CN101664409A

CN101664409A - Stabilization of hypoxia inducible factor (HIF) alpha

Info

Publication number: CN101664409A
Application number: CN200910139446A
Authority: CN
Inventors: V·古恩泽勒-普卡尔; T·B·尼夫; Q·王; M·P·阿兰德; L·A·弗利平
Original assignee: Fibrogen Inc
Current assignee: Fibrogen Inc
Priority date: 2001-12-06
Filing date: 2002-12-06
Publication date: 2010-03-10
Also published as: CN101664553B; CN101664553A; CN101664552B; CN101664552A; CN101664551A; CN101664551B; CN101664408A; CN101664408B

Abstract

The present invention relates to methods of stabilizing the alpha subunit of hypoxia inducible factor (HIF). The invention further relates to methods of preventing, pretreating, or treating conditionsassociated with HIF, including ischemic and hypoxic conditions. Compounds for use in these methods are also provided.

Description

Stabilization of Hypoxia Inducible Factor (HIF) alpha

The present application is a divisional application of an invention patent application having an application date of 2002, 12/6/h, an application number of 02824098.7, and an invention name of "stabilization of Hypoxia Inducible Factor (HIF) alpha".

The present invention claims U.S. provisional patent application 60/337082, filed 12/6/2001, U.S. provisional patent application 60/359683, filed 2/25/2002, U.S. provisional patent application 60/349659, filed 1/16/2002, and U.S. provisional patent application 60/386488, filed 5/6/2002, each of which is incorporated herein by reference in its entirety.

Technical Field

The present invention relates to methods for stabilizing the alpha subunit of Hypoxia Inducible Factor (HIF), and to compounds useful in these methods.

Background

The early response to tissue hypoxia is the production of hypoxia-inducible factor (HIF), a basic helix-loop-helix (bHLH) PAS (Per/Arnt/Sim) transcriptional activator that buffers changes in gene expression against changes in oxygen concentration in the cell. HIF is a heterodimer comprising an oxygen-regulating alpha subunit (HIF α) and a beta subunit of an expression structure (HIF β), also known as the Arene Receptor Nuclear Transporter (ARNT). In normoxic (normoxic) cells, the HIF α subunit is rapidly degraded by a mechanism involving ubiquitination of the von Hippel-Lindau tumor suppressor (pVHL) E3 ligase complex. Under hypoxic conditions, HIF α is not degraded, and active HIF α/β complexes are enriched in the nucleus, stimulating the expression of several genes including glycolytic enzymes, glucose transporter (GLUT) -1, Erythropoietin (EPO), and Vascular Endothelial Growth Factor (VEGF). (Jiang et al (1996) J.biol.chem.271: 17771-17778; Iliopoulus et al (1996) Proc.Natl.Aced.Sci.USA 93: 10595-10599; Maxwell et al (1999) Nature 399: 271-275; Sutter et al (2000) Proc.Natl.Acad.Sci.USA 97: 4748-4753; Cockman et al (2000) J.biol.chem.275: 25733-25741; Tanimoto et al (2000) EMBO J19: 4298-179.)

In most cells, HIF α protein levels are elevated due to hypoxia, and HIF α is produced in vivo if the animal is anemic or hypoxic. Once hypoxic, HIF α levels rise within hours and return to baseline under sustained hypoxic conditions. HIF is involved in a myriad of cellular activities and developmental processes, including cell proliferation, angiogenesis, and cell cycle termination. Myocardial ischemia and early infarction, arterial hypertension, and inflammation are also associated with HIF α. While HIF α has been linked to tumor growth and metastasis, there is insufficient evidence that HIF is directly associated with tumorigenesis. Studies have shown that hypoxic preconditioning methods that induce short-term hypoxia in target tissues can protect the myocardium and brain from hypoxia-ischemia damage. Stabilization of HIF α is closely associated with ischemia and can be produced by preconditioning procedures. (Wang and Semenza (1993) Proc. Natl. Acad. Sci. USA 90: 4304-4308; Stroka et al (2001) FASEB J15: 2445-2450; Semenza et al (1997) Kidney Int 51: 553-555; Carmeliet et al (1998) Nature 394: 485-490; Zhong et al (1999) Cancer Res.59: 5830-5835; Lee et al (2000) N Engl J Med 343: 148-149; Sharp et al (2000) J Cerebb Blood Flow Met 20: 1011-1011; Semenza et al (2000) Adv Exp Med: 123-130; Thornton et al (2000) Biotron J350: 307-312; Deindza and (1998) Mo Et 43: 2000-2000; Cell 285-48: 76-2000)

Several researchers have investigated the mechanism of action between HIF α and pVHL. The oxygen-dependent degradation domain (ODD) in HIF-1 α from residues 401 to 603 was originally thought to be sufficient to impart oxygen instability to protein chimera structures. It was found that pVHL dependent degradation required the involvement of a portion of the ODD region from 526 to 652. Furthermore, in the retention region in the HIF α -homologous protein (residue 556-574 in HIF-1 α), P₅₆₄YI to aspartic acid or K₅₃₂The mutation to arginine confers stability to the entire HIF α protein under normoxic conditions and is resistant to pVHL-mediated degradation. (Huang et al (1998) Proc. Natl. Acad. Sci. USA 95: 7987-

HIF α levels are elevated under a number of hypoxia-like factors, including iron chimeras such as Desferoxamine (DFO) and divalent metal salts such as CoCl₂. Angiotensin II, coagulationBlood enzymes and platelet growth factor increase HIF α levels under normoxic conditions through mechanisms involving reactive oxygen species. HIF α has also been reported to be regulated by phosphorylation, a pathway involving phosphatidylinositol 3' -kinase (PI3K) activated by nitric oxide, hepatocyte growth factor, or protein kinase activated by mitogen. Glycogen synthase kinase is a downstream target of PI3K, directly phosphorylating the HIF α ODD domain. (Richard et al (2000) J Biol Chem 275: 26765-26771; Sandau et al (2000) Biochem Biophys Res Commun 278: 263-267; tacchini et al (2001) Cardigenesis 22: 1363-1371; Sodhi et al (2001) Biochem Biophys Res Commun 287: 292-300)

Hypoxia, a condition of reduced oxygen supply, occurs when lung function is impaired or blood flow decreases. Ischemic events associated with reduced blood flow can be caused by arterial or venous obstructions, such as blood clots (thrombi) or foreign circulatory material (emboli), or vascular abnormalities, such as arteriosclerosis. The decrease in blood flow may be sudden and short in duration (acute ischemia), or may be slow and long in duration or repeated (chronic ischemia). Acute ischemia is usually associated with local irreversible tissue necrosis (obstruction), while chronic ischemia is usually associated with transient hypoxic tissue damage. However, chronic ischemia may also be associated with obstruction if the duration of perfusion decline is too long or too severe. Obstructions often occur in the spleen, kidney, lung, brain and heart, resulting in diseases such as ileus, pulmonary obstruction, ischemic stroke and myocardial obstruction.

The pathological changes of ischemic abnormalities depend on the duration and severity of ischemia and the length of patient survival. Tissue necrosis occurs within the first 24 hours of obstruction, and a severe inflammatory response occurs in the visible tissue near the obstruction, with leukocytes migrating to the necrotic tissue area. Within the following days, the bacteriophagy action gradually breaks down and eliminates cells from the obstruction site, instead of collagen or colloidal eschar.

Hypoperfusion conditions or obstructions in one organ often propagate to other organs. For example, pulmonary ischemia, caused by pulmonary embolism and the like, not only affects the lungs, but also exposes the heart and other organs (e.g., the brain) to hypoxic stress. Myocardial obstruction often involves thrombosis-induced coronary artery obstruction, coronary wall spasm, or viral infection of the heart, leading to congestive heart failure and systemic hypotension. If the heart ceases to function normally for an extended period of time due to sustained hypotension, a second complication, such as ischemic encephalopathy, can develop. Cerebral ischemia is most commonly caused by vascular obstruction due to arteriosclerosis, which can range in severity from mild to transient cerebral ischemia (TIA) to severe to ileus or stroke. Although symptoms of TIA are temporary and recoverable, TIA is susceptible to relapse and often leads to stroke.

Obstructive arterial disease includes coronary artery disease, which can cause myocardial obstruction and peripheral arterial disease, affecting the abdominal aorta, its major arteries and the leg arteries. Peripheral artery disease includes Buerger's disease, Raynaud's disease, and cyanosis of the extremities. Although peripheral artery disease is usually caused by arteriosclerosis, other causes include diabetes and the like. Complications of peripheral artery disease include severe leg spasms, angina, arrhythmia, heart failure, heart disease, stroke, and renal failure.

Ischemia and hypoxia problems are important factors affecting morbidity and mortality. Cardiovascular disease causes at least 1500 million deaths per year, accounting for 30% of all deaths worldwide. Of the various cardiovascular diseases, ischemic heart disease and cerebrovascular disease cause about 17% of all deaths. 130 million, approximately 600 out of 10, reported cases of non-fatal severe myocardial obstruction suffer from the disease annually. Furthermore, it is estimated that 500 million americans suffer from venous thrombosis each year, of which about 60 million eventually suffer from pulmonary embolism. About 1/3 patients with pulmonary embolism eventually die, making pulmonary embolism the third leading cause of death in the united states.

Currently, treatment of ischemic and hypoxic diseases focuses on relieving symptoms and treating predisposing diseases. For example, treatment of myocardial obstruction includes the use of nitroglycerin and analgesics to control pain and relieve cardiac load. While other drugs are used to stabilize the condition, such as digoxin, diuretics, amrinone, beta-blockers, lipid lowering agents, and angiotensin converting enzyme inhibitors, none of the treatments are directed to tissue damage caused by ischemia and hypoxia.

Due to the deficiencies of current treatments, there remains a need for effective treatments for diseases caused by ischemia and hypoxia, such as obstructive arterial disease, angina, ileus, pulmonary obstruction, cerebral ischemia, and myocardial obstruction. In addition, there is a need for effective methods for preventing tissue damage due to ischemia, for example, due to arteriosclerosis, diabetes, and pulmonary diseases, such as pulmonary embolism. In summary, there is a need in the art for methods and compounds that can be used to stabilize HIF and treat and prevent HIF conditions, including conditions caused by ischemia and hypoxia.

Summary of The Invention

Described herein are methods for stabilizing the alpha subunit of hypoxia inducible factor (HIF α). These methods may be used in vivo or in vitro.

The present invention relates generally to methods of stabilizing the alpha subunit of Hypoxia Inducible Factor (HIF). In one embodiment, a method for stabilizing the alpha subunit of HIF (HIF α) comprises providing to a subject a compound capable of inhibiting a hydroxylation response in HIF α. In certain embodiments of the invention, HIF α is selected from the group consisting of HIF-1 α, HIF-2 α, HIF-3 α, and any fragments thereof. In another embodiment, the method comprises providing to the subject a compound that inhibits 2-oxoglutarate dioxygenase enzyme activity. In various embodiments, the 2-oxoglutarate dioxygenase is selected from the group consisting of EGLN1, EGLN2, EGLN3, procollagenprolyl 4-hydroxylase, procollagenprolyl 3-hydroxylase, procollagenlysylhydroxylase, PHD4, FIH-1, any fragment or subunit thereof.

Some particular methods of stabilizing HIF α of the invention include inhibiting HIF prolyl hydroxylase activity. In other embodiments, the HIF prolyl hydroxylase enzyme is selected from the group consisting of EGLN1, EGLN2, EGLN3, and any fragment or subunit thereof.

One aspect of the present invention provides methods for stabilizing endogenous HIF α. Thus, in a particular embodiment, HIF α is endogenous to the subject. Embodiments of the present invention include a method for stabilizing HIF α in a subject by providing a compound that stabilizes HIF α in the subject. The subject to be treated includes an animal, preferably a mammal, more preferably a human. Methods of in vitro administration are also contemplated. In this method, the subject may be a cell, a tissue, an organ, or the like. In certain embodiments, the subject may be a cell, tissue or organ within a system such as the kidney, heart, liver, lung, hematopoietic system, gastrointestinal, nervous system, or skeletal muscular system.

The invention also provides methods for treating, preventing, or pretreating a HIF-associated condition. In particular, the invention provides a method for treating, preventing, or pretreating a HIF-associated condition in a subject, the method comprising stabilizing HIF α. In particular, the present invention provides a method for treating, preventing, or pretreating/preconditioning HIF-associated conditions in a subject, the method comprising stabilizing HIF α. In particular, HIF-associated conditions include conditions associated with ischemia or hypoxia. A preferred aspect of the present invention includes administering to a subject a compound that stabilizes HIF α.

In various embodiments, the compound is selected from the group consisting of heterocyclic carboxamides, phenanthrolines, hydroxamic acids and physiologically active salts and prodrugs made thereof. In a particular embodiment, the compound is a heterocyclic carboxamide selected from the group consisting of pyridine carboxamides, quinoline carboxamides, isoquinoline carboxamides, cinnoline carboxamides and β -carboline carboxamides. In a preferred embodiment of the invention, the compound is provided in the form of an oral dosage. In another preferred embodiment, the compound is provided as a transdermal agent.

In one method of the invention for stabilizing HIF α, the compound stabilizes HIF α by specifically inhibiting hydroxylation of at least one amino acid residue in HIF α. In another aspect, the amino acid residue is selected from proline and asparagine.

Methods for treating, preventing, or pretreating a HIF-associated condition are provided, the methods comprising inhibiting 2-oxoglutarate dioxygenase enzyme activity, and methods wherein the HIF condition is associated with ischemia or hypoxia. In one aspect, the invention provides a method for treating, preventing, or pretreating a HIF-associated condition in a subject, the method comprising providing to the subject a compound capable of inhibiting 2-oxoglutarate dioxygenase enzyme activity.

In a preferred embodiment, the invention provides a method for treating, preventing, or pretreating/preconditioning a HIF-associated condition in a subject, the method comprising inhibiting HIF prolyl hydroxylase enzyme activity. Similarly, HIF-associated conditions include conditions associated with hypoxia or ischemia, among others. In a particular embodiment, the method comprises providing to a subject a compound that inhibits HIF prolyl hydroxylase activity.

In another embodiment, the method further comprises administering a second compound. In certain embodiments, the second compound inhibits the activity of 2-oxoglutarate dioxygenase, or the foregoing compound and the second compound inhibit the activity of different 2-oxoglutarate dioxygenase enzymes, or the second compound is selected from the group consisting of ACE inhibitors (ACEI), angiotensin II receptor blockers (ARB), diuretics, digoxin, statin, or carnitine, and the like.

In particular embodiments, HIF-associated conditions include pulmonary conditions (e.g., pulmonary embolism, etc.), cardiac conditions (e.g., myocardial infarction, congestive heart failure, etc.), neurological conditions, and the like. The present invention therefore specifically contemplates methods that can be used to treat, prevent, or pre-treat/pre-condition HIF-associated ischemic conditions/whether acute or transient or chronic. Acute ischemic conditions include conditions associated with surgery, organ transplantation, obstruction (e.g., brain obstruction, intestinal obstruction, myocardial infarction, lung obstruction, etc.), trauma, injury or trauma, and the like. Chronic ischemic conditions include hypertension, diabetes, closed artery disease, chronic venous insufficiency, Raynaud's disease, cirrhosis, congestive heart failure, systemic sclerosis, and the like.

The present invention specifically contemplates methods of preconditioning or pretreatment. In one embodiment, the invention provides methods for pretreating or preconditioning HIF conditions by stabilizing HIF α prior to the onset of a condition associated with the HIF condition, e.g., ischemia, or prior to the worsening of the condition associated with the HIF. Ischemia can be caused by acute events such as surgery (e.g., angioplasty, organ transplantation, etc.) and related therapeutic procedures such as the administration of anesthesia, etc. In addition, in chronic situations, methods of pretreatment or preconditioning are applicable to treating a subject suffering from a HIF condition for which a predisposition to worsen is predicted, e.g., short-term ischemia or angina pectoris, early stroke, myocardial infarction, and the like, in order to prevent or reduce the severity of the HIF condition. In a particular embodiment, a compound can be provided to a subject to increase an ischemic preconditioning factor, such as EPO.

Specifically, methods for increasing the expression of various HIF-associated factors are presented herein. In one aspect, the invention provides a method for increasing expression of an angiogenic factor in a subject, the method comprising stabilizing HIF α. In another aspect, the invention provides a method for increasing expression of glycolytic factors in a subject, the method comprising stabilizing HIF α. In yet another aspect, the invention provides methods for increasing expression of a factor associated with oxidative stress in a subject, the method comprising stabilizing HIF α. The invention also features a method for treating a condition associated with ischemia reperfusion injury in a subject, the method comprising stabilizing HIF α.

Also provided herein are methods of identifying compounds that stabilize HIF α. For example, the present invention provides a method for identifying a compound that stabilizes HIF α, comprising: (a) providing a compound of interest to a patient or a sample from a patient; (b) determining HIF α levels in the patient or sample; (c) comparing the level of HIF α in the subject or sample to a standard level, and if the level of HIF α in the subject or sample is increased, indicating that the compound stabilizes HIF α.

In another aspect, the present methods can be used to prevent tissue damage caused by HIF-associated conditions, including, but not limited to, ischemia and hypoxic conditions. In one embodiment, treatment is dependent on a previously diagnosed condition, such as hypertension, diabetes, occlusive arterial disease, chronic venous insufficiency, acroarterial spasm, cirrhosis, congestive heart failure, systemic sclerosis, and the like.

In another aspect, the present methods can be used as a pretreatment method for reducing or preventing tissue damage caused by HIF disorders, including, but not limited to, ischemia and hypoxic conditions. In one embodiment, the need for pretreatment depends on the patient's history of ischemic disease, such as myocardial infarction or temporary ischemia recurrence cycle, or the patient has persistent ischemic symptoms, such as angina pectoris. In another embodiment, whether pre-treatment is required depends on physical parameters indicative of possible ischemia or hypoxia, such as where the individual is under general anesthesia or temporarily working at high altitude. In yet another embodiment, the methods of the invention may be used in organ transplantation to pre-treat an organ donor and protect the organ prior to its removal from the body but prior to transplantation into a recipient.

In another aspect, the invention provides compounds that stabilize HIF α and methods of using such compounds to prevent, treat or ameliorate HIF conditions, as described above. In one embodiment, an effective amount of a compound or a pharmaceutically acceptable salt thereof can be administered to a subject having a HIF condition, alone or in combination with a pharmaceutically acceptable excipient. In one embodiment, the compound should be administered immediately upon diagnosis of severe ischemia. In another embodiment, the compound is administered to a patient during a chronic ischemic disease. In yet another embodiment, the ischemia is caused by a temporary or severe trauma, injury, or trauma, such as spinal cord injury. In one embodiment, the compound is administered to the patient as needed after the patient has been diagnosed with a pulmonary disease, such as COPD or the like.

The compounds can be administered to a subject suffering from a predisposition to a disease, such as a chronic disease, or as a pretreatment to reduce or prevent tissue damage caused by a HIF disease. In particular, the compounds can be administered to patients who have a history of recurrence of ischemic disease, such as myocardial infarction or transient ischemia, or who have symptoms of persistent ischemia, such as angina pectoris and the like. In another embodiment, the administration of the compound is dependent on a physical parameter indicative of possible ischemia or hypoxia, such as where the individual is under general anesthesia or temporarily working at high altitude. In yet another embodiment, the compounds may be used in organ transplantation for the pretreatment of organ donors and to protect organs after they have been removed from the body but prior to transplantation into recipients.

In one aspect, the compounds of the invention stabilize HIF α by specifically inhibiting hydroxylation of amino acid residues in HIF α proteins. In one embodiment, the agent inhibits hydroxylation of HIF α proline residues. In one embodiment, the agent inhibits HIF-1. alpha.P₅₆₄Hydroxylation of a residue or a homologous proline in another HIF α isomer. In another embodiment, the agent inhibits HIF-1. alpha.P₄₀₂Hydroxylation of a residue or a homologous proline in another HIF α isomer. In yet another embodiment, the compound additionally inhibits hydroxylation of HIF α asparagine residues. In one embodiment, the agent inhibits HIF-1. alpha.N₈₀₃Hydroxylation of residues or homologous asparagine residues in another HIF α isomer.

In a particular embodiment, the compound used in the process of the invention is selected from the group consisting of the compounds of formula (I)

Wherein,

a is 1, 2-arylene, 1, 3-arylene, 1, 4-arylene; or (C)₁-C₄) Alkylene (optionally one or more halogen atoms)Cyano, nitro, trifluoromethyl substituted), (C)₁-C₆) Alkyl radicals, (C)₁-C₆) -hydroxyalkyl, (C)₁-C₆) -alkoxy, -O- [ CH₂]_k-C_fH_(2f+1-g)-halogen_g、(C₁-C₆) -fluoroalkoxy, (C)₁-C₈) -fluorohydrocarbyleneoxy, (C)₁-C₈) -fluoroalkenyloxy, -OCF₂Cl，-O-CF₂-CHFCl；(C₁-C₆) -alkylmercapto, (C)₁-C₆) -alkylsulfinyl, (C)₁-C₆) Alkyl sulfonyl, (C)₁-C₆) -alkylcarbonyl, (C)₁-C₆) Alkoxycarbonyl, carbamoyl, N- (C)₁-C₄) -alkylcarbamoyl, N-di- (C)₁-C₄) -alkylcarbamoyl, (C)₁-C₆) -alkylcarbonyloxy, (C)₃-C₈) Cycloalkyl, phenyl, benzyl, phenoxy, anilino, N-methylanilino, phenylmercapto, phenylsulfamoyl, phenylsulfinyl, sulfamoyl, N- (C)₁-C₄) -alkylsulfamoyl, N-di- (C)₁-C₄) -alkylsulfamoyl substitution; or is (C)₆-C₁₂) -aryloxy group, (C)₇-C₁₁) Aralkyloxy, (C)₆-C₁₂) -aryl, (C)₇-C₁₁) Aralkyl (having 1 to 5 identical or different substituents in the aryl moiety, said substituents being selected from halogen, cyano, nitro, trifluoromethyl), (C)₁-C₆) Alkyl radicals, (C)₁-C₆) -alkoxy, -O- [ CH₂]_x-C_fH_(2f+1-g)-halogen_g、-OCF₂Cl、-O-CF₂-CHFCl、(C₁-C₆) -alkylmercapto, (C)₁-C₆) -alkylsulfinyl, (C)₁-C₆) Alkyl sulfonyl, (C)₁-C₆) Alkylcarbonyl, carbamoyl, N- (C)₁-C₄) -alkylcarbamoyl, N-di- (C)₁-C₄) -alkylcarbamoyl, (C)₁-C₆) -alkylcarbonyloxy, (C)₃-C₈) Cycloalkyl, sulfamoyl, N- (C)₁-C₄) -alkylsulfamoyl, N-di- (C)₁-C₄) -alkylsulfamoyl substitution; or A is CR⁵R⁶，R⁵And R⁶Each independently selected from hydrogen and (C)₁-C₆) Alkyl radicals, (C)₃-C₇) -cycloalkyl, aryl, or a substituent of an alpha carbon atom of an alpha amino acid, wherein the amino acid is a natural L amino acid or a D isomer thereof.

B is-COH₂、-NH₂、-NHSO₂CF₃Tetrazolyl, imidazolyl, 3-hydroxyisoxazolyl, -CONHCOR '", -CONHSOR'", wherein R '"is aryl, heteroaryl, (C'") and₃-C₇) -cycloalkyl, (C)₁-C₄) -alkyl, optionally with (C)₁-C₄) Thioalkyl, (C)₁-C₄) -sulfinyl group, (C)₁-C₄) -thioacyl, CF3, Cl, Br, F, I, NO2, -COOH, (C)₂-C₅) Alkoxycarbonyl, NH₂Mono- (C)₁-C₄-alkyl) -amino, di- (C)₁-C₄-alkyl) -amino or (C)₁-C₄) -perfluoroalkyl substitution; or B is CO₂-G carboxyl, wherein G is a radical of an alcohol G-OH, G being selected from (C)₁-C₂₀) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (C)₂-C₂₀) -alkenyl, (C)₃-C₈) Cycloalkenyl, retinyl, (C)₂-C₂₀) -alkynyl, (C)₄-C₂₀) -alkapolyenyl (alkenynyl), wherein alkenyl, cycloalkenyl, alkynyl and alkapolyenyl comprise one or more multiple bonds; (C)₆-C₁₆) Carbocyclic aryl group, (C)₇-C₁₆) -aralkyl, heteroaryl or heteroaralkyl, wherein the heteroaryl or heteroaryl portion of the heteroaralkyl contains 5 to 6 ring atoms; the group defined by G may be substituted with one or more other groups including hydroxy, halogen, cyano, trifluoromethyl, nitro, carboxy, (C)₁-C₁₂) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (C)₅-C₈) -cycloalkenyl, (C)₆-C₁₂) -aryl, (C)₇-C₁₆) Aralkyl, (C)₂-C₁₂) -alkenyl, (C)₂-C₁₂) -alkynyl, (C)₁-C₁₂) -alkoxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) Alkyl radicals, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkoxy, (C)₆-C₁₂) -aryloxy group, (C)₇-C₁₆) Aralkyloxy, (C)₁-C₈) -hydroxyalkyl, -O- [ CH₂]_x-C_fH_(2f+1-g)-F_g、-OCF₂Cl、-O-CF₂-CHFCl、(C₁-C₁₂) -alkylcarbonyl, (C)₂-C₈) -cycloalkylcarbonyl, (C)₆-C₁₂) -arylcarbonyl group, (C)₇-C₁₆) Aralkyl carbonyl, cinnamoyl, (C)₂-C₁₂) -alkenylcarbonyl, (C)₂-C₁₂) -alkynylcarbonyl, (C)₁-C₁₂) Alkoxycarbonyl, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkylcarbonyl, (C)₆-C₁₂) -aryloxycarbonyl, (C)₇-C₁₆) Aralkoxycarbonyl radical, (C)₃-C₈) -cycloalkoxycarbonyl, (C)₂-C₁₂) -alkenyloxycarbonyl, (C)₂-C₁₂) -alkynyloxycarbonyl, acyloxy, (C)₁-C₁₂) -alkoxycarbonyloxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkylcarbonyloxy, (C)₆-C₁₂) -aryloxycarbonyloxy, (C)₇-C₁₆) An aralkyloxycarbonyloxy group, a (C)₃-C₈) -cycloalkoxycarbonyloxy, (C)₂-C₁₂) -alkenyloxycarbonyloxy, (C)₂-C₁₂) -alkynyloxycarbonyloxy, carbamoyl, N- (C)₁-C₁₂) -alkylcarbamoyl, N-di- (C)₁-C₁₂) -alkylcarbamoyl, N- (C)₃-C₈) -Cycloalkylcarbamoyl, N- (C)₆-C₁₆) Aryl carbamoyl, N- (C)₇-C₁₆) Aralkyl carbamoyl radical, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₆) Aryl carbamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyl, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyl, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₆) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, carbamoyloxy, N- (C)₁-C₁₂) -alkylcarbamoyloxy, N-di- (C)₁-C₁₂) -alkylcarbamoyloxy, N- (C)₃-C₈) -cycloalkylcarbamoyloxy, N- (C)₆-C₁₂) Aryl carbamoyloxy, N- (C)₇-C₁₆) -aralkyl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₆) Aryl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyloxy, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyloxy, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₆) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, amino, (C)₁-C₁₂) Alkylamino, di (C)₁-C₁₂) -alkylamino, (C)₃-C₈) -cycloalkylamino, (C)₂-C₁₂) -alkenylamino, (C)₂-C₁₂) -alkynylamino, N- (C)₆-C₁₂) Arylamino, N- (C-C)₁₁) -aralkylamino, N-alkyl-arylamino, (C)₁-C₁₂) -alkoxy-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -cycloalkylcarbonylamino group, (C)₆-C₁₂) -arylcarbonylamino group, (C)₇-C₁₆) -aralkylcarbonylamino, (C)₁-C₁₂) -alkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -Cycloalkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₆-C₁₂) -arylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₇-C₁₁) -aralkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₁-C₁₂) -alkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₃-C₈) -cycloalkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -arylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -aralkylcarbonylamino- (C)₁-C₈) Alkyl, amino- (C)₁-C₁₀) Alkyl, N- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N-di- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl radicals, (C)₃-C₈) -cycloalkylamino- (C)₁-C₁₀) Alkyl radicals, (C)₁-C₁₂) -alkylmercapto, (C)₁-C₁₂) -alkylsulfinyl, (C)₁-C₁₂) Alkyl sulfonyl, (C)₆-C₁₆) Aryl mercapto, (C)₆-C₁₆) -arylsulfinyl, (C)₆-C₁₂) Aryl thioacyl, (C)₇-₁₆) -aralkylthio, (C)₇-C₁₆) -arylsulfinyl, (C)₇-C₁₂) Arylsulfonyl, sulfamoyl, N- (C)₁-C₁₀) -alkylsulfamoyl, N-di- (C)₁-C₁₀) -alkylsulfamoyl, (C)₃-C₈) -Cycloalkylsulfamoyl, N- (C)₆-C₁₂) Alkylsulfamoyl, N- (C)₇-C₁₆) Aralkyl sulfamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₂) Arylsulfamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) Aralkyl sulfamoyl, (C)₁-C₁₀) -alkylsulfonamido, N- ((C)₁-C₁₀) -alkyl) - (C₁-C₁₀) -alkylsulfonamido, (C)₇-C₁₆) -aralkylsulfonamido or N- ((C)₁-C₁₀) -alkyl) - (C₇-C₁₆) -an aralkyl sulfonamido group; wherein the aryl group or the aryl group of the aryl-containing group may be substituted with 1 to 5 same or different groups including hydroxy, halogen, cyano, trifluoromethyl, nitro, carboxy, (C)₁-C₁₂) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (C)₆-C₁₂) -aryl, (C)₇-C₁₆) Aralkyl, (C)₁-C₁₂) -alkoxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) Alkyl radicals, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkoxy, (C)₆-C₁₂) -aryloxy group, (C)₇-C₁₆) Aralkyloxy, (C)₁-C₈) -hydroxyalkyl, (C)₁-C₁₂) -alkylcarbonyl, (C)₃-C₈) -cycloalkylcarbonyl, (C)₆-C₁₂) -arylcarbonyl group, (C)₇-C₁₆) -aralkylcarbonyl, (C)₁-C₁₂) Alkoxycarbonyl, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkoxycarbonylBase, (C)₆-C₁₂) -aryloxycarbonyl, (C)₇-C₁₆) Aralkoxycarbonyl radical, (C)₃-C₈) -cycloalkoxycarbonyloxy, (C)₂-C₁₂) -alkenyloxycarbonyloxy, (C)₂-C₁₂) -alkynyloxycarbonyloxy, (C)₁-C₁₂) -alkylcarbonyloxy, (C)₃-C₈) -cycloalkylcarbonyloxy, (C)₆-C₁₂) Aryl carbonyloxy, (C)₇-C₁₆) Aralkyl carbonyloxy, cinnamoyloxy, (C)₂-C₁₂) -alkenylcarbonyloxy, (C)₂-C₁₂) -alkynylcarbonyloxy, (C)₁-C₁₂) -alkoxycarbonyloxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkylcarbonyloxy, (C)₆-C₁₂) -aryloxycarbonyloxy, (C)₇-C₁₆) An aralkyloxycarbonyloxy group, a (C)₃-C₈) -cycloalkoxycarbonyloxy, (C)₂-C₁₂) -alkenyloxycarbonyloxy, (C)₂-C₁₂) -alkynyloxycarbonyloxy, carbamoyl, N- (C)₁-C₁₂) -alkylcarbamoyl, N-di- (C)₁-C₁₂) -alkylcarbamoyl, N- (C)₃-C₈) -Cycloalkylcarbamoyl, N- (C)₆-C₁₂) Aryl carbamoyl, N- (C)₇-C₁₆) Aralkyl carbamoyl radical, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₂) Aryl carbamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyl, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyl, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, carbamoyloxy, N- (C)₁-C₁₂) -alkylcarbamoyloxy, N-di- (C)₁-C₁₂) -alkylcarbamoyloxy, N- (C)₃-C₈) -cycloalkylcarbamoyloxy, N- (C)₆-C₁₂) Aryl carbamoyloxy, N- (C)₇-C₁₆) -aralkyl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₆) Aryl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyloxy, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyloxy, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₆) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, amino, (C)₁-C₁₂) Alkylamino, di (C)₁-C₁₂) -alkylamino, (C)₃-C₈) -cycloalkylamino, (C)₂-C₁₂) -alkenylamino, (C)₂-C₁₂) -alkynylamino, N- (C)₆-C₁₂) Arylamino, N- (C-C)₁₁) -aralkylamino, N-alkyl-arylamino, (C)₁-C₁₂) -alkoxy-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -cycloalkylcarbonylamino group, (C)₆-C₁₂) -arylcarbonylamino group, (C)₇-C₁₆) -aralkylcarbonylamino, (C)₁-C₁₂) -alkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -Cycloalkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₆-C₁₂) -arylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₇-C₁₁) -aralkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₁-C₁₂) -alkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₃-C₈) -cycloalkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -arylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -aralkylcarbonylamino- (C)₁-C₈) Alkyl, amino- (C)₁-C₁₀) Alkyl, N- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N-di- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N- (C)₃-C₈) -cycloalkylamino- (C)₁-C₁₀) Alkyl radicals, (C)₁-C₁₂) -alkylmercapto, (C)₁-C₁₂) -alkylsulfinyl, (C)₁-C₁₂) Alkyl sulfonyl, (C)₆-C₁₆) Aryl mercapto, (C)₆-C₁₆) -arylsulfinyl, (C)₆-C₁₂) Aryl thioacyl, (C)₇-C₁₆) -aralkylthio, (C)₇-C₁₆) -arylsulfinyl or (C)₇-C₁₂) -an aryl thioacyl group;

x is O or S;

q is O, S, NR' or a bond;

wherein, if Q is a bond, R⁴Is halogen, nitrile or trifluoromethyl;

alternatively, if Q is O, S, NR', then R⁴Is hydrogen, (C)₁-C₁₀) Alkyl radicals, (C)₂-C₁₀) -alkenyl, (C)₂-C₁₀) -alkynyl, wherein alkenyl or alkynyl comprises one or more C-C multiple bonds; has the chemical formula-O- [ CH₂]_x-C_fH_(2f+1-g)-F_gUnsubstituted fluoroalkyl group of (A), (B), (C)₁-C₈) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₁-C₆) -alkoxy- (C)₁-C₄) -alkoxy- (C)₁-C₄) Alkyl, aryl, heteroaryl, (C)₇-C₁₁) -aralkyl or a group having the formula shown in formula (Z)

-[CH₂]_v-[O]_w-[CH₂]_t-E (Z)

Wherein E is heteroaryl, (C)₃-C₈) -cycloalkyl or phenyl having the formula shown in formula F

v is a number of the groups 0 to 6,

w is a number of 0 or 1,

t is 0 to 3, and R⁷、R⁸、R⁹、R¹⁰And R¹¹May be the same or different and may be hydrogen, halogen, cyano, trifluoromethyl, nitro, carboxyl, (C)₁-C₆) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (C)₁-C₆) -aralkyl, -O- [ CH₂]_x-C_fH_(2f+1-g)-F_g、-OCF₂Cl、-O-CF₂-CHFCl、(C₁-C₆) -alkylmercapto, (C)₁-C₆) -hydroxyalkyl, (C)₁-C₆) -alkoxy- (C)₁-C₆) -alkoxy, (C)₁-C₆) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₁-C₆) -alkylsulfinyl, (C)₁-C₆) Alkyl thioacyl、(C₁-C₆) -alkylcarbonyl, (C)₁-C₈) Alkoxycarbonyl, carbamoyl, N- (C)₁-C₈) -alkylcarbamoyl, N-di- (C)₁-C₈) -alkylcarbamoyl or (C)₇-C₁₁) Arylalkyl carbamoyl, optionally substituted by fluorine, chlorine, bromine, trifluoromethyl, (C)₁-C₆) Alkoxy, N- (C)₃-C₈) -Cycloalkylcarbamoyl, N- (C)₃-C₈) -cycloalkyl- (C)₁-C₄) -alkylcarbamoyl, (C)₁-C₆) -alkylcarbonyloxy, phenyl, benzyl, phenoxy, benzyloxy, NR^YR^ZWherein R is^YAnd R^ZIndependently selected from hydrogen, (C)₁-C₁₂) Alkyl radicals, (C)₁-C₈) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy- (C)₁-C₈) Alkyl radicals, (C)₃-C₁₀) -cycloalkyl, (C)₃-C₁₂) -alkenyl, (C)₃-C₁₂) -alkynyl, (C)₆-C₁₂) -aryl, (C)₇-C₁₁) Aralkyl, (C)₁-C₁₂) -alkoxy, (C)₇-C₁₂) -aryloxy group, (C)₁-C₁₂) -alkylcarbonyl, (C)₃-C₈) -cycloalkylcarbonyl, (C)₆-C₁₂) -arylcarbonyl group, (C)₇-C₁₆) -an aralkylcarbonyl group; or R^YAnd R^ZAre all- [ CH₂]_hIn which CH₂Can be O, S, N- (C)₁-C₄) -alkylcarbonylimino or N- (C)₁-C₄) -an alkoxycarbonylimino group; phenylmercapto, thiophenyl, phenylsulfinyl, phenylsulfamoyl, N- (C)₁-C₈) An alkylsulfamoyl group or an N, N-di- (C)₁-C₈) -an alkylsulfamoyl group; or R⁷And R⁸、R⁸And R⁹、R⁹And R¹⁰Or R¹⁰And R¹¹Are all selected from- [ CH₂]_nOr a chain of-CH-, wherein CH₂Optionally O, S, SO₂Or NR^YSubstitution; n is 3, 4 or 5; if E is heteroaryl, said group may contain 1 to 3 groups R⁷-R¹¹Substituents as defined, or if E is cycloalkyl, said group may contain one R⁷-R¹¹A substituent as defined;

or when Q is NR', R⁴Is R ', where R ' and R ' may be the same or different and may in particular be hydrogen, (C)₆-C₁₂) -aryl, (C)₇-C₁₁) Aralkyl, (C)₁-C₈) Alkyl radicals, (C)₁-C₈) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy- (C)₁-C₈) Alkyl radicals, (C)₁-C₁₀) -alkylcarbonyl, optionally substituted (C)₇-C₁₆) -aralkylcarbonyl or optionally substituted (C)₆-C₁₂) -an arylcarbonyl group; or R 'and R' are both- [ CH ]₂]_hIn which CH₂Is O, S, N-imidoyl or N- (C)₁-C₁₀) -an alkoxycarbonylimino group, h is 3-7.

Y is N or CR³；

R¹、R²And R³May be the same or different, and is specifically hydrogen, hydroxy, cyano, trifluoromethyl, nitro, carboxy, (C)₁-C₂₀) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (C)₃-C₈) -cycloalkyl- (C)₁-C₁₂) Alkyl radicals, (C)₃-C₈) -cycloalkoxy, (C)₃-C₈) -cycloalkyl- (C)₁-C₁₂) -alkoxy, (C)₃-C₈) -cycloalkoxy- (C)₁-C₁₂) Alkyl radicals, (C)₃-C₈) -cycloalkoxy- (C)₁-C₁₂) -alkoxy, (C)₃-C₈) -cycloalkyl- (C)₁-C₈) -alkyl- (C)₁-C₆) -alkoxy, (C)₃-C₈) -cycloalkyl- (C)₁-C₈) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₃-C₈) -cycloalkoxy- (C)₁-C₈) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₃-C₈₈) -cycloalkoxy- (C)₁-C₈) -alkoxy- (C)₁-C₆) -alkoxy, (C)₆-C₁₂) -aryl, (C)₇-C₁₆) Aralkyl, (C)₇-C₁₆) -aralkenyl, (C)₇-C₁₆) -aralkynyl, (C)₂-C₂₀) -alkenyl, (C)₂-C₂₀) -alkynyl, (C)₁-C₂₀) -alkoxy, (C)₂-C₂₀) -alkenyloxy, (C)₂-C₂₀) -alkynyloxy, retinoxy, (C)₁-C₂₀) -alkoxy- (C)₁-C₁₂) Alkyl radicals, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkoxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₈) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy group, (C)₇-C₁₆) Aralkyloxy, (C)₆-C₁₂) -aryloxy- (C)₁-C₆) -alkoxy, (C)₇-C₁₆) -aralkyloxy- (C)₁-C₆) Alkoxy group, (C)₁-C₁₆) -hydroxyalkyl, (C)₆-C₁₆) -aryloxy- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₆) -aralkyloxy- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy- (C)₁-C₈) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₇-C₁₂) -aralkyloxy- (C)₁-C₈) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₂-C₂₀) -alkenyloxy- (C)₁-C₆) Alkyl radicals, (C)₂-C₂₀) -alkynyloxy- (C)₁-C₆) Alkyl, retinoxy- (C)₁-C₆) -alkyl, -O- [ CH₂]_x-C_fH_(2f+1-8)-F_g、-OCF₂Cl、-O-CF₂-CHFCl、(C₁-C₂₀) -alkylcarbonyl, (C)₃-C₈) -cycloalkylcarbonyl, (C)₆-C₁₂) -arylcarbonyl group, (C)₇-C₁₆) Aralkyl carbonyl, cinnamoyl, (C)₂-C₂₀) -alkenylcarbonyl, (C)₂-C₂₀) -alkynylcarbonyl, (C)₁-C₂₀) Alkoxycarbonyl, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) Alkoxycarbonyl, (C)₆-C₁₂) -aryloxycarbonyl, (C)₇-C₁₆) Aralkoxycarbonyl radical, (C)₃-C₈) Cycloalkoxycarbonyl, (C)₂-C₂₀) -alkenyloxycarbonyl, retinoxycarbonyl, (C)₂-C₂₀) -alkynyloxycarbonyl, (C)₆-C₁₂) -aryloxy- (C)₁-C₆) Alkoxycarbonyl, (C)₇-C₁₆) -aralkyloxy- (C)₁-C₆) Alkoxycarbonyl, (C)₃-C₈) -cycloalkyl- (C)₁-C₆) Alkoxycarbonyl, (C)₃-C₈) -cycloalkoxy- (C)₁-C₆) Alkoxycarbonyl, (C)₁-C₁₂) -alkylcarbonyloxy, (C)₃-C₈) -cycloalkylcarbonyloxy, (C)₆-C₁₂) Aryl carbonyloxy, (C)₇-C₁₆) Aralkyl carbonyloxy, cinnamoyloxy, (C)₂-C₁₂) -alkenylcarbonyloxy, (C)₂-C₁₂) -alkynylcarbonyloxy, (C)₁-C₁₂) -alkoxycarbonyloxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkylcarbonyloxy, (C)₆-C₁₂) -aryloxycarbonyloxy, (C)₇-C₁₆) An aralkyloxycarbonyloxy group, a (C)₃-C₈) -cycloalkoxycarbonyloxy, (C)₂-C₁₂) -alkenyloxycarbonyloxy, (C)₂-C₁₂) -alkynyloxycarbonyloxy, carbamoyl, N- (C)₁-C₁₂) -alkylcarbamoyl, N-di- (C)₁-C₁₂) -alkylcarbamoyl, N- (C)₃-C₈) -RingAlkylcarbamoyl, N-bicyclo- (C)₃-C₈) -alkylcarbamoyl, N- (C)₁-C₁₀) Alkyl radical N- (C)₃-C₈) -Cycloalkylcarbamoyl, N- ((C)₃-C₈) -cycloalkyl- (C)₁-C₆) -alkyl) carbamoyl, N- (C)₁-C₆) Alkyl radical N- ((C)₃-C₈) -cycloalkyl- (C)₁-C₆) -alkyl) carbamoyl, N- (+) -dehydroabietyl carbamoyl, N- (C)₁-C₆) -alkyl-N- (+) -dehydroabietyl carbamoyl, N- (C)₆-C₁₂) Aryl carbamoyl, N- (C)₇-C₁₆) Aralkyl carbamoyl radical, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₂) Aryl carbamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyl, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyl, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl; CON (CH)₂)_hIn which CH₂Can be O, S, N- (C)₁-C₈) -alkylimino, N- (C)₃-C₈) -cycloalkylimino, N- (C)₃-C₈) -cycloalkyl- (C)₁-C₄) -alkylimino, N- (C)₆-C₁₂) Aryl imino, N- (C)₇-C₁₂) -aralkylimino, N- (C)₁-C₄) -alkoxy- (C)₁-C₆) -alkylimino substitution, h is 3-7; utensil for cleaning buttockCarbamoyloxy of formula R

Wherein R is^xAnd R^vEach independently selected from hydrogen, (C)₁-C₆) Alkyl radicals, (C)₃-C₇) -cycloalkyl, aryl or a substituent of the alpha carbon atom of an alpha amino acid, wherein the amino acid is a natural L amino acid or a D isomer thereof,

s is a number of 1 to 5,

t is OH or NR^*R^**，R^*、R^**And R^***May be the same or different and are selected from hydrogen, (C)₆-C₁₂) -aryl, (C)₇-C₁₁) Aralkyl, (C)₁-C₈) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (+) -dehydroabietyl, (C)₁-C₈) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -aralkyloxy- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy- (C)₁-C₈) Alkyl radicals, (C)₁-C₁₀) Alkanoyl, optionally substituted (C)₇-C₁₆) Aralkanoyl, optionally substituted (C)₆-C₁₂) -an aroyl group; or R^*And R^**Are all CH₂In which CH₂Can be O, S, SO₂N-acylamino, N- (C)₁-C₁₀) -alkoxycarbonylimino, N- (C)₁-C₈) -alkylimino, N- (C)₃-C₈) -cycloalkylimino, N- (C)₃-C₈) -cycloalkyl- (C)₁-C₄) -alkylimino, N- (C)₆-C₁₂) Aryl imino, N- (C)₇-C₁₆) -aralkylimino, N- (C)₁-C₄) -alkoxy- (C)₁-C₆) -alkylimino, h is 3 to 7;

carbamoyloxy, N- (C)₁-C₁₂) -alkylcarbamoyloxy, N-di- (C)₁-C₁₂) -alkylcarbamoyloxy, N- (C)₃-C₈) -cycloalkylcarbamoyloxy, N- (C)₆-C₁₂) Aryl carbamoyloxy, N- (C)₇-C₁₆) -aralkyl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₆) Aryl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyloxy, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyloxy, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₆) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, amino, (C)₁-C₁₂) Alkylamino, di (C)₁-C₁₂) -alkylamino, (C)₃-C₈) -cycloalkylamino, (C)₂-C₁₂) -alkenylamino, (C)₂-C₁₂) -alkynylamino, N- (C)₆-C₁₂) Arylamino, N- (C-C)₁₁) -aralkylamino, N-alkyl-arylamino, (C)₁-C₁₂) -alkoxy-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -cycloalkylcarbonylamino group, (C)₆-C₁₂) -arylcarbonylamino group, (C)₇-C₁₆) -aralkylcarbonylamino, (C)₁-C₁₂) -alkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -cycloalkylcarbonyl-N-(C₁-C₁₀) -alkylamino, (C)₆-C₁₂) -arylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₇-C₁₁) -aralkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₁-C₁₂) -alkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₃-C₈) -cycloalkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -arylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -aralkylcarbonylamino- (C)₁-C₈) Alkyl, amino- (C)₁-C₁₀) Alkyl, N- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N-di- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N- (C)₃-C₈) -cycloalkylamino- (C)₁-C₁₀) Alkyl radicals, (C)₁-C₁₂) -alkylmercapto, (C)₁-C₁₂) -alkylsulfinyl, (C)₁-C₁₂) Alkyl sulfonyl, (C)₆-C₁₆) Aryl mercapto, (C)₆-C₁₆) -arylsulfinyl, (C)₆-C₁₂) Aryl thioacyl, (C)₇-C₁₆) -aralkylthio, (C)₇-C₁₆) -arylsulfinyl, (C)₇-C₁₂) Arylsulfonyl, sulfamoyl, N- (C)₁-C₁₀) -alkylsulfamoyl, N-di- (C)₁-C₁₀) -alkylsulfamoyl, (C)₃-C₈) -Cycloalkylsulfamoyl, N- (C)₆-C₁₂) Alkylsulfamoyl, N- (C)₇-C₁₆) Aralkyl sulfamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₂) Arylsulfamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) Aralkyl sulfamoyl, (C)₁-C₁₀) -alkylsulfonamido, N- ((C)₁-C₁₀) -alkyl) - (C₁-C₁₀) -alkylsulfonamido, (C)₇-C₁₆) -aralkyl sulfonamido radicalOr N- ((C)₁-C₁₀) -alkyl) - (C₇-C₁₆) -an aralkyl sulfonamido group; wherein the aryl group or the aryl group of the aryl-containing group may be substituted with 1 to 5 same or different groups including hydroxy, halogen, cyano, trifluoromethyl, nitro, carboxy, (C)₁-C₁₂) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (C)₆-C₁₂) -aryl, (C)₇-C₁₆) Aralkyl, (C)₁-C₁₂) -alkoxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) Alkyl radicals, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkoxy, (C)₆-C₁₂) -aryloxy group, (C)₇-C₁₆) Aralkyloxy, (C)₁-C₈) -hydroxyalkyl, (C)₁-C₁₂) -alkylcarbonyl, (C)₃-C₈) -cycloalkylcarbonyl, (C)₆-C₁₂) -arylcarbonyl group, (C)₇-C₁₆) -aralkylcarbonyl, (C)₁-C₁₂) Alkoxycarbonyl, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) Alkoxycarbonyl, (C)₆-C₁₂) -aryloxycarbonyl, (C)₇-C₁₆) Aralkoxycarbonyl radical, (C)₃-C₈) -cycloalkoxycarbonyloxy, (C)₂-C₁₂) -alkenyloxycarbonyloxy, (C)₂-C₁₂) -alkynyloxycarbonyloxy, (C)₁-C₁₂) -alkylcarbonyloxy, (C)₃-C₈) -cycloalkylcarbonyloxy, (C)₆-C₁₂) Aryl carbonyloxy, (C)₇-C₁₆) Aralkyl carbonyloxy, cinnamoyloxy, (C)₂-C₁₂) -alkenylcarbonyloxy, (C)₂-C₁₂) -alkynylcarbonyloxy, (C)₁-C₁₂) -alkoxycarbonyloxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkylcarbonyloxy, (C)₆-C₁₂) -aryloxycarbonyloxy, (C)₇-C₁₆) An aralkyloxycarbonyloxy group, a (C)₃-C₈) -cycloalkoxycarbonyloxy, (C)₂-C₁₂) -alkenyloxycarbonyloxy, (C)₂-C₁₂) -alkynyloxycarbonyloxy, carbamoyl, N- (C)₁-C₁₂) -alkylcarbamoyl, N-di- (C)₁-C₁₂) -alkylcarbamoyl, N- (C)₃-C₈) -Cycloalkylcarbamoyl, N- (C)₆-C₁₂) Aryl carbamoyl, N- (C)₇-C₁₆) Aralkyl carbamoyl radical, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₂) Aryl carbamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyl, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyl, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, carbamoyloxy, N- (C)₁-C₁₂) -alkylcarbamoyloxy, N-di- (C)₁-C₁₂) -alkylcarbamoyloxy, N- (C)₃-C₈) -cycloalkylcarbamoyloxy, N- (C)₆-C₁₂) Aryl carbamoyloxy, N- (C)₇-C₁₆) -aralkyl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₆) Aryl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyloxy, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyloxy, N- ((C)₇-C₁₆) -aralkyl radicalOxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₆) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, amino, (C)₁-C₁₂) Alkylamino, di (C)₁-C₁₂) -alkylamino, (C)₃-C₈) -cycloalkylamino, (C)₂-C₁₂) -alkenylamino, (C)₂-C₁₂) -alkynylamino, N- (C)₆-C₁₂) Arylamino, N- (C-C)₁₁) -aralkylamino, N-alkyl-arylamino, (C)₁-C₁₂) -alkoxy-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -cycloalkylcarbonylamino group, (C)₆-C₁₂) -arylcarbonylamino group, (C)₇-C₁₆) -aralkylcarbonylamino, (C)₁-C₁₂) -alkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -Cycloalkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₆-C₁₂) -arylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₇-C₁₁) -aralkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₁-C₁₂) -alkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₃-C₈) -cycloalkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -arylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -aralkylcarbonylamino- (C)₁-C₈) Alkyl, amino- (C)₁-C₁₀) Alkyl, N- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N-di- (C)₁-C₁₀) -alkylamino-(C₁-C₁₀) Alkyl, N- (C)₃-C₈) -cycloalkylamino- (C)₁-C₁₀) Alkyl radicals, (C)₁-C₁₂) -alkylmercapto, (C)₁-C₁₂) -alkylsulfinyl, (C)₁-C₁₂) Alkyl sulfonyl, (C)₆-C₁₆) Aryl mercapto, (C)₆-C₁₆) -arylsulfinyl, (C)₆-C₁₂) Aryl thioacyl, (C)₇-C₁₆) -aralkylthio, (C)₇-C₁₆) -arylsulfinyl or (C)₇-C₁₆) -an aryl thioacyl group;

or R¹And R²Or R²And R³Form a chain [ CH ]₂]_oIt may be a saturated chain or an unsaturated chain containing a C ═ C double bond, in which 1 or 2 CH groups₂Optionally O, S, SO₂Or NR ', wherein R' is hydrogen, (C)₆-C₁₂) -aryl, (C)₁-C₈) Alkyl radicals, (C)₁-C₈) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -aralkyloxy- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy- (C)₁-C₈) Alkyl radicals, (C)₁-C₁₀) Alkanoyl, optionally substituted (C)₇-C₁₆) Aralkanoyl, optionally substituted (C)₆-C₁₂) -an aroyl group; o is 3, 4 or 5;

or R¹And R²Or R²And R³Form a 5, 6, 7, 8-tetrahydroisoquinoline ring, a 5, 6, 7, 8-tetrahydroquinoline ring or a 5, 6, 7, 8-tetrahydrocinnoline ring with a pyridine or pyridazine comprising them;

or R¹And R²Or R²And R³Form a 5-or 6-membered aromatic carbocyclic or heterocyclic ring;

or R¹And R²Or R²And R³With pyridine or pyridazine containing them to form an optionally substituted heterocyclic system, which may be selected from thienopyridinesFuropyridine, pyridopyridine, pyrimidopyridine, imidazopyridine, thiazolopyridine, oxazolopyridine, quinoline, isoquinoline, and cinnoline; wherein quinoline, isoquinoline and cinnoline preferably satisfy the formulae Ia, Ib and Ic;

wherein R is¹²-R²³Each independently of the other, is as defined for R¹、R²And R³；

Or a radical R¹And R²Together with the pyridine containing them, form a compound of formula Id:

wherein V is S, O or NR^kWherein R is^kSelected from hydrogen, (C)₁-C₆) -alkyl, aryl or benzyl; wherein aryl may be substituted as described above for 1-5 substituents;

and R is²⁴、R²⁵、R²⁶And R²⁷Each independently of the other, is as defined for R¹、R²And R³；

f is 1 to 8;

g is 0 or 1 to (2f + 1);

x is 0 to 3;

h is 3 to 7;

including physiologically active salts and prodrugs of the above compounds.

In certain embodiments, compounds of formula (I) above include, but are not limited to, [ (3-methoxy-pyridine-2-carbonyl) -amino ] -acetic acid; 3-methoxypyridine-2-carboxylic acid N- (((hexadecyloxy) -carbonyl) -methyl) -amide hydrochloride; 3-methoxypyridine-2-carboxylic acid N- (((1-octyloxy) -carbonyl) -methyl) -amide; 3-methoxypyridine-2-carboxylic acid N- (((hexyloxy) -carbonyl) -methyl) -amide; 3-methoxypyridine-2-carboxylic acid N- (((butoxy) -carbonyl) -methyl) -amide; racemic 3-methoxypyridine-2-carboxylic acid N- (((2-nonanyloxy) -carbonyl) -methyl) -amide; 3-methoxypyridine-2-carboxylic acid N- (((heptyloxy) -carbonyl) -methyl) -amide; 3-phenoxypyridine-2-carboxylic acid N- (((octyloxy) -carbonyl) -methyl) -amide; 3-benzyloxypyridine-2-carboxylic acid N- (((butoxy) -carbonyl) -methyl) -amide; 5- (((3- (1-butoxy) -propyl) -amino) -carbonyl) -3-methoxypyridine-2-carboxylic acid N- ((benzyloxycarbonyl) -methyl) -amide; 5- (((3- (1-butoxy) -propyl) -amino) -carbonyl) -3-methoxypyridine-2-carboxylic acid N- (((1-butoxy) -carbonyl) -methyl) -amide; 5- (((3-dodecyloxypropyl) -amino) -carbonyl) -3-methoxypyridine-2-carboxylic acid N- ((benzyloxycarbonyl) -methyl) -amide; [ (3-hydroxy-pyridine-2-carbonyl) -amino ] acetic acid; [ (3-methoxy-pyridine-2-carbonyl) -amino) ] acetic acid. In other embodiments, compounds of formula (Ia) above include, but are not limited to, N- ((3-hydroxy-6-isopropoxy-quinoline-2-carbonyl) -amino) acetic acid, N- ((6- (1-butoxy) -3-hydroxyquinolin-2-yl) -carbonyl) glycine, [ (3-hydroxy-6-trifluoromethoxy-quinoline-2-carbonyl) amino ] acetic acid, n- ((6-chloro-3-hydroxyquinolin-2-yl) -carbonyl) glycine, N- ((7-chloro-3-hydroxyquinolin-2-yl) -carbonyl) glycine and [ (6-chloro-3-hydroxy-quinoline-2-carbonyl) amino ] acetic acid. In other embodiments, compounds of formula (Ib) above include, but are not limited to, N- ((1-chloro-4-hydroxy-7- (2-propoxy) isoquinolin-3-yl) carbonyl) glycine, N- ((1-chloro-4-hydroxy-6- (2-propoxy) isoquinolin-3-yl) carbonyl) glycine, N- ((1-chloro-4-hydroxy-isoquinolin-3-yl) amino) acetic acid, N- ((1-chloro-4-hydroxy-7-methoxyisoquinolin-3-yl) carbonyl) glycine, N- ((1-chloro-4-hydroxy-6-methoxyisoquinolin-3-yl) carbonyl) glycine, N- ((7-butoxy) -1-chloro-4-hydroxyisoquinolin-3-yl) carbonyl) aminoacetic acid, N- ((6-benzyloxy-1-chloro-4-hydroxyisoquinolin-3-yl) amino) acetic acid, ((7-benzyloxy-1-chloro-4-hydroxyisoquinolin-3-yl) amino) acetic acid methyl ester, n- ((7-benzyloxy-1-chloro-4-hydroxyisoquinoline-3-carbonyl) amino) acetic acid, N- ((8-chloro-4-hydroxyisoquinolin-3-yl) carbonyl) aminoacetic acid, N- ((7-butoxy-4-hydroxyisoquinoline-3-carbonyl) amino) acetic acid.

In other embodiments, the compound used in the method of the invention is selected from compounds of formula (II)

Wherein R is²⁸Is hydrogen, nitro, amino, cyano, halogen, (C)₁-C₄) -alkyl, carboxyl or metabolically labile ester derivatives thereof; (C)₁-C₄) Alkylamino, di- (C)₁-C₄) -alkylamino, (C)₁-C₆) Alkoxycarbonyl, (C)₂-C₄) Alkanoyl, hydroxy- (C)₁-C₄) Alkyl, carbamoyl, N- (C)₁-C₄) -alkylcarbamoyl, (C)₁-C₄) Alkylthio group(s), (C)₁-C₄) -alkylsulfinyl, (C)₁-C₄) -alkylsulfanyl, thiophenyl, phenylsulfinyl, phenylsulfamoyl, the phenyl group optionally being 1-4 identical or different halogen substitutions, (C)₁-C₄) -alkoxy, (C)₁-C₄) -alkyl, cyano, hydroxy, trifluoromethyl, fluoro- (C)₁-C₄) -alkylthio, fluoro- (C)₁-C₄) -alkylsulfinyl, fluoro- (C)₁-C₄) Alkyl sulfonyl, (C)₁-C₄) -alkoxy- (C)₂-C₄) Alkoxycarbonyl, N-bis- [ (C)₁-C₄) -alkyl radical]Carbamoyl- (C)₁-C₄) Alkoxycarbonyl, (C)₁-C₄) -alkylamino- (C)₂-C₄) Alkoxycarbonyl, di- (C)₁-C₄) -alkylamino- (C)₂-C₄) Alkoxycarbonyl, (C)₁-C₄) -alkoxy- (C)₂-C₄) -alkoxy- (C)₂-C₄) -alkoxy radicalAlkylcarbonyl, (C)₂-C₄) -alkanoyloxy- (C)₁-C₄) Alkyl or N- [ amino- (C)₂-C₈) -alkyl radical]-a carbamoyl group;

R²⁹is hydrogen, hydroxy, amino, cyano, halogen, (C)₁-C₄) -alkyl, carboxyl or metabolically labile ester derivatives thereof; (C)₁-C₄) Alkylamino, di- (C)₁-C₄) -alkylamino, (C)₁-C₆) Alkoxycarbonyl, (C)₂-C₄) Alkanoyl radical, (C)₁-C₄) -alkoxy, carboxy- (C)₁-C₄) -alkoxy, (C)₁-C₄) -alkoxycarbonyl- (C)₂-C₄) Alkoxy, carbamoyl, N- (C)₁-C₈) -alkylcarbamoyl, N-di- (C)₁-C₈) -alkylcarbamoyl, N- [ amino- (C)₂-C₈) -alkyl radical]Carbamoyl, N- [ (C)₁-C₄) -alkylamino- (C)₁-C₈) -alkyl radical]Carbamoyl, N- [ di- (C)₁-C₄) -alkylamino- (C)₁-C₈) -alkyl radical]Carbamoyl, N-cyclohexylcarbamoyl, N-cyclopentylcarbamoyl, N- (C)₁-C₄) -alkylcyclohexylcarbamoyl, N- (C)₁-C₄) -alkylcyclopentylcarbamoyl, N-phenylcarbamoyl, N- (C)₁-C₄) alkyl-N-phenylcarbamoyl, N-diphenylcarbamoyl, N- [ phenyl- (C)₁-C₄) -alkyl radical]Carbamoyl, N- (C)₁-C₄) -alkyl-N- [ phenyl- (C)₁-C₄) -alkyl radical]Carbamoyl, or N, N-di [ phenyl- (C)₁-C₄) -alkyl radical]Carbamoyl, said phenyl being optionally substituted with 1 to 4 identical or different halogens, (C)₁-C₄) -alkoxy, (C)₁-C₄) Alkyl, cyano, hydroxy, trifluoromethyl, N- [ (C)₂-C₄) -alkanoyl radical]Carbamoyl, N- [ (C)₁-C₄) -alkoxycarbonyl group]Carbamoyl, N- [ fluoro- (C)₂-C₆) -alkyl radical]A carbamoyl group,N, N- [ fluoro- (C)₂-C₆) -alkyl radical]-N-(C₁-C₄) -alkylcarbamoyl, N- [ difluoro- (C)₂-C₆) -alkyl radical]Carbamoyl, 1-pyrrolyl-carbonyl, piperidinylcarbonyl, 1-piperazinyl-carbonyl, morpholinylcarbonyl, wherein the heterocyclic group is optionally substituted with 1 to 4 substituents; (C)₁-C₄) -alkyl, benzyl, 1, 2, 3, 4-tetrahydroisoquinolin-2-yl-carbonyl, N- [ di- (C)₁-C₄) -alkyl radical]Thiocarbamoyl, N- (C)₂-C₄) Alkanoylamino or N- [ (C)₁-C₄) -alkoxycarbonyl group]An amino group;

R³⁰is hydrogen, (C)₁-C₄) Alkyl radicals, (C)₂-C₄) -alkoxy, halogen, nitro, hydroxy, fluoro- (1-4C) alkyl or pyridyl;

R³¹is hydrogen, (C)₁-C₄) Alkyl radicals, (C)₂-C₄) Alkoxy, halogen, nitro, hydroxy, fluoro- (C)₁-C₄) Alkyl, pyridyl domain methoxy;

R³²is hydrogen, hydroxy, amino, (C)₁-C₄) Alkylamino, di (C)₁-C₄) -alkylamino, halogen, (C)₁-C₄) -alkoxy- (C)₂-C₄) -alkoxy, fluoro- (C)₁-C₆) -alkoxy, pyrrol-1-yl, piperidinyl, piperazin-1-yl or morpholinyl, wherein heterocyclyl is optionally 1-4 of the same or different (C)₁-C₄) -alkyl or phenyl substitution;

R³³and R³⁴Each independently selected from hydrogen, (C)₁-C₄) -alkyl and (C)₁-C₄) -an alkoxy group;

also included are pharmaceutically acceptable salts and prodrugs thereof.

In certain embodiments, the compounds of formula (II) include, but are not limited to, 4-oxo-1, 4-dihydro- [1, 10] phenanthroline-3-carboxylic acid, 3-carboxy-5-hydroxy-4-oxo-3, 4-dihydro-1, 10-phenanthroline, 3-carboxy-5-methoxy-4-oxo-3, 4-dihydro-1, 10-phenanthroline, ethyl 5-methoxy-4-oxo-1, 4-dihydro [1, 10] phenanthroline-3-carboxylate, 5-methoxy-4-oxo-1, 4-dihydro [1, 10] phenanthroline-3-carboxylic acid, and 3-carboxy-8-hydroxy-4-oxo-3, 4-dihydro-1, 10-phenanthroline.

The compounds may be administered alone or in combination with various other therapeutic approaches. In one embodiment, the compound is administered with another 2-oxoglutarate dioxygenase inhibitor, the two compounds having different specificities for the individual members of the 2-oxoglutarate dioxygenase family. The two compounds may be administered simultaneously in a certain ratio or sequentially during the course of treatment, for example for myocardial infarction. In a specific embodiment, one compound specifically inhibits HIF prolyl hydroxylase activity and another compound specifically inhibits collagen prolyl 4-hydroxylase activity. In another embodiment, the compounds are used with another therapeutic agent having a different mode of action, such as an ACE inhibitor (ACEI), angiotensin-II receptor blocker (ARB), diuretic and/or digoxin. In another embodiment, the compound is administered with carnitine.

In one aspect, the compounds of the invention inhibit one or more 2-oxoglutarate dioxygenase enzymes. In one embodiment, the compound inhibits at least two members of the 2-oxoglutarate dioxygenase family, e.g., HIF prolyl hydroxylase and collagen prolyl 4-hydroxylase, which may be the same or different in specificity. In another embodiment, the compound may be specific for a 2-oxoglutarate dioxygenase enzyme, such as a HIF prolyl hydroxylase, and exhibit little or no specificity for other family members.

Preferred embodiments of the present invention comprise methods of using oral or transdermal delivery mechanisms. Accordingly, the present invention also provides an oral medicament comprising a compound of the present invention. In another preferred embodiment, the method of the invention involves administering the compounds of the invention by a transdermal mechanism. Accordingly, the present invention also provides a transdermal patch comprising a compound of the present invention.

Those skilled in the art will readily appreciate from the disclosure herein that the above-described and other embodiments of the present invention are all specifically designed.

Brief description of the drawings

FIGS. 1A and 1B show the stabilization of HIF-1 α in cells treated with a compound of the invention. FIG. 1A shows the stabilization and enrichment of HIF-1 α in Human Foreskin Fibroblasts (HFFs) treated with various compounds of the invention. FIG. 1B is a graph showing the dose response of HIF-1 α stabilization and enrichment in various human cells treated with compounds of the invention. The cell lines shown in the figure include HFF, Human Microvascular Endothelial Cells (HMEC), venous endothelial cells (AG7), Human Umbilical Vein Endothelial Cells (HUVEC), squamous epithelial cancer cells (SCC), Human Lung Fibroblasts (HLF), mammary epithelial cancer cells (MCF7), degenerated fetal kidney cells (293A), and cervical cancer cells (HeLa).

FIGS. 2A and 2B show the stabilization and enrichment of HIF-1 α in human cells treated with compounds of the invention. FIG. 2A shows 293A and human hepatoma cells (Hep3B) treated with various compounds of the present invention. FIG. 2B is a graph showing the dose response of HIF-1 α stabilization in Hep3B cells treated with exemplary compounds of the invention.

FIGS. 3A and 3B show oxygen consumption and cell viability in human cells treated with compounds of the invention. FIG. 3A shows single dose and dose response oxygen consumption in cells treated with various compounds of the invention. FIG. 3B shows the cell proliferation and viability of cells treated with the compounds selected IN FIG. 3A, measured as the division of WST-1 tetrazolium salt (Roche Diagnostics Corp., Indianapolis IN).

FIGS. 4A and 4B show that human cells treated with compounds of the invention exhibit increased expression of HIF-responsive genes. FIG. 4A is a graph showing the levels of Vascular Endothelial Growth Factor (VEGF) in human cell culture media following treatment with a compound of the present invention, wherein the factor is a key gene in the process of angiogenesis. The cell lines shown in the figure are 293A, Hep3B and HFF. FIG. 4B shows the increase over time of aldolase in cells treated with a compound of the invention, where aldolase is a key enzyme in the glycolysis pathway.

FIGS. 5A and 5B show that the expression of angiogenesis proteins in the lungs of animals was increased after treatment with the compounds of the present invention. FIG. 5A is a composite graph showing the expression of angiogenic genes. Genes shown in the figure include Vascular Endothelial Growth Factor (VEGF) -C, Flt-1/VEGF receptor-1, renal medullasin, endothelin-1, Plasminogen Activator Inhibitor (PAI) -1, and Cyr 61. FIG. 5B shows gene expression during coding of a selection of endostatin-1 and renal medullasin from FIG. 5A.

FIGS. 6A and 6B show increased expression of HIF responsive genes in vivo. FIG. 6A shows that the transcriptional levels of VEGF in the liver and kidney of rats during the coding process are increased after treatment with a compound of the invention. Figure 6B shows the levels of VEGF in rat plasma at 2 hours, 5 hours, and 20 hours after final treatment with a compound of the invention, compared to untreated controls.

FIGS. 7A and 7B show that glycolytic enzyme expression was increased in animal kidneys after treatment with a compound of the invention. FIG. 7A is a composite graph showing glycolytic gene expression. Genes shown in the figure include aldolase-A, enolase-1, Glut1, Glut3, GAPDH, hexokinase-1 and-2, lactate dehydrogenase-A, phosphofructokinase-L and-C, phosphoglycerate kinase-1, and pyruvate kinase-M. FIG. 7B shows the gene expression during the coding process for aldolase-A and phosphofructokinase-L selected from FIG. 7A.

Fig. 8 shows the percent survival at different time intervals for the group treated with the compound of the present invention (n-34) and the untreated control group (n-34) in samples induced myocardial infarction.

FIGS. 9A and 9B show the improvement in heart architecture in animals with myocardial infarction compared to untreated controls following treatment with a compound of the invention. FIG. 9A shows the change in the end-systolic left ventricular diameter (LVESD) at different intervals in samples with myocardial infarction in the group treated with the compound of the present invention relative to the untreated control group. FIG. 9B shows the change in the end-diastolic diameter (LVEDD) of the left ventricle at different intervals in a sample with myocardial infarction in the group treated with the compound of the present invention relative to the untreated control group.

FIGS. 10A and 10B show improvement in cardiac function in animals with myocardial infarction relative to untreated controls following treatment with a compound of the invention. FIG. 10A is a graph showing the change in left ventricular ejection fraction at different intervals in a group of samples induced myocardial infarction treated with a compound of the present invention relative to an untreated control group. FIG. 10B is a graph showing a decrease in ejection fraction at different intervals in a myocardial infarction sample group treated with a compound of the present invention relative to an untreated control group.

FIG. 11 is a graph showing the contractile response of the heart after 4 weeks in a group of samples treated with the compounds of the present invention, including samples stimulated and not stimulated with isoproterenol, relative to an untreated control group.

FIGS. 12A and 12B show improvement in cardiac architecture after pretreatment of animals with myocardial infarction with a compound of the invention relative to untreated controls. FIG. 12A shows a statistically significant improvement in the reduction in ejection fraction (p < 0.05) in treated animals compared to untreated control animals 1 week after induction of myocardial infarction. FIG. 12B shows that the diameter of the end-diastolic phase of the left ventricle (LVEDD; p < 0.05) and the diameter of the end-systolic phase of the left ventricle (LVESD; p < 0.01) are statistically significantly improved in treated animals compared to untreated control animals 1 week after induction of myocardial infarction.

Figure 13 is a graph showing that the survival rate of animals pretreated prior to being subjected to renal ischemia reperfusion injury, and subsequently treated with a compound of the invention, was improved compared to untreated and sham operated samples.

Figures 14A and 14B show that pre-treatment of animals followed by renal ischemia reperfusion injury, followed by treatment with a compound of the invention, resulted in improved renal function compared to untreated control samples. FIG. 14A shows that treated animals received a lower level of nitrogen in the blood urine than untreated animals 3 days and 7 days after the induced ischemia reperfusion injury. Figure 14B shows the low blood cholesterol levels of treated animals compared to untreated animals after 3, 7, and 14 days of induced ischemia reperfusion injury.

Figures 15A and 15B show that animals treated with the present invention have improved treatment of chronic wounds compared to untreated controls. Figure 15A shows that after 7 and 10 days of injury, the treated animals had improved growth of epithelial cells and granulation tissue as compared to untreated controls. Figure 15B shows that there was no difference in peak-to-peak distance in the scar between treated and untreated animals.

Detailed Description

Before the present compositions and methods are described, it is to be understood that this invention is not limited to particular methods, protocols, cell lines, assays, and reagents, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to limit the scope of the invention which will be set forth in the appended claims.

It must be noted that, as used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a fragment" includes a plurality of such fragments; "an antibody" can refer to one or more antibodies, and equivalent antibodies familiar to those skilled in the art; and so on.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood in the art. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described. All documents cited herein are incorporated by reference in their entirety for the purpose of describing the methods, reagents and tools related to the invention in those documents. This is in no way to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

The present invention will employ, in practice, conventional chemical, biochemical, molecular biological, cell biological, genetic, immunological and pharmaceutical procedures known in the art, unless otherwise indicated. For example, see Gennaro, A.R. eds Remington's Pharmaceutical Sciences (1990), 18 th edition, Mack publishing company; hardam, J.G., Limbird, LE. and Gilman, A.G. eds "pharmacological Basis for treatment methods" (The Pharmaceutical Basis of Therapeutics) (2001), 10 th edition, McGraw-Hill; colowick, S. et al, Methods In immunology, Academic Press; weir, D.M. and Blackwell, C.C. eds "Handbook of Experimental Immunology" (1986), Vol.I-IV, Blackwell Scientific Press; maniatis, T. et al, eds "molecular cloning: a Laboratory Manual (molecular Cloning: A Laboratory Manual) (1989), 2 nd edition, Vols.I-III, Cold Spring Harbor Laboratory Press; eds for Molecular Biology Protocols (Short Protocols in Molecular Biology) (1999), 4 th edition, John Wiley & Sons Ream et al, Molecular biotechnology: (ii) Fine-cut Laboratory courses (molecular Biology Techniques: An intense Laboratory Course) (1998), Academic Press; newton, C.R. and Graham, A. eds PCR (Biotechnology entry Series) (Introduction to Biotechniques Series) (1997), 2 nd edition, Springer Verlag.

Definition of

The term "ischemia" refers to a decrease in blood flow. Ischemia reduces the supply of nutrients, including oxygen, to the tissue. Ischemia may be caused in such cases, for example, by arteriosclerosis, thrombosis in arteries or veins, blockage of arteries or veins by emboli, occlusion of vessels by other causes, for example, by vasospasm or the like. These conditions can reduce blood flow, create a state of hypoperfusion to an organ or tissue, or completely occlude blood flow. Other conditions that cause ischemia include tissue damage resulting from injury, such as spinal cord injury; a virulent infection, for example, it can cause congestive heart failure, and the like. The terms "ischemic disease" and "ischemic disorder" include severe ischemic diseases including, but not limited to, myocardial infarction, ischemic stroke, pulmonary embolism, perinatal hypoxia, circulatory shock (e.g., including blood loss, sepsis, cardiac ischemia, etc.), mountain sickness, severe respiratory failure, etc., and chronic ischemic diseases including arteriosclerosis, chronic venous insufficiency, chronic heart failure, cardiac sclerosis, diabetes, macular degeneration, sleep apnea, acroarterial spasm, systemic sclerosis, nonbacterial thromboangiitis, arterial occlusive disease, angina, TIAs, chronic alcohol liver disease, etc. Ischemic disease can also be caused when an individual is placed under general anesthesia, and damage to the tissue to be transplanted can result.

The terms "hypoxia" and "hypoxic" refer to the ambient conventional level of oxygen-containing protons. Culturing the cells in a hypoxic environment can hypoxic the cells, or treat the cells with a compound that mimics hypoxia. The oxygen content used to determine the hypoxic state in cell culture can be determined using techniques known in the art.

The terms "hypoxic disease" and "hypoxic disorder" include, but are not limited to, the above ischemic diseases (ischemic hypoxia), where hypoxia is caused by a reduction in circulation volume; pulmonary diseases (hypoxic hypoxia) such as COPD, severe pneumonia, pulmonary edema, pulmonary hypertension, hyaline membrane disease, etc., where hypoxia is caused by a decrease in oxygen exchange in the lungs; anemia disorders (anemic hypoxia), such as gastric or duodenal ulcers, liver or kidney diseases, thrombocytopenia or coagulopathy, cancer or other chronic diseases, anemia resulting from cancer chemotherapy and other therapeutic interventions, and the like, where hypoxia is caused by a decrease in hemoglobin or red blood cell concentration; altitude diseases, etc.

The terms "disorder" and "disease" are used broadly to refer to any disease that deviates from the normal state. The terms "ischemic disease" and "ischemic disorder" refer to any disease or condition associated with ischemia. The terms "hypoxic disease" and "hypoxic disorder" refer to any disease or condition associated with hypoxia. Such ischemic and hypoxic conditions include, but are not limited to, the above-mentioned conditions.

The term "HIF α" refers to the α subunit of the hypoxia inducible factor protein. HIF α can be any human or mammalian protein or protein fragment, including, but not limited to, human HIF-1 α (GenBank accession No. Q16665), HIF-2 α (GenBank accession No. AAB41495), and HIF-3 α (GenBank accession No. AAD22668); murine HIF-1 α (GenBank accession No. Q61221), HIF-2 α (GenBank accession No. BAA20130 and AAB41496), and HIF-3 α (GenBank accession No. AAC72734); rat HIF-1 alpha (GenBank accession No. CAA70701), HIF-2 alpha (GenBank accession No. CAB96612) and HIF-3 alpha (GenBank accession No. CAB 96611); bovine HIF-1 α (GenBank accession No. BAA78675). HIF α can also be any non-mammalian protein or protein fragment, including Xenopus laevis HIF-1 α (GenBank accession No. CAB96628), Drosophila melanogaster HIF-1 α (GenBank accession No. JC4851), and chicken HIF-1 α (GenBank accession No. BAA34234). The HIF α gene sequence may also be obtained by conventional cloning techniques, e.g., by using all or a portion of the HIF α gene sequence described above as a probe and determining the HIF α sequence in another fragment.

The HIF α fragment includes regions defined by human HIF-1 α, including amino acids 401-603(Huang et al, supra), amino acids 531-575(Jiang et al (1997) J Biol Chem 272: 19253-19260), amino acids 556-575(Tanimoto et al, supra), amino acids 557-571(Srinivas et al (1999) Biochem Biophys ComResmun 260: 557-561), and amino acids 556-575(Ivan and Kaelin (2001) Science 292: 464-468). Furthermore, fragments of HIF α comprise the motif LXXLAP, which occurs at least once, e.g.in the HIF-1 α main sequenceL of₃₉₇TLAP and L₅₅₉EMLAP. Furthermore, a fragment of HIF α comprises any fragment that retains at least one functional or structural feature of HIF α. For example, the HIF polypeptide for use in the screening assay of example 7 can comprise [ methoxycoumarin ]]-DLDLEALAPYIPADDDFQL-amide (SE1 ID NO: 5).

The terms "HIF prolyl hydroxylase" and "HIF PH" refer to any enzyme that hydroxylates a proline residue in a HIF protein. Proline residues hydroxylated by HIF PH include the proline in the motif LXXLAP, e.g. L present in the HIF-1. alpha. main sequence₃₉₇TLAP and L₅₅₉EMLAP. HIF PH comprises members of the Egl-Nine (EGLN) Gene family, as described by Taylor (2001, Gene 275: 125-132), characterized by Aravind and Koonin (2001, Genome Biol 2: RESEARCH0007), Epstein et al (2001, Cell 107: 43-54), Bruick, and McKnight (2001, Science 294: 1337-1340). Examples of HIF PH enzymes are human SM-20(EGLN1) (GenBank accession No. AAG 33965; Dupuy et al (2000) Genomics 69: 348-54), EGLN2 isoform 1 (GenBank accession No. AAG 33965; Taylor, supra), EGLN2 isoform 2 (GenBank accession No. NP-060025) and EGLN3 (GenBank accession No. CACC42511; Taylor, supra); mouse EGLN1 (GenBank accession No. CACA42515), EGLN2 (GenBank accession No. CAA42511) and EGLN3(SM-20) (GenBank accession No. CACC42517); rat SM-20 (GenBank accession No. AAA19321). In addition, HIF PH may comprise the Caenorhabditis elegans EGL-3 (GenBank accession No. AAD5635) and Drosophila melanogaster CG1114 gene products (GenBank accession No. AAF52050). HIF PH also encompasses any fragment that retains at least one of the structural or functional characteristics of the full-length proteins described above, including fragments having hydroxylase activity.

The term "amino acid sequence" or "polypeptide" as used herein refers to HIF α and fragments thereof, or HIF PH and fragments thereof, including oligopeptide, peptide or protein sequences, or fragments thereof and natural or synthetic molecules. A "fragment" may refer to any portion of a sequence that contains at least one structural or functional feature of a protein. The immunogenic fragments or antigenic fragments are polypeptide fragments, preferably fragments of about 5 to 15 amino acids in length, which retain at least one biological or immunogenic activity. When referring to the polypeptide sequence of a native protein molecule by "amino acid sequence," amino acid sequence "and like terms does not limit the amino acid sequence to the complete native sequence associated with the protein molecule.

The term "related proteins" as used herein refers to proteins associated with HIF α prolyl hydroxylases, which comprise other 2-oxoglutarate dioxygenases, especially those requiring Fe similarly²⁺2-oxoglutarate and oxygen to maintain the family member of hydroxylase activity. Such enzymes include, but are not limited to, collagen lysyl hydroxylase, collagen prolyl 4-hydroxylase, and factor inhibition HIF (fih), which is an asparaginyl hydroxylase enzyme responsible for regulating HIF α cross-activation. (GenBank accession No. AAL27308; Mahon et al (2001) Genes Dev 15: 2675-2686; Lando et al (2002) Science 295: 858-861; Lando et al (2002) Genes Dev 16: 1466-1471; see also Elkins et al (2002) J Biol Chem C200644200.)

The term "agonist" refers to a molecule that increases or prolongs the sustained effect of a particular molecule, such as an enzyme or protein, or a particular environment, such as a hypoxic environment. Agonists include proteins, nucleic acids, carbohydrates or any other molecules that modulate the effect of a target molecule.

The term "antagonist" refers to a molecule that reduces the effect or duration of biological or immunological activity of a particular molecule. Antagonists include proteins, nucleic acids, carbohydrates, antibodies or any other molecules that reduce the effect of a target molecule.

The term "microarray" refers to any arrangement of nucleic acids, amino acids, antibodies, etc. on a substrate. The substrate may be any suitable support, such as beads, glass, paper, nitrocellulose, nylon, or any suitable membrane, and the like. The substrate can be any rigid or semi-rigid carrier, including but not limited to a membrane, filter, wafer, chip, slide, fiber, bead (including magnetic or non-magnetic) beads, gel, tubing, plate, polymer, particle, capillary, etc. The substrate may provide a surface for coating operations and/or have various surface forms, such as wells, needles, grooves, channels and wells, to which nucleic acids, amino acids, etc. may be attached.

The term "excipient" as used herein refers to inert or inactive substances used in the manufacture of pharmaceutical or other tablets, including, but not limited to, any substance used as a binder, disintegrant, coating, compression/encapsulation aid, cream or lotion, lubricant, injection, sweetener or flavoring, suspension/gel, wet granulation agent. Binders include carbopol (carbopol), povidone, xanthan gum, and the like; the coating comprises cellulose acetate p-dibenzoate, ethyl cellulose, gellan gum, maltodextrin and the like; compression/encapsulation aids include calcium carbonate, dextrose, fructose dc, honey dc, lactose (anhydrous or monohydrate; optionally in combination with aspartame, cellulose or microcrystalline cellulose), starch dc, sucrose, and the like; the disintegrating agent comprises croscarmellose sodium, gellan gum, sodium starch glycolate, etc.; creams and lotions include maltodextrin, carrageenan, and the like; lubricants include magnesium stearate, stearic acid, sodium stearyl fumarate; materials used for chewing the tablets include dextrose, fructose dc, lactose (monohydrate, optionally mixed with aspartame or cellulose), and the like; the injection comprises mannitol, polyvidone, etc.; plasticizers include dibutyl sebacate, polyvinyl acetate-o-dibenzoate, and the like; the suspending/gelling agent comprises carrageenan, sodium starch glycolate, xanthan gum and the like; sweeteners include aspartame, dextrose, fructose dc, sorbitol, sucrose dc, and the like; wet granulation agents include calcium carbonate, maltodextrin, microcrystalline cellulose, and the like.

The term "sample" is used herein in its broadest sense. The sample may be taken from any source, such as body fluids, secretions, tissues, cells, or cells in culture including, but not limited to, saliva, blood, urine, serum, plasma, vitreous, synovial fluid, cerebral spinal fluid, amniotic fluid, and organ tissue (e.g., biopsy tissue); genomic DNA, cDNA, RNA, mRNA, etc.; removed cells or tissue, or spots or imprints on such cells or tissue. Samples may also be taken from sources such as humans or mammals other than humans. The sample may also be an animal model of any disease. The sample may be placed in a solution or may be immobilized or attached to a substrate. A sample may refer to any material suitable for use in determining the presence of HIF α or fragments of HIF α, or for screening for molecules that adhere to HIF α or fragments of HIF α. Methods for obtaining such samples are well within the level of skill in the art.

The term "processing object" is used herein in its broadest sense. The object of treatment may include isolated cells (prokaryotic or eukaryotic) or tissues grown in culture. The subject to be treated preferably includes animals, particularly mammals, including mice, rabbits, cows, sheep, pigs, rodents, horses and primates, particularly humans.

Invention of the invention

The present invention provides methods of stabilizing HIF α, compounds for use in the methods, and uses of the methods in the prevention or treatment of HIF disorders, including, but not limited to, the hypoxic and/or ischemic disorders described above. The present invention also relates to the discovery that stabilization of the alpha subunit of hypoxia inducible factor (HIF α) is an effective therapeutic approach that may provide unexpected benefits when used to treat or prevent hypoxic and/or ischemic conditions, such as myocardial infarction, stroke, closed artery disease, angina, cardiac sclerosis, arteriosclerosis, and the like.

The present invention provides methods for stabilizing HIF to promote vascular growth, enhance response to severe hypoxia, and promote adaptation to chronic hypoxia. Since tissue ischemia is a major cause of morbidity and mortality, finding ways to stabilize HIF α would be beneficial for the treatment of hypoxic conditions. In addition, the methods described herein have been used to advantage in preconditioning hypoxic responses, etc., by stabilizing HIF α in a normoxic environment prior to an ischemic or hypoxic event. The methods can also be used to induce a HIF α -specific effect, as described below, including therapeutic vascular growth, to restore blood flow to damaged tissue; neuroprotection to prevent neuronal atrophy and the like caused by neurodegenerative diseases; protection against oxidative damage generated by reactive species resulting from reperfusion in an ischemic or hypoxic event.

When ischemic and/or hypoxic conditions are treated by the methods of the invention, the condition may be an acute ischemic condition, such as pulmonary infarction, intestinal infarction, cerebral infarction and/or myocardial infarction, or a chronic ischemic condition, such as arterial occlusive disease, liver cirrhosis, congestive heart failure, and the like. In addition, the methods of the invention may be used to treat ischemia due to short-term or acute injury, such as spinal cord injury, or to treat patients suffering from pulmonary diseases and the like, such as pulmonary embolism and the like.

When preventing tissue damage caused by HIF conditions, including but not limited to ischemic and hypoxic conditions, using the methods of the invention, treatment depends on pre-diagnosed conditions, such as hypertension, diabetes, arterial occlusive disease, chronic venous insufficiency, acroarterial spasm, systemic sclerosis, cirrhosis, congestive heart failure, and the like. Similarly, the present methods can be used in pretreatments to alleviate or prevent HIF disease-induced tissue damage, including (but not limited to) ischemic and hypoxic conditions. Whether pretreatment is required depends on the history of recurrence of ischemic disease, such as myocardial infarction or transient ischemia; symptoms depending on persistent ischemia, such as angina pectoris; or on a physical parameter indicative of possible ischemia or hypoxia, such as in the case of an individual under general anesthesia or short-term operation in high latitudes. The method may also be used for organ transplantation, pre-treatment of an organ donor, and maintenance of the organ after removal from the body but prior to transplantation to a recipient.

The findings presented herein are that stabilization of HIF α, regulated by hydroxylation of proline, is effective in treating or preventing, preventing the persistence or progression of ischemic conditions such as DVT, angina, pulmonary embolism, stroke, myocardial infarction, and the like. In particular, studies have shown that they were pre-cultured with Rabbit Reticulocyte Lysate (RRL) and were associated with residues 556-]Corresponding HIF-1 α and HIF-1 α peptides can bind exclusively to von Hippel Lindau protein (pVHL), which can cause ubiquitination and degradation of HIF-1 α. The study also shows thatThe highly conserved consensus sequence M56LAPYIPM in HIF (556-575) stabilizes HIF (556-575) after mutations to 8 consecutive alanines under normal pressure conditions. (Srinivas et al, supra) scanning this region for alanine revealed P in the full-length HIF-1 α or glutathione S-transferase (GST) -HIF-1 α oxygen degradation region (ODD) fusion protein (Gal4-ODD)₅₆₄Mutation to alanine abolished pVHL binding activity. Determination of P by electrospray ion capture tandem mass spectrometry (MS/MS) and thin layer chromatography of Gal4-HIF (555-₅₆₄The denaturation process of (2) is a hydroxylation process in which Gal4-HIF (555-³]Is translated in vivo with RRL in the presence of proline. The functional importance of the hydroxylation of proline is that P₅₆₄Hydroxylated HIF α binds to pVHL and comprises P₅₆₄The HIF-1 alpha mutant factor with single point mutation to alanine is stable in COS7 cells and is insensitive to hypoxia apoferritin. (see Ivan and Kaelin, supra; Jaakkola et al (2001) Science 292: 468-

HIF α is hydroxylated by proline (a requirement for oxygen and Fe)²⁺The reaction of (a), according to one aspect of the present invention. The enzymes in hydroxylation of HIF α are members of the 2-oxoglutarate dioxygenase family. Such enzymes include, but are not limited to, collagen lysyl hydroxylase, collagen prolyl 3-hydroxylase, collagen prolyl 4-hydroxylase α (I) and α (II), thymine 7-hydroxylase, aspartic acid (asparagine) β hydroxylase, ε -N-trimethyllysyl hydroxylase, and γ -butyrolactam hydroxylase, among others. These enzymes require oxygen, Fe²⁺2-ketoglutarate and ascorbyl acid to obtain hydroxylase activity. (see, e.g., Majamaa et al (1985) Biochem J229: 127-

Several small molecule inhibitors of prolyl 4-hydroxylase have been identified. (see, e.g., Majamaa et al, supra; Kivirikko and Mylly harju (1998) Matrix Biol 16: 357-.

Compounds useful in the methods of the invention include structural analogs of 2-oxoglutarate. These compounds inhibit the target member of the family of 2-oxoglutarate dioxygenases, with a competitive advantage over 2-oxoglutarate and no competitive advantage over iron. (Majamaa et al (1984) Eur J Biochem 138: 239-

In certain embodiments, the compounds used in the methods of the present invention are selected from compounds of formula (I)

Wherein A is a1, 2-arylene group, a1, 3-arylene group, a1, 4-arylene group; or (C)₁-C₄) Alkylene (optionally substituted by one or more halogen atoms, cyano, nitro, trifluoromethyl), (C)₁-C₆) Alkyl radicals, (C)₁-C₆) -hydroxyalkyl, (C)₁-C₆) -alkoxy, -O- [ CH₂]_x-C_fH_(2f+1-g)Halogen element_g、(C₁-C₆) -fluoroalkoxy, (C)₁-C₈) -fluorohydrocarbyleneoxy, (C)₁-C₈) -fluoroalkenyloxy, -OCF₂Cl，-O-CF₂-CHFCl；(C₁-C₆) -alkylmercapto, (C)₁-C₆) -alkylsulfinyl, (C)₁-C₆) Alkyl sulfonyl, (C)₁-C₆) -alkylcarbonyl, (C)₁-C₆) Alkoxycarbonyl, carbamoyl, N- (C)₁-C₄) -alkylcarbamoyl, N-di- (C)₁-C₄) -alkylcarbamoyl, (C)₁-C₆) -alkylcarbonyloxy, (C)₃-C₈) Cycloalkyl, phenyl, benzyl, phenoxy, benzyloxy, anilino, N-methylanilino, phenylsulfenylPhenyl sulfonyl, phenyl sulfinyl, sulfamoyl, N- (C)₁-C₄) -alkylsulfamoyl, N-di- (C)₁-C₄) -alkylsulfamoyl substitution; or is (C)₆-C₁₂) -aryloxy group, (C)₇-C₁₁) Aralkyloxy, (C)₆-C₁₂) -aryl, (C)₇-C₁₁) Aralkyl (having 1 to 5 identical or different substituents in the aryl moiety, said substituents being selected from halogen, cyano, nitro, trifluoromethyl), (C)₁-C₆) Alkyl radicals, (C)₁-C₆) -alkoxy, -O- [ CH₂]_x-C_fH_(2f+1-g)Halogen element_g、-OCF₂Cl、-O-CF₂-CHFCl、(C₁-C₆) -alkylmercapto, (C)₁-C₆) -alkylsulfinyl, (C)₁-C₆) Alkyl sulfonyl, (C)₁-C₆) Alkylcarbonyl, carbamoyl, N- (C)₁-C₄) -alkylcarbamoyl, N-di- (C)₁-C₄) -alkylcarbamoyl, (C)₁-C₆) -alkylcarbonyloxy, (C)₃-C₈) Cycloalkyl, sulfamoyl, N- (C)₁-C₄) -alkylsulfamoyl, N-di- (C)₁-C₄) -alkylsulfamoyl substitution; or A is CR⁵R⁶，R⁵And R⁶Each independently selected from hydrogen and (C)₁-C₆) Alkyl radicals, (C)₃-C₇) -cycloalkyl, aryl, or a substituent of an alpha carbon atom of an alpha amino acid, wherein the amino acid is a natural L amino acid or a D isomer thereof.

B is-COH₂、-NH₂、-NHSO₂CF₃Tetrazolyl, imidazolyl, 3-hydroxyisoxazolyl, -CONHCOR '", -CONHSOR'", wherein R '"is aryl, heteroaryl, (C'") and₃-C₇) -cycloalkyl, (C)₁-C₄) -alkyl, optionally with (C)₁-C₄) Thioalkyl, (C)₁-C₄) -sulfinyl group, (C)₁-C₄) -thioacyl, CF3, Cl, Br, F, I, NO2, -COOH, (C)₂-C₅) Alkoxycarbonyl, NH₂Mono- (C)₁-C₄-alkyl) -amino, di- (C)₁-C₄-alkyl) -amino or (C)₁-C₄) -perfluoroalkyl substitution; or B is CO₂-G carboxyl, wherein G is a radical of an alcohol G-OH, G being selected from (C)₁-C₂₀) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (C)₂-C₂₀) -alkenyl, (C)₃-C₈) Cycloalkenyl, retinyl, (C)₂-C₂₀) -alkynyl, (C)₄-C₂₀) -an alkenyl group, wherein the alkenyl, cycloalkenyl, alkynyl and alkenyl groups comprise one or more multiple bonds; (C)₆-C₁₆) Carbocyclic aryl group, (C)₇-C₁₆) -aralkyl, heteroaryl or heteroaralkyl, wherein the heteroaryl or heteroaryl portion of the heteroaralkyl contains 5 to 6 ring atoms; the group defined by G may be substituted with one or more other groups including hydroxy, halogen, cyano, trifluoromethyl, nitro, carboxy, (C)₁-C₁₂) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (C)₅-C₈) -cycloalkenyl, (C)₆-C₁₂) -aryl, (C)₇-C₁₆) Aralkyl, (C)₂-C₁₂) -alkenyl, (C)₂-C₁₂) -alkynyl, (C)₁-C₁₂) -alkoxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) Alkyl radicals, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkoxy, (C)₆-C₁₂) -aryloxy group, (C)₇-C₁₆) Aralkyloxy, (C)₁-C₈) -hydroxyalkyl, -O- [ CH₂]_x-C_fH_(2f+1-g)-F_g、-OCF₂Cl、-O-CF₂-CHFCl、(C₁-C₁₂) -alkylcarbonyl, (C)₃-C₈) -cycloalkylcarbonyl, (C)₆-C₁₂) -arylcarbonyl group, (C)₇-C₁₆) Aralkyl carbonyl, cinnamoyl, (C)₂-C₁₂) -alkenylcarbonyl, (C)₂-C₁₂) -alkynylcarbonyl, (C)₁-C₁₂) -alkoxycarbonyl group、(C₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkylcarbonyl, (C)₆-C₁₂) -aryloxycarbonyl, (C)₇-C₁₆) Aralkoxycarbonyl radical, (C)₃-C₈) -cycloalkoxycarbonyl, (C)₂-C₁₂) -alkenyloxycarbonyl, (C)₂-C₁₂) -alkynyloxycarbonyl, acyloxy, (C)₁-C₁₂) -alkoxycarbonyloxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkylcarbonyloxy, (C)₆-C₁₂) -aryloxycarbonyloxy, (C)₇-C₁₆) An aralkyloxycarbonyloxy group, a (C)₃-C₈) -cycloalkoxycarbonyloxy, (C)₂-C₁₂) -alkenyloxycarbonyloxy, (C)₂-C₁₂) -alkynyloxycarbonyloxy, carbamoyl, N- (C)₁-C₁₂) -alkylcarbamoyl, N-di- (C)₁-C₁₂) -alkylcarbamoyl, N- (C)₃-C₈) -Cycloalkylcarbamoyl, N- (C)₆-C₁₆) Aryl carbamoyl, N- (C)₇-C₁₆) Aralkyl carbamoyl radical, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₆) Aryl carbamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyl, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyl, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₆) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, carbamoyloxy, N- (C)₁-C₁₂) -alkylcarbamoyloxy, N-di- (C)₁-C₁₂) -alkylcarbamoyloxy, N- (C)₃-C₈) -cycloalkylcarbamoyloxy, N- (C)₆-C₁₂) Aryl carbamoyloxy, N- (C)₇-C₁₆) -aralkyl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₆) Aryl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyloxy, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyloxy, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₆) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, amino, (C)₁-C₁₂) Alkylamino, di (C)₁-C₁₂) -alkylamino, (C)₃-C₈) -cycloalkylamino, (C)₂-C₁₂) -alkenylamino, (C)₂-C₁₂) -alkynylamino, N- (C)₆-C₁₂) Arylamino, N- (C-C)₁₁) -aralkylamino, N-alkyl-arylamino, (C)₁-C₁₂) -alkoxy-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -cycloalkylcarbonylamino group, (C)₆-C₁₂) -arylcarbonylamino group, (C)₇-C₁₆) -aralkylcarbonylamino, (C)₁-C₁₂) -alkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -Cycloalkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₆-C₁₂) -arylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₇-C₁₁) -aralkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₁-C₁₂) -alkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₃-C₈) -cycloalkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -arylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -aralkylcarbonylamino- (C)₁-C₈) Alkyl, amino- (C)₁-C₁₀) Alkyl, N- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N-di- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl radicals, (C)₃-C₈) -cycloalkylamino- (C)₁-C₁₀) Alkyl radicals, (C)₁-C₁₂) -alkylmercapto, (C)₁-C₁₂) -alkylsulfinyl, (C)₁-C₁₂) Alkyl sulfonyl, (C)₆-C₁₆) Aryl mercapto, (C)₆-C₁₆) -arylsulfinyl, (C)₆-C₁₂) Aryl thioacyl, (C)₇-C₁₆) -aralkylthio, (C)₇-C₁₆) -arylsulfinyl, (C)₇-C₁₂) Arylsulfonyl, sulfamoyl, N- (C)₁-C₁₀) -alkylsulfamoyl, N-di- (C)₁-C₁₀) -alkylsulfamoyl, (C)₃-C₈) -Cycloalkylsulfamoyl, N- (C)₆-C₁₂) Alkylsulfamoyl, N- (C)₇-C₁₆) Aralkyl sulfamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₂) Arylsulfamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) Aralkyl sulfamoyl, (C)₁-C₁₀) -alkylsulfonamido, N- ((C)₁-C₁₀) -alkyl) - (C₁-C₁₀) -alkylsulfonamido, (C)₇-C₁₆) -aralkylsulfonamido or N- ((C)₁-C₁₀) -alkyl) - (C₇-C₁₆) -an aralkyl sulfonamido group; wherein the aryl group or the aryl group of the aryl-containing group may be substituted with 1 to 5 same or different groups including hydroxy, halogen, cyano, trifluoromethyl, nitro, carboxy, (C)₁-C₁₂) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (C)₆-C₁₂) -aryl, (C)₇-C₁₆) Aralkyl, (C)₁-C₁₂) -alkoxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) Alkyl radicals, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkoxy, (C)₆-C₁₂) -aryloxy group, (C)₇-C₁₆) Aralkyloxy, (C)₁-C₈) -hydroxyalkyl, (C)₁-C₁₂) -alkylcarbonyl, (C)₃-C₈) -cycloalkylcarbonyl, (C)₆-C₁₂) -arylcarbonyl group, (C)₇-C₁₆) -aralkylcarbonyl, (C)₁-C₁₂) Alkoxycarbonyl, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) Alkoxycarbonyl, (C)₆-C₁₂) -aryloxycarbonyl, (C)₇-C₁₆) Aralkoxycarbonyl radical, (C)₃-C₈) -cycloalkoxycarbonyloxy, (C)₂-C₁₂) -alkenyloxycarbonyloxy, (C)₂-C₁₂) -alkynyloxycarbonyloxy, (C)₁-C₁₂) -alkylcarbonyloxy, (C)₃-C₈) -cycloalkylcarbonyloxy, (C)₆-C₁₂) Aryl carbonyloxy, (C)₇-C₁₆) Aralkyl carbonyloxy, cinnamoyloxy, (C)₂-C₁₂) -alkenylcarbonyloxy, (C)₂-C₁₂) -alkynylcarbonyloxy, (C)₁-C₁₂) -alkoxycarbonyloxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkylcarbonyloxy, (C)₆-C₁₂) -aryloxycarbonyloxy, (C)₇-C₁₆) An aralkyloxycarbonyloxy group, a (C)₃-C₈) -cycloalkoxycarbonyloxy, (C)₂-C₁₂) -alkenyloxycarbonyloxy, (C)₂-C₁₂) -alkynyloxycarbonyloxy, carbamoyl, N- (C)₁-C₁₂) -alkylcarbamoyl, N-di (C)₁-C₁₂) -alkylcarbamoyl, N- (C)₃-C₈) -Cycloalkylcarbamoyl, N- (C)₆-C₁₂) Aryl carbamoyl, N- (C)₇-C₁₆) Aralkyl carbamoyl radical, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₂) Aryl carbamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyl, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyl, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, carbamoyloxy, N- (C)₁-C₁₂) -alkylcarbamoyloxy, N-di- (C)₁-C₁₂) -alkylcarbamoyloxy, N- (C)₃-C₈) -cycloalkylcarbamoyloxy, N- (C)₆-C₁₂) Aryl carbamoyloxy, N- (C)₇-C₁₆) -aralkyl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₆) Aryl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyloxy, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyloxy, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamic acid methylAcyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₆) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, amino, (C)₁-C₁₂) Alkylamino, di (C)₁-C₁₂) -alkylamino, (C)₃-C₈) -cycloalkylamino, (C)₂-C₁₂) -alkenylamino, (C)₂-C₁₂) -alkynylamino, N- (C)₆-C₁₂) Arylamino, N- (C-C)₁₁) -aralkylamino, N-alkyl-arylamino, (C)₁-C₁₂) -alkoxy-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -cycloalkylcarbonylamino group, (C)₆-C₁₂) -arylcarbonylamino group, (C)₇-C₁₆) -aralkylcarbonylamino, (C)₁-C₁₂) -alkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -Cycloalkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₆-C₁₂) -arylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₇-C₁₁) -aralkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₁-C₁₂) -alkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₃-C₈) -cycloalkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -arylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -aralkylcarbonylamino- (C)₁-C₈) Alkyl, amino- (C)₁-C₁₀) Alkyl, N- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N-di- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N- (C)₃-C₈) -cycloalkylamino- (C)₁-C₁₀) Alkyl radicals, (C)₁-C₁₂) -alkylmercapto, (C)₁-C₁₂) -alkylsulfinyl, (C)₁-C₁₂) Alkyl sulfonyl, (C)₆-C₁₆) Aryl mercapto, (C)₆-C₁₆) -arylsulfinyl, (C)₆-C₁₂) Aryl thioacyl, (C)₇-C₁₆) -aralkylthio, (C)₇-C₁₆) -arylsulfinyl or (C)₇-C₁₂) -an aryl thioacyl group;

x is O or S;

q is O, S, NR' or a bond;

wherein, if Q is a bond, R⁴Is halogen, nitrile or trifluoromethyl;

-[CH₂]_v-[O]_w-[CH₂]_t-E (Z)

v is a number of the groups 0 to 6,

w is a number of 0 or 1,

t is 0 to 3, and R⁷、R⁸、R⁹、R¹⁰And R¹¹May be the same or different and may be hydrogen, halogen, cyano, trifluoromethyl, nitro, carboxyl, (C)₁-C₆) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (C)₁-C₆) -aralkyl, -O- [ CH₂]_x-C_fH_(2f+1-g)-F_g、-OCF₂Cl、-O-CF₂-CHFCl、(C₁-C₆) -alkylmercapto, (C)₁-C₆) -hydroxyalkyl, (C)₁-C₆) -alkoxy- (C)₁-C₆) -alkoxy, (C)₁-C₆) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₁-C₆) -alkylsulfinyl, (C)₁-C₆) Alkyl sulfonyl, (C)₁-C₆) -alkylcarbonyl, (C)₁-C₈) Alkoxycarbonyl, carbamoyl, N- (C)₁-C₈) -alkylcarbamoyl, N-di- (C)₁-C₈) -alkylcarbamoyl or (C)₇-C₁₁) Arylalkyl carbamoyl, optionally substituted by fluorine, chlorine, bromine, trifluoromethyl, (C)₁-C₆) Alkoxy, N- (C)₃-C₈) -Cycloalkylcarbamoyl, N- (C)₃-C₈) -cycloalkyl- (C)₁-C₄) -alkylcarbamoyl, (C)₁-C₆) -alkylcarbonyloxy, phenyl, benzyl, phenoxy, benzyloxy, NR^YR^ZWherein R is^YAnd R^ZIndependently selected from hydrogen, (C)₁-C₁₂) Alkyl radicals, (C)₁-C₈) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy- (C)₁-C₈) -an alkyl group,(C₃-C₁₀) -cycloalkyl, (C)₃-C₁₂) -alkenyl, (C)₃-C₁₂) -alkynyl, (C)₆-C₁₂) -aryl, (C)₇-C₁₁) Aralkyl, (C)₁-C₁₂) -alkoxy, (C)₇-C₁₂) -aryloxy group, (C)₁-C₁₂) -alkylcarbonyl, (C)₃-C₈) -cycloalkylcarbonyl, (C)₆-C₁₂) -arylcarbonyl group, (C)₇-C₁₆) -an aralkylcarbonyl group; or R^YAnd R^ZAre all- [ CH₂]_hIn which CH₂Can be O, S, N- (C)₁-C₄) -alkylcarbonylimino or N- (C)₁-C₄) -an alkoxycarbonylimino group; phenylmercapto, thiophenyl, phenylsulfinyl, phenylsulfamoyl, N- (C)₁-C₈) An alkylsulfamoyl group or an N, N-di- (C)₁-C₈) -an alkylsulfamoyl group; or R⁷And R⁸、R⁸And R⁹、R⁹And R¹⁰Or¹⁰And R¹¹Are all selected from- [ CH₂]_nOr a chain of-CH-, wherein CH₂Optionally O, S, SO₂Or NR^YSubstitution; n is 3, 4 or 5; if E is heteroaryl, said group may contain 1 to 3 groups R⁷-R¹¹Substituents as defined, or if E is cycloalkyl, said group may contain one R⁷-R¹¹A substituent as defined;

or when Q is NR', R⁴Is R ', where R ' and R ' may be the same or different and may in particular be hydrogen, (C)₆-C₁₂) -aryl, (C)₇-C₁₁) Aralkyl, (C)₁-C₈) Alkyl radicals, (C)₁-C₈) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy- (C)₁-C₈) Alkyl radicals, (C)₁-C₁₀) -alkylcarbonyl, optionally substituted (C)₇-C₁₆) -aralkylcarbonyl or optionally substituted(C₆-C₁₂) -an arylcarbonyl group; or R 'and R' are both- [ CH ]₂]_hIn which CH₂Is O, S, N-imidoyl or N- (C)₁-C₁₀) -an alkoxycarbonylimino group, h is 3-7.

Y is N or CR³；

R¹、R²And R³May be the same or different, and is specifically hydrogen, hydroxy, cyano, trifluoromethyl, nitro, carboxy, (C)₁-C₂₀) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (C)₃-C₈) -cycloalkyl- (C)₁-C₁₂) Alkyl radicals, (C)₃-C₈) -cycloalkoxy, (C)₃-C₈) -cycloalkyl- (C)₁-C₁₂) -alkoxy, (C)₃-C₈) -cycloalkoxy- (C)₁-C₁₂) Alkyl radicals, (C)₃-C₈) -cycloalkoxy- (C)₁-C₁₂) -alkoxy, (C)₃-C₈) -cycloalkyl- (C)₁-C₈) -alkyl- (C)₁-C₆) -alkoxy, (C)₃-C₈) -cycloalkyl- (C)₁-C₈) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₃-C₈) -cycloalkoxy- (C)₁-C₈) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₃-C₈) -cycloalkoxy- (C)₁-C₈) -alkoxy- (C)₁-C₆) -alkoxy, (C)₆-C₁₂) -aryl, (C)₇-C₁₆) Aralkyl, (C)₇-C₁₆) -aralkenyl, (C)₇-₁₆) -aralkynyl, (C)₂-C₂₀) -alkenyl, (C)₂-C₂₀) -alkynyl, (C)₁-C₂₀) -alkoxy, (C)₂-C₂₀) -alkenyloxy, (C)₂-C₂₀) -alkynyloxy, retinoxy, (C)₁-C₂₀) -alkoxy- (C)₁-C₁₂) Alkyl radicals, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkoxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₈) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy group, (C)₇-C₁₆) Aralkyloxy, (C)₆-C₁₂) -aryloxy- (C)₁-C₆) -alkoxy, (C)₇-C₁₆) -aralkyloxy- (C)₁-C₆) -alkoxy, (C)₁-C₁₆) -hydroxyalkyl, (C)₆-C₁₆) -aryloxy- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₆) -aralkyloxy- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy- (C)₁-C₈) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₇-C₁₂) -aralkyloxy- (C)₁-C₈) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₂-C₂₀) -alkenyloxy- (C)₁-C₆) Alkyl radicals, (C)₂-C₂₀) -alkynyloxy- (C)₁-C₆) Alkyl, retinoxy- (C)₁-C₆) -alkyl, -O- [ CH₂]_x-C_fH_(2f+1-g)-F_g、-OCF₂Cl、-O-CF₂-CHFCl、(C₁-C₂₀) -alkylcarbonyl, (C)₃-C₈) -cycloalkylcarbonyl, (C)₆-C₁₂) -arylcarbonyl group, (C)₇-C₁₆) Aralkyl carbonyl, cinnamoyl, (C)₂-C₂₀) -alkenylcarbonyl, (C)₂-C₂₀) -alkynylcarbonyl, (C)₁-C₂₀) Alkoxycarbonyl, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) Alkoxycarbonyl, (C)₆-C₁₂) -aryloxycarbonyl, (C)₇-C₁₆) Aralkoxycarbonyl radical, (C)₃-C₈) -cycloalkoxycarbonyl, (C)₂-C₂₀) -alkenyloxycarbonyl, retinoxycarbonyl, (C)₂-C₂₀) -alkynyloxycarbonyl, (C)₆-C₁₂) -aryloxy- (C)₁-C₆) Alkoxycarbonyl, (C)₇-C₁₆) -aralkyloxy- (C)₁-C₆) Alkoxycarbonyl, (C)₃-C₈) -cycloalkyl- (C)₁-C₆) Alkoxycarbonyl, (C)₃-C₈) -cycloalkoxy- (C)₁-C₆) Alkoxycarbonyl, (C)₁-C₁₂) -alkylcarbonyloxy, (C)₃-C₈) -cycloalkylcarbonyloxy, (C)₆-C₁₂) Aryl carbonyloxy, (C)₇-C₁₆) Aralkyl carbonyloxy, cinnamoyloxy, (C)₂-C₁₂) -alkenylcarbonyloxy, (C)₂-C₁₂) -alkynylcarbonyloxy, (C)₁-C₁₂) -alkoxycarbonyloxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkylcarbonyloxy, (C)₆-C₁₂) -aryloxycarbonyloxy, (C)₇-C₁₆) An aralkyloxycarbonyloxy group, a (C)₃-C₈) -cycloalkoxycarbonyloxy, (C)₂-C₁₂) -alkenyloxycarbonyloxy, (C)₂-C₁₂) -alkynyloxycarbonyloxy, carbamoyl, N- (C)₁-C₁₂) -alkylcarbamoyl, N-di- (C)₁-C₁₂) -alkylcarbamoyl, N- (C)₃-C₈) -cycloalkylcarbamoyl, N-bicyclo- (C)₃-C₈) -alkylcarbamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₃-C₈) -Cycloalkylcarbamoyl, N- ((C)₃-C₈) -cycloalkyl- (C)₁-C₆) -alkyl) carbamoyl, N- (C)₁-C₆) -alkyl-N- ((C)₃-C₈) -cycloalkyl- (C)₁-C₆) -alkyl) carbamoyl, N- (+) -dehydroabietyl carbamoyl, N- (C)₁-C₆) -alkyl-N- (+) -dehydroabietyl carbamoyl, N- (C)₆-C₁₂) Aryl carbamoyl, N- (C)₇-C₁₆) Aralkyl carbamoyl radical, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₂) Aryl carbamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyl, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyl, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl; CON (CH)₂)_hIn which CH₂Can be O, S, N- (C)₁-C₈) -alkylimino, N- (C)₃-C₈) -cycloalkylimino, N- (C)₃-C₈) -cycloalkyl- (C)₁-C₄) -alkylimino, N- (C)₆-C₁₂) Aryl imino, N- (C)₇-C₁₂) -aralkylimino, N- (C)₁-C₄) -alkoxy- (C)₁-C₆) -alkylimino substitution, h is 3-7; carbamoyloxy of formula R

s is a number of 1 to 5,

t is OH or NR^*R^**，R^*、R^**And R^***May be the same or different and are selected from hydrogen, (C)₆-C₁₂) -aryl, (C)₇-C₁₁) Aralkyl, (C)₁-C₈) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (+) -dehydroabietyl, (C)₁-C₈) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -aralkyloxy- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy- (C)₁-C₈) Alkyl radicals, (C)₁-C₁₀) Alkanoyl, optionally substituted (C)₇-C₁₆) Aralkanoyl, optionally substituted (C)₆-C₁₂) -an aroyl group; or R and R^**Are all CH₂In which CH₂Can be O, S, SO₂N-acylamino, N- (C)₁-C₁₀) -alkoxycarbonylimino, N- (C)₁-C₈) -alkylimino, N- (C)₃-C₈) -cycloalkylimino, N- (C)₃-C₈) -cycloalkyl- (C)₁-C₄) -alkylimino, N- (C)₆-C₁₂) Aryl imino, N- (C)₇-C₁₆) -aralkylimino, N- (C)₁-C₄) -alkoxy- (C)₁-C₆) -alkylimino, h is 3 to 7;

carbamoyloxy, N- (C)₁-C₁₂) -alkylcarbamoyloxy, N-di- (C)₁-C₁₂) -alkylcarbamoyloxy, N- (C)₃-C₈) -cycloalkylcarbamoyloxy, N- (C)₆-C₁₂) Aryl carbamoyloxy, N- (C)₇-C₁₆) -aralkyl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₆) Aryl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyloxy, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyloxy, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkanesradical-N- ((C)₆-C₁₆) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, amino, (C)₁-C₁₂) Alkylamino, di (C)₁-C₁₂) -alkylamino, (C)₃-C₈) -cycloalkylamino, (C)₂-C₁₂) -alkenylamino, (C)₂-C₁₂) -alkynylamino, N- (C)₆-C₁₂) Arylamino, N- (C)₇-C₁₁) -aralkylamino, N-alkyl-arylamino, (C)₁-C₁₂) -alkoxyamino group, (C)₁-C₁₂) -alkoxy-N- (C)₁-C₁₀) -alkylamino, (C)₁-C₁₂) - - -alkylcarbonyl (alkanoyl) amino, (C)₃-C₈) -cycloalkylcarbonylamino group, (C)₆-C₁₂) -arylcarbonylamino group, (C)₇-C₁₆) -aralkylcarbonylamino, (C)₁-C₁₂) -alkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -Cycloalkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₆-C₁₂) -arylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₇-C₁₁) -aralkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₁-C₁₂) -alkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₃-C₈) -cycloalkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -arylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₆) -aralkylcarbonylamino- (C)₁-C₈) Alkyl, amino- (C)₁-C₁₀) Alkyl, N- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N-di- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N- (C)₃-C₈) -cycloalkylamino- (C)₁-C₁₀) -alkanesBase, (C)₁-C₂₀) -alkylmercapto, (C)₁-C₂₀) -alkylsulfinyl, (C)₁-C₂₀) Alkyl sulfonyl, (C)₆-C₁₂) Aryl mercapto, (C)₆-C₁₂) -arylsulfinyl, (C)₆-C₁₂) Aryl thioacyl, (C)₇-C₁₆) -aralkylthio, (C)₇-C₁₆) -aralkylsulfinyl, (C)₇-C₁₆) Aralkyl thioacyl, (C)₁-C₁₂) -alkylmercapto- (C)₁-C₆) Alkyl radicals, (C)₁-C₁₂) -alkylsulfinyl- (C)₁-C₆) Alkyl radicals, (C)₁-C₁₂) -alkylsulfanyl- (C)₁-C₆) Alkyl radicals, (C)₆-C₁₂) Aryl mercapto- (C)₁-C₆) Alkyl radicals, (C)₆-C₁₂) -arylsulfinyl- (C)₁-C₆) Alkyl radicals, (C)₆-C₁₂) Aryl thioacyl- (C)₁-C₆) Alkyl radicals, (C)₇-C₁₆) -arylalkyl mercapto- (C)₁-C₆) Alkyl radicals, (C)₇-C₁₆) -aralkylsulfinyl- (C)₁-C₆) Alkyl radicals, (C)₇-C₁₆) -aralkylsulfonyl- (C)₁-C₆) Alkyl, sulfamoyl, N- (C)₁-C₁₀) -alkylsulfamoyl, N-di- (C)₁-C₁₀) -alkylsulfamoyl, (C)₃-C₈) -Cycloalkylsulfamoyl, N- (C)₆-C₁₂) Alkylsulfamoyl, N- (C)₇-C₁₆) Aralkyl sulfamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₂) Arylsulfamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) Aralkyl sulfamoyl, (C)₁-C₁₀) -alkylsulfonamido, N- ((C)₁-C₁₀) -alkyl) - (C₁-C₁₀) -alkylsulfonamido, (C)₇-C₁₆) -aralkylsulfonamido or N- ((C)₁-C₁₀) -alkyl) - (C₇-C₁₆) -an aralkyl sulfonamido group; wherein the aryl radicalOr the aryl group in the aryl-containing group may be substituted with 1 to 5 same or different groups including hydroxy, halogen, cyano, trifluoromethyl, nitro, carboxy, (C)₂-C₁₆) Alkyl radicals, (C)₃-C₈) -cycloalkyl, (C)₃-C₈) -cycloalkyl- (C)₁-C₁₂) Alkyl radicals, (C)₃-C₈) -cycloalkoxy, (C)₃-C₈) -cycloalkyl- (C)₁-C₁₂) -alkoxy, (C)₃-C₈) -cycloalkoxy- (C)₁-C₁₂) Alkyl radicals, (C)₃-C₈) -cycloalkoxy- (C)₁-C₁₂) -alkoxy, (C)₃-C₈) -cycloalkyl- (C)₁-C₈₈) -alkyl- (C)₁-C₆) -alkoxy, (C)₃-C₈) -cycloalkyl- (C)₁-C₈) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₃-C₈) -cycloalkoxy- (C)₁-C₈) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₃-C₈) -cycloalkoxy- (C)₁-C₈) -alkoxy- (C)₁-C₆) -alkoxy, (C)₆-C₁₂) -aryl, (C)₇-C₁₆) Aralkyl, (C)₂-C₁₆) -alkenyl, (C)₂-C₁₂) -alkynyl, (C)₁-C₁₆) -alkoxy, (C)₁-C₁₆) -alkenyloxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) Alkyl radicals, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkoxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₈) -alkoxy- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy group, (C)₇-C₁₆) Aralkyloxy, (C)₆-C₁₂) -aryloxy- (C)₁-C₆) -alkoxy, (C)₇-C₁₆) -aralkyloxy- (C)₁-C₆) -alkoxy, (C)₁-C₈) -hydroxyalkyl, (C)₆-C₁₆) -aryloxy- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₆) An aralkyloxy group-(C₁-C₈) Alkyl radicals, (C)₆-C₁₂) -aryloxy- (C)₁-C₈) -alkoxy- (C)₁-C₆) Alkyl radicals, (C)₇-C₁₂) -aralkyloxy- (C)₁-C₈) -alkoxy- (C)₁-C₆) -alkyl, -O- [ CH₂]_x-C_fH_(2f+1-g)-F_g、-OCF₂Cl、-O-CF₂-CHFCl、(C₁-C₁₂) -alkylcarbonyl, (C)₃-C₈) -cycloalkylcarbonyl, (C)₆-C₁₂) -arylcarbonyl group, (C)₇-C₁₆) -aralkylcarbonyl, (C)₁-C₁₂) Alkoxycarbonyl, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) Alkoxycarbonyl, (C)₆-C₁₂) -aryloxycarbonyl, (C)₇-C₁₆) Aralkoxycarbonyl radical, (C)₃-C₈) -cycloalkoxycarbonyl, (C)₂-C₁₂) -alkenyloxycarbonyl, (C)₂-C₁₂) -alkynyloxycarbonyl, (C)₆-C₁₂) -aryloxy- (C)₁-C₆) Alkoxycarbonyl, (C)₇-C₁₆) -aralkyloxy- (C)₁-C₆) Alkoxycarbonyl, (C)₃-C₈) -cycloalkyl- (C)₁-C₆) Alkoxycarbonyl, (C)₃-C₈) -cycloalkoxy- (C)₁-C₆) Alkoxycarbonyl, (C)₁-C₁₂) -alkynylcarbonyloxy, (C)₃-C₈) -cycloalkylcarbonyloxy, (C)₆-C₁₂) Aryl carbonyloxy, (C)₇-C₁₆) Aralkyl carbonyloxy, cinnamoyloxy, (C)₂-C₁₂) -alkenylcarbonyloxy, (C)₂-C₁₂) -alkynylcarbonyloxy, (C)₁-C₁₂) -alkoxycarbonyloxy, (C)₁-C₁₂) -alkoxy- (C)₁-C₁₂) -alkylcarbonyloxy, (C)₆-C₁₂) -aryloxycarbonyloxy, (C)₇-C₁₆) An aralkyloxycarbonyloxy group, a (C)₃-C₈) -cycloalkoxycarbonyloxy, (C)₂-C₁₂) -alkenyloxycarbonyloxy, (C)₂-C₁₂) -alkynyloxycarbonyloxy, carbamoyl, N- (C)₁-C₁₂) -alkylcarbamoyl, N-di- (C)₁-C₁₂) -alkylcarbamoyl, N- (C)₃-C₈) -cycloalkylcarbamoyl, N-bicyclo- (C)₃-C₈) -alkylcarbamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₃-C₈) -Cycloalkylcarbamoyl, N- ((C)₃-C₈) -cycloalkyl- (C)₁-C₆) -alkyl) carbamoyl, N- (C)₁-C₆) -alkyl-N- ((C)₃-C₈) -cycloalkyl- (C)₁-C₆) -alkyl) carbamoyl, N- (+) -dehydroabietyl carbamoyl, N- (C)₁-C₆) -alkyl-N- (+) -dehydroabietyl carbamoyl, N- (C)₆-C₁₂) Aryl carbamoyl, N- (C)₇-C₁₆) Aralkyl carbamoyl radical, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₂) Aryl carbamoyl, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyl, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyl, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyl, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyl; CON (CH)₂)_hIn which CH₂Can be O, S, N- (C)₁-C₈) -alkylimino, N- (C)₃-C₈) -cycloalkylimino, N- (C)₃-C₈) -cycloalkyl- (C)₁-C₄) -alkylimino, N- (C)₆-C₁₂) Aryl imino, N- (C)₇-C₁₂) -aralkylimino, N- (C)₁-C₄) -alkoxy- (C)₁-C₆) -alkylimino substitution, h is₃-₇(ii) a Carbamoyloxy, N- (C)₁-C₁₂) -alkylcarbamoyloxy, N-di- (C)₁-C₁₂) -alkylcarbamoyloxy, N- (C)₃-C₈) -cycloalkylcarbamoyloxy, N- (C)₆-C₁₂) Aryl carbamoyloxy, N- (C)₇-C₁₆) -aralkyl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₆-C₁₆) Aryl carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- (C)₇-C₁₆) -aralkylcarbamoyloxy, N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- ((C)₆-C₁₂) -aryloxy- (C)₁-C₁₀) Alkyl) carbamoyloxy, N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₁-C₁₀) -alkoxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₆-C₁₆) -aryloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, N- (C)₁-C₁₀) -alkyl-N- ((C)₇-C₁₆) -aralkyloxy- (C)₁-C₁₀) -alkyl) carbamoyloxy, amino, (C)₁-C₁₂) Alkylamino, di (C)₁-C₁₂) -alkylamino, (C)₃-C₈) -cycloalkylamino, (C)₂-C₁₂) -alkenylamino, (C)₂-C₁₂) -alkynylamino, N- (C)₆-C₁₂) Arylamino, N- (C)₇-C₁₁) -aralkylamino, N-alkyl-arylamino, (C)₁-C₁₂) -alkoxy-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -cycloalkylcarbonylamino group, (C)₆-C₁₂) -arylcarbonylamino group, (C)₇-C₁₆) -aralkylcarbonylamino, (C)₁-C₁₂) -alkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₃-C₈) -Cycloalkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₆-C₁₂) -arylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₇-C₁₁) -aralkylcarbonyl-N- (C)₁-C₁₀) -alkylamino, (C)₁-C₁₂) -alkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₃-C₈) -cycloalkylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₆-C₁₂) -arylcarbonylamino- (C)₁-C₈) Alkyl radicals, (C)₇-C₁₂) -aralkylcarbonylamino- (C)₁-C₈) Alkyl, amino- (C)₁-C₁₀) Alkyl, N- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N-di- (C)₁-C₁₀) -alkylamino- (C)₁-C₁₀) Alkyl, N- (C)₃-C₈) -cycloalkylamino- (C)₁-C₁₀) Alkyl radicals, (C)₁-C₁₂) -alkylmercapto, (C)₁-C₁₂) -alkylsulfinyl, (C)₁-C₁₂) Alkyl sulfonyl, (C)₆-C₁₆) Aryl mercapto, (C)₆-C₁₆) -arylsulfinyl, (C)₆-C₁₆) Aryl thioacyl, (C)₇-C₁₆) -aralkylthio, (C)₇-C₁₆) -arylsulfinyl or (C)₇-C₁₆) -an aryl thioacyl group;

or R¹And R²Or R²And R³Optionally substituted heterocyclic ring systems with the pyridine or pyridazine comprising them, said systems being selected from the group consisting of thienopyridines, furopyridines, pyridopyridines, pyrimidopyridines, imidazopyridines, thiazolopyridines, oxazolopyridines, quinolines, isoquinolines and cinnolines; wherein quinoline, isoquinoline and cinnoline preferably satisfy the formulae Ia, Ib and Ic:

f is 1 to 8;

g is 0 or 1 to (2f + 1);

x is 0 to 3;

h is 3 to 7;

including physiologically active salts and prodrugs of the above compounds.

Examples of compounds of formula (I) are described in European patents EP065096 and EP 0650961. All compounds listed in EP065096 and EP0650961, in particular in the compound claims section and the end product of the working examples, are incorporated by reference in the present application. Examples of compounds of formula (I) include, but are not limited to [ (3-hydroxy-pyridine-2-carbonyl) -amino ] -acetic acid (compound G) and [ (3-methoxy-pyridine-2-carbonyl) -amino ] -acetic acid (compound P).

Further, examples of the compounds represented by the formula (I) are described in U.S. Pat. No. 5658933. All compounds listed in us patent 5658933, in particular in the compound claims section and the final product of the working examples, are incorporated by reference in the present application. Examples of compounds of formula (I) include, but are not limited to, 3-methoxypyridine-2-carboxylic acid N- (((hexadecyloxy) -carbonyl) -methyl) -amide hydrochloride; 3-methoxypyridine-2-carboxylic acid N- (((1-octyloxy) -carbonyl) -methyl) -amide; 3-methoxypyridine-2-carboxylic acid N- (((hexyloxy) -carbonyl) -methyl) -amide; 3-methoxypyridine-2-carboxylic acid N- (((butoxy) -carbonyl) -methyl) -amide; racemic 3-methoxypyridine-2-carboxylic acid N- (((2-nonanyloxy) -carbonyl) -methyl) -amide; 3-methoxypyridine-2-carboxylic acid N- (((heptyloxy) -carbonyl) -methyl) -amide; 3-phenoxypyridine-2-carboxylic acid N- (((octyloxy) -carbonyl) -methyl) -amide; 3-benzyloxypyridine-2-carboxylic acid N- (((butoxy) -carbonyl) -methyl) -amide; 5- (((3- (1-butoxy) -propyl) -amino) -carbonyl) -3-methoxypyridine-2-carboxylic acid N- ((benzyloxycarbonyl) -methyl) -amide; 5- (((3- (1-butoxy) -propyl) -amino) -carbonyl) -3-methoxypyridine-2-carboxylic acid N- (((1-butoxy) -carbonyl) -methyl) -amide; 5- (((3-dodecyloxypropyl) -amino) -carbonyl) -3-methoxypyridine-2-carboxylic acid N- ((benzyloxycarbonyl) -methyl) -amide.

Other compounds of formula (I) are substituted heterocyclic carboxamides as described in U.S. Pat. No. 5620995; 3-hydroxypyridine-2-carboxamide esters described in U.S. Pat. No. 6020350; sulfonamidocarbonyl-pyridine-2-carboxamides described in U.S. patent 5607954; sulfonamidocarbonyl-pyridine-2-carboxamides and sulfonamidocarbonyl-pyridine-2-carboxamides described in U.S. Pat. Nos. 5610172 and 5620996. All compounds listed in these patents, in particular in the compound claims section and the final products of the working examples, are incorporated by reference in the present application.

Examples of compounds of formula (Ia) are described in U.S. Pat. Nos. 5719164 and 5726305. All compounds listed in the aforementioned patents, in particular in the compound claims section and the final products of the working examples, are incorporated by reference in the present application. Examples of compounds of formula (I) include, but are not limited to, N- ((3-hydroxy-6-isopropoxy-quinoline-2-carbonyl) -amino) acetic acid (compound H), N- ((6- (1-butoxy) -3-hydroxyquinolin-2-yl) -carbonyl) glycine, [ (3-hydroxy-6-trifluoromethoxy-quinoline-2-carbonyl) amino ] acetic acid (compound I), N- ((6-chloro-3-hydroxyquinolin-2-yl) -carbonyl) glycine, N- ((7-chloro-3-hydroxyquinolin-2-yl) -carbonyl) glycine and [ (6-chloro-3-hydroxy-quinoline-2-carbonyl) amino ] ethanamino acid Acid (compound O).

Examples of compounds of formula (Ib) are described in U.S. Pat. No. 6093730. All compounds listed in us patent 6093730, in particular in the compound claims section and the final product of the working examples, are incorporated by reference in the present application. Examples of compounds of formula (Ib) include, but are not limited to, N- ((1-chloro-4-hydroxy-7- (2-propoxy) isoquinolin-3-yl) carbonyl) glycine, N- ((1-chloro-4-hydroxy-6- (2-propoxy) isoquinolin-3-yl) carbonyl) glycine, N- ((1-chloro-4-hydroxy-isoquinoline-3-carbonyl) amino) acetic acid (compound B), N- ((1-chloro-4-hydroxy-7-methoxyisoquinolin-3-yl) carbonyl) glycine, N- ((1-chloro-4-hydroxy-6-methoxyisoquinolin-3-yl) carbonyl) glycine, N- ((B) amino acid, N- ((B) methyl-ethyl-, N- ((7-butoxy) -1-chloro-4-hydroxyisoquinolin-3-yl) carbonyl) glycine, N- ((6-benzyloxy-1-chloro-4-hydroxyisoquinolin-3-yl) amino) acetic acid (Compound J), ((7-benzyloxy-1-chloro-4-hydroxyisoquinolin-3-yl) amino) acetic acid methyl ester (Compound K), N- ((7-benzyloxy-1-chloro-4-hydroxyisoquinolin-3-yl) amino) acetic acid (Compound L), N- ((8-oxo-4-hydroxyisoquinolin-3-yl) carbonyl) glycine, and mixtures thereof, N- ((7-butoxy-4-hydroxyisoquinoline-3-carbonyl) amino) acetic acid (Compound M).

Compounds related to formula (I) which are also useful in the process of the present invention include, but are not limited to, 6-cyclohexyl-1-hydroxy-4-methyl-1H-pyridin-2-one (Compound N), 7- (4-methyl-piperazin-1-methyl) -5-phenylsulfanylmethyl-quinoline-8-hydroxy (Compound D), 4-nitro-quinoline-8-hydroxy (Compound E) and 5-butoxymethyl-quinoline-8-hydroxy (Compound F). In addition, the present invention provides other compound examples where positions A and B may together form hexanoic acid, cyanomethyl, 2-aminoethyl, benzoic acid, 1H-benzoimidazol-2-methyl, and the like.

In other embodiments, the compound used in the methods of the invention is selected from compounds of formula (II)

Wherein R is²⁸Is hydrogen, nitro, amino, cyano, halogen, (C)₁-C₄) -alkyl, carboxyl or metabolically labile esters thereof; (C)₁-C₄) Alkylamino, di- (C)₁-C₄) -alkylamino, (C)₁-C₆) Alkoxycarbonyl, (C)₂-C₄) Alkanoyl, hydroxy- (C)₁-C₄) Alkyl, carbamoyl, N- (C)₁-C₄) -alkylcarbamoyl, (C)₁-C₄) Alkylthio group(s), (C)₁-C₄) -alkylsulfinyl, (C)₁-C₄) -alkylsulfanyl, thiophenyl, phenylsulfinyl, phenylsulfamoyl, the phenyl group being optionally 1 to 4 identical or different halogens, (C)₁-C₄) -alkoxy, (C)₁-C₄) -alkyl, cyano, hydroxy, trifluoromethyl, fluoro- (C)₁-C₄) -alkylthio, fluoro- (C)₁-C₄) -alkylsulfinyl, fluoro- (C)₁-C₄) Alkyl sulfonyl, (C)₁-C₄) -alkoxy- (C)₂-C₄) Alkoxycarbonyl, N-bis- [ (C)₁-C₄) -alkyl radical]Carbamoyl- (C)₁-C₄) Alkoxycarbonyl, (C)₁-C₄) -alkylamino- (C)₂-C₄) Alkoxycarbonyl, di- (C)₁-C₄) -alkylamino- (C)₂-C₄) Alkoxycarbonyl, (C)₁-C₄) -alkoxy- (C)₂-C₄) -alkoxy- (C)₂-C₄) Alkoxycarbonyl, (C)₂-C₄) -alkanoyloxy- (C)₁-C₄) Alkyl or N- [ amino- (C)₂-C₈) -alkyl radical]-a carbamoyl group;

R²⁹is hydrogen, hydroxy, amino, cyano, halogen, (C)¹-C₄) -alkyl, carboxyl or metabolically labile ester derivatives thereof; (C)₁-C₄) Alkylamino, di- (C)₁-C₄) -alkylamino, (C)₁-C₆) Alkoxycarbonyl, (C)₂-C₄) Alkanoyl radical, (C)₁-C₄) -alkoxy, carboxy- (C)₁-C₄) -alkoxy, (C)₁-C₄) -alkoxycarbonyl- (C)₂-C₄) Alkoxy, carbamoyl, N- (C)₁-C₈) -alkylcarbamoyl, N-di- (C)₁-C₈) -alkylcarbamoyl, N- [ amino-, (C₂-C₈) -alkyl radical]Carbamoyl, N- [ (C)₁-C₄) -alkylamino- (C)₁-C₈) -alkyl radical]Carbamoyl, N- [ di- (C)₁-C₄) -alkylamino- (C)₁-C₈) -alkyl radical]Carbamoyl, N-cyclohexylcarbamoyl, N-cyclopentylcarbamoyl, N- (C)₁-C₄) -alkylcyclohexylcarbamoyl, N- (C)₁-C₄) -alkylcyclopentylcarbamoyl, N-phenylcarbamoyl, N- (C)₁-C₄) alkyl-N-phenylcarbamoyl, N-diphenylcarbamoyl, N- [ phenyl- (C)₁-C₄) -alkyl radical]Carbamoyl, N- (C)₁-C₄) -alkyl-N- [ phenyl- (C)₁-C₄) -alkyl radical]Carbamoyl, or N, N-di [ phenyl- (C)₁-C₄) -alkyl radical]Carbamoyl, the phenyl radical being optionally from 1 to 4 identical or different halogens, (C)₁-C₄) -alkoxy, (C)₁-C₄) Alkyl, cyano, hydroxy, trifluoromethyl, N- [ (C)₂-C₄) -alkanoyl radical]Carbamoyl, N- [ (C)₁-C₄) -alkoxycarbonyl group]Carbamoyl, N- [ fluoro- (C)₂-C₆) -alkyl radical]Carbamoyl, N- [ fluoro- (C)₂-C₆) -alkyl radical]-N-(C₁-C₄) -alkylcarbamoyl, N- [ difluoro- (C)₂-C₆) -alkyl radical]Carbamoyl, 1-pyrrolyl-carbonyl, piperidinylcarbonyl, 1-piperazinyl-carbonyl, morpholinylcarbonyl wherein the heterocyclic group is optionally substituted with 1-4 or less groups, i.e. (C)₁-C₄) -alkyl, benzyl, 1, 2, 3, 4-tetrahydroisoquinolin-2-yl-carbonyl, N- [ di- (C)₁-C₄) -alkyl radical]Thiocarbamoyl, N- (C)₂-C₄) Alkanoylamino or N- [ (C)₁-C₄) -alkoxycarbonyl group]An amino group;

R³¹is hydrogen, (C)₁-C₄) Alkyl radicals, (C)₂-C₄) Alkoxy, halogen, nitro, hydroxy, fluoro- (C)₁-C₄) Alkyl, pyridyl or methoxy;

also included are pharmaceutically acceptable salts and prodrugs thereof.

Examples of compounds of formula (II) are described in U.S. Pat. Nos. 5916898 and 6200974 and International patent publication WO 99/21860. All compounds listed in the aforementioned patents and publications, in particular in the compound claims section and the final products of the working examples, are incorporated by reference in the present application. Examples of the compound represented by the formula (II) include 4-oxo-1, 4-dihydro- [1, 10] phenanthroline-3-carboxylic acid (Compound A) (see, for example, Seki et al (1974) Chem Abstracts 81: 424, No.21), 3-carboxy-5-hydroxy-4-oxo-3, 4-dihydro-1, 10-phenanthroline, 3-carboxy-5-methoxy-4-oxo-3, 4-dihydro-1, 10-phenanthroline, ethyl 5-methoxy-4-oxo-1, 4-dihydro [1, 10] phenanthroline-3-carboxylate, 5-methoxy-4-oxo-1, 4-dihydro [1, 10] phenanthroline-3-carboxylic acid (Compound Q), and 3-carboxy-8-hydroxy-4-oxo -3, 4-dihydro-1, 10-phenanthroline.

In other embodiments, the compound used in the methods of the invention is selected from compounds of formula (III) or a pharmaceutically acceptable salt thereof

Wherein a is an integer between 1 and 4;

b is an integer between 0 and 4;

c is an integer between 0 and 4;

z is selected from (C)₃-C₁₀) Cycloalkyl radicals, substituted by one or more Y¹Independently substituted (C)₃-C₁₀) Cycloalkyl, 3-to 10-membered heterocycloalkyl and substituted by one or more Y¹Independently substituted 3-10 membered heterocycloalkyl; (C)₅-C₂₀) Aryl radicals, substituted by one or more Y¹Independently substituted (C)₅-C₂₀) Aryl, 5-20 membered heteroaryl and substituted by one or more Y¹Independently substituted 5-20 membered heteroaryl;

ar1 is selected from (C)₅-C₂₀) Aryl radicals, substituted by one or more Y²Independently substituted (C)₅-C₂₀) Aryl, 5-20 membered heteroaryl and substituted by one or more Y²Independently substituted 5-20 membered heteroaryl;

each Y¹Independently selected from lipophilic functional groups, (C)₅-C₂₀) Aryl group, (C)₆-C₂₆) Alkylaryl, 5-20 membered heteroaryl and 6-26 membered alkylheteroaryl grades;

each Y²Is independently selected from-R ', -OR ", -SR', -SR", -NR 'R', -NO₂-CN, -halogen, -trihalomethyl, -trihalomethoxy, -C (o) R ', -C (o) OR ', -C (o) NR ' R ', -C (o) NR ' OR ', -C (NR ' R ') -NO R ', -NR ' -C (o) R ', -SO2R ', -SO2R ", -NR ' -SO2-R ' -, -NR ' -C (o) -NR ' R ', tetrazol-5-yl-, -NR ' -C (o) -OR ', -C (NR ' R ') -N R ', -s (o) -R", and-NR ' -C(s) NR ' R ';

each R' is independently selected from-H, (C)₁-C₈) Alkyl, (C)₂-C₈) Alkenyl and (C)₂-C₈) An alkynyl group;

each R' is independently selected from (C)₅-C₂₀) Aryl and substituted with one OR more of-OR ', -SR', -NR 'R', -NO₂Independently substituted by-CN, -halogen, -trihalomethyl (C)₅-C₂₀) An aryl group;

or wherein c is 0, Ar¹Is an N' substituted urea-aryl, said compound having the structure of formula (IIIa):

or a pharmaceutically acceptable salt thereof;

wherein a, b and Z are as defined above;

R³⁵and R³⁶Each independently selected from hydrogen, (C)₁-C₈) Alkyl, (C)₂-C₈) Alkenyl, (C)₂-C₈) Alkynyl, (C)₃-C₁₀) Cycloalkyl group, (C)₅-C₂₀) Aryl group, (C)₅-C₂₀) Substituted aryl, (C)₆-C₂₆) Alkylaryl, (C)₆-C₂₆) Substituted alkylaryl, 5-20 membered heteroaryl, 5-20 membered substituted heteroaryl, 6-26 membered alkylheteroaryl, and 6-26 membered substituted alkylheteroaryl;

R³⁷each independently selected from hydrogen, (C)₁-C₈) Alkyl, (C)₂-C₈) Alkenyl and (C)₂-C₈) Alkynyl.

Examples of compounds of formula (III) are described in International patent publication WO 00/50390. All compounds listed in WO00/50390, in particular in the compound claims section and the final product of the working examples, are incorporated by reference in the present application. Examples of compounds of formula (III) include 3- { [4- (3, 3-dibenzyl-ureido) -thiophenyl ] - [2- (4-methoxy-phenyl) -ethyl ] -amino } -N-hydroxy-propionamide (compound C), 3- { {4- [3- (4-chloro-phenyl) -ureido ] -phenylsulfonyl } - [2- (4-methoxy-phenyl) -ethyl ] -amino } -N-hydroxy-propionamide and 3- { {4- [3- (1, 2-diphenylethyl) -ureido ] -phenylsulfonyl } - [2- (4-methoxy-phenyl) -ethyl ] -amino } -N-hydroxy-propionamide.

Based on the general mechanism of action of members of the family of 2-oxoglutarate dioxygenases, e.g. activity on Fe²⁺And 2-oxoglutarate dependency, the present invention relates in certain aspects to the use of compounds, including the compounds described above, to inhibit HIF α hydroxylation and thereby stabilize HIF α in an oxygen-independent manner. Furthermore, the present examples and data demonstrate that HIF α can be stabilized using these compounds, thereby producing HIF regulatory gene products in vivo and in vitro. In particular embodiments, these compounds have unique benefits in the prevention and treatment of ischemic and hypoxic diseases.

The methods of the invention are dose-dependent in stabilizing HIF α in cells grown in an normoxic environment. Although different cell types exhibit different levels of HIF α in the presence of a compound of the invention, the cell lines measured all exhibit some level of HIF α stabilization. HIF α levels in untreated cells are generally very low and undetectable.

Stabilization of HIF α results in the expression of HIF-dependent genes in vivo and in vitro, including genes encoding vascular growth factors such as VEGF, Flt-1, EG-VEGF, PAI-1, renal medullasin, and Cyr 61. Thus, the ability to stabilize HIF α has potential benefits in inducing vascular growth and preventing tissue damage from ischemia and hypoxia. For example, transgenic mice expressing structurally active HIF-1 α in the epithelium express enhanced expression of each VEGF isoform with a significant increase in epidermal capillaries. Unlike over-expression of a single VEGF isoform, HIF α -induced production of hypervascular material is free of edema, inflammation, or vascular rupture. (see Elson et al (2001) Genes Dev 15: 2520-2532; Detmar et al (1998) J Invest der 111: 1-6; Larcher et al (1998) Oncogene 17: 303-311; Thurston et al (1999) Science 286: 2511-2514.) thus, in certain aspects, the methods of the invention can be used to induce the development of a therapeutic blood vessel that involves the development of collateral blood vessels to revascularize ischemic tissue.

Furthermore, the method of the invention allows the oxygen consumption in the cells to be reduced in terms of dose, without any effect on the viability of the cells. Stable HIF complexes activate the expression of proteins involved in glucose uptake and utilization, such as glucose transporter (GluT) -1 and GluT-3; aldolase-A, enolase-1, hexokinase-1 and-2, phosphofructokinase-L and-C. After HIF α stabilization, oxygen consumption may decrease as cellular metabolism switches from aerobic to anaerobic energy production. Thus, the methods of the invention can be used to generate energy under hypoxic conditions, which are beneficial for ischemic and hypoxic conditions, such as peripheral arterial disease, DVT, angina, pulmonary embolism, stroke, and myocardial infarction. The invention also provides methods for increasing the uptake and utilization of glucose by somatic cells, and is generally useful for other diseases.

The invention also provides methods for improving oxygen delivery capabilities, such as inducing the production of red blood cells, facilitating the transport and utilization of iron. Specifically, the methods of the invention promote the expression of Erythropoietin (EPO), a naturally occurring hormone that stimulates the production of red blood cells. (see, e.g., co-owned co-pending U.S. patent application ______ entitled "method for increasing endogenous erythropoietin (FPO)", co-pending, and incorporated herein by reference in its entirety.) methods for enhancing enzyme and protein expression relate specifically to iron absorption, transport, and processing. These enzymes and proteins include, but are not limited to, transferrin and transferrin receptors, which together facilitate the transport of iron to and absorption by red blood cell tissue and ceruloplasmin; ceruloplasmin is the iron oxidase enzyme required to oxidize ferrous ions to ferric ions. Since transferrin can only bind and transport iron ions, ceruloplasmin plays an important role in providing iron to tissues. The methods of the invention increase endogenous erythropoietin while facilitating iron transport and utilization, and are particularly advantageous for delivering oxygen in normoxic and hypoxic environments.

One aspect of the invention provides methods for protecting a nerve, e.g., by stabilizing HIF α. For example, both VEGF and EPO protect nerves. (see, e.g., Jin et al (2000) Proc Natl Acad Sci USA 97: 10242-. EPO also accelerates recovery from spinal cord injury and protects nerves if introduced prior to an ischemic event. (see, e.g., Gorio et al (2002) Proc Natl Acad Sci USA 99: 9450-.

Hypoxia preconditioning has a good effect on protecting against severe ischemic injury. Since the primary response to hypoxia is stabilization of HIF α and subsequent activation of HIF regulatory genes, the present methods will mimic ischemic preconditioning in an normoxic environment. For example, the method may be applied prior to surgery, as ischemia reperfusion injury during surgery may have deleterious consequences for the patient. Such prophylactic treatment is applied prior to the occurrence of an ischemic event, and may be applied at any time prior to the occurrence of an ischemic event, either as a course of treatment or as multiple courses of treatment.

The methods of the invention also enable the coordinated regulation of genes involved in oxidative stress and vascular quality. These genes include Inducible Nitric Oxide Synthase (iNOS) and heme oxygenase 1. Production of iNOS was also a beneficial effect of hypoxic preconditioning in several animal samples. (see, e.g., Serracino-Inglott et al (2002) BMCGastroenol 2: 22-27; Kuntscher et al (2002) Br J plant Surg 55: 430-433.) in particular, blocking the activity of iNOS can reduce but not eliminate the beneficial effects of preconditioning, but non-specific blocking of protein production can completely eliminate the beneficial effects of preconditioning. (Wang et al (2002) Cardiovasc Res 56: 33-42) this suggests that iNOS is an important, but not the only, component of the physiological response that occurs upon preconditioning. Because the methods of the invention can synergistically regulate various factors, including iNOS involved in hypoxic reactions, the methods of the invention can more accurately reproduce the benefits of hypoxic preconditioning.

Methods of Using the Compounds of the invention

The present invention provides methods for inhibiting hydroxylation of HIF α, thereby stabilizing HIF and activating expression of HIF regulatory genes. The methods are useful for preventing, pretreating, or treating HIF conditions, including ischemic and hypoxic conditions. These diseases include, for example, myocardial infarction, liver ischemia, kidney ischemia, and stroke; peripheral vascular disease, ulcers, burns and chronic wounds; pulmonary embolism; ischemia reperfusion injury, such as occurs in surgery and organ transplantation. In a few ways, the present invention provides methods for stabilizing HIF α before, during, or after occurrence of ischemia or hypoxia, particularly ischemia or hypoxia associated with myocardial infarction, stroke, or renal ischemia-reperfusion injury.

In one aspect, the invention provides methods of treatment of various ischemic and hypoxic diseases, particularly treatment with the above compounds. In one embodiment, the methods of the invention can be used to achieve a therapeutic effect after ischemia or hypoxia has occurred. For example, the methods of the present invention, when used in myocardial infarction, can significantly reduce morbidity and mortality, and can significantly improve cardiac architecture and function. In addition, the application of the method of the present invention to the liver poisoning ischemia injury can improve the liver function. Hypoxia is an important manifestation of liver disease, particularly chronic liver disease caused by hepatotoxic compounds such as ethanol. In addition, HIF α, e.g., nitric oxide synthase and glucose transporter-1, is induced to produce gene expression that is enhanced in alcohol-induced liver disease. (see, e.g., Areel et al (1997) Hepatology 25: 920-

Accordingly, the present invention provides a method of treating ischemic or hypoxic diseases, said method comprising administering to a subject an effective amount of a compound or a pharmaceutically acceptable salt thereof, alone or in combination with a pharmaceutically acceptable excipient. In one embodiment, the compound is administered immediately after the onset of an acute ischemic disease, such as myocardial infarction, pulmonary embolism, ileus, ischemic stroke, and renal ischemia reperfusion injury. In another embodiment, the compounds may be administered to a patient diagnosed with a chronic ischemic disease, such as cardiac sclerosis, macular degeneration, pulmonary embolism, acute respiratory failure, neonatal respiratory depression syndrome, and congestive heart failure. In another embodiment, the compound is administered immediately after the injury.

Another aspect of the invention provides methods of treatment with the above compounds for potential patients with ischemic or hypoxic conditions, such as individuals most likely to suffer from arteriosclerosis. Potential factors that lead to arteriosclerosis include hyperlipidemia, smoking, hypertension, diabetes, hyperinsulinemia, and abdominal obesity. Accordingly, the present invention provides a method of preventing ischemic tissue injury comprising administering to a subject an effective amount of a compound or a pharmaceutically acceptable salt thereof, alone or in combination with a pharmaceutically acceptable excipient. In one embodiment, the compound may be administered according to a previously diagnosed condition, such as hypertension, diabetes, arterial occlusive disease, chronic venous insufficiency, limb arterial spasm, chronic skin ulcers, cirrhosis, congestive heart failure, and systemic sclerosis.

In one embodiment, the method can be used to promote the formation of vascular and/or granulation tissue in injured tissue, wounds, and ulcers. For example, studies have shown that the compounds of the present invention are effective in promoting granulation tissue formation in wound treatment. Granulation tissue contains a nascent but still leaky temporary matrix of blood vessels and plasma proteins, such as fibrinogen and plasma fibronectin. Growth factors released from inflammatory cells, platelets and stimulated endothelium can stimulate migration and proliferation of fibroblasts and endothelial cells in granulation tissue. If blood vessel growth or nerve excitation is impaired, ulceration can occur. The method of the invention can effectively promote the formation of granulation tissue. Therefore, the therapeutic method provided by the present invention can be used for treating tissue damage caused by infarction and the like, trauma caused by trauma and the like, or chronic trauma or ulcer caused by diseases such as diabetes and the like of a patient. The method comprises administering to a subject in need thereof an effective amount of a compound or a pharmaceutically acceptable salt thereof, alone or in combination with a pharmaceutically acceptable excipient.

In another aspect, the invention provides methods of using the compounds to pretreat a patient to alleviate or prevent the worsening of ischemic or hypoxic tissue damage. The method of the present invention can be applied before ischemic or hypoxic diseases are suffered from the better treatment effect. For example, it can be seen from the statistical results that the application of the method of the invention before the induction of myocardial infarction significantly improves the structure and function of the heart. In addition, the method of the present invention can be used immediately before and during the ischemic reperfusion injury to produce better therapeutic effect and significantly reduce the diagnostic parameters related to renal failure.

Accordingly, the present invention provides a method of pre-treating a patient to alleviate or prevent ischemic or hypoxic tissue damage, said method comprising administering to a patient having a history of ischemic events (e.g., myocardial infarction) or having chronic ischemic symptoms (e.g., angina pectoris) an effective amount of a compound or a pharmaceutically acceptable salt thereof, alone or in combination with a pharmaceutically acceptable excipient. In another embodiment, the compound is administered according to a physical parameter indicative of possible ischemia or hypoxia, for example, the individual is under general anesthesia or temporarily working at high altitude. In yet another embodiment, the methods of the invention may be used in organ transplantation to pre-treat an organ donor and protect the organ prior to its removal from the body but prior to transplantation into a recipient.

Previous studies have shown that certain compounds useful in the methods of the invention are effective in inhibiting collagen prolyl 4-hydroxylase. While it is recognized that the connective tissue is deposited in the necrotic area from the initial infarction or wound healing, the present invention does not show a negative therapeutic impact in terms of scar formation. Thus, in view of the advantages of certain compounds of the present invention in the treatment and prevention of hypoxic tissue damage and fibrosis, the present invention proposes a "dual effect" method for the treatment or prevention of ischemic or hypoxic conditions, including reactive fibrosis complicated by ischemia or hypoxia, such as myocardial infarction and congestive heart failure resulting therefrom. The methods can inhibit more than one 2-oxoglutarate dioxygenase enzyme, e.g., a HIF prolyl hydroxylase and a collagen prolyl 4-hydroxylase, with a single compound, having the same or different specificity. Alternatively, the methods may employ compounds in combination, where each compound specifically inhibits one 2-oxoglutarate dioxygenase enzyme, e.g., one compound specifically inhibits HIF prolyl hydroxylase and a second compound specifically inhibits collagen prolyl 4-hydroxylase.

The compounds of the invention are, in one aspect, capable of inhibiting one or more 2-oxoglutarate dioxygenase enzymes. In one embodiment, the compounds inhibit at least two members of the family of 2-oxoglutarate dioxygenase enzymes, such as HIF prolyl hydroxylase and HIF asparaginyl hydroxylase (FIH-1), which may be the same or different in specificity. In another embodiment, the compound is specific for a 2-oxoglutarate dioxygenase enzyme, e.g., a HIF prolyl hydroxylase, with little to no specificity towards other members of the same family.

The compounds may be administered in combination with other various therapeutic approaches. In one embodiment, the compound may be administered simultaneously with another 2-oxoglutarate dioxygenase inhibitor, the two compounds having different specificities for individual 2-oxoglutarate dioxygenase family members. The two compounds may be administered simultaneously in a certain ratio. The proportion of a given course of treatment or the particular patient to whom it is administered can be determined using techniques known in the art. Alternatively, the two compounds may be administered sequentially during the course of therapy, for example for myocardial infarction. In a particular embodiment, one compound specifically inhibits HIF prolyl hydroxylase activity and a second compound specifically inhibits collagen prolyl 4-hydroxylase activity. In another embodiment, one compound specifically inhibits HIF prolyl hydroxylase activity and a second compound specifically inhibits HIF asparagine hydroxylase activity. In another embodiment, the compound is administered concurrently with another therapeutic agent having a different mode of action, e.g., an ACE inhibitor (ACEI), angiotensin-II receptor blocker (ARB), statin, diuretic, digoxin, carnitine, and the like.

Pharmaceutical formulations and routes of administration

The compositions of the present invention may be delivered directly or may be combined with suitable carriers or excipients to form pharmaceutical compositions, as is known in the art. The treatment methods of the present invention comprise administering an effective amount of a compound of the present invention to a patient who may be suffering from an ischemic disease, such as congestive heart failure, arteriosclerosis, and the like. In a preferred embodiment, the subject is a mammal, and in most preferred embodiments, the subject is a human. Preferred routes of administration include oral and transdermal delivery mechanisms.

The effective amount of such agent may conveniently be determined by routine experimentation, and the most effective and convenient route of administration and formulation may be determined. Various formulations and drug delivery systems are known, and the selection of an appropriate formulation is well within the skill of the art. (see, e.g., Gennaro, eds. (1995) Remington pharmacy, supra; Hardman, Limbird, and Gilman, eds. (2001) pharmacological basis for treatment, supra.)

Suitable routes of administration may include oral, rectal, transmural, nasal or small intestinal administration and parenteral administration, including intramuscular, subcutaneous, intraspinal, and intramembranous, direct intraventricular, intravenous, intraperitoneal, intranasal or intraocular injection. The agent or composition may be administered topically, rather than systemically. For example, suitable agents may be delivered by injection or in a targeted delivery system, such as a sustained release formulation.

The pharmaceutical compositions of the present invention may be manufactured by methods well-established in the art, such as by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating or lyophilizing processes. As mentioned above, the compositions of the invention may contain one or more physiologically acceptable carriers, such as excipients and auxiliaries, to aid in the manufacture of medicaments from the active molecules.

Suitable formulations depend on the route of administration chosen. For example, for injection methods, the compositions may be formed into aqueous solutions, preferably physiological buffers such as Hanks 'solution, ringer's solution, or live physiological saline buffer. For transmural or nasal administration, penetrants appropriate to the barrier agent to be permeated may be used in the formulation. Such penetrants are generally known in the art. For oral administration, the compounds are conveniently formulated by combining the active compound with a pharmaceutically acceptable carrier, which is well known in the art. Such carriers enable the compounds of the invention to be formed into tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral administration to a patient. The compounds may also be formulated in rectal compositions such as suppositories or slow release enemas, which may contain conventional suppository bases such as cocoa butter or other glycerides.

Oral preparations can be obtained by adding a solid excipient to the compound, optionally grinding the resulting mixture, processing the granulated mixture, if desired with suitable auxiliaries, and then obtaining tablets or dragee cores. Suitable excipients include in particular fillers, such as sugars, including fructose, sucrose, mannitol or sorbitol; cellulose preparations, such as corn flour, wheat flour, rice flour, potato flour, gelatin, tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, a disintegrant such as cross-linked polyvinylpyrrolidone, agar or alginic acid or a salt thereof such as alginate may be added.

The dragee cores are coated with a suitable coating. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gum, polyethylene glycol, and/or titanium dioxide, varnish solutions, and organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for marking or to characterize different combinations of active compound doses.

Oral formulations include push-fit capsules made of gelatin, soft, sealed capsules made of gelatin and a plasticizer, such as glycerin or sorbitol. The push-fit capsules may contain the active ingredient in admixture with fillers, such as lactose, binders, such as starches, and/or lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added.

In one embodiment, the compounds of the invention are administered transdermally (e.g., via a patch) or topically. In one aspect, the transdermal or topical formulations of the present invention may additionally comprise one or more penetration enhancers or other potentiating agents, including agents that promote the migration of the compound to be delivered. Transdermal or topical administration is preferred where localized administration is desired, and the like.

For administration by inhalation, the compounds for use in the present invention may conveniently be delivered in the form of an aerosol spray presentation from a compressed pack or a nebulizer, with the aid of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or any other suitable gas. For a compressed aerosol, the appropriate dosage can be controlled by a valve to achieve dosing. Gels for use in inhalers or insufflators may be made in the form of capsules or cartridges.

Compositions for parenteral injection, e.g., contrast media injection or continuous infusion, may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may be in the form of suspensions, solutions or emulsions in oil or water vehicles, and may contain dispensing agents such as suspending, stabilizing and/or dispersing agents. Parenteral injection formulations include aqueous solutions or other water-soluble compositions.

Suspensions of the active compounds may also be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils (e.g., sesame oil) and synthetic fatty acid esters (e.g., ethyl oleate or triglycerides), or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextrose. Optionally, the suspension may also contain suitable stabilizers or agents to increase the solubility of these compounds, thereby facilitating the preparation of highly concentrated solutions. Alternatively, the active ingredient may be in powder form for admixture with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

As noted above, the compositions of the present invention may also be formulated as stock pharmaceutical formulations. Such long acting formulations may be administered by implantation (e.g. subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds of the invention may be formulated with suitable polymeric or hydrophobic materials (e.g., as an emulsion in an oil), or with ion exchange resins, or as sparingly soluble derivatives, e.g., as a sparingly soluble salt.

Suitable carriers for the hydrophobic molecules of the present invention are well known in the art and include cosolvent systems and aqueous phases, the former including benzyl alcohols, non-polar surfactants, readily water soluble organic polymers, and the like. The co-solvent system may be a VPD co-solvent system. VPD is a solution of 3% (w/v) benzyl alcohol, 8% (w/v) non-polar surfactant polysorbate 80 and 65% (w/v) polyethylene glycol 300 in volume, made up with absolute ethanol. VPD in a VPD cosolvent system (VPD: 5W) was diluted 1: 1 with 5% dextrose in water. The cosolvent system is effective in dissolving hydrophobic compounds, and has low toxicity during systemic administration. Of course, the proportions of the co-solvent system can be varied considerably, as long as the solubility and toxicity characteristics are not impaired. In addition, the co-solvent composition may vary. For example, polysorbate 80 may be replaced by other low toxicity non-polar surfactants, the proportion of polyethylene glycol may be varied, other biocompatible polymers may be substituted for polyethylene glycol, for example polyvinylpyrrolidone, and other sugars and polysaccharides may be substituted for dextrose.

In addition, other delivery systems for hydrophobic molecules may also be employed. Liposomes and emulsions are well known examples of delivery vehicles or carriers for hydrophobic drugs. Liposomal delivery systems have been discussed above in connection with gene delivery systems. Certain organic solvents, such as dimethyl sulfoxide, may also be used, although often with greater toxicity. In addition, the compounds may be delivered using a sustained release system, such as a semipermeable matrix of a solid hydrophobic polymer containing an effective amount of the composition to be delivered. Various sustained release materials are known and readily available to those skilled in the art. Sustained release capsules can release compounds over a period of weeks to over 100 days, depending on their chemical properties. Depending on the chemical nature and biological stability of the therapeutic agent, other strategies may be employed to increase the stability of the protein.

For any of the compositions used in the methods of treatment of the present invention, the therapeutically effective dose can be determined initially by techniques well known in the art. For example, based on information obtained from cell culture assays, a dose can be formulated to achieve inclusion of IC in an animal sample₅₀The circulating concentration range of (c). Dosage ranges appropriate for humans can similarly be determined, for example using information obtained in cell culture assays and other animal studies.

A therapeutically effective dose of an agent refers to an amount of the agent that will alleviate symptoms or prolong the survival of the subject being treated. Toxicity and therapeutic efficacy of such molecules can be determined by standard pharmaceutical procedures in cultured cells or experimental animals, e.g., for determining LD₅₀(dose lethal to 50% of the population) and ED₅₀(dose that is therapeutically effective in 50% of the population). The dose ratio of toxic to therapeutic effect is the therapeutic index, which can be expressed as LD₅₀/ED₅₀And (4) the ratio. The higher the therapeutic index of the agent, the better.

The dose is preferably within a circulating concentration range which includes the ED₅₀But with little or no toxicity. The dosage may vary within this range depending upon the form of the agent used and the route of administration. The formulation, route of administration and dosage actually employed are selected according to the particular condition of the patient's disease, according to methods known in the art.

The dosage and interval may be adjusted to provide plasma with an amount of active ingredient sufficient to regulate the HIF α stabilization and HIF-regulated gene induction processes, as desired, to achieve a Minimum Effective Concentration (MEC). The MEC may vary for each compound, but can be estimated from in vitro data. The dose required to achieve MEC depends on the individual characteristics of the compound and the route of administration. The agent or composition should be delivered via a controlled carrier to maintain plasma levels above the MEC, about 10-90%, preferably about 30-90%, and most preferably about 50-90% during the treatment period. In the case of local administration or selective absorption, the effective local concentration of the drug does not necessarily correlate with plasma concentration.

The amount of agent or composition administered will, of course, depend on a variety of factors including the sex, age and weight of the subject being treated, the severity of the affliction, the mode of administration and the judgment of the prescribing physician.

If desired, the compositions of the invention may be contained in a pack or dispensing device and may contain one or more doses of the drug containing the active ingredient. Such packs or devices may comprise, for example, metal or plastic foil, such as blister packs. The medicine package or the medicine distribution device can be attached with the injection instructions. Compositions containing the compounds of the present invention formulated in a pharmaceutically acceptable carrier may also be presented in a suitable container and labeled for treatment of a given condition. The corresponding disease indicated on the label may include a disease or disorder that is dominated by ischemia or hypoxia.

Screening and identification of Compounds

The present invention also provides screening and identification of other compounds that inhibit hydroxylation of HIF α or stabilize HIF α, etc.

Various assay and screening techniques, including those described below, can be used to identify small molecules that modulate (e.g., increase or decrease) HIF α level or activity. Assays typically provide a detectable signal associated with the consumption of a reaction substrate or the production of a reaction product. For example, detection may involve fluorophores, radioisotopes, conjugated enzymes, and other detectable labels known in the art. The results obtained may be qualitative or quantitative. Tags such as biotin or histidine may help track the separation of reaction products, which may be purified from other reaction components by precipitation or affinity chromatography.

Assays for the hydroxylation process of HIF α may involve the determination of hydroxylated proline or lysine residues in HIF α or fragments thereof (see, e.g., Palmerini et al (1985) J Chromatogr 339: 285-. An exemplary procedure for determining the hydroxylation process of HIF α is described in Ivan et al (supra) and example 10. Exemplary procedures for determining succinate formation from 2-oxoglutarate are described in Kaule and Gunzler (1990; Anal Biochem 184: 291-; for example, an exemplary substrate employed in the assay described in example 10 is [ methoxycoumarin ] ═ DLDLEALAPYIPADDDFQL-amide (SEQ ID NO: 5). Enzymes can include, for example, HIF α prolyl hydroxylase (see, e.g., GenBank accession No. AAG33965, etc.), and can be from any source. The enzyme may also be present in the crude cell lysate or in partially purified form. A compound that stabilizes HIF α or inhibits hydroxylation of HIF α can be assayed and compared for enzyme activity in the presence or absence of the compound.

In addition, compounds can be identified by various screening techniques known in the art, which can also be used in combination with the above methods. These screening methods may be performed such that the target polypeptide or compound is not contained in the solution, or such that it is attached to a solid support, produced on the surface of a cell, or located inside a cell. For example, test compounds can be arrayed on a surface in a manner similar to array methods known in the art and then assayed for activity (see, e.g., Shalon et al (1995) International publication WO 95/35505; Baldeschweiler et al (1995) International publication WO 95/251116; Brennan et al (1995) U.S. Pat. No. 5474796; Heller et al (1997) U.S. Pat. No. 5605662.)

These and other embodiments of the present invention, which have been specifically repeated and understood by those skilled in the art after reviewing the present specification, will be readily apparent to those skilled in the art.

Examples

The present invention will be better understood with reference to the following examples, which are intended to be illustrative of the invention. The scope of the invention is not limited by the illustrated embodiments, which are merely illustrative of a single side of the invention. Any method which is functionally equivalent is within the scope of the invention. In view of the foregoing description and accompanying drawings, it will be apparent to those skilled in the art that various modifications may be made in the present invention beyond those described herein. Such modifications are also intended to fall within the scope of the appended claims.

Example 1 stabilization of HIF α in vitro cells

Human cells from adenovirally denatured fetal kidney epithelial cells (293A), cervical epithelial adenocarcinoma cells (HeLa), liver cancer cells (Hep3B), foreskin fibroblasts (HFF), breast epithelial cancer cells (MCF7), venoventricular endothelial cells (HUVEC), microvascular endothelial cells (HMEC-1), umbilical squamous carcinoma cells (SCC-25), lung fibroblasts (HLF), venous endothelial cells (AG10774B) tissues (see, e.g., American type culture Collection, ManassaVA; Qbiogene, Carlsbad CA) were seeded in 35mm dishes at 37 deg.C and 20% O₂、5％CO₂The culture is carried out in the environment, and the medium is as follows: HeLa cells in Dulbecco Modified Eagle Medium (DMEM), 2% calf serum (FBS); HFF and HLF cells in DMEM, 10% FBS; 293A cells in DMEM, 5% FBS; HUVEC and AG10774B cells in endothelial growth medium (EGM-2; BioWhittaker, Inc., Walkersville MD); HMEC-1 in RPMI 1640, 10% FBS; hep3B cells in Minimum Essential Medium (MEM), Earle BSS (Mediatech inc., herndon va), 2mM L-glutamic acid, 0.1mM minor amino acid, 1mM sodium pyruvate, 10% FBS. When the cell layer is convergedAfter this time, the media was replaced with OPTI-MEM media (Invitrogen Life Technologies, Carlsbad CA) and the cell layer was at 37C at 20% O₂、5％CO₂Medium culture for about 24 hours. The compound of the invention (one of the compounds A-O) or DMSO (0.5-1%) is then added to the existing medium and incubation is continued overnight.

After incubation, the medium was removed, centrifuged and stored for analysis (see below). Cells were washed 2 times in cold Phosphate Buffered Saline (PBS), and then lysed in 1ml 10mM Tris (pH 7.4), 1mM EDTA, 150mM NaCl, 0.5% IGEPAL (Sigma-Aldrich, St. Louis MO) and protease inhibitor cocktail (Roche Molecular biochem capsules) for 15 minutes under freezing conditions. The cell lysate was centrifuged at 3000Xg for 5 minutes at 4C and the cell lysate fraction (supernatant) was collected. The nuclei (pellets) were resuspended and solubilized in 100. mu.l of a20 mM HEPES (pH 7.2), 400mM NaCl \1mM EDTA, 1mM dithiothreitol and protease mixture (Roche Molecular Biochemicals), centrifuged at 13000Xg at 4 ℃ and the nuclear protein fraction was collected.

The core fraction was corrected for protein concentration, loaded into 4-12% TG gels, and fractionated under reducing conditions. Proteins were transferred to PVDF membranes (Invitrogen corp., Carlsbad CA) over 1.5 hours at 500mA current. The membranes were masked in T-TBS, 2% milk for 1 hour at room temperature, and rat anti-human HIF-1. alpha. antibody (BD Bioscience, Bedford MA), diluted 1: 250 in T-TBS, 2% milk, was incubated overnight. Spots were incubated with SUPERSIGNAL WEST chemiluminescent substrate (Pierce, Rockford IL). As shown in FIG. 1A, various compounds of the invention (A-F) stabilized HIF α in a dose-dependent manner in an normoxic environment. As shown in fig. 1B, various cell types, including fibroblasts, epithelial cells, endothelial cells, and hepatocytes from various sources, all showed dose-dependent stabilization of HIF α when treated with the compounds of the present invention in an normoxic environment.

Alternatively, the nuclear and peri-fluid fractions were analyzed for HIF-1 α using a QUANTIKINE immunoassay device (R & D Systems, Inc., MinneapolisMN) according to the manufacturer's instructions. As shown in FIG. 2A, HIF α was stabilized and enriched in epithelial cells (293A) and hepatocytes (Hep3B) treated with various compounds of the invention (compounds B and G-O) compared to vehicle-treated control cells. As shown in FIG. 2B, cells treated with a compound of the invention have dose-dependent stabilization of HIF α.

Example 2: oxygen consumption effect

Oxygen sensing cell culture dishes (BD Bioscience, Bedford MA) contain a spike complex that has better fluorescence under low oxygen conditions. Thus, if oxygen-consuming cells are present in the culture dish, the fluorescence readout signal is enhanced, which shifts the equilibrium towards low oxygen saturation and high fluorescence states. It is expected that compounds that stabilize HIF by inhibiting hydroxylation will reduce oxygen consumption, i.e., will reduce oxygen consumption by the hydroxylation itself, and/or will switch cell metabolism from aerobic to anaerobic.

Adenovirus-denatured fetal kidney epithelial cells (293A) or cervical epithelial adenocarcinoma cells (HeLa) (American type culture Collection) were cultured at 37 ℃ and 10% CO₂Confluent in medium (high glucose DMEM (Mediatech, inc., Herndon VA), 1% penicillin/streptomycin mixture (Mediatech), 1% calf serum) under conditions. Cells were collected and resuspended in media at a density of 500000 cells/ml. The suspension was dispensed into each well of an Oxygen Biosensor 96 well cell culture dish (BD Bioscience), 0.2ml per well. The following treatment time reagents were added to the three well groups in 10 μ l volumes: (1) 0.5% DMSO; (2)200 μ M sodium lauryl sulfate; or (3)1, 10 or 50. mu.M of a compound (Compound B, G or a prodrug of Compound V [ pV ]]One of them).

Culture medium at 37C 10% CO₂Medium for 72 hours, and then the dish data were read by FL600 fluorometer (biotek instruments, inc., Winooski VT) at an excitation wavelength of 485nm and an emission wavelength of 590 nm. The data obtained are used to plot the fold function of absorbance (O consumption) versus DMSO reference or at a wavelength of 450nm (WST-1)₂Volume), and entered using EXCEL software (microsoft corporation, Bellevue WA)And (4) performing descriptive statistical analysis.

FIG. 3A shows the fold change in oxygen consumption of cells treated with the compound relative to a reference. As can be seen from the figure, all compounds reduced oxygen consumption to some extent. Furthermore, the reduction in oxygen consumption was dose dependent (fig. 3A), and little or no loss in cell viability was detected even at the highest dose (fig. 1B). Additional experiments (not shown) were performed in various cell culture experimental systems, including addition³Both H-thymidine and the full amino acid demonstrated that the decrease in oxygen consumption was not associated with cytotoxicity.

Example 3: expression of HIF regulatory genes in vitro

Immunoassay using QUANTIKINE immunoassay device (R)&D) Vascular Endothelial Growth Factor (VEGF) was analyzed according to the manufacturer's instructions on conditioning media collected from cell culture broth prepared as in example 1. As shown in FIG. 4A, various compounds of the present invention (Compound A, B, C, H, K, L, Q and prodrug of Compound V [ pV ]]One) treated foreskin fibroblasts (HFF), adenovirally denatured fetal kidney epithelial cells (293A), and liver cancer cells (Hep3B) all had reduced expression of VEGF (fig. 4A). The values on the Y axis represent the log of the fold induction relative to the reference²Values, such that a value of 1 represents a 2-fold induction.

Alternatively, at 37 ℃ and 10% CO²Human cells from adenovirus-denatured fetal kidney epithelial cells (293A) were cultured in DMEM, 5% FBS, 1% penicillin-streptomycin in ambient. After 48 hours, the cells were collected and pooled in 35mm dishes using conventional media, which was changed to Opti-Mem I after 1 day. After 18-24 hours, compound B was added to the medium and incubated for an additional 18 hours. The supernatant was removed from the dish, the dish was placed on ice, cell Lysis Buffer (LB) -1 was added, and the cells were scraped. Scraped cells were collected, incubated on ice for 15 minutes, and then centrifuged at 3000Xg for 5 minutes at 4 ℃. Collecting supernatant representing cell sap, and separating cell sap proteins each by SDS-polyacrylamide gel under modified and reduced pressure conditionsThe channels were loaded with equal amounts of protein.

After SDS-PAGE by 2-hour gel electrophoresis at 150V, the proteins were transferred to PVDF membrane at 400mA current and 4 ℃ temperature within 1.5 hours. Then, the membrane was incubated in a masking buffer, washed once with T-TBS, added with the anti-aldolone antibody diluted to the working concentration in the masking buffer, and incubated at 4 ℃ overnight with gentle stirring. The membrane was then washed 4 times with T-TBS and incubated for 1 hour at room temperature, with the masking buffer containing labeled secondary antibodies. The membrane was then washed 4 times with T-TBS. The X-ray film was exposed and developed using ECL SUPERSIGNAL WEST FEMTO or PICO chemiluminescent substrate (Pierce, Rockford IL) as described, and an antigen specific to the original antibody was seen.

FIG. 4B shows the increase in aldolase expression by the compound at various times, the aldolase being an enzyme involved in glycolysis. Thus, stabilization of HIF α by a compound of the invention additionally results in increased expression of HIF regulatory genes.

Example 4: stabilization of HIF α in cells in vivo

Swiss webster mice (30-32g) were obtained from Charles River Laboratories, Inc. (Wilmington MA) or Simonsen, Inc. (Gilroy, CA) and fed one or more times per day for at least one day by feeding 2ml/kg volumes of 0.5% carboxymethylcellulose (CMC; Sigma-Aldrich) (control) or 5.0% compound (0.5% CMC). At one or more time points of the last dose, e.g., 2-5 hours, the animals are anesthetized with isoflurane, and 0.1ml of blood is drawn, e.g., from the eye sinuses, into heparinized tubes. After all time points were selected, animals were given sublethal amounts of CO₂Blood was drawn from the abdominal vein and placed in heparinized tubes. All blood samples were stored at-80 ℃.

HIF α protein levels were assayed in the following manner for tissues isolated from animals treated with the compounds of the invention described above. The tissue was homogenized for 15 seconds in 3ml 10mM Tris (pH 7.4), 1mM EDTA, 150mM NaCl, 0.5% IGEPAL (Sigma-Aldrich) using a POLYTRON PT-1200 homogenizer (Brinkmann Instruments, Inc., Westbury NY). The cell lysate was centrifuged at 3000Xg for 5 minutes at 4 ℃ to collect the cell fluid (supernatant). The nuclei (pellets) were resuspended and dissolved in 100. mu.l of 20mM HEPES (pH 7.2), 400mM NaCl, 1mM EDTA, 1mM dithiothreitol and protease mixture (Roche molecular biochemicals), and the cell lysate was centrifuged at 3000Xg for 5 minutes at 4C to collect the nucleoprotein (supernatant).

The nuclear fraction was normalized to protein concentration and loaded onto 4-12% TG gels under reduced pressure. Proteins were transferred to PVDF membranes (Invitrogen Life technologies) at 500mA current over 1.5 hours. T-TBS at room temperature, 2% milk for 1 hour, and incubated overnight with anti-HIF α antibody diluted in T-TBS, 2% milk. Spots were incubated with SUPERSIGNAL WEST chemiluminescent substrate (Pierce, Rockford IL).

Alternatively, the nuclear fraction and peri-fluid fraction prepared as above were analyzed for HIF-1 α using a QUANTIKINE immunoassay device (R & D Systems, Inc., MinneapolisMN) according to the manufacturer's instructions.

Example 5: expression of HIF regulatory genes in vivo

Experiment I

24 Switzerland Webster mice (30-32g) were obtained from Charles River Laboratories, Inc. (Wilmington MA) or Simonsen, Inc. (Gilroy, Calif.) and fed with 4ml/kg volume of 0.5% carboxymethylcellulose (CMC; Sigma-Aldrich) (0 mg/kg/day) or 1.25% Compound A (25mg/ml in 0.5% CMC) (100 mg/kg). After feeding the last dose for 4, 8, 16, 24, 48 or 72 hours, the animals were anesthetized with isoflurane and blood samples were drawn from the abdominal vein. Blood samples were collected into MICROTAINER serum separation tubes (Becton-Dickinson, Franklin Lakes NJ), incubated at room temperature for 30 minutes, centrifuged at 8000rpm for 10 minutes at 4 ℃, the cell plates resuspended in rnalter solution (Ambion), and stored at-80 ℃. These rats were then sacrificed and tissue samples in the kidney, liver, brain, lung and heart were isolated and stored in rnalter solution (Ambion) at-80 ℃.

RNA isolation was performed by the following method. A50 mg piece of tissue was excised from each organ, 875. mu.l of RLT buffer (RNEASY kit; Qiagen Inc., Valencia) was added, and each piece of tissue was homogenized with a rotor-stator POLYTRON homogenizer (Kinematica, Inc., Cincinnati OH) for about 20 seconds. The homogenate was microcentrifuged for 3 minutes to pellet the insoluble material, the supernatant transferred to a new tube, and RNA was isolated using the RNEASY kit (Qiagen) as described. RNA was eluted into 80. mu.l of water and the amount was determined using RIBOGREEN reagent (molecular probes, Eugene OR). Genomic DNA was removed from RNA using the DNA-FREE kit (Ambion Inc., Austin TX) according to the instructions. The absorbance was measured at 260 and 280nm to determine the purity and concentration of the RNA.

Alternatively, after tissue samples are excised, they are homogenized in TRIZOL reagent (invitrogen life technologies, CarlsbadCA) using a rotor-stator POLYTRON homogenizer (Kinematica). The homogenate is left at room temperature, 0.2 volume of chloroform is added and the sample is vigorously stirred. The mixture was incubated at room temperature for several minutes and then centrifuged at 12000g for 15 minutes at 4 ℃. The aqueous phase was collected and 0.5 part by volume of isopropanol was added. The samples were mixed, incubated at room temperature for 10 minutes, and centrifuged at 12000g for 10 minutes at 4 ℃. The supernatant was removed, the cell plates were washed with 75% EtOH and centrifuged at 7500g for 5 min at 4C. Genomic DNA was then removed from RNA using the DNA-FREE kit (Ambion inc., Austin TX) according to the instructions. The absorbance was measured at 260 and 280nm to determine the purity and concentration of the RNA.

RNA was precipitated in 0.3M sodium acetate (pH 5.2), 50ng/ml glycogen and 2.5 volumes of ethanol at-20 ℃ for 1 hour. The samples were centrifuged and the cell plates were washed with 80% cold ethanol, dried and resuspended in water. Double-stranded cDNA was synthesized using the SUPERSCRIPTCHOICICE system (Invitrogen) using T7- (dT)24 as the first primer (Affymetrix, Inc., Santa Clara CA) according to the instructions. The final cDNA was extracted with 25: 24: 1 phenol: chloroform: isoamyl alcohol using the PHASE LOCK GEL insert (Brinkman, Inc., WestburyNY). The aqueous phase was collected and the cDNA precipitated with 0.5 volumes of 7.5M ammonium acetate and 2.5 volumes of ethanol. Alternatively, the cDNA was purified using GENECHIP sample cleaning Module (Affymetrix) according to the instructions.

Biotin-labeled cRNA was synthesized from cDNA in an In Vitro Translation (IVT) reaction using the BIOARRAY High Yield RNA transcription labeling kit (azo diagnostics, inc., farmingdaley) according to the instructions for use. The final labeled product was purified and fragmented using GENECHIP sample cleaning module (Affymetrix) according to the instructions for use.

Mu.g of probe was added to 100. mu.l of 1 Xhybridization buffer (100mM MES, 1M [ Na ]⁺]Hybrid "cocktails" were prepared from 20mM EDTA, 0.01% Tween20), 100. mu.g/ml herring sperm DNA, 500. mu.g/ml acetogenized BSA, 0.03nM control Low B2(Affymetrix), and 1 XGENECHIP eukaryotic hybrid control (Affymetrix). The cocktail was incubated at 99C for 5 minutes and 45 ℃ for 5 minutes in sequence, then centrifuged for 5 minutes. Murine genomic U74AV2 array (MG-U74AV 2; Affymetrix) was set at room temperature, then 1 Xhybridized buffer was added and spun at 45 ℃ for 10 minutes for prehybridization. The array was then hybridized for 16 hours with 80. mu.l of the hybridization cocktail replacing the buffer, and counter-rotating at 60rpm at 45 ℃. After hybridization, the array was washed once with 6x SSPE, 0.1% Tween20, then washed and stained with R-phycoerythrin-conjugated streptavidin (molecular probes, Eugene OR), goat anti-streptavidin antibody (Vector Laboratories, Burlingame CA), and GENECHIP fluidics Station 400 instrument (Affymetrix) according to the commercial micro-1 vl protocol (Affymetrix). Arrays were analyzed using GENEARRY scanner (Affymetrix) and Microarray Suite software (Affymetrix).

The Murine Genome U74AV2 array (Affymetrix) represents all sequences (. about.6000) (which are functionally characterized) and about 6000 unlabeled Expressed Sequence Tag (EST) clusters in the Mouse UniGene database 74 (national center for Biotechnology information, BethesdamD).

As can be seen from FIG. 5A, the expression of the gene encoding the angiogenic protein was increased in an equivalent manner after treatment with the compound of the present invention, taking lung as a representative organ. The transcription patterns shown in the figure include VEGF-C, Flt-1/VEGF receptor-1, renal medullasin, endothelin-1, Plasminogen Activation Inhibitor (PAI) -1, and Cyr 61. The mRNA exited the peak earlier with time and returned to control levels after 24 hours. FIG. 5B shows the specific expression-time relationship of two genes, endoscortin-1 and renal medullasin, representing the gene cluster in FIG. 5A. In similar experiments, significant increases in expression of other HIF regulatory genes were seen, including phosphofructokinase, enolase 1, lactate dehydrogenase, glucose transporter 1, acyl-CoA thioesterase, heme oxidase, transferrin receptor, IGFBP-1, nip3, nix, and cyclin G3.

As can be seen from FIG. 7A, the expression of the gene encoding glycolytic enzyme increases in an equivalent manner after treatment with the compound of the present invention, using the kidney as a representative organ. The transcription patterns shown in the figure include aldolase A, enolase 1, glucose transporters (GluT) -1 and-3, GAPDH, hexokinase-1 and-2, lactate dehydrogenase A, phosphofructokinase-L and-C, phosphoglycerate kinase-1, and pyruvate kinase-M. The mRNA exited the peak earlier with time and returned to control levels after 24 hours. FIG. 7B shows specific expression-time relationships for two genes, aldolase and phosphofructokinase, representing the gene cluster in FIG. 7A.

Experiment II

12 Swiss Webster mice (30-32g) were obtained from Simonsen, Inc. and fed with 4ml/kg volume of 0.5% carboxymethylcellulose (CMC; Sigma-Aldrich) (0 mg/kg/day) or 2.5% of compound B or E (25mg/ml in 0.5% CMC) (200mg/kg) 2 times a day for 2.5 days (5 doses). After the last dose 4 was fed, the animals were anesthetized with isoflurane and blood samples were drawn from the abdominal vein. Blood samples were collected into MICROTAINER serum separation tubes (Becton-Dickinson), incubated at room temperature for 30 minutes, and centrifuged at 8000rpm for 10 minutes at 4 ℃. The serum fraction was processed and analyzed for Vascular Endothelial Growth Factor (VEGF) expression using a QUANTIKINE immunoassay device (R & DSystems) according to the Merchant's instructions. These rats were then sacrificed and approximately 150mg of liver and kidney were isolated and stored in RNARATER solution (Ambion) at-20 ℃.

RNA isolation was performed by the following method. Tissue sections were cut into small pieces, 1.75ml of RLT buffer (RNEASY kit; Qiagen) was added, and each piece of tissue was homogenized with a rotor-stator POLYTRON homogenizer (Kinematica, Inc., Cincinnati OH) for about 20 seconds. Mu.l of the homogenate were microcentrifuged for 3 minutes to granulate the insoluble material, the supernatant was transferred to a new tube and RNA was isolated using the RNEASY kit (Qiagen) as described. RNA was eluted into 80. mu.l of water and the amount was determined using RIBOGREEN reagent (Molecular Probes, EugeneOR). Genomic DNA was removed from RNA using the DNA-FREE kit (Ambion) according to the instructions. The absorbance was measured at 260 and 280nm to determine the purity and concentration of the RNA.

cDNA was synthesized using 1. mu.M random hexamer primers, 1. mu.g of whole RNA and OMNISCRIPT reverse transcriptase (Qiagen) as per the instructions. The resulting cDNA was diluted with four times the volume of water to a final volume of 100. mu.l. The relative levels of Vascular Endothelial Growth Factor (VEGF) gene expression were analyzed by quantitative PCR using the LIGHTCYCLE system (Roche Molecular Biochemicals) using the FASTSTART DNA MASTER SYBR GREENI kit (Roche Molecular Biochemicals) and VEGF specific primers according to the instructions. The sample was heated to 94 in 6 minutes, then switched to 95 in 15 seconds, 60 in 5 seconds, and 72 in 10 seconds, for a total of 42 cycles. VEGF specific primers were as follows:

m-VEGF-F1 GTTGCAAGGCGAGGCAGCTT (SEQ ID NO：1)

m-VEGF-R1 TGACGATGATGGCATGGTGGT (SEQ ID NO：2)

the relative level of 18S ribosomal RNA gene expression was determined as a control. PCR was quantified using the QUANTITECTSYBR GREEN PCR kit (Qiagen) and 18S rRNA specific primers using the LIGHTCYCLER system (Roche Molecular Biochemicals) according to the instructions. The sample was heated to 94 in 6 minutes, then switched to 95 in 15 seconds, 60 in 5 seconds, and 72 in 10 seconds, for a total of 42 cycles. The ribosomal RNA specific primers were as follows:

18S-rat-2B TAGGCACGGCGACTACCATCGA (SEQ ID NO: 3)

18S-rat-2A CGGCGGCTTTGGTGACTCTAGAT (SEQ ID NO: 4)

Each round of PCR included a standard curve and a water blank. In addition, after each round of PCR was completed, the melting curve was measured to evaluate expanded specificity. VEGF gene expression was corrected for the expression level of 18S ribosomal RNA in this sample.

Figure 6A shows compound E enhanced VEGF expression in kidney and compound B enhanced VEGF expression in liver and kidney. As can be seen in fig. 6B, VEGF levels in plasma of animals treated with the compound were significantly increased relative to untreated control animals at 2, 5, and 20 hours after the last dose administration.

Example 6: cardiac ischemia

Experiment I

Nwogu et al (2001; Circulation 104: 2216-2221) have reported the use of the compounds of the present invention for the treatment of myocardial infarction. While the authors explain their results from the perspective that the compounds affect fibrosis, the present invention clearly shows that HIF α stabilization is a major benefit to cardiac function. The experimental procedures are described in Nwogu et al (supra), and are also described in detail below.

70 adult Wistar male mice (200- & 250g) were anesthetized and their left coronary arteries were closed, resulting in Acute Myocardial Infarction (AMI). The same procedure was performed on 9 animals, but without coronary artery banding. 24-48 hours post-surgery, the electrodes of an Electrocardiograph (ECG) were attached to the paws, a 15MHz linear probe (Acuson Corp., Mountain View CA) was brought into contact with the chest, and a short axis thoracic intracardiac echo image (2DE) was obtained near the mid-papillary. The probe is moved cephalad or caudal and angled until an endocardial image of the left ventricle can be clearly detected. Images were acquired with a Sequoia ultrasound system (Acuson). Animals with less than 20% fractional shortening on 2DE and local mura abnormalities were treated randomly with compound a (n-14) or vehicle (n-12). Control sham samples were also treated randomly with compound a (n-4) or vehicle (n-5).

During the experiment, animals were fed compound A (50mg/kg) or vehicle alone 2 times per day. Periodically measuring the serum level of the drug to determine that a sufficient amount of the drug has been continuously received in the treated animal, the measured level being sufficient to inhibit prolyl 4-hydroxylase, represented by 2-oxoglutarate dioxygenase.

A series of 2DE images were collected weekly. Three short axis 2DE digital folders containing 5 or more systolic and diastolic images are captured and saved. Two observers unfamiliar with the treatment method performed the off-line measurements. During measurement, the digital image is slowed down and frozen at the systolic and diastolic ends. Two systolic and diastolic images were measured for each of the three digital folders until a consistent result was obtained, and then averaged. Anterior systolic wall (AWS) and anterior diastolic wall (AWD), posterior systolic wall (PWS) and posterior diastolic wall (PWD), and left ventricular systolic end (lvdsd) and diastolic end (LVEDD) were determined according to the lead edge method of the american society of cardioacoustics (ASE). To remain coherent, the measurements were performed between the anterior midpoint and posterior midpoint of the left ventricle, repeated randomly to ensure repeatability (replication rate of about 96%).

After 4 weeks of treatment, infusion (0.2 ml over 1 minute) via the femoral vein 10⁷Hemodynamic assays were performed in vivo before and after M isoproterenol. The heart was then exercised and weighed as described below.

Alternatively, 140 adult Wistar male mice (200- & 250g) were anesthetized and their left coronary arteries were closed, resulting in Acute Myocardial Infarction (AMI). 2DE images were obtained 48 hours post-surgery, and animals with significant infarct areas were randomized to compound a (n-34) or vehicle (n-34).

During the experiment, animals were fed compound A (50mg/kg) or vehicle alone 2 times per day. The serum levels of the drug are periodically measured to determine that the treated animal has received a sufficient amount of the drug to continuously measure levels sufficient to inhibit prolyl 4-hydroxylase.

Half of the animals in each group were measured 2DE digital images of the middle papillary muscle and the top four chambers every other week for 8 weeks. The off-line measurements were performed by two observers unfamiliar with the treatment method. During measurement, the digital image is slowed down and frozen at the systolic and diastolic ends. Two three cardiac internal surfaces were followed in the short axis and four ventricular directions and averaged. The areas of the left ventricle during systole and diastole, fraction ratio of ejection, change in area of each part, wall thickness, mitral valve peak E-wave velocity, aortic peak velocity and embolization size were determined.

After 10 weeks of treatment, hemodynamic testing was performed in vivo and the heart was exercised and weighed as described below.

To collect in vivo hemodynamic test data, animals were anesthetized, the right carotid artery cut from the surrounding tissue and made into a hollow structure using a SPR-671 ultramicro pressure transducer (Millar Instruments, inc., Houston TX). The catheter is then inserted into the left ventricle. After establishing the equilibrium state, the maximal rates of baseline Heart Rate (HR), resultant pressure (DP), systolic index (CI), left ventricular systolic pressure (SBP), end diastolic pressure (LVEDP), and pressure rise and fall (+ dP/dt and-dP/dt, respectively) were recorded.

In the hemodynamic determination, the heart is exercised and weighed. The crusted myocardium, the right ventricle and the left ventricle muscle, which are distant from the embolization site, were cut into small pieces and weighed. Hydroxylated proline and proline were determined by Palmerini et al (1985, J Chromatogr 339: 285-92) except that L-azetidine-2-carboxylic acid (Sigma-Aldrich) was used as an internal standard in place of 3, 4-dehydroproline.

If the compounds of the invention are administered to patients with myocardial infarction, an immediate reduction in mortality can be seen. As can be seen from fig. 8, no case death was seen in the treated group immediately after the heart injury, and more than 90% of the cases survived in the treated group after 8 weeks. In contrast, only about 60% of the cases in the untreated group survived this period. Statistically, the survival rate of the treated group was significantly improved (P < 0.05) and the mortality rate was relatively decreased by 77% within 2-8 weeks compared to the untreated group.

The cardiac parameters were also improved in the treated group compared to the untreated group. Table 1 shows that the left ventricular end-diastolic diameter (LVEDD) of the treated group did not increase, whereas the LVEDD and left ventricular end-systolic diameters (LVEDD) measured contemporaneously in the untreated group increased. After 1 week of treatment, the statistical results for cardiac enlargement were significantly different between the treated and untreated groups.

TABLE 1 variation of diameter at end-diastole of the left ventricle

Number of weeks	treatment-MI (mm)	untreated-MI (mm)	Pseudo sample (mm)
Number of weeks	treatment-MI (mm)	untreated-MI (mm)	Pseudo sample (mm)	0	69±1	67±2	43±3
1	68±2	76±2	44±3	0	69±1	67±2	43±3
1	68±2	76±2	44±3	2	69±3	74±4	45±2
3	68±4	75±3	45±2	2	69±3	74±4	45±2

The values in the table represent the mean. + -. standard deviation.

TABLE 2 variation in diameter at end-systole of the left ventricle

Number of weeks	treatment-MI (mm)	untreated-MI (mm)	Pseudo sample (mm)
Number of weeks	treatment-MI (mm)	untreated-MI (mm)	Pseudo sample (mm)	0	77±2	75±1	67±2
1	82±2	88±1	65±2	0	77±2	75±1	67±2
1	82±2	88±1	65±2	2	85±3	86±3	69±2
3	85±4	86±2	68±4	2	85±3	86±3	69±2

The values in the table represent the mean. + -. standard deviation.

FIGS. 9A and 9B are graphs showing LVESD and LVEDD, respectively, as a function of time. The end-diastolic and systolic diameters of the left ventricle in the three groups were similar at any time. In fig. 10A, treated animals were compared to untreated controls at weeks 2 through 8. The Left Ventricular Ejection Fraction (LVEF) was statistically significantly increased. At any time, LVEF was 33% for both groups. The LVEF of the untreated control group increased significantly from week 4 to week 6, reflecting the high mortality rate of the members of the group.

The fractional shortening of the treated groups during myocardial contraction was also improved. Table 3 statistically shows that the fractional shortening was significantly improved in the treated groups compared to the untreated groups within 1-4 weeks.

TABLE 3 partial foreshortening variation

Number of weeks	treatment-MI (%)	untreated-MI (%)	Pseudo sample (%)
Number of weeks	treatment-MI (%)	untreated-MI (%)	Pseudo sample (%)	0	10±0.8	12±1	34±3
1	17±1	13±1	33±3	0	10±0.8	12±1	34±3
1	17±1	13±1	33±3	2	20±2	15±2	33±2
3	21±2	12±1	35±2	2	20±2	15±2	33±2
3	21±2	12±1	35±2	4	21±3	16±2	36±1

The values in the table represent the mean. + -. standard deviation.

Furthermore, as can be seen in fig. 10B, the fractional shortening of the treatment group increased from 10% at the starting point to 20% at week 2, which is a 79% increase relative to the starting point. The untreated and sham-treated controls remained unchanged for the 4 week period.

The systolic and diastolic capacity of the treated group was also increased after injury due to cardiac ischemia. Table 4A statistically shows that the negative change in pressure (-dP/dt), which measures the diastolic capacity after systole, is significantly different in the treated group over time compared to the untreated group after 4 weeks of treatment. As shown in table 4A and fig. 11, the positive change in cardiac pressure over time (+ dP/dt) was statistically significantly different in the treated versus untreated group after isoproterenol stimulation, where + dP/dt measures the ability of the heart to contract.

TABLE 4A hemodynamics data after four weeks of MI

	Treatment of-MI	untreated-MI	Dummy sample
	Treatment of-MI	untreated-MI	Dummy sample	Contracting BP (mmHg) baseline isoproterenol	143±7130±9	142±3123±7	144±5197±3
Development of stress (mmHg) baseline isoproterenol	133±6121±9	133±3115±8	135±6173±3	Contracting BP (mmHg) baseline isoproterenol	143±7130±9	142±3123±7	144±5197±3
Development of stress (mmHg) baseline isoproterenol	133±6121±9	133±3115±8	135±6173±3	+ dP/dt (mmHg/sec) baseline isoproterenol	9477±58116830±1195	8642±20913832±1097	9925±119421515±1074
-dP/dt (mmHg/sec) baseline isoproterenol	9978±8279234±703	8009±4268984±622	11578±62211549±10742	+ dP/dt (mmHg/sec) baseline isoproterenol	9477±58116830±1195	8642±20913832±1097	9925±119421515±1074

The values in the table represent the mean. + -. standard deviation.

Table 4B statistically shows that after 10 weeks of treatment, there was a significant difference in both + dP/dt and-dP/dt in the treated versus untreated group.

TABLE 4B hemodynamics data after four weeks of MI

	Treatment of-MI	untreated-MI	P-value
	Treatment of-MI	untreated-MI	P-value	Contracting BP (mmHg)	106±4	92±5	0.053
Development pressure (mmHg)	97±3	69±14	0.031	Contracting BP (mmHg)	106±4	92±5	0.053
Development pressure (mmHg)	97±3	69±14	0.031	+dP/dt(mmHg/sec)	6701±331	4937±828	0.042
-dP/dt(mmHg/sec)	6395±373	3641±737	0.002	+dP/dt(mmHg/sec)	6701±331	4937±828	0.042

The values in the table represent the mean. + -. standard deviation.

The improved pressure and systolic pressure at week 10 were also significantly improved in the treated group compared to the untreated group.

While it is recognized that the connective tissue is deposited in the necrotic area from the initial infarction or wound healing, the present invention does not show a negative therapeutic impact in terms of scar formation. In contrast, as can be seen from the statistical results in table 5A, there was no significant change in collagen deposition in scar and non-infarcted tissue after 4 weeks, indicating that the improvement in cardiac function in the four weeks of the head was not associated with collagen deposition.

FIG. 5A collagen content in Heart after four weeks of MI

	Treatment of-MI	untreated-MI	Dummy sample
	Treatment of-MI	untreated-MI	Dummy sample	Hydroxyproline/proline in non-infarct left ventricular myocardium	0.12±0.06	0.18±0.05	0.11±0.02
Hydroxyproline/proline in non-infarct right ventricular myocardium	0.13±0.02	0.17±0.03	0.15±0.03		0.12±0.06	0.18±0.05	0.11±0.02
	0.13±0.02	0.17±0.03	0.15±0.03	Hydroxyproline/proline in infarct scar	0.34±0.08	0.45±0.09

The values in the table represent the mean. + -. standard deviation.

However, as can be seen from table 5B, the absolute statistically significant decrease in the suburban parenchyma content in non-infarcted myocardium and scar tissue was observed in the treated group compared to the untreated group after 10 weeks, indicating that the method of the present invention indeed reduces fibrosis in the viable myocardium over a longer period of time.

FIG. 5B collagen content in Heart after week of MI10

	Treatment of-MI	untreated-MI	P-value
	Treatment of-MI	untreated-MI	P-value	Hydroxyproline/proline in non-infarct left ventricular myocardium	0.099±0.025	0.135±0.036	＜0.05
Hydroxyproline/proline in non-infarct right ventricular myocardium	0.152±0.044	0.175±0.042	-		0.099±0.025	0.135±0.036	＜0.05
	0.152±0.044	0.175±0.042	-	Hydroxyproline/proline in infarct scar	0.471±0.024	0.638±0.020	＜0.05

The values in the table represent the mean. + -. standard deviation.

Experiment II

Wistar male mice (100- & 110g) of 4-5 weeks old were routinely fed and placed in a 12-hour day-night cycle. These animals were randomized into three treatment groups as follows: (1) sham-operated animals (n-12), (2) myocardial infarction control group (n-25) and (3) group treated with compound B for myocardial infarction (n-25). Animals were treated for two days prior to surgery and continued for one week after surgery. During the treatment, animals were fed 0.5% CMC (Sigma-Aldrich) (control) or 50mg/kg of Compound B dissolved in 0.5% CMC 2 times daily. After the animal had opened the throat, the left anterior descending coronary artery was bundled under artificial oxygen supply. Animals were sacrificed 1 week post-surgery and cardiac echo testing was performed. The diameter of the fractional shortening, end diastole and end systole was measured objectively.

As can be seen in fig. 12A, the partial shortening dropped from 51% in sham operated animals to 29% in the untreated MI reference group. Statistical results after treatment with the compounds showed a significant improvement in the partial shortening (p < 0.05; one-way ANOVA/Turey experiment) compared to the untreated control group, reaching 41%. Similarly, FIG. 12B statistically shows a significant improvement in left ventricular end-diastolic (LVEDD) and end-systolic (LVESD) diameters (p less than 0.005 and 0.001, respectively; one-way ANOVA/Turey experiments) in treated animals compared to untreated MI controls. Animals treated with the compound had no increase in diameter at the end-systolic phase of the left ventricle, but 18% increase in diameter at the end-diastolic phase, compared to sham operated animals. However, LVESD and LVEDD increased by 15% and 65%, respectively, in the untreated control group.

Example 7: liver ischemia

Bickel et al (1998; Hepatology 28: 404-411) have reported the use of the compounds of the invention for the treatment of hepatotoxic ischemic injury. Although the authors explain their results in terms of the effect of the compound on fibrosis, they acknowledge that good effects on liver function indices, including serum levels of bilirubin, bile acids and alkaline phosphatase, cannot be directly attributed to a reduction in fibrosis.

Bickel et al (supra) describe a model of toxic hypoxic liver injury. Briefly, Wistar male rats (212-₄) (1: 1), twice weekly for a total of 9 weeks (n-140), or no treatment (control; n-10). In addition, one group accepts CCl₄Animals (n-60) received compound P simultaneously. The compounds were administered by peritoneal injection 2 times daily at a dose of 60mg compound/2 ml saline/kg body weight. After 9 weeks, animals were sacrificed and the liver weighed. Serum bilirubin, alanine transaminase, alkaline phosphatase, albumin and total bile acids were measured using a commercial kit.

It can be seen from table 6 (Bickel et al, supra, table 2) that the weight (BW) decreased significantly after liver injury, but there was no significant change in the weight of the liver itself (not shown).

TABLE 6 serum parameters of liver function after 9 weeks of treatment

Treatment of	N	BW(g)	BR(μmol/L)	tBA(μmol/L)	ALT(U/L)	AP(U/L)
Treatment of	N	BW(g)	BR(μmol/L)	tBA(μmol/L)	ALT(U/L)	AP(U/L)	Control	10	425±66.9	2.00±0.50	8.48±8.40	27.5±10.9	156±57.5
CCl ₄	80	370±43.3	4.34±3.93	81.3±87.9	83.1±51.7	269±117	Control	10	425±66.9	2.00±0.50	8.48±8.40	27.5±10.9	156±57.5
CCl ₄	80	370±43.3	4.34±3.93	81.3±87.9	83.1±51.7	269±117	CCl₄+CPD	60	373±38.9	2.83±2.21	40.8±51.4	59.0±29.5	195±72.7

The values in the table represent the mean. + -. standard deviation.

Statistically, liver damage also significantly reduces liver function, as can be seen from the following measurements: serum levels in Bilirubin (BR), total bile acid (tBA), alanine Aminotransferase (ALT) and Alkaline Phosphatase (AP) were increased by 117%, 856%, 201% and 72%, respectively. However, treatment with the compounds of the invention (CPD) statistically significantly improved liver function. Serum levels of BR, tBA, ALT and AP were reduced by 64%, 65%, 43% and 65%, respectively, in the treated group compared to the untreated group. The improvement in liver function may be attributed to the stabilizing effect of the present methods on HIF α.

Example 8: renal ischemia reperfusion injury

Nemoto et al describe a model of ischemic acute renal failure (2001, Kidney Int 59: 246-251). Briefly, Sprague-Dawley males (200. sub. & 250g) were treated by feeding 0.5% carboxymethylcellulose (CMC; Sigma-Aldrich) or 1.5% Compound B suspended in CMC at a dose of 4 ml/kg/d. Rats were first pre-treated for 4 consecutive days (days-3 to 0). Renal Ischemia Reperfusion Injury (IRI) experiments were performed on day 0 at 4, i.e. hours after the last dose of administration.

Animals were divided into four groups: (1) pretreating with a medium and performing a simulated operation; (2) pretreatment with compound B and simulated surgery; (3) pretreatment with vehicle and IRI surgery: (4) pretreatment with compound B and IRI surgery. Animals were anesthetized with isoflurane, and an incision was made at the midline of the abdomen, directly over the renal pedicle. The right renal pedicle was clamped with a vascular clamp for 45 minutes while the left kidney was excised. After each closure, the clamp was released for 45 minutes and reperfusion was visualized by a change in kidney color. The temperature was maintained constant and warm saline (0.5% body weight) containing Buprenex analgesic was directly infused into the abdomen followed by suturing the incision.

Animal body weight and mortality were monitored. Blood samples were drawn from the tail vein, serum chemistry and CBC were sent to the IDEXX veterinary service (West Sacramento CA) for determination. Data are reported as mean ± SE, numbers in parentheses are animal numbers. Data from four groups of samples at each time point were compared using one-way bias analysis (ANOVA, SIGMA STAT) and Student-Newman-Keuls methods. P < 0.05 indicates significant phase difference.

As shown in fig. 13, treatment with the compounds prevented early death due to ischemia reperfusion injury. Furthermore, renal IRI significantly increased serum urea nitrogen (BUN) on days 3 and 7, while treatment with compounds significantly decreased the degree of BUN increase caused by IRI, which is a measure of kidney function (fig. 14A). In addition, renal IRI significantly increased serum cholesterol on days 3, 7 and 14, while treatment with compound completely prevented IRI-induced increase in serum cholesterol (fig. 14B). Although the cause is still under investigation, the rise in renal cholesterol is a natural reflection of renal ischemia reperfusion injury. (Zager et al (2001) Am J Pathol 159: 743-

Example 9: promotion of granulation tissue formation in chronic wounds

The ability to treat chronic wounds was studied using a rabbit cortical hyperplastic scarring model described by Morris et al (1997, Plast Reconsr Surg 100: 674-681) and Marcus et al (2000, Plast Reconsr Surg 105: 1591-1599). Briefly, female New Zealand white rabbits (n 12; 3-6 months old) were anesthetized and by removing the perichondrium, 4 skin ulcer wounds of 7mm length were made on the ventral surface of each ear. Wounds were treated and bandaged with TEGADERM semi-occlusive polyurethane gauze (3M Health Care, st. paul MN). On week 1, wounds were treated by topical application of 0.5% or 1% (w/V) of the prodrug of compound V [ pV ] mixed in 0.5% (w/V) CARBOPOL 971PNF hydrosol (pH 6.5; noveon inc., Cleveland OH) once daily. When tested in vitro, the gel was found to release 50% of the drug in 2 hours and 95% in 4 hours. Either low dose treatment (0.5% compound) or high dose treatment (1% compound) was received in the treated ear, while the control ear received only gel. A hole is formed in the gauze wrapped up when the wound is injured, and therapeutic medicines are fed from the hole, so that the infection of the area around the wound caused by tearing off the gauze every day is avoided. A small piece of gauze was then placed over the hole to prevent the wound from drying out. Wounds that were too dry or infected were excluded from the study.

After 7 and 12 days of injury, the wounds were opened and incised and stained with hematoxylin-potato red to determine the formation of granulation tissue and the appearance of skin growth of the wounds. An observer unfamiliar with the treatment method collects the quantitative parameters of the wound treatment by means of a graduated ocular cross. Data were analyzed using Student's t-test to compare treated and untreated samples. P < 0.05 indicates significant phase difference.

The formation of granulation tissue and the skin growth of the wound were measured for the wounds; wound treatment parameters sensitive to ischemia and hypoxia were determined (Corral et al (1999) Arch Surg 134: 200-. As shown in fig. 15A, an increase in granulation tissue area was observed for the treated wounds compared to untreated wounds. As can be seen in fig. 15B, there was no difference in peak-to-peak distance between treated and untreated animals. Peak-to-peak is an indication that granulation tissue covers the wound. Thus, the methods of the invention can be used to increase the formation of vascular and granulation tissue in wounds, such as chronic wounds and ulcers.

Example 10: screening experiments

Compounds that inhibit HIF-specific prolyl hydroxylase activity, and thereby stabilize HIF α, can be identified and characterized using the following assays. A50. mu.l aliquot was taken from the reaction mixture containing 4mg/ml BSA, 0.1M Tris HCl (pH 7.2), 2mM ascorbate, 80. mu.M ferrous sulfate, 0.2mM 2-oxoglutarate, 600 units/ml catalase and optionally 100. mu.M alpha.peptide, mixed with 50. mu.l HeLa cell extract or purified HIF prolyl hydroxylase and incubated at 37 ℃ for 1.5 hours. Then 50. mu.l of streptaguanidine beads were added and the resulting mixture was incubated at 4 ℃ for 1 hour with stirring. The mixture was transferred to a tube and centrifuged at low speed to pellet the beads. The beads were washed 3 times with 0.5-lml 20mM Tris HCl (pH 7.2). The peptides were eluted from the beads with 5. mu.l of 2mM biotin in 20mM Tris HCl (pH 7.2). The tube was centrifuged to pellet the resin, 40-50. mu.l of the supernatant removed, and an equal amount of acetonitrile was added. Alternatively, the peptide is attached to methoxycoumarin, which is a pH insensitive fluorophore. The fluorophores provide sensitivity and specificity, thereby facilitating detection of crude cell fluids. An exemplary HIF peptide for use in screening assays may comprise [ methoxycoumarin ] -DLDLEALAPYIPADDDFQL-amide (SEQ ID NO: 5). The non-hydroxylated and hydroxylated peptides were then separated by reverse phase HPLC through a C18 column and detected with 214nm uv.

Those skilled in the art will readily appreciate from the foregoing description that various modifications may be made to the present invention in addition to those described herein. Such modifications are intended to be included within the scope of the appended claims.

All documents cited herein are incorporated by reference in their entirety.

Sequence listing

<110> V. Guengelle-Pokar (Guenzler-Pukall, Volkmar)

T.B. Niff (Neff, Thomas B.)

Q, king (Wang, Qingjian)

M, Alander (Arend, Michael)

L.A. Folippin (Flippin, Lee A.)

A. Melychoff (Melekhov, Alexey)

<120> stabilization of Hypoxia Inducible Factor (HIF) alpha

<130> FP0600PCT

<140>PCT/US02/38867

<141> 2002-12-06

<150>US 60/337,082

<151> 2001-12-06

<150>US 60/359,683

<151> 2002-02-25

<150>US 60/349,659

<151> 2002-01-16

<150>US 60/386,488

<151> 2002-06-05

<160> 5

<170> Patentln version 3.2

<210> 1

<211> 20

<212> DNA

<213> mouse (Mus musculus)

<400> 1

gttgcaaggc gaggcagctt 20

<210> 2

<211> 21

<212> DNA

<213> mouse (Mus musculus)

<400> 2

tgacgatgat ggcatggtgg t 21

<210> 3

<211> 22

<212> DNA

<213> rat (Rattus norvegicus)

<400> 3

taggcacggc gactaccatc ga 22

<210> 4

<211> 23

<212> DNA

<213> rat (Rattus norvegicus)

<400> 4

cggcggcttt ggtgactcta gat 23

<210> 5

<211> 19

<212> PRT

<213> Artificial

<220>

<223> synthetic peptide

<400> 5

Asp Leu Asp Leu Glu Ala Leu Ala Pro Tyr Ile Pro Ala Asp Asp Asp

1 5 10 15

Phe Gln Leu

Claims

1. Use of a compound capable of inhibiting hydroxylation of HIF in the manufacture of a medicament for stabilizing the alpha subunit of hypoxia inducible factor (HIF- α) in a subject, wherein said compound is selected from the group consisting of a heterocyclic carboxamide and a physiologically active pharmaceutically acceptable salt or prodrug derived from a heterocyclic carboxamide.

2. Use of a compound that inhibits hydroxylation of HIF in the manufacture of a medicament for stabilizing the alpha subunit of hypoxia inducible factor (HIF- α) in a subject, wherein the compound is selected from; 7- (4-methyl-piperazine-1-methyl) -5-phenylsulfanylmethyl-quinoline-8-hydroxy (compound D), 4-nitro-quinoline-8-hydroxy (compound E), 5-butoxymethyl-quinoline-8-hydroxy (compound F), [ (3-hydroxy-pyridine-2-carbonyl) -amino ] -acetic acid (compound G), 6-cyclohexyl-1-hydroxy-4-methyl-1H-pyridin-2-one (compound N), [ (3-methoxy-pyridine-2-carbonyl) -amino ] -acetic acid (compound P), N- ((3-hydroxy-6-isopropoxy-quinoline-2-carbonyl) -amino ] -acetic acid (compound H), [ (3-hydroxy-6-trifluoromethoxy-quinoline-2-carbonyl) -amino ] -acetic acid (compound I), [ (6-chloro-3-hydroxy-quinoline-2-carbonyl) -amino ] -acetic acid (compound O), 4-oxo-1, 4-dihydro- [1, 10] phenanthroline-3-carboxylic acid (compound A), 5-methyl-4-oxo-1, 4-dihydro- [1, 10] phenanthroline-3-carboxylic acid (compound Q), 3- { [4- (3, 3-dibenzyl-ureido) -thiophenoyl ] - [2- (4-methoxy-phenyl) -ethyl ] -amino } -N- Hydroxy-propionamide (compound C), and physiologically active salts, esters, and prodrugs thereof of the above compounds.

3. The use of claim 1 or 2, wherein the compound inhibits the activity of 2-oxoglutarate dioxygenase enzyme.

4. The use of claim 1 or 2, wherein the compound inhibits HIF prolyl hydroxylase activity.

5. The use of claim 4, wherein the HIF prolyl hydroxylase enzyme is selected from the group consisting of EGLN1, EGLN2, EGLN3, and any fragment or subunit thereof.

6. The use of claim 1 or 2, wherein said compound inhibits the enzymatic activity of FIH-1 or any fragment or subunit thereof.

7. The use according to claim 1 or 2, which is a mammal in said subject.

8. The use of claim 1 or 2, wherein the subject is a human.

9. The use of claim 1 or 2, wherein the HIF- α is selected from the group consisting of HIF-1 α, HIF-2 α, HIF-3 α, and any fragment thereof.

10. The use of claim 1 or 2, wherein the HIF- α is endogenous to the subject.

11. The use of claim 1 or 2, wherein the compound is used in the manufacture of a medicament for treating, preventing, or pretreating a HIF-associated condition in a subject.

12. The use of claim 11, wherein the HIF-associated condition is associated with hypoxia.

13. The use of claim 11, wherein the HIF-associated condition is associated with ischemia.

14. The use of claim 11, wherein the HIF-associated condition is a pulmonary disease.

15. The use of claim 11, wherein the HIF-associated condition is a cardiac disorder.

16. The use of claim 11, wherein the HIF-associated condition is a neurological condition.

17. The use of claim 11, wherein the HIF-associated condition is associated with an ischemic event.

18. The use of claim 17, wherein the ischemic event is acute.

19. The use of claim 18, wherein the ischemic event is associated with surgery, organ transplantation, infarction, trauma, or injury.

20. The use of claim 17, wherein the ischemic event is chronic.

21. The use of claim 20, wherein the ischemic event is associated with a disorder selected from the group consisting of hypertension, diabetes, occlusive arterial disease, chronic venous insufficiency, limb arterial spasm, cirrhosis, congestive heart failure, and systemic sclerosis.

22. The use of claim 1 or 2, wherein the medicament comprises a second compound.

23. The use according to claim 22, wherein the second compound inhibits the activity of 2-oxoglutarate dioxygenase enzyme.

24. The use according to claim 22, wherein said compound inhibits the activity of a first 2-oxoglutarate dioxygenase enzyme and said second compound inhibits the activity of a second 2-oxoglutarate dioxygenase enzyme.

25. The use of claim 22, wherein the second compound is selected from an ACE inhibitor (ACEI), angiotensin II receptor blocker (ARB), diuretic, digoxin, statin, or carnitine.

26. The use of claim 1 or 2, wherein the compound stabilizes HIF- α by specifically inhibiting hydroxylation of at least one amino acid residue in HIF- α.

27. The use of claim 26, wherein the amino acid residue is selected from proline and asparagine.

28. Use of a compound according to claim 1 or 2 for the preparation of a medicament for increasing expression of an angiogenic factor in a subject.

29. Use of a compound of claim 1 or 2 for the preparation of a medicament for increasing expression of a glycolytic factor in a subject.

30. Use of a compound according to claim 1 or 2 for the preparation of a medicament for increasing the expression of a factor associated with oxidative stress in a subject.

31. Use of a compound according to claim 1 or 2 for the preparation of a medicament for treating a disease associated with ischemia reperfusion injury in a subject.

32. The use of claim 1 or 2, wherein the compound is provided in the form of an oral dosage.

33. The use of claim 1 or 2, wherein the compound is provided in the form of a transdermal agent.