm, preferably stops during for 210-270 in absorbancy.

8, according to the arbitrary described method of claim 1-7, it is characterized in that: described degraded stops realizing by regulating pH to 2.0.

9, according to the arbitrary described method of claim 1-8, it is characterized in that: also comprise following purification step after the described degraded:

Reaction solution when 1) degraded stops is that 0.2 micron cellulose membrane filters through the aperture, obtains filtrate just;

2) the first filtrate that step 1) is obtained is that the ultra-filtration membrane of 3000-5000Da filters with molecular weight cut-off, obtains time filtrate;

3) with step 2) the inferior filtrate and the volume that obtain be that time filtrate volume 2-3 ethanol doubly mixes, and be centrifugal, receive and precipitate;

4) the precipitation washing with acetone that step 3) is obtained, evaporated under reduced pressure obtains the ultra-low molecular weight heparin of purifying.

Images