CN101648996B - Anti-myocardial remodelling polypeptide, preparation method thereof, preparations and application thereof in preparation of anti-myocardial remodelling medicament - Google Patents
Anti-myocardial remodelling polypeptide, preparation method thereof, preparations and application thereof in preparation of anti-myocardial remodelling medicament Download PDFInfo
- Publication number
- CN101648996B CN101648996B CN2008101333641A CN200810133364A CN101648996B CN 101648996 B CN101648996 B CN 101648996B CN 2008101333641 A CN2008101333641 A CN 2008101333641A CN 200810133364 A CN200810133364 A CN 200810133364A CN 101648996 B CN101648996 B CN 101648996B
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- seq
- nucleotide sequence
- preparation
- myocardial
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a G protein competitive inhibitory peptide, which starts from a 55 peptide sequence and obtains a series of derived polypeptides by deleting amino acid residues in any number more than one in any point from the first amino acid residue at the amino end and at least remaining twelve amino acid residues at the amino end. The length of the polypeptide is shortened up to 78.2 percent; and the polypeptide has a remarkable effect on anti-myocardial remodelling. The invention also relates to a method for preparing the series of derived polypeptides, which successfully synthesizes a target polypeptide with the purity up to 99.2 percent by utilizing advanced peptide synthesis technology. The invention further relates to the preparations containing the polypeptides and the application thereof in the preparation of an anti-myocardial remodelling medicament.
Description
Technical field
The present invention relates to a peptide species, more particularly, the present invention relates to a kind of competitive inhibition peptide of Gq protein alpha; The invention still further relates to the preparation method of this polypeptide, the preparation that contains this polypeptide and the application of this polypeptide in preparing anti-myocardial remodelling medicament.
Background technology
Myocardial remodelling (being common myocardial hypertrophy) refers to that myocardial cell's volume increases and quantity is constant, that the myocardial cell is to jointly replying that multiple pathology stimulates, all can cause myocardial hypertrophy when as body fluid endocrine substances such as the hemorheology variation such as hypertension, valvular heart disease, acute myocardial infarction, congenital heart disease and the increase of mobility pressure load and endothelin, Angiotensin II, catecholamines, transforming growth factor-beta, il-1s, stimulating, so sickness rate is high
[1]Only in hypertension, its sickness rate has reached 15%～20% in west, though Chinese a little less than this, patient's number has exceeded 1.5 hundred million.In disease initial stage myocardial hypertrophy, certain compensation is arranged, but along with PD, the myofiber reconstruct arrangement disorder that is caused by myocardial hypertrophy, myocardium shrinkage function obstacle etc. cause heart function to descend, be further development of heart failure, the heart failure by myocardial hypertrophy, dead by heart failure, be one of major causes of death of above-mentioned clinical patient.Therefore, the specificity active drug of exploring treatment and controlling myocardial hypertrophy is not only theme and the study hotspot that world today's scientists faces, and is also one of important hygienic issues of needing to be resolved hurrily of global medical field.
Because the myocardial hypertrophy pathogenic factors is numerous, mechanism is complicated, and up to the present, this area does not also have special clinical treatment medicine for myocardial hypertrophy.Existing research shows, no matter being that hemorheology changes stretch stimulation or the stimulation of body fluid endocrine substance (reciprocal causation during disease) that causes, is all almost to induce the pathologic reactions such as myocardial hypertrophy, interstitial fibrosis by signal transduction process after corresponding acceptor and acceptor thereof
[2]Find based on this research, people treat as endothelin antagonist on probation, angiotensin-convertion enzyme inhibitor antihypertensive drugs etc. for a certain factor of its morbidity, find that there is certain effect.But factor, acceptor are numerous, and above-mentioned antagonist/inhibitor when suppressing a certain signaling molecule function, can cause on autoreceptor that being in harmonious proportion the compensatory secretion of other associated receptor aglucon increases, so its effect is very limited in addition
[3-6]Thereby, very necessary from more basic approach developing specificity control medicine.
G albumen is the heterotrimer gtp binding protein that consists of α, β and three subunits of γ, at transduction born of the same parents external stimulus signal, plays keying action in born of the same parents' internal procedure.Norepinephrine (norepinephrine, NE), endothelin (endotheline, ET), the exciting α of Angiotensin II (Ang II) philosophy
1-AR, AT
1After acceptor, endothelin receptor, all, by the activation effect enzyme Phospholipase C-β of Gq family (phospholipase C, PLC-β) of G albumen, act on PIP
2, produce DAG and IP
3Jointly following DAG-PKC-Ras-MAPK and IP
3-Ca
2+-CaN/CaMPK II-NFAT3/GATA-4 signal path induces Embryonic genes in born of the same parents to express, and causes myocardial remodelling.Stretch stimulation, except by integrin activation Raf1, also can stimulate Ang II, NE, ET
1Secretion, therefore also in close relations with Gq.In addition, experiment is also observed: 1. in the pathological remodeling of the heart process, the Gq signal is obviously hyperfunction, and its level is significantly higher than the physiological Gq signal in healthy tissues; , all without obviously changing, occur myocardial hypertrophy and cardiac systolic function obstacle when the Gq alpha expression increases heart function and form when 2 times (or following) while increasing 4 times, occur heart failure while increasing 8 times; 2., by genetically modified mode, but at mouse heart, cross expression Gq α gene induced animal, significant myocardial hypertrophy and lethality heart failure appear; 3. knock out Gq alpha expression in heart and can obviously weaken the hypertrophic response of heart to pressure load
[7-9]This shows, Gq α is in the hinge status in the myocardial remodelling carcinogenesis of human, is the common target spot of many barss approach, is the key signal element that the mediation many factors causes myocardial remodelling/hypertrophy.Therefore, for Gq α, regulate and control, be expected to become brand-new strategy and the successful approach of anti-myocardial remodelling/hypertrophy.
But transgenic animal refer to import foreign gene with experimental technique, and stable integration also can entail offspring's a class animal in the chromogene group; Its principle is the zygote/preimplantation embryos cell of the goal gene that will operate through molecular biology/fragment use different genes method injection test animal, then this zygote/preimplantation embryos cell is replanted in the uterine tube or uterus of receptor, make it develop into the transgenic animal that carry foreign gene, and the phenotype of the Integration by analyzing foreign gene in transgenic animal and transgenic animal explains the function of foreign gene, cultivates the good genetically engineered animal of kind through the genetic and breeding method of routine on this basis.Therefore, with regard to currently available technology, be used for the to grow up treatment of the Autopsy Cases reconstruct of sequela/hypertrophy of transgenic technology is impossible, also to be irrational.In addition, but, because Gq α also has important physiological function simultaneously, knock out Gq alpha expression in heart and will produce serious toxic side effect, therefore above-mentioned two strategies and method do not have actual application value in the control of clinical myocardial remodelling/hypertrophy.
For this reason, we fully utilize the multiple technologies such as molecular designing, optimization, genetically engineered, polypeptide preparation and external, activity in vivo screening, have prepared and have had remarkable anti-myocardial remodelling/the active serial polypeptide of hypertrophy.
Summary of the invention
Based on the defect that exists in prior art, one object of the present invention just is to provide serial polypeptide, and this series polypeptide not only has the therapeutic activity of anti-myocardial hypertrophy, and production method is simple, and is with low cost, is easy to industrialization and the marketization.
Another object of the present invention is to provide the production method of this serial polypeptide, and the method program is simple, economical and can produce the active good serial polypeptide products of high, the anti-myocardial hypertrophy of purity.
Another purpose of the present invention is to provide the formulation products that contains this polypeptide, and the application in the anti-myocardial hypertrophy medicine of preparation.
For realizing purpose of the present invention, the present invention, according to Gq α peptide sequence, at first provides a peptide species, and it has the aminoacid sequence as shown in SEQ ID NO:1 (55 peptide sequence), and it has the therapeutic activity of anti-myocardial hypertrophy.
In a preferred technical scheme, polypeptide provided by the invention is for from the 1st amino-acid residue of aminoterminal of SEQ ID NO:1, position, arbitrfary point deletion any amount and at least one amino-acid residue, but keep at least 12 polypeptide that amino-acid residue obtains of carboxyl terminal.
In a preferred technical scheme, polypeptide provided by the invention is deleted from 1-10 amino-acid residue of aminoterminal of SEQ ID NO:1, resulting polypeptide as shown in SEQ ID NO:2 (45 peptide sequence).
In a preferred technical scheme, polypeptide provided by the invention is deleted from 1-20 amino-acid residue of aminoterminal of SEQ ID NO:1, resulting polypeptide as shown in SEQ ID NO:3 (35 peptide sequence).
In a preferred technical scheme, polypeptide provided by the invention is deleted from 1-25 amino-acid residue of aminoterminal of SEQ ID NO:1, resulting polypeptide as shown in SEQ ID NO:4 (30 peptide sequence).
In a preferred technical scheme, polypeptide provided by the invention is deleted from 1-28 amino-acid residue of aminoterminal of SEQ ID NO:1, resulting polypeptide as shown in SEQ ID NO:5 (27 peptide sequence).
In a preferred technical scheme, polypeptide provided by the invention is deleted from 1-30 amino-acid residue of aminoterminal of SEQ ID NO:1, resulting polypeptide as shown in SEQ ID NO:6 (25 peptide sequence).
In a preferred technical scheme, polypeptide provided by the invention is deleted from 1-35 amino-acid residue of aminoterminal of SEQ ID NO:1, resulting polypeptide as shown in SEQ ID NO:7 (20 peptide sequence).
In a preferred technical scheme, polypeptide provided by the invention is deleted from 1-38 amino-acid residue of aminoterminal of SEQ ID NO:1, resulting polypeptide as shown in SEQ ID NO:8 (17 peptide sequence).
In a preferred technical scheme, polypeptide provided by the invention is deleted from 1-40 amino-acid residue of aminoterminal of SEQ ID NO:1, resulting polypeptide as shown in SEQ ID NO:9 (15 peptide sequence).
In a preferred technical scheme, polypeptide provided by the invention is deleted from 1-43 amino-acid residue of aminoterminal of SEQ ID NO:1, resulting polypeptide as shown in SEQ ID NO:10 (12 peptide sequence).
Polypeptide provided by the invention can also be the above-mentioned polypeptide of arbitrary peptide sequence through replacing, lacking or add one or more amino acid and have identical or approximate anti-myocardial remodelling function.
Polypeptide provided by the invention can also be to contain arbitrary sequence in aforementioned polypeptides, and the polypeptide with anti-myocardial remodelling function.
The present invention also provides the nucleotide sequence of coding aforementioned polypeptides, and it is respectively:
A kind of nucleotide sequence as shown in SEQ ID NO:11, the polypeptide shown in its coding SEQ ID NO:1.
A kind of nucleotide sequence as shown in SEQ ID NO:12, the polypeptide shown in its coding SEQ ID NO:2.
A kind of nucleotide sequence as shown in SEQ ID NO:13, the polypeptide shown in its coding SEQ ID NO:3.
A kind of nucleotide sequence as shown in SEQ ID NO:14, the polypeptide shown in its coding SEQ ID NO:4.
A kind of nucleotide sequence as shown in SEQ ID NO:15, the polypeptide shown in its coding SEQ ID NO:5.
A kind of nucleotide sequence as shown in SEQ ID NO:16, the polypeptide shown in its coding SEQ ID NO:6.
A kind of nucleotide sequence as shown in SEQ ID NO:17, the polypeptide shown in its coding SEQ ID NO:7.
A kind of nucleotide sequence as shown in SEQ ID NO:18, the polypeptide shown in its coding SEQ ID NO:8.
A kind of nucleotide sequence as shown in SEQ ID NO:19, the polypeptide shown in its coding SEQ ID NO:9.
A kind of nucleotide sequence as shown in SEQ ID NO:20, the polypeptide shown in its coding SEQ ID NO:10.
The present invention also provides the recombinant vectors that contains above-mentioned arbitrary nucleotide sequence.
In another preferred technical scheme, described recombinant vectors contains the T7 promotor.
In a preferred technical scheme, described recombinant vectors contains described nucleotide sequence and pIVEX2.3MCS plasmid.
The present invention also provides the preparation that contains acceptable auxiliary material on aforementioned polypeptides and pharmacopedics.
In a preferred technical scheme, described preparation is non-enteron aisle injection formulations.
The present invention provides the application of aforementioned polypeptides in preparation treatment myocardial hypertrophy medicine on the other hand.
In a preferred technical scheme, described polypeptide is as active constituents of medicine, then is equipped with acceptable auxiliary material on pharmacopedics.
The present invention provides the preparation method of aforementioned polypeptides aspect another, and it comprises the following steps:
Carry out polypeptide according to above-mentioned aminoacid sequence synthetic on Peptide synthesizer.
The present invention also provides the another kind of preparation method of aforementioned polypeptides, and it comprises the following steps:
Corresponding nucleotide sequence and carrier are formed recombinant vectors;
Described recombinant vectors is transformed in host cell;
Induce the described polypeptide of described host cell expression;
Separate and obtain described polypeptide.
In preparation method's a preferred technical scheme, described carrier contains the T7 promotor.
In preparation method's a preferred technical scheme, described carrier is plasmid, and described host cell is intestinal bacteria.
In preparation method's a preferred technical scheme, described plasmid is pIVEX2.3MCS, and described intestinal bacteria are BL21.
By above-mentioned technical scheme, the present invention is from the aminoacid sequence shown in SEQ ID NO:1, from the 1st amino-acid residue of its aminoterminal, towards carboxyl terminal position, arbitrfary point deletion any amount and at least one amino-acid residue, its amino-acid residue progressively successively decreases,, until deleted 43 residues, only kept the polypeptide from 12 amino-acid residues of carboxyl terminal; Based on this inventive concept, gene and molecular structure to 55 peptides are optimized, keeping and improving on the basis of its activity, the length that has successfully shortened its peptide reaches 78.2%, and utilize advanced peptide synthetic technology, successfully synthesize target polypeptides, purity reaches 99.2%, and its industrialization key parameter all possesses.
The present invention has also successfully produced target polypeptides by engineered method.Because 55 peptide gene total lengths are 165bp only, add that restriction enzyme site etc. is about about 180bp, consider the factors such as economy, easy to operate and reliability, we have selected minute two sections (4) synthetic, more successively are cloned into the method for expression vector.Built pIVEX2.3MCS2-55 peptide expression plasmid, it contains 55 complete peptide genes, and is under the control of T7 promotor.Can 55 peptides have successfully been given expression under the prokaryotic expression system that adopts the T7 promotor.
The present invention's application light microscopic, Electronic Speculum, directly weigh, the technology such as Color B-Type Ultrasonic, target polypeptides has been carried out pharmacodynamic evaluation than system, evident in efficacy.Studies confirm that, target polypeptides all has good preventive and therapeutic effect to the cultured hypertrophy cardiomyocytes model that the many factors such as Angiotensin II, NE cause; MAPK activity change to stimulations such as Angiotensin IIs all has good inhibition; To the myocardial hypertrophy of normal mouse at the body reverse aortic coaractation model of operation (TAC), and the myocardial hypertrophy that normal rat volume overload (AVO) causes all has good therapeutic action; Spontaneous hypertensive rat (SHR) also had obvious anti-myocardial remodelling, anti-angiogenic plump effect and pressure reduction effect.
Preliminary secure estimate shows, the target polypeptides medication is fool proof.1. cell toxicity test, acellular poison (feminine gender); 2. genetic toxicity test, without heredity poison (feminine gender); 3. mutagenicity test (Salmonella reversion test): without mutagenic effect (feminine gender).The target polypeptides mouse tolerance dose is at least greater than 50mg/kg, with the ratio of significant quantity at least greater than 500; And mouse LD50/ common dose (quantity the is scaled the mouse consumption) ratio of the antihypertensive drugs captopril with anti-myocardial hypertrophy effect commonly used, losartan, nifedipine is respectively 388,349,157, shows that the target polypeptides security obviously is better than said medicine.In addition, do not observe other any toxic side effecties in process of the test.
Description of drawings
The morphologic change of Fig. 1 .SHR model group cardiac muscular tissue;
Fig. 2. the morphologic change of losartan group cardiac muscular tissue;
The morphologic change of Fig. 3 .27 peptide group cardiac muscular tissue;
Fig. 4 .SHR model group myocardial cell's Ultrastructural change;
Fig. 5. losartan group myocardial cell's Ultrastructural change;
Fig. 6 .27 peptide group myocardial cell's Ultrastructural change.
Embodiment
Below according to the specific embodiment of the present invention, by reference to the accompanying drawings the present invention is described in more detail.
Embodiment 1: the solid phase synthesis of polypeptide
One, synthetic, the purifying process of 27 peptides
Following steps feed intake by pilot scale 25g resin (substituent constant is 0.6mmol/g).Industrial scale is the 1kg resin, enlarges in proportion charging capacity, extends the reaction times.
The synthesis technique of (one) 27 peptide
1. accurately take 25g Fmoc-Val-Wang resin, be placed in the 1000ml reactor, add 500ml DCM, vibrate and soak 30min, and with DCM, MeOH, each 500ml of DMF, cleaning respectively twice, suction filtration is except desolventizing.
2. add 500ml 20%Piperidin/DMF, the room temperature vibration, reaction 30min, remove N end Fmoc protecting group.After suction filtration removes desolventizing, then clean resin twice with DMF, MeOH, each 500ml of DCM respectively, and suction filtration is except desolventizing.
3. take 21.2g Fmoc-Leu-OH, 22.8g HBTU is dissolved in 500ml DMF, adds 40ml DIEA, after stirring at room reaction 30min, adds in reactor room temperature vibration, reaction 2h.After suction filtration is removed reaction solution, then clean resin twice with DMF, MeOH, each 500ml of DCM respectively, and suction filtration is except desolventizing.
4. repeated for 2,3 steps, except the amino acid that adds in the 3rd step is 35.8g Fmoc-Asn (Trt)-OH, the reaction times is that beyond 3h, other condition is constant, and step is identical.
5. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 27.6gFmoc-Tyr (tBu)-OH, other condition is constant, and step is identical.
6. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 25.5gFmoc-Glu (OtBu)-OH, other condition is constant, and step is identical.
7. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 28.1gFmoc-Lys (Boc)-OH, other condition is constant, and step is identical.
8. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 21.2g Fmoc-Leu-OH, other condition is constant, and step is identical.
9. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 35.8gFmoc-Asn (Trt)-OH, other condition is constant, and step is identical.
10. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 21.2g Fmoc-Leu-OH, other condition is constant, and step is identical.
11. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 36.7gFmoc-Gln (Trt)-OH, other condition is constant, step is identical.
12. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 21.2g Fmoc-Leu-OH, other condition is constant, step is identical.
13. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 21.2g Fmoc-Ile-OH, other condition is constant, step is identical.
14. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 23.9gFmoc-Thr (tBu)-OH, other condition is constant, step is identical.
15. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 24.7gFmoc-Asp (OtBu)-OH, other condition is constant, step is identical.
16. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 28.1gFmoc-Lys (Boc)-OH, other condition is constant, step is identical.
17. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 20.4g Fmoc-Val-OH, other condition is constant, step is identical.
18. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 19.8g Fmoc-Ala-OH, other condition is constant, step is identical.
19. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 19.8g Fmoc-Ala-OH, other condition is constant, step is identical.
20. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 23.2Fmoc-Phe-OH, other condition is constant, step is identical.
21. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 20.4g Fmoc-Val-OH, other condition is constant, step is identical.
22. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 23.2g Fmoc-Phe-OH, other condition is constant, step is identical.
23. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 39.0gFmoc-Arg (pbf)-OH, other condition is constant, step is identical.
24. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 21.2g Fmoc-Ile-OH, other condition is constant, step is identical.
25. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 35.8g Fmoc-Asn (Trt)-OH, other condition is constant, step is identical.
26. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 25.5gFmoc-Glu (OtBu)-OH, other condition is constant, step is identical.
27. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 23.9g Fmoc-Thr (tBu)-OH, other condition is constant, step is identical.
28. repeated for the 2nd, 3 steps, the amino acid that adds in the 3rd step is that 24.7g Fmoc-Asp (OtBu)-OH, other condition is constant, step is identical.
29. add 500ml 20%Piperidine/DMF, the room temperature vibration, reaction 30min, remove N end Fmoc protecting group.After suction filtration removes desolventizing, then clean resin twice with DMF, MeOH, each 500ml of DCM respectively, and suction filtration is except desolventizing.The vacuum-drying resin is crossed liquid.
30. the dried resin of weighing, gross weight is 68g, increases weight as 43g.With resin transfer in the 250ml round-bottomed flask, add 150ml (TFA/TA/EDT/TIS/H2O/ phenol 7: 1: 1: 0.1: 0.35/0.5), stirring at room 4h.Suction filtration separates resin with filtrate, to adding 2000ml, the ether of 0 ℃ in filtrate, centrifugal will the precipitation with ether separated, dry after 27 peptide crude product 40g.
(2) 27 peptide purification techniques:
1. the 27 thick peptide sample dissolution of peptide of freeze-drying, in DMSO, are used rp-hplc system, after gradient elution separation, collect 27 peptide main peak streams part, obtain 27 peptide raw materials of a purifying after merging freezing draining again.Dried frozen aquatic products after purifying is dissolved in 15% acetonitrile, carries out secondarily purifiedly with rp-hplc system, collects main peak stream part, removes near the impurity main peak, 27 peptides that obtain making with extra care after merging again freezing draining.
2. chromatographic condition is as follows:
Chromatographic instrument: Varian liquid chromatograph prepstar and operation analysis software thereof;
Chromatographic column: use Load ﹠amp; Lock loads C
18Chromatographic column (250x50 millimeter);
Moving phase: A:0.05%TFA/2% acetonitrile/water; The B:90% acetonitrile/water;
Gradient a: purifying: 8-8-32-57%B moving phase totally 70 minutes, flat gradient 5 minutes;
Secondarily purified: 0-0-34-55%B moving phase totally 70 minutes, flat gradient 5 minutes;
Flow velocity: 50 ml/min;
Ultraviolet detection wavelength: 275nm;
Two, synthetic, the purifying process of 55 peptides
Following steps feed intake by pilot scale 25g resin (substituent constant is 0.6mmol/g).Industrial scale is the 1kg resin, enlarges in proportion charging capacity, extends the reaction times.
1. accurately take 25g Fmoc-Val-Wang resin, be placed in the 2000ml reactor, add 500ml DCM, vibrate and soak 30min, and with DCM, MeOH, each 500ml of DMF, cleaning respectively twice, suction filtration is except desolventizing.
2. add 500ml 20%Piperidin/DMF, the room temperature vibration, reaction 30min, remove N end Fmoc protecting group.After suction filtration removes desolventizing, then clean resin twice with DMF, MeOH, each 500ml of DCM respectively, and suction filtration is except desolventizing.
3. take 21.2g Fmoc-Leu-OH, 22.8g HBTU is dissolved in 500ml DMF, adds 40ml DIEA, after stirring at room reaction 30min, adds in reactor room temperature vibration, reaction 2h.After suction filtration is removed reaction solution, then clean resin twice with DMF, MeOH, each 500ml of DCM respectively, and suction filtration is except desolventizing.
4. the washing of repeating step 2,3 and go protection, and add amino acid successively, until be reacted to last amino acid, finishes;
5. add 750ml 20%Piperidine/DMF, the room temperature vibration, reaction 30min, remove N end Fmoc protecting group.After suction filtration removes desolventizing, then clean resin twice with DMF, MeOH, each 500ml of DCM respectively, and suction filtration is except desolventizing.The vacuum-drying resin is crossed liquid.
6. the dried resin of weighing, gross weight is 113g, increases weight as 88g.With resin transfer in the 250ml round-bottomed flask, add 250ml (TFA/TA/EDT/TIS/H2O/ phenol 7: 1: 1: 0.1: 0.35/0.5), stirring at room 4h.Suction filtration separates resin with filtrate, to adding 3000ml, the ether of 0 ℃ in filtrate, centrifugal will the precipitation with ether separated, dry after 55 peptide crude product 85g.
7. process for refining and chromatographic condition are with reference to 27 peptides.
Three, synthetic, the purifying process of 12 peptides
1-4. with above-mentioned 55 peptide moieties
5. add 500ml 20%Piperidine/DMF, the room temperature vibration, reaction 30min, remove N end Fmoc protecting group.After suction filtration removes desolventizing, then clean resin twice with DMF, MeOH, each 500ml of DCM respectively, and suction filtration is except desolventizing.The vacuum-drying resin is crossed liquid.
6. the dried resin of weighing, gross weight is 46g, increases weight as 21g.Resin transfer in the 250ml round-bottomed flask, is added 100ml (TFA/TA/EDT/TIS/H2O 7: 1: 1: 0.1: 0.35), stirring at room 3h.Suction filtration separates resin with filtrate, to adding 1500ml, the ether of 0 ℃ in filtrate, centrifugal will the precipitation with ether separated, dry after 12 peptide crude product 19g.
7. process for refining and chromatographic condition are with reference to 27 peptides.
Embodiment 2:55 peptide, the gene engineering expression of 27 peptides, purifying
, according to the gene order of 55 peptides and 27 peptides, for building its expression vector, designed corresponding oligonucleotide sequence.
Synthesize four oligonucleotide strands for 55 peptides:
55-1：60bp
5’tcgagctccatgggtcgagaattcattctgaagatgttcgtcgactaaacgttctctgca?3’
55-2：52bp
5’gagaacgtttagtcgacgaacatcttcagaatgaattctcgacccatggagc?3’
55-3：85bp
5’gaggtcgacctgaacccagacagtgacaaaattatctactcccacttcacgtgtgccacagacaccg
agaatatccgctttgtct 3’
55-4：85bp
5’tagcccggggaccagattgtactccttcaggttcagctggaggatggtgtccttgacggctgcaaag
acaaagcggatattctcg 3’
For 27 peptide synthetic oligonucleotide strands:
27-1：
5’catggacaccgagaatatccgctttgtctttgcagccgtcaaggacaccatcctccagctgaacctga
aggagtacaatctggtctaaccc?3’
27-2：
5’gggttagaccagattgtactccttcaggttcagctggaggatggtgtccttgacggctgcaaagacaa
agcggatattctcggtgtc 3’
The synthetic rear double chain DNA fragment with sticky end that forms of first and second oligonucleotide strand annealing of 55 peptides is directed between the XhoI site and PstI site that is cloned into pEGFP-N1 plasmid (heredity teaching and research room of Third Military Medical University provides), and the plasmid that is built into is referred to as pEGFP-A.Third and fourth synthetic oligonucleotide strand 3 ' end has 20 base complementrities, and at the downward double chain DNA fragment B that is stretched into of Taq enzyme effect, the visible amplified fragments of 2.5% agarose gel electrophoresis is positioned at the 150bp place.Fragment B is after SalI and SmaI double digestion, and directed cloning enters between the SalI site and SmaI site of pEGFP-A, and the plasmid that is built into is referred to as pEGFP-55, and it has comprised 55 complete peptide genes.After XhoI and SmaI double digestion downcut 55 peptide genes, insert between the XhoI site and SmaI site of pIVEX2.3-MCS plasmid, the prokaryotic expression carrier that is built into is called pIVEX2.3MCS-55.Its screening can be by after XhoI and SmaI double digestion, and 2.5% agarose gel electrophoresis, as having positive clone of band in the 180bp left and right.
Article one and second single stranded oligonucleotide that 27 peptides are synthetic, can be formed directly in the double-stranded DNA with NcoI and SmaI sticky end after annealed.After NcoI and SmaI double digestion pIVEX2.3 plasmid, reclaim the plasmid segment of test kit recovery with sticky end with glue after electrophoresis.With the T4DNA ligase enzyme, 27 peptide gene directed clonings are entered in pIVEX2.3 plasmid (being purchased from Switzerland Roche company).Positive colony contains 27 peptide genes, is referred to as pIVEX2.3-27.6 of pickings connect the recombinant plasmid product at the bacterium colony that contains on the plate of penbritin, are incubated in 5ml LB substratum and spend the night, and extract plasmid and carry out the evaluation of double digestion rear electrophoresis with NcoI and SmaI; Electrophoresis identifies that positive clone remakes order-checking and identifies, determines that pIVEX2.3MCS-55 and pIVEX2.3-27 successfully construct.Respectively with pIVEX2.3MCS-55 and pIVEX2.3-27 difference transformed competence colibacillus BL21 (DE3) pLysE bacterium (be purchased from Shanghai and give birth to work biotechnology company limited), plasmid extraction kit extracts the plasmid that transforms bacterium colony, enzyme is cut evaluation, get single bacterium colony and contain 37 ℃, 180rpm/min in penbritin (100 μ g/ml) LB substratum in 2ml, shake was cultivated 10 hours.Contain in penbritin LB substratum and add the 200 above-mentioned bacterium liquid of μ l at 250ml, 37 ℃, 180 rev/mins shakes were cultivated 10 hours, and adding IPTG to make its final concentration is 1mmol/L, and 37 ℃ of continuation cultivations continued to cultivate 12 hours in 4～6 hours and 30 ℃.Centrifugal collection bacterium ,-70 ℃ save backup.The bacterium 1g weight in wet base of collecting is resuspended with 5ml binding buffer liquid, ultrasonication bacterium (condition: pulse is 6 seconds, and amplitude is 15～20, broken 8～10 minutes on ice), and 12000rpm/min, centrifugal 10 minutes, draw supernatant and make purifying.Purifying adopts the nickel chelating affinitive layer purification under Denaturing: first use 5ml sex change binding buffer liquid balance nickel post.Ultrasonication liquid supernatant is crossed post, and flow rate control per hour is being no more than 10ml, collects and penetrates liquid.5ml sex change dcq buffer liquid A rinses pillar, collects and sees through liquid.Non-sex change is rushed Xian's buffer B and sex change dcq buffer liquid B and is made into each 1ml of liquid that ratio is 0: 1,1: 9,2: 8,3: 7,4: 6,5: 5,6: 4,7: 3,8: 2,9: 1 and 1: 0, wash post with aforesaid liquid successively respectively, wash post with the non-sex change dcq buffer of 2ml liquid B again, whole process will be grown, should be not less than 2～3 hours, collect and see through liquid.3ml elution buffer A crosses post Xian deproteinated, collects and sees through liquid.2 * 3ml elution buffer B crosses the post eluted protein, collects and sees through liquid.And identify its purity by SDS-PAGE, result shows BL21 (DE3) bacterial expression target polypeptides, expression amount accounts for 10% of bacterial protein, and through ni-sepharose purification and renaturation, output be 250ml bacterium liquid approximately purifying obtain the 1.5mg target polypeptides.Wash lower most of target polypeptides during 500mmol/L imidazoles wash-out, the SDS-PAGE band is single, and its purity of image analysis reaches more than 98%.
Embodiment 3: the present invention series polypeptide can obviously reduce protein content in the Cardiomyocytes Hypertrophy model that norepinephrine induces
1. take out and give birth to the Wistar rat (available from Third Military Medical University's Experimental Animal Center) of rear 1～3 day, the cervical vertebra dislocation is put to death, and is fixed on autopsy table.With 2% tincture of iodine, 75% ethanol disinfection outside of belly skin.Take out heart, be cut into approximately 1～3mm
3The fragment of size, digest repeatedly with the Digestive system that contains 0.08% trypsinase, 0.02%EDTA, 0.05% collagenase II, collecting cell in the DMEM that contains 10% foetal calf serum, 37 ℃, 5%CO
2Cultivate in incubator.
2. cultivate the myocardial cell of 48 hours, change the DMEM nutrient solution of serum-free, continue cultivation and add medicine by following experiment grouping after 24 hours:
Normal group: add PBS 10 μ l
Norepinephrine group: add norepinephrine (norepinephrine, NE, Serva company, the U.S.) 1 μ mol/L
Polypeptide administration group: when adding NE, add corresponding polypeptide drugs 10nmol/L.
3. continue to cultivate 24 hours after adding medicine, discard nutrient solution, the PBS washing, every hole adds 5% trichoroacetic acid(TCA) 0.5ml, places 1h for 4 ℃, will be precipitated and dissolved in the NaOH of 1ml 0.1mol/L, with the Lowry method, measures protein content.
4. 55 peptides of result: 10nmol/L, 45 peptides, 35 peptides, 30 peptides, 27 peptides, 25 peptides, 20 peptides, 17 peptides, 15 peptides all can obviously reduce protein content in the hypertrophic cardiomyocytes that NE induces, and 12 peptides are without obvious effect (as table 1).
Table 1. the present invention series polypeptide is to cultured rat myocardial
The impact of protein content (n=6, x ± s)
*P＜0.01vs control group;
#P＜0.05,
##P＜0.01vs NE group.
Embodiment 4. the present invention series polypeptide can obviously reduce protein content in the Cardiomyocytes Hypertrophy model that Angiotensin II (Ang II) induces
1. the myocardial cell cultivates the samely, after cultivating 48h, changes the DMEM nutrient solution of serum-free, continues to cultivate after 24 hours to add medicine by following experiment grouping: Normal group: add PBS10 μ l; Ang II group: add AngII 1 μ mol/L; Series polypeptide administration group: when adding Ang II, add respectively 12 peptides, 15 peptides, 27 peptides, 55 peptide 10nmol/L.
2. continue to cultivate 24 hours after adding medicine, discard nutrient solution, the PBS washing, every hole adds 5% trichoroacetic acid(TCA) 0.5ml, places 1h for 4 ℃, will be precipitated and dissolved in the NaOH of 1ml 0.1mol/L, with the Lowry method, measures protein content.
3. result: compare with Normal group, add Ang II can obviously increase myocardial cell's protein content (μ g:143.2 ± 5.49vs 113.9 ± 7.48, p＜0.01) in cell culture fluid.Compare with the AngII group, 15 peptides, 27 peptides, 55 peptides can reduce protein content in the myocardial cell to some extent, and 12 peptides are without positive effect (in Table 2).
The impact of the hypertrophic cardiomyocytes protein content that the serial polypeptide of table 2. is induced Angiotensin II (n=6, x ± s)
Annotate:
*P＜.05,
*P＜0.01vs control group;
#P＜0.05,
##P＜0.01vs Ang II group
Embodiment 5. the present invention's series polypeptide can obviously suppress the mouse cardiac muscle hypertrophy that norepinephrine is induced
Test Kunming mouse (available from Third Military Medical University's Experimental Animal Center) 50, be divided into 5 groups, every group 10, control group gives 0.1% xitix-3mg% Seignette salt-physiological saline, and model group gives 0.1% xitix-6mg% noradrenaline bitartrate-physiological saline (being equivalent to NE 1.5mg/kg); Give 3 groups of medicines, when giving 0.1% xitix-6mg% noradrenaline bitartrate-physiological saline, give 15 peptides, 27 peptides, 55 peptide 30 μ g/kg, abdominal injection (ip), twice of every day (bid), continuous 15 days respectively.Each is organized the administration volume and is 50ml/kg.When the time comes, animal is put to death in the cervical vertebra dislocation, opens chest and takes out heart, and ice-cold physiological saline washes away bloodstain, and filter paper blots, and balance is weighed, and carefully removes atrium and right ventricle (reservation interventricular septum), and left ventricle is weighed.
Result shows: serial polypeptide can obviously stop the generation of mouse cardiac muscle hypertrophy, outside 15 peptide group cardiac weights (alleviate 9.9%, but p＞0.05), and other group myocardial hypertrophy indices all be significantly improved (in Table 3).
The serial polypeptide of table 3. is on the impact of mouse cardiac muscle hypertrophy (x ± s)
Annotate: BW-body weight (body weight); HW-heart heavy (heart weight); LVW-left ventricle heavy (left ventricular weight); HI-cardiac index (heart index); LVI-left ventricle index (left ventricular index) or cardiac hypertrophy parameter
*P＜0.05,
*P＜0.01vs control group;
#P＜0.05,
##P＜0.01vs NE group
Embodiment 6: the present invention's series polypeptide suppresses the cardiac hypertrophy that norepinephrine is induced
Select 30 of Wistar rats, 5 groups, 6 every group, control group gives 0.1% xitix-3mg% Seignette salt-physiological saline, model group gives 0.1% xitix-6mg% noradrenaline bitartrate-physiological saline, give 3 groups of medicines, when giving norepinephrine, give respectively 15 peptides, 27 peptides, 55 peptide 15 μ g/kg respectively, each is organized the administration volume and is 33ml/kg, ip, bid, continuous 20 days.When the time comes, weigh heart and left ventricle.
Result shows (in Table 4): 15 Toplink obviously reduce the left ventricle index, and 27 peptides and 55 peptides significantly reduce left ventricular mass, cardiac index and left ventricle index.
The impact of the cardiac hypertrophy that the serial polypeptide of table 4 is induced norepinephrine (n=6, x ± s)
Annotate: BW-body weight (body weight); HW-heart heavy (heart weight); LVW-left ventricle heavy (left ventricular weight); HI-cardiac index (heart index); LVI-left ventricle index (left ventricular index) or cardiac hypertrophy parameter
*P＜0.05,
*P＜0.01vs control group;
#P＜0.05,
##P＜0.01vs NE group
Embodiment 7: the present invention's series polypeptide can be prevented and treated the cardiac hypertrophy that attenuates pressure-overload left is induced
Healthy male Wistar rat (available from Third Military Medical University's Experimental Animal Center), be divided into: sham operated rats (sham-operation group), surgery models group (SRS), polypeptide administration group at random.The preoperative overnight fasting of animal, freely drink water, and with after vetanarcol anesthesia, opens abdomen, separates aorta abdominalis, No. 8 injection needless (external diameter 0.80mm) tightened and rapidly syringe needle removed afterwards with silk thread along aorta abdominalis above right renal artery, sews up and close abdomen.Sham operated rats is not done the silk thread ligation, and other processing is identical.From rear 1 day of operation, Sham-operated control group and surgery models group gave physiological saline 7.5ml/kg, ip, 1 times/day; Give respectively 15 peptides, 27 peptides, 55 peptide 15 μ g/kg, ip, 1 times/day to medicine.Rat is conventional raised for 3 weeks after, put to death, open chest and take out heart, ice-cold physiological saline washes away bloodstain, filter paper blots, balance weigh heart and left ventricle.
Result shows: compare with the surgery models group, serial polypeptide can significantly stop the generation of cardiac hypertrophy, and HW, LVW, HI and LVI all have obviously and reduce (in Table 5).
The serial polypeptide of table 5 is on the impact of rats with abdominal aorta coarctation myocardial hypertrophy (x ± SEM)
*P＜0.05，
**P＜0.01vs?sham-operation?group；
#P＜0.05，
##P＜0.01vs?SRSgroup。
Embodiment 8 the present invention's series polypeptide can be prevented and treated the spontaneous hypertensive rat myocardial remodelling
1. select 13 all spontaneous hypertensive rat in age (SHR, available from Beijing Vital River Experimental Animals Technology Co., Ltd.) 30, be divided at random 5 groups, 6 every group:
SHR model group (Vehicle): 0.9% physiological saline, press the 5ml/kg abdominal injection, every twice-daily.
Positive controls (Losartan): Losartan Potassium 6mg/kg, gavage on the 1/th.
15 peptide groups: by 30 μ g/kg abdominal injections, give 15 peptides, every twice-daily.
27 peptide groups: by 30 μ g/kg abdominal injections, give 27 peptides, every twice-daily.
55 peptide groups: by 30 μ g/kg abdominal injections, give 55 peptides, every twice-daily.
Alternative with WKY (Wistar-Kyoto) rat (available from Third Military Medical University's Experimental Animal Center) 6 as normal control.
2. continuous use is intervened 8 weeks (from the 14th 21 weeks of week to the).Every two weeks of all experimental rats are measured body weight once, according to body weight, adjust dosage.
3. result shows
(1) serial polypeptide has certain hypotensive effect, can obviously reduce the systolic arterial pressure (in Table 6) of SHR
The impact (x ± s n=6) of table 6 the present invention series polypeptide on the SHR systolic pressure
##p＜0.01vs?WKY；
**p＜0.01vs?Vehicle
(2) the present invention's series polypeptide can obviously improve the myocardial remodelling of SHR, can significantly reduce end-diastolic LPWT (the leftventricular posterior wall thickness of HW, LVW, HI and LVI (table 7) and the SHR of rat, PWT), IVSTd (intervertricularseptum thickness, IVST) (table 8).
Table 7: the impact (x ± s n=6) of serial polypeptide on heart hypertrophy in rats
Annotate:
*P＜0.01vs Vehicle;
##P＜0.01vs WKY
The impact (x ± s n=6) of table 8 the present invention series polypeptide on the SHR echocardiographic parameters
Annotate: ##:p＜0.01vs WKY;
*: p＜0.05,
*: p＜0.01vs Vehicle
LAD:left atrium sinistrum diameter (left room diameter); LVEDD:leftventricular end diastolic diameter (left ventricular end diastolic dimension), EF:ejectionfraction (ejection fraction); FS:shortening fraction (shortening fraction), SV:strokevolume (the often amount of fighting)
(3) impact of the present invention's series polypeptide on SHR cardiac muscular tissue form:
Morphological analysis shows: model group rat myocardial cell diameter (TDM) and cross-sectional area (CSA) obviously increase (p＜0.01) than the WKY group, and the CSA of serial polypeptide medication group and losartan group rat significantly reduces (p＜0.01) (in Table 9) than model group.
Table 9. rat myocardial cell morphological analysis (x ± s n=6)
##p＜0.01vs WKY;
*P＜0.01,
*Under p＜0.01vs vehicle. light microscopic, as seen, it is blue that cardiac cell nucleus is, the endochylema pinkiness, and collagen is not painted.
SHR model group (Fig. 1): the cardiac muscle fibre chap, swelling, gap are unclear, fracture, fusion or arrangement disorder, and comparatively significantly big area cardiac muscle hydropic degeneration appears in part; The myocardial cell is loose, cloudy swelling obviously, and the cavity sample changes; Nucleus hypertrophy or pyknosis; Entocyte becomes particulate state, and fracture is merged, and necrosis is even arranged; Spotty necrosis kitchen range, focal necrosis kitchen range can be seen in the minority visual field; Vessel wall thickening; Smooth muscle cell proliferation, hypertrophy; Indivedual visuals field cardiac muscle interstitial fibrosis.But on the whole: the model group fibrosis is lighter; Inflammatory response is heavier; Necrosis region can be seen in the minority visual field.
Losartan group (Fig. 2): pathology makes moderate progress, and pathological change, take inflammatory cell infiltration as main, can be seen the myocardial cell and be the inflammatories variations such as obvious cloudy swelling, hypertrophy, and necrosis region still can be seen in indivedual visuals field.
27 peptide groups (Fig. 3) compare with the SHR model group, above-mentioned myocardial cell's pathology damage obviously alleviates, and pathology is improved substantially close to Normal group, and indivedual visuals field are accidental to be changed to inflammatories such as myocardial cell's mild swellings, form without necrosis region, cardiac muscle fibre and vessel wall form are normal.
The Ultrastructural impact (PHILIPS-TECNI10 transmission electron microscope, Holland) of (4) 27 peptides on SHR myocardial cell:
SHR model group (Fig. 4): myocardial cell's volume increases, and nuclear membrane is imperfect, and core hypertrophy, deformity, dissolving etc. are irregular variation; Dilatation of sarcoplasmic reticulum; Mitochondrial hyperplasia, arrangement disorder, (light, in, heavy) swelling in various degree, in have cavity to form; Myofilament is arranged normal, and part myocardial cell's myofilament has the kitchen range dissolving; The visible unclear transverse striation of muscle fiber of regional area, Z line normal, indivedual arrangement disorders; The interstitial collagen fiber is without obvious hyperplasia.
Losartan group (Fig. 5): the karyomorphism normal is somewhat irregular; Myofilament kitchen range dissolving under adipose membrane; The plastosome mild swelling; Dilatation of sarcoplasmic reticulum, mild swelling; The Z line, band structure normal.
27 peptide groups (Fig. 6): with the SHR model group, compare, myocardial ultrastructure is improved obviously, myocardial cell's structure normal, myocardial cell's muscle segment, myofilament are arranged normal, and band is clear, the interstitial collagen fiber is without obvious hyperplasia, Z line marshalling, plastosome be without obvious hyperplasia, small part plastosome mild swelling, myofilament slightly dissolves, and capillary endothelial cell is normal.
Although herein disclosed is above embodiment, technical scheme of the present invention is not limited to above embodiment; In the situation that do not break away from the present invention's design, any change that technical scheme of the present invention is done all will fall into claims limited range of the present invention.
Reference:
1.Cooper?G?4th.Basic?determinants?of?myocardial?hypertrophy：a?review?ofmolecular?mechanisms.Annu?Rev?Med，1997，48：13-23.
2.Aoki?H，Sadoshima?J，Izumo?S.Myosin?light?chain?kinase?mediatessarcomere?organization?during?cardiac?hypertrophy?in?vitro.Nat?Med2000，6(2)：183-188.
3.McKinsey?TA，Kass?DA.Small-molecule?therapies?for?cardiachypertrophy：moving?beneath?the?cell?surface.Nat?Rev?Drug?Discov.2007；6(8)：617-635.
4.Mitchell?JA，Ventura?HO，Mehra?MR.Early?recognition?and?treatment?ofhypertensive?heart?disease.Curr?Opin?Cardiol.2005；20(4)：282-289.
5.Jalili?T，Carlstrom?J，Kim?S，Freeman?D，Jin?H，Wu?TC，Litwin?SE，DavidSymons?J.Quercetin-supplemented?diets?lower?blood?pressure?andattenuate?cardiac?hypertrophy?in?rats?with?aortic?constriction.J?CardiovascPharmacol.2006；47(4)：531-541.
6.Carlstrom?J，Symons?JD，Wu?TC，Bruno?RS，Litwin?SE，Jalili?T.Aquercetin?supplemented?diet?does?not?prevent?cardiovascular?complicationsin?spontaneously?hypertensive?rats.J?Nutr.2007；137(3)：628-633.
7.Niizeki?T，Takeishi?Y，Kitahara?T，et?al.Diacylglycerol?Kinase?zetaRescues?Galphaq-Induced?Heart?Failure?in?Transgenic?Mice.Circ?J.2008；72(2)：309-317.
8.Dorn?GW?2nd，Tepe?NM，Lorenz?JN，Koch?WJ，Liggett?SB.Low-andhigh-level?transgenic?expression?of?β2-adrenergic?receptors?differentiallyaffect?cardiac?hypertrophy?and?function?in?Gαq-overexpressing?mice.ProcNatl?Acad?Sci?USA.1999；96(11)：6400-6405.
9.Berenji?K，Drazner?MH，Rothermel?BA，Hill?JA.Does?load-inducedventricular?hypertrophy?progress?to?systolic?heart?failure？Am?J?PhysiolHeart?Circ?Physiol.2005；289(1)：H8-H16.
Sequence table
＜110〉Li Xiaohui
Pharmaceutical college of Military Medical Univ No.3, P.L.A
Chongqing Zhao Kangli converges Pharmaceutical Technology Co., Ltd
Qingyang, Chongqing pharmaceutcal corporation, Ltd
＜120〉anti-myocardial remodelling polypeptide, its preparation method, preparation and the application in preparing anti-myocardial remodelling medicament
<130>DP1F080358ZX/CNSJY/YL
<160>20
<170>PatentIn?version?3.3
<210>1
<211>55
<212>PRT
＜213〉mankind
<400>1
Ala?Arg?Glu?Phe?Ile?Leu?Lys?Met?Phe?Val?Asp?Leu?Asn?Pro?Asp?Ser
1 5 10 15
Asp?Lys?Ile?Ile?Tyr?Ser?His?Phe?Thr?Cys?Ala?Thr?Asp?Thr?Glu?Asn
20 25 30
Ile?Arg?Phe?Val?Phe?Ala?Ala?Val?Lys?Asp?Thr?Ile?Leu?Gln?Leu?Asn
35 40 45
Leu?Lys?Glu?Tyr?Asn?Leu?Val
50 55
<210>2
<211>45
<212>PRT
＜213〉mankind
<400>2
Asp?Leu?Asn?Pro?Asp?Ser?Asp?Lys?Ile?Ile?Tyr?Ser?His?Phe?Thr?Cys
1 5 10 15
Ala?Thr?Asp?Thr?Glu?Asn?Ile?Arg?Phe?Val?Phe?Ala?Ala?Val?Lys?Asp
20 25 30
Thr?Ile?Leu?Gln?Leu?Asn?Leu?Lys?Glu?Tyr?Asn?Leu?Val
35 40 45
<210>3
<211>35
<212>PRT
＜213〉mankind
<400>3
Tyr?Ser?His?Phe?Thr?Cys?Ala?Thr?Asp?Thr?Glu?Asn?Ile?Arg?Phe?Val
1 5 10 15
Phe?Ala?Ala?Val?Lys?Asp?Thr?Ile?Leu?Gln?Leu?Asn?Leu?Lys?Glu?Tyr
20 25 30
Asn?Leu?Val
35
<210>4
<211>30
<212>PRT
＜213〉mankind
<400>4
Cys?Ala?Thr?Asp?Thr?Glu?Asn?Ile?Arg?Phe?Val?Phe?Ala?Ala?Val?Lys
1 5 10 15
Asp?Thr?Ile?Leu?Gln?Leu?Asn?Leu?Lys?Glu?Tyr?Asn?Leu?Val
20 25 30
<210>5
<211>27
<212>PRT
＜213〉mankind
<400>5
Asp?Thr?Glu?Asn?Ile?Arg?Phe?Val?Phe?Ala?Ala?Val?Lys?Asp?Thr?Ile
1 5 10 15
Leu?Gln?Leu?Asn?Leu?Lys?Glu?Tyr?Asn?Leu?Val
20 25
<210>6
<211>25
<212>PRT
＜213〉mankind
<400>6
Glu?Asn?Ile?Arg?Phe?Val?Phe?Ala?Ala?Val?Lys?Asp?Thr?Ile?Leu?Gln
1 5 10 15
Leu?Asn?Leu?Lys?Glu?Tyr?Asn?Leu?Val
20 25
<210>7
<211>20
<212>PRT
＜213〉mankind
<400>7
Val?Phe?Ala?Ala?Val?Lys?Asp?Thr?Ile?Leu?Gln?Leu?Asn?Leu?Lys?Glu
1 5 10 15
Tyr?Asn?Leu?Val
20
<210>8
<211>17
<212>PRT
＜213〉mankind
<400>8
Ala?Val?Lys?Asp?Thr?Ile?Leu?Gln?Leu?Asn?Leu?Lys?Glu?Tyr?Asn?Leu
1 5 10 15
Val
<210>9
<211>15
<212>PRT
＜213〉mankind
<400>9
Lys?Asp?Thr?Ile?Leu?Gln?Leu?Asn?Leu?Lys?Glu?Tyr?Asn?Leu?Val
1 5 10 15
<210>10
<211>12
<212>PRT
＜213〉mankind
<400>10
Ile?Leu?Gln?Leu?Asn?Leu?Lys?Glu?Tyr?Asn?Leu?Val
1 5 10
<210>11
<211>165
<212>DNA
＜213〉mankind
<400>11
gcccgagaat?tcattctgaa?gatgttcgtg?gacctgaacc?cagacagtga?caaaattatc 60
tactcccact?tcacgtgtgc?cacagacacc?gagaatatcc?gctttgtctt?tgcagccgtc 120
aaggacacca?tcctccagct?gaacctgaag?gagtacaatc?tggtc 165
<210>12
<211>135
<212>DNA
＜213〉mankind
<400>12
gacctgaacc?cagacagtga?caaaattatc?tactcccact?tcacgtgtgc?cacagacacc 60
gagaatatcc?gctttgtctt?tgcagccgtc?aaggacacca?tcctccagct?gaacctgaag 120
gagtacaatc?tggtc 135
<210>13
<211>105
<212>DNA
＜213〉mankind
<400>13
tactcccact?tcacgtgtgc?cacagacacc?gagaatatcc?gctttgtctt?tgcagccgtc 60
aaggacacca?tcctccagct?gaacctgaag?gagtacaatc?tggtc 105
<210>14
<211>90
<212>DNA
＜213〉mankind
<400>14
tgtgccacag?acaccgagaa?tatccgcttt?gtctttgcag?ccgtcaagga?caccatcctc 60
cagctgaacc?tgaaggagta?caatctggtc 90
<210>15
<211>81
<212>DNA
＜213〉mankind
<400>15
gacaccgaga?atatccgctt?tgtctttgca?gccgtcaagg?acaccatcct?ccagctgaac 60
ctgaaggagt?acaatctggt?c 81
<210>16
<211>75
<212>DNA
＜213〉mankind
<400>16
gagaatatcc?gctttgtctt?tgcagccgtc?aaggacacca?tcctccagct?gaacctgaag 60
gagtacaatc?tggtc 75
<210>17
<211>60
<212>DNA
＜213〉mankind
<400>17
gtctttgcag?ccgtcaagga?caccatcctc?cagctgaacc?tgaaggagta?caatctggtc 60
<210>18
<211>51
<212>DNA
＜213〉mankind
<400>18
gccgtcaagg?acaccatcct?ccagctgaac?ctgaaggagt?acaatctggt?c 51
<210>19
<211>45
<212>DNA
＜213〉mankind
<400>19
aaggacacca?tcctccagct?gaacctgaag?gagtacaatc?tggtc 45
<210>20
<211>36
<212>DNA
＜213〉mankind
<400>20
atcctccagc?tgaacctgaa?ggagtacaat?ctggtc 36
Claims (26)
1. the polypeptide shown in a SEQ ID NO:2.
2. the polypeptide shown in a SEQ ID NO:3.
3. the polypeptide shown in a SEQ ID NO:4.
4. the polypeptide shown in a SEQ ID NO:5.
5. the polypeptide shown in a SEQ ID NO:6.
6. the polypeptide shown in a SEQ ID NO:7.
7. the polypeptide shown in a SEQ ID NO:8.
8. the nucleotide sequence shown in the SEQ ID NO:12 of coding claim 1 described polypeptide.
9. the nucleotide sequence shown in the SEQ ID NO:13 of coding claim 2 described polypeptide.
10. the nucleotide sequence shown in the SEQ ID NO:14 of coding claim 3 described polypeptide.
11. the nucleotide sequence shown in the SEQ ID NO:15 of the described polypeptide of coding claim 4.
12. the nucleotide sequence shown in the SEQ ID NO:16 of the described polypeptide of coding claim 5.
13. the nucleotide sequence shown in the SEQ ID NO:17 of the described polypeptide of coding claim 6.
14. the nucleotide sequence shown in the SEQ ID NO:18 of the described polypeptide of coding claim 7.
15. recombinant vectors that contains the described nucleotide sequence of any one in claim 8-14.
16. recombinant vectors according to claim 15, is characterized in that, described recombinant vectors contains the T7 promotor.
17. recombinant vectors according to claim 16, is characterized in that, described recombinant vectors is to build and obtain by described nucleotide sequence being inserted in the pIVEX2.3MCS plasmid.
18. one kind contains in claim 1-7 the preparation of acceptable auxiliary material on the described polypeptide of arbitrary claim and pharmacopedics.
19. preparation according to claim 18, is characterized in that, described preparation is non-enteron aisle injection formulations.
20. the application of the described polypeptide of arbitrary claim in preparation treatment myocardial hypertrophy medicine in claim 1-7.
21. application according to claim 20, wherein said polypeptide be as active constituents of medicine, then be equipped with acceptable auxiliary material on pharmacopedics.
22. the preparation method of the described polypeptide of arbitrary claim in a claim 1-7, it comprises the following steps:
Carrying out polypeptide according to the described amino acid whose sequence of arbitrary claim in claim 1-7 on Peptide synthesizer synthesizes.
23. the preparation method of the described polypeptide of arbitrary claim in a claim 1-7, it comprises the following steps:
Corresponding nucleotide sequence and carrier are formed recombinant vectors;
Described recombinant vectors is transformed in host cell;
Induce the described polypeptide of described host cell expression;
Separate and obtain described polypeptide.
24. method according to claim 23, described carrier contains the T7 promotor.
25. method according to claim 24, described carrier are plasmid, described host cell is intestinal bacteria.
26. method according to claim 25, described plasmid are pIVEX2.3MCS, described intestinal bacteria are BL21.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101333641A CN101648996B (en) | 2008-08-11 | 2008-08-11 | Anti-myocardial remodelling polypeptide, preparation method thereof, preparations and application thereof in preparation of anti-myocardial remodelling medicament |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101333641A CN101648996B (en) | 2008-08-11 | 2008-08-11 | Anti-myocardial remodelling polypeptide, preparation method thereof, preparations and application thereof in preparation of anti-myocardial remodelling medicament |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101648996A CN101648996A (en) | 2010-02-17 |
| CN101648996B true CN101648996B (en) | 2013-11-20 |
Family
ID=41671338
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101333641A Active CN101648996B (en) | 2008-08-11 | 2008-08-11 | Anti-myocardial remodelling polypeptide, preparation method thereof, preparations and application thereof in preparation of anti-myocardial remodelling medicament |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101648996B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999005294A1 (en) * | 1997-07-24 | 1999-02-04 | Duke University | INTRACELLULAR INHIBITORS OF Gq PROTEIN SIGNALING |
| US5955575A (en) * | 1997-12-22 | 1999-09-21 | Hopital Sainte-Justine | Antagonists of G-protein-coupled receptor |
| US7208279B2 (en) * | 2001-03-14 | 2007-04-24 | Caden Biosciences, Inc. | Method for identifying inhibitors of G protein coupled receptor signaling |
-
2008
- 2008-08-11 CN CN2008101333641A patent/CN101648996B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| Conklin B R et al.Substitution of three amino acids switches receptor specificity of Gq alpha to that of Gi alpha.《Nature》.1993,第363卷(第6426期),274-276. |
| Dong Q., et al..Genbank序列号：AAC50363.1.《Genbank数据库》.1996, * |
| Substitution of three amino acids switches receptor specificity of Gq alpha to that of Gi alpha;Conklin B R et al;《Nature》;19930520;第363卷(第6426期);274-276 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101648996A (en) | 2010-02-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2289778T3 (en) | FUSION PROTEINS OF THE CONSTANT REGION OF THE IMMUNOGLOBULIN / RECEIVER TGF-BETA TYPE II. | |
| JP4942818B2 (en) | Peptide having epidermal growth factor activity and use thereof | |
| JP4971373B2 (en) | Peptide having insulin-like growth factor-1 activity and use thereof | |
| JP5361988B2 (en) | Growth factor-mimicking peptides and uses thereof | |
| US8895003B2 (en) | Pharmaceutical composition comprising EDA-1 Fusion Protein | |
| EP3138399B1 (en) | Composition for organ, tissue, or cell transplantation, kit, and transplantation method | |
| JP5507691B2 (en) | Peptides derived from WNT10 and uses thereof | |
| CN104211800A (en) | Protease resistant mutants of stromal cell derived factor-1 in the repair of tissue damage | |
| US10676507B2 (en) | Peptide and composition containing the same for anti-inflammation, anti-fibrosis, wound healing, and anticancer treatment | |
| CA2833515C (en) | High-affinity, dimeric inhibitors of psd-95 as efficient neuroprotectants against ischemic brain damage and for treatment of pain | |
| CN107530400A (en) | The method for the illness for destroying or removing cell is needed using the peptide treatment from NF-M | |
| JP4954215B2 (en) | Peptides with improved skin condition or periodontal disease treatment | |
| CN113683679B (en) | Recombinant I-type humanized collagen C1L6T and preparation method and application thereof | |
| CN102883736A (en) | Peptides for promoting angiogenesis and a use thereof | |
| CN109890401A (en) | The method for improving BPH symptom or preventing BPH symptom from deteriorating or being in progress | |
| CN107847551A (en) | Peptide with antivirus action and include its composition | |
| CN102482323B (en) | Novel peptide and use thereof | |
| CN101648996B (en) | Anti-myocardial remodelling polypeptide, preparation method thereof, preparations and application thereof in preparation of anti-myocardial remodelling medicament | |
| CN108794634A (en) | The long-acting human growth hormone (HGH) fusion protein and its preparation and use of recombination | |
| RU2487135C2 (en) | POLYPEPTIDES COMPETITIVELY INHIBITING Gq-PROTEIN, METHODS OF THEIR PRODUCTION AND APPLICATION | |
| JP2022513305A (en) | Hair growth promoting composition containing adiponectin-derived peptide | |
| EP2552940A2 (en) | Peptides for promoting angiogenesis and an use thereof | |
| CN110964119A (en) | Anti-malarial dimeric immunoadhesin, pharmaceutical composition and use | |
| CN101890153A (en) | Method for treating chronic liver diseases by using hepatocyte nuclear factor-4alpha (HNF4alpha) | |
| CN116082483B (en) | Preparation method and application of polypeptide capable of improving osteoporosis and enhancing bone density |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200312 Address after: Chongqing city Shapingba street 400038 gaotanyan No. 30 Co-patentee after: Chongqing Zhaokang Lihui Medical Technology Co., Ltd. Patentee after: PLA Military Medical University Co-patentee after: Chongqing Qingyang Yaoye Co., Ltd. Address before: Chongqing city Shapingba street 400038 gaotanyan No. 30 Co-patentee before: THIRD MILITARY MEDICAL UNIVERSITY, CHINESE PEOPLE'S LIBERATION ARMY, P.R. OF CHINA Patentee before: Li Xiaohui Co-patentee before: Chongqing Zhaokang Lihui Medical Technology Co., Ltd. Co-patentee before: Chongqing Qingyang Yaoye Co., Ltd. |
|
| TR01 | Transfer of patent right |