CN101659702A - Monoclonal antibody of anti-human calnexin protein, preparation method and application thereof - Google Patents
Monoclonal antibody of anti-human calnexin protein, preparation method and application thereof Download PDFInfo
- Publication number
- CN101659702A CN101659702A CN 200910308129 CN200910308129A CN101659702A CN 101659702 A CN101659702 A CN 101659702A CN 200910308129 CN200910308129 CN 200910308129 CN 200910308129 A CN200910308129 A CN 200910308129A CN 101659702 A CN101659702 A CN 101659702A
- Authority
- CN
- China
- Prior art keywords
- monoclonal antibody
- calnexin
- antibody
- preparation
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a monoclonal antibody of anti-human calnexin protein, a preparation method and the application thereof, belonging to the preparation of antibody-containing medical preparationor the monoclonal antibody. The monoclonal antibody of the anti-human calnexin protein is generated by a hybridoma cell with the collection number of CGMCC No. 3240. The breast adenocarcinoma MCF-7 immuno-BALB/c mouse is adopted, spleen and myeloma cell of the mouse are taken to make cell fusion, the MCF-7 cell is utilized for screening, and then a monoclonal antibody library is formed by the obtained positive clones; and the antigen of the monoclonal antibody of the anti-human calnexin protein derived from the antibody library can be identified to be calnexin by immuno-precipitation and a mass spectrum method. The antibody and the calnexin protein have specific binding capacity, and a variable region sequence for identifying the antibody can be determined. The invention is applicable to the detection of immunohistochemistry, immuno-fluorescence, immuno-blot and immuno-precipitation of the molecule.
Description
Technical field
The present invention relates to contain the pharmaceutical product of antibody, or MONOCLONAL ANTIBODIES SPECIFIC FOR, specifically be monoclonal antibody of a kind of anti-human calnexin protein and its production and application.
Background technology
1975, Kohler and Milstein found murine myeloma cell and sheep red blood cell (SRBC) mice immunized splenocyte are merged, and the hybrid cell of formation both can produce antibody, but infinite multiplication again, thus founded the monoclonal antibody hybridoma technology.
Clone antibody stock is by hybrid antigen immune mouses such as cell or cell extracts, obtains the set at the proteic various monoclonal antibodies of difference.Adopting this kind method to prepare the monoclonal antibody shortcoming is that once to merge the workload of preparation antibody big, and the later stage needs antigen evaluation work, is difficult to which kind of antibody of prediction generating at first.Advantage is once to prepare the monoclonal antibody that can produce multiple protein, makes the monoclonal antibody preparation work of multiple protein once finish, and realizes the high-throughput of working routine; And owing to adopt native protein to carry out immunity, therefore the antibodies specific that produces is good, quality is high.
At present, tumor research enters the new stage of developed by molecule spectrum from oncogene/cancer suppressor gene theory, find that in the neoplastic process be not only that certain several gene changes, and the cell overall coordination that relates to a plurality of signal transduction pathway changes, therefore utilize the clone antibody stock technology can directly find the protein molecular that changes, obtain the special monoclonal antibody of this molecule simultaneously, reach the purpose of killing two birds with one stone.
Endoplasmic reticulum is protein synthesis and Ca in the eukaryotic cell
2+The main place of storing up, it can participate in various biological functions such as the protein mass control of cell, glycosylation modified, apoptosis, protein degradation and calcium ion stable state, and molecular chaperones is being brought into play crucial effect therein.Calnexin Calnexin is a kind of transmembrane protein in the endoplasmic reticulum, it all belongs to the agglutinoid molecular chaperones with calprotectin Calreticulin and the special homologue Calmegin that is distributed in the testis tissue, the Calnexin/Calreticulin circulation that this quasi-molecule companion is constituted can be discerned the glycoprotein that connects with the N2 glycosidic link single-mindedly, be the important monitoring mechanism of eukaryotic cell protein folding and assembling, also can regulate the Ca in the endoplasmic reticulum simultaneously
2+Homeostasis and Ca
2+The signal conductive process, therefore further clearly the mechanism of action of this molecule in cell have important effect for the explaination of all many cells biological phenomenas and the formation molecular mechanism of some tumour.Be monoclonal antibody and be used to detect one of the expression of this molecule and important tool of distribution under study for action.
Summary of the invention
The present invention is directed to the mechanism of action of human calnexin protein in cell, for the explaination of all many cells biological phenomenas and the formation mechanism of some tumour, be cell biological functional study, basic medical research and clinical detection, monoclonal antibody of a kind of anti-human calnexin protein that obtains by the clone antibody stock technology and its production and application is provided.
The present invention realizes by following technical scheme.
A kind of monoclonal antibody of anti-human calnexin protein, this antibodies specific is discerned human calnexin protein, and has specific binding capacity with Calnexin albumen, and it is to be by preserving number: the hybridoma of CGMCC No.3240 produces.
State the monoclonal antibody of anti-human calnexin protein, the variable region of light chain dna sequence dna of described Calnexin monoclonal antibody as shown in Figure 5, the variable region of heavy chain dna sequence dna of described Calnexin monoclonal antibody is as shown in Figure 6;
The monoclonal antibody of described anti-human calnexin protein, described Calnexin monoclonal antibody hypotype is accredited as IgG2b.
A kind of monoclonal antibody of anti-human calnexin protein gets the preparation method, it is to adopt breast cancer cell MCF-7 immunity BALB/c mouse, get mouse spleen and murine myeloma cell and carry out cytogamy, utilize the MCF-7 cell to screen, then the positive colony that obtains is made up clone antibody stock; Be derived from the monoclonal antibody of the anti-human calnexin protein of this antibody library, adopt immunoprecipitation and mass spectral method to identify that its antigen is Calnexin; The hybridoma of this monoclonal antibody is extracted RNA, and reverse transcription becomes cDNA, utilizes the antibody variable region primer to increase, and obtains the order-checking of PCR product and identifies.
A kind of hybridoma, described hybridoma produces the monoclonal antibody of anti-human calnexin protein, the preserving number of this hybridoma: CGMCC No.3240.
The application of the monoclonal antibody of anti-human calnexin protein in preparation medical science detection preparation:
A. the application of the monoclonal antibody of anti-human calnexin protein in preparation immunohistochemical methods detection preparation;
B. the application of described antibody in preparation immunofluorescence detection preparation;
C. the application of described antibody in preparation immunoblotting reaction detection preparation;
D. the application of described antibody in preparation immunoprecipitation detection preparation.
Using this antibody carries out panimmunity experiment and all obtains good result, show that this antibody can have specific binding capacity with Calnexin albumen, be applicable to the detection of immunohistochemical methods (IHC), immunofluorescence (IF), immunoblotting (Westernblot) and the immunoprecipitation (IP) of this molecule.The present invention is applied to cell biological functional study, basic medical research and clinical detection, for the clinical and fundamental research of this molecule provides testing tool reliably.
Hybridoma is by China Committee for Culture Collection of Microorganisms's common micro-organisms center preservation;
Preserving number is: CGMCC No.3240, and preservation date: on 09 03rd, 2009, after testing, the biomaterial survival.
Description of drawings
Fig. 1 shows Calnexin Western blot dyeing;
Fig. 2 shows Calnexin immunoprecipitation and mass spectrum evaluation;
Fig. 3 shows Calnexin breast cancer tissue immunohistochemical staining;
Fig. 4 shows the Calnexin immunofluorescence dyeing;
Fig. 5 is the dna sequence dna of Calnexin variable region of light chain
Fig. 6 is the dna sequence dna of Calnexin variable region of heavy chain.
Embodiment
One, the preparation of MCF-7 cell monoclonal antibody library
(1) material method
1. experiment material is originated
BALB/c mouse, MCF-7 cell and murine myeloma cell (SP2/0) are provided by Tianjin tumour hospital.Fu Shi Freund's complete adjuvant and freund 's incomplete adjuvant, HAT, HT conditioned medium composition are available from Invitrigen company.DMEM substratum, polyoxyethylene glycol (PEG), RPMI 1640 substratum are available from Hyclone company.The anti-mouse Ig of horseradish peroxidase (HRP) labelled goat, O-Phenylene Diamine (OPD), diaminobenzidine (DAB), 8-azaguanine (8-AG) are available from Sigma company.
2. animal immune
Get 1 * 10
7The MCF-7 cell, centrifugal collection adds 200ul physiological saline multigelation 5 times, the centrifugal supernatant of abandoning.Add lysate (0.05M Tris-HCl pH=8.0,1%Triton X100) 300ul in precipitation, 4 ℃ centrifugal 12, and 000rpm gets supernatant as immunogen.
Get 7~10 age in week 4 of BALB/c female mices, with 100ul MCF-7 cellular immunization former with the abundant mixing of equal-volume Freund's complete adjuvant (Sigma), subcutaneous abdomen multi-point injection.The 1st immunity back the 15th and 29 day is used fully booster immunization behind the mixing of 100ul immunogen and equal-volume Freund's incomplete adjuvant (Sigma) respectively, and 3d injects the 50ul immunogen 1 time by tail vein reinforced immunological before merging.
3. indirect elisa method detects serum titer
With MCF-7 cellular immunization primordial covering enzyme plate, establish the blank group, 37 ℃ of bags are spent the night.With 37 ℃ of sealings of 0.25%BSA 1 hour.Add the serum of gradient series dilution, hatch 1h for 37 ℃, PBS-T washes 5 times.Add the anti-mouse Ig of horseradish peroxidase (HRP) labelled goat, hatch 1h for 37 ℃, PBS-T washes 5 times.The OD492 value is measured in OPD substrate Color Appearance System colour developing 2-3 minute.
4. cytogamy and clone antibody stock make up
Learn from else's experience 1 of the BALB/c mouse of booster immunization after the sacrificed by exsanguination, is got spleen under the aseptic condition, the preparation splenocyte suspension.Get 2 * 10
7Individual myeloma cell (SP2/0) adds 50%PEG (MW 4000) 1ml and merges in 37 ℃ of water-baths, fused cell is inoculated in 96 well culture plates, adopts HAT and HT substratum to carry out selectivity respectively and cultivates.When treating that hybridoma grows to culture hole bottom surface 1/3, with MCF-7 immunity original work envelope antigen, with ELISA method screening antibody, select the positive hole of antibody-secreting, adopt methylcellulose gum semisolid medium method,, be inoculated in 96 well culture plates hybridoma cell cloneization, get culture supernatant and do antibody test, positive person is frozen.Total positives clone's set is clone antibody stock, and it is standby to give over to further screening.
(2) experimental result
Behind the mouse immune three times, get blood and carry out titration with MCF-7 cellular immunization primordial covering plate, tail vein, its to tire be 1: 4000.Primary dcreening operation forms 96 positive colonies after the cytogamy, and each clone is all frozen after cloning.
Two, the screening in monoclonal antibody storehouse and antigen are identified
(1) material method
1. immunoblotting (Western blot) screening
The former SDS-PAGE electrophoresis that carries out of MCF-7 cellular immunization carries out the transfer printing of pvdf membrane albumen then.Carry out the hybridization of transfer film respectively with the hybridoma culture supernatant in the clone antibody stock, chemical illuminating reagent (ECL) develops.Get the positive colony recovery, enlarged culturing.Concrete steps are as follows:
1.1 added isopyknic sample loading buffer boiling water bath 5 minutes during MCF-7 cellular immunization is former, carry out the SDS-PAGE electrophoresis, each swimming lane application of sample 20ul, deposition condition are constant current 20mA/ plate, about 1.5~2 hours.Albumen is transferred as half-dried transfer printing, constant current 40mA, about 1 hour.
1.2 film is placed 5% skim-milk, and 37 ℃ are shaken 1h.
1.3 film is placed the monoclonal antibody culture supernatant, and 4 ℃ are shaken 2h and spend the night.TBS-T rinsing 3 times, each 5 minutes.
1.4 film is placed in the sheep anti mouse two anti-diluents (1: 10,000), and 37 ℃ are shaken 1h.TBS-T rinsing 3 times, each 5 minutes.
1.5 ECL exposure imaging.
2. positive hybridoma ascites MONOCLONAL ANTIBODIES SPECIFIC FOR
BALB/c mouse abdominal injection Pristane0.5ml/, 1 all pneumoretroperitoneums are injected well-grown positive hybridoma cell 10
7, about 10 days, when mouse web portion swells to its vigor extreme difference, put to death mouse, extract its ascites, 2000 leave the heart goes precipitation, collects supernatant.
3. immunoprecipitation (IP) is identified antigen
Get the 1ul mouse ascites and mix, hatched 1 hour the centrifugal supernatant that goes for 4 ℃ with 10ul albumin A/G; In precipitation, add the former 1ml of MCF-7 cellular immunization, hatch shaken over night for 4 ℃, the centrifugal supernatant that goes; Add sample loading buffer 20ul, boiling water bath 10 minutes, last sample SDS-PAGE electrophoresis in will precipitating.Sedimentary protein band is downcut, carry out mass spectrum and identify.
4.Calnexin the immunological response of monoclonal antibody
Adopt the Calnexin ascites monoclonal antibody of having identified to carry out every immunological response test:
4.1 immunoprecipitation (the square method 3 of concrete grammar)
4.2 Western blot (the square method 1 of concrete grammar)
4.3 immunohistochemical methods (IHC)
1) the mammary cancer section was put into 67 ℃ of incubators dried roasting 24 hours.
2) dewaxing of conventional dimethylbenzene is 2 times, and each 20 minutes, gradient ethanol PBS to the water washed twice, each 10 minutes.
3) incubated at room 10 minutes in 3%H2O2, the blocking-up endogenous peroxydase.
4) immerse in the EDTA antigen retrieval liquid of pH=8.0, with the capable antigen retrieval of microwave.Antigen retrieval liquid is rapidly heated after 92-98 ℃, kept this temperature range lasting 20 minutes.
5) cooling places antigen retrieval liquid naturally cooling, and the time is no less than 20 minutes.
6) PBS liquid soaks 3 times, each 5 minutes.
7) with Normal animal serum 50 μ l sealing 10min, the unnecessary serum that inclines is not washed.
8) gently get rid of serum, drip Calnexin ascites monoclonal antibody diluent (1: 100), put into 4 ℃ of overnight incubation, take out section and go among the PBS to embathe each 5 minutes 3 times.
9) drip PV6002 (Beijing Zhong Shan) two anti-working fluids in the immunohistochemical staining test kit, after put into 37 ℃ of incubators and hatched 20 minutes.
10) PBS liquid soaks 3 times, each 5 minutes.
11) diaminobenzidine (diamminobenzidine, DAB) dyeing: every 1ml distilled water adds 1 A respectively successively, B, C liquid drips behind the mixing in section, mirror is the monitoring process color down, in good time termination reaction.
12) Hematorylin is redyed, the neutral gum mounting.
4.4 immunofluorescence (IF)
The acid of slide glass bubble is cleaned, and does roasting sterilization, and is standby.Get the MCF-7 cell and add a small amount of substratum, mixing, therefrom sucking-off 100ul point places 37 ℃ of aseptic plates on slide glass, cultivates after 8 hours, and each sheet replenishes the 100ul substratum, spends the night.Slide glass is taken out from plate, be soaked in 0.9% physiological saline, clean serum.Place cold methanol to fix 20 minutes.Slide is placed 3%H2O2 solution, soaked 15 minutes, remove endogenous peroxydase.1 normal sheep serum of every point, 37 ℃ of temperature were bathed 20 minutes.Use Calnexin ascites monoclonal antibody diluent (1: 100), 4 ℃ are spent the night.PBS rinsing 3 times adds AlexaFluor488 mark sheep anti mouse Ig (molecular probe company), hatches conventional mounting, fluorescence microscope 15 minutes for 37 ℃.
5. antibody subtype is identified
With sheep anti mouse Ig coated elisa plate,, 37 ℃ of bags are spent the night.With 37 ℃ of sealings of 0.25%BSA 1h.Add Calnexin hybridoma culture supernatant, hatch 1h for 37 ℃, PBS-T washes 5 times.Add the anti-mouse IgG1 of horseradish peroxidase (HRP) labelled goat, IgG2a, IgG2b, IgG3, IgM, IgA respectively, hatch 1h for 37 ℃, PBS-T washes 5 times.OPD substrate Color Appearance System colour developing 5-10min measures the OD492 value.
(2) experimental result
1, carry out the hybridization of the former transfer film of MCF-7 cellular immunization respectively with the antibody supernatant in the clone antibody stock, chemical illuminating reagent (ECL) develops.The monoclonal antibody that western blot reaction can take place has 30 strains, chooses wherein a strain positive colony cell (as Fig. 1) and recovers, and enlarged culturing prepares mouse ascites in a large number.
2, utilize mouse ascites to carry out immunoprecipitation, Precipitation Antigen is carried out mass spectrum and is accredited as Calnexin (as Fig. 2), and the immunoprecipitation demonstration changes the monoclonal antibody high specificity, does not have other non-differential proteins precipitations, and the mass spectrum qualification result is single; Match with it, Western blot shows that equally the hybridization protein signal is single, high specificity (as Fig. 1), and the result proves that this antibody can use as the detection preparation of immunoprecipitation and western blot.
3, the immunohistochemical staining of Calnexin monoclonal antibody, as seen breast cancer cell is obviously painted, be positioned endochylema, around nucleus, concentrate, with endoplasmic reticulum location consistent (as Fig. 3), and illustrate to change the immunology dyeing that monoclonal antibody is applicable to tissue that the result proves that this antibody can use as the detection preparation of immunohistochemical staining.
4, the immunofluorescence dyeing of Calnexin monoclonal antibody shows: endochylema is painted, concentrates around the nucleus, and with endoplasmic reticulum location consistent (as Fig. 4), the result proves that this antibody can use as the detection preparation of immunofluorescence.
5, Calnexin monoclonal antibody hypotype is accredited as IgG2b.
Three, the evaluation of Calnexin variable region of mab sequence
(1) experiment material
Available from PHARMACIA BIOTECH, M-MulV reversed transcriptive enzyme, Taq archaeal dna polymerase are available from Takara for Expression Module (recombinant phage antibody system).
(2) experimental procedure
Referring to PHARMACIA BIOTECH (27-9401-01) test kit specification sheets
Total RNA → the reverse transcription of the cultivation of Calnexin monoclonal antibody hybridoma cell → extract becomes cDNA → with light chain, heavy chain primer (test kit provides) amplification light chain DNA and heavy chain DNA.
1, the preparation of the total RNA of Calnexin hybridoma: 1 * 10
7The Calnexin hybridoma add the abundant cracking of TRIZOL 1ml.Add the 0.2ml chloroform, fully mixing is 15 seconds, centrifugal 15 minutes of 4 ℃, 12000 * g.Get the upper strata water and place new pipe, add the 0.5ml Virahol and left standstill 10 minutes, 12000 * g, 4 ℃ are centrifugal 10 minutes.Abandon supernatant, with 75% washing with alcohol, vortex, centrifugal 5 minutes of 7500 * g, 4 ℃ wash 2 times.Adding 20 μ l does not have RNA enzyme water, gets 4.5 μ l and is used to detect the RNA integrity, and 2 μ l are used for concentration and the purity testing of RNA, all the other-70 ℃ of preservations, and it is synthetic to be used for cDNA first chain.
2,65 ℃ of heating of RNA are 10 minutes, cooling rapidly on ice, beginning first chain cDNA reaction in 2 minutes.
MRNA 5 μ l, no RNA enzyme water 15 μ l, Primed First-Strand Mix 11 μ l, DTT Slution 1 μ l, M-MulV reversed transcriptive enzyme 1 μ l, cumulative volume 33 μ l were hatched 1 hour for 37 ℃.
3, light chain PGR:First-strand reaction 33 μ l, Light Primer Mix 2 μ l, sterilized water 64 μ l, cumulative volume 99 μ l.Heavy chain PGR:First-strand reaction 33 μ l, Heavy Primer1 2 μ l, HeavyPrimer2 2 μ l, sterilized water 62 μ l, cumulative volume 99 μ l.95 ℃ were heated 5 minutes.Respectively add TaqDNA polysaccharase 2 μ l in each reaction, mixing respectively is divided into 2 pipes in the 0.2ml thin-walled tube, start-up routine 1 (30 circulations: 94 ℃ 1 minute; 55 ℃ 2 minutes; 72 ℃ 2 minutes).Electrophoresis rubber tapping purifying, the purpose band is transferred to little revolving in the post, places the 1.5mlEppendorf pipe, and centrifugal 2 minutes of 740 * g, eluate are the light chain and the heavy chain DNA of purifying, send the order-checking of AudioCodes company.
(3) experimental result
1, the variable region of light chain dna sequence dna 333bp of coding Calnexin monoclonal antibody, sequence is:
GACATTGAGCTCACCCAGTCTCCTGCTTCCTTAGCTGTATCTCTGGGGCAGAGGGCCACCATCTCATACAGGGCCAGCAAAAGTGTCAGTACATCTGGCTATAGTTATATGCACCGGAACCAACAGAAACCAGGACAGCCACCCAGACTCCTCATCTATCTTGTATCCAACCTAGAATCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACCCTCAACATCCATCCTGTGGAGGAGGAGGATGCTGCAACCTATTACTGTCAGCACATTAGGGAGCTTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAACGGA。
2, the variable region of heavy chain dna sequence dna 347bp of coding Calnexin monoclonal antibody, sequence is:
AGGTGCAAGCTGCAGGAGTCAGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCGCTTTCAGTAGCTATGACATGTGTTGGATTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCATATATTAGTAGCGGTGGTGATTACACCTACTATCCAGACACTATGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACGCCCTGTATTTGCAAATGAAGAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCAAGAAAAACTGGGACCGCTTACTGGGGCCAAGGGACCACGGTCACCGTCTCCCTCAA。
SEQUENCE?LISTING
<110〉Tumour Hospital Attached To Tianjin Medical Univ.
<120〉monoclonal antibody of anti-human calnexin protein and its production and application
<130〉mouse
<160>1
<170>PatentIn?version?3.1
<210>1
<211>333
<212>DNA
<213>2?Ambystoma?laterale?x?Ambystoma?jeffersonianum
<220>
<221〉variable region of light chain
<222>(1)..(333)
<223>
<400>1
gacattgagc?tcacccagtc?tcctgcttcc?ttagctgtat?ctctggggca?gagggccacc 60
atctcataca?gggccagcaa?aagtgtcagt?acatctggct?atagttatat?gcaccggaac 120
caacagaaac?caggacagcc?acccagactc?ctcatctatc?ttgtatccaa?cctagaatct 180
ggggtccctg?ccaggttcag?tggcagtggg?tctgggacag?acttcaccct?caacatccat 240
cctgtggagg?aggaggatgc?tgcaacctat?tactgtcagc?acattaggga?gcttacacgt 300
tcggaggggg?gaccaagctg?gaaataaaac?gga 333
<221〉variable region of heavy chain
<222>(1)..(347)
<223>
<400>1
aggtgcaagc?tgcaggagtc?agggggaggc?ttagtgaagc?ctggagggtc?cctgaaactc 60
tcctgtgcag?cctctggatt?cgctttcagt?agctatgaca?tgtgttggat?tcgccagact 120
ccggagaaga?ggctggagtg?ggtcgcatat?attagtagcg?gtggtgatta?cacctactat 180
ccagacacta?tgaagggccg?attcaccatc?tccagagaca?atgccaagaa?cgccctgtat 240
ttgcaaatga?agagtctgaa?gtctgaggac?acagccatgt?attactgtgc?aagaaaaact 300
gggaccgctt?actggggcca?agggaccacg?gtcaccgtct?ccctcaa 347
Claims (6)
1. the monoclonal antibody of an anti-human calnexin protein is characterized in that: this antibodies specific identification human calnexin protein, and have specific binding capacity with Calnexin albumen, it is to be by preserving number: the hybridoma of CGMCCNo.3240 produces.
2. the monoclonal antibody of anti-human calnexin protein according to claim 1, the variable region of light chain dna sequence dna that it is characterized in that described Calnexin monoclonal antibody as shown in Figure 5, the variable region of heavy chain dna sequence dna of described Calnexin monoclonal antibody is as shown in Figure 6;
3. the monoclonal antibody of anti-human calnexin protein according to claim 1 is characterized in that Calnexin monoclonal antibody hypotype is accredited as IgG2b.
4. the MONOCLONAL ANTIBODIES SPECIFIC FOR method of anti-human calnexin protein according to claim 1 is characterized in that:
Adopt breast cancer cell MCF-7 immunity BALB/c mouse, get mouse spleen and murine myeloma cell and carry out cytogamy, utilize the MCF-7 cell to screen, then the positive colony that obtains is made up clone antibody stock; Be derived from the monoclonal antibody of the anti-human calnexin protein of this antibody library, adopt immunoprecipitation and mass spectral method to identify that its antigen is Calnexin; The hybridoma of this monoclonal antibody is extracted RNA, and reverse transcription becomes cDNA, utilizes the antibody variable region primer to increase, and obtains the order-checking of PCR product and identifies.
5. a hybridoma is characterized in that: the monoclonal antibody of described hybridoma generation anti-human calnexin protein, the preserving number of this hybridoma: CGMCC No.3240.
6. the application of the monoclonal antibody of anti-human calnexin protein in preparation medical science detection preparation according to claim 1:
A. the application of the monoclonal antibody of anti-human calnexin protein in preparation immunohistochemical methods detection preparation;
B. the application of described antibody in preparation immunofluorescence detection preparation;
C. the application of described antibody in preparation immunoblotting reaction detection preparation;
D. the application of described antibody in preparation immunoprecipitation detection preparation.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 200910308129 CN101659702B (en) | 2009-10-09 | 2009-10-09 | Monoclonal antibody of anti-human calnexin protein, preparation method and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 200910308129 CN101659702B (en) | 2009-10-09 | 2009-10-09 | Monoclonal antibody of anti-human calnexin protein, preparation method and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101659702A true CN101659702A (en) | 2010-03-03 |
CN101659702B CN101659702B (en) | 2012-12-05 |
Family
ID=41787973
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 200910308129 Expired - Fee Related CN101659702B (en) | 2009-10-09 | 2009-10-09 | Monoclonal antibody of anti-human calnexin protein, preparation method and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101659702B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2022157281A1 (en) | 2021-01-21 | 2022-07-28 | Agency For Science, Technology And Research | Method |
WO2024008960A1 (en) | 2022-07-08 | 2024-01-11 | Agency For Science, Technology And Research | Cnx antigen-binding molecules |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU695117B2 (en) * | 1994-10-06 | 1998-08-06 | Hoechst Aktiengesellschaft | Regulated genes by stimulation of chondrocytes with IL-1beta |
-
2009
- 2009-10-09 CN CN 200910308129 patent/CN101659702B/en not_active Expired - Fee Related
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2022157281A1 (en) | 2021-01-21 | 2022-07-28 | Agency For Science, Technology And Research | Method |
WO2024008960A1 (en) | 2022-07-08 | 2024-01-11 | Agency For Science, Technology And Research | Cnx antigen-binding molecules |
Also Published As
Publication number | Publication date |
---|---|
CN101659702B (en) | 2012-12-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN111410690B (en) | anti-CK 19 protein monoclonal antibody, cell line, preparation method and application thereof | |
US9823251B2 (en) | Anti-Uroplakin II antibodies systems and methods | |
CN113045667B (en) | anti-IDO 1 protein monoclonal antibody and cell strain, preparation method and application thereof | |
CN113061186B (en) | Monoclonal antibody of anti CA125 protein, cell strain, preparation method and application thereof | |
CN113105547B (en) | anti-CD 5 protein monoclonal antibody and cell strain, preparation method and application thereof | |
CN113265003B (en) | anti-TdT protein monoclonal antibody, cell strain thereof, preparation method and application | |
CN105001327B (en) | Anti- p16 monoclonal antibody and its preparation method and application | |
CN112940133B (en) | Monoclonal antibody of anti-ATRX protein, cell strain, preparation method and application thereof | |
CN111454360A (en) | anti-CD 61 protein monoclonal antibody, cell line, preparation method and application thereof | |
CN113087793A (en) | anti-CK 14 protein monoclonal antibody, cell strain thereof, preparation method and application | |
CN112094348B (en) | Anti-human Tim3 antibody or functional fragment thereof and application thereof | |
CN109485724A (en) | Anti- Desmin protein monoclonal antibody, cell line and its preparation method and application | |
CN101659702B (en) | Monoclonal antibody of anti-human calnexin protein, preparation method and application thereof | |
CN113583120A (en) | Monoclonal antibody of anti-CK 20 protein, cell strain, preparation method and application thereof | |
CN113234159A (en) | anti-LAG 3 protein monoclonal antibody, cell strain thereof, preparation method and application | |
CN104892759B (en) | Anti- Ki67 monoclonal antibodies and its application by hybridoma cell line secretion | |
CN113831410B (en) | anti-CD 56 protein monoclonal antibody and cell strain, preparation method and application thereof | |
CN113845592B (en) | anti-CK 5/6 protein monoclonal antibody, cell strain thereof, preparation method and application | |
CN101659703B (en) | Monoclonal antibody of anti-human BAP31 protein, preparation method and application thereof | |
CN113234158B (en) | anti-TIM 3 protein monoclonal antibody, cell strain thereof, preparation method and application | |
CN101240021B (en) | Monoclonal antibody for anti-human CDK5RAP2 protein and application thereof | |
CN103266089A (en) | Anti-human copeptin monoclonal antibody mcco1 and application thereof | |
CN113735971A (en) | anti-CK 18 protein monoclonal antibody, cell strain thereof, preparation method and application | |
CN106543285B (en) | Anti- Ttyh1 monoclonal antibodies and its application | |
CN113307875B (en) | Monoclonal antibody for resisting TCR beta F1 protein, cell strain, preparation method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121205 Termination date: 20161009 |