CN101648985A - Method for extracting DNA from acidic mine water bed mud in coal mine - Google Patents
Method for extracting DNA from acidic mine water bed mud in coal mine Download PDFInfo
- Publication number
- CN101648985A CN101648985A CN 200810231369 CN200810231369A CN101648985A CN 101648985 A CN101648985 A CN 101648985A CN 200810231369 CN200810231369 CN 200810231369 CN 200810231369 A CN200810231369 A CN 200810231369A CN 101648985 A CN101648985 A CN 101648985A
- Authority
- CN
- China
- Prior art keywords
- bed mud
- water bed
- coal mine
- dna
- mine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to a method for extracting DNA from acidic mine water bed mud in a coal mine. Buffer solution elution, supersonic oscillation and membrane filtration for thallus collection are adopted in the method, and cell lysis is performed to extract DNA. The extracted DNA can be applied to such molecular biology technologies as PCR amplification, DGGE and TRFLP and the like for analyzing microbial communities in the acidic mine water bed mud in the coal mine without purification. The method has the advantages of being simple and rapid, and being capable of truly reflecting diversityof different microbial populations in the acidic mine water bed mud in the coal mine.
Description
Technical field
The present invention relates to the extraction and purification of DNA, be specifically related to method for extracting DNA from acidic mine water bed mud in coal mine, belong to technical field of molecular biology.
Technical background
The colliery is in recovery process, and the spontaneous redox reaction of carrying out of tax dis environment variation because of institute's sulfur compound (being mainly pyrite) in the coal stratum can cause producing the draining of acid ore deposit.Acid ore deposit draining has low pH value and higher salinity feature, and very strong solvability and aggressiveness are arranged, and the effluent of this ore deposit can be carried a large amount of heavy metals and harmful chemical enters environment.Some objectionable impuritiess in the acid waste water of colliery also can deposit in bed mud in river, the long-time water quality that can influence the downstream water body equally again that discharges of all contaminations in the bed mud.At present colliery acid waste water is influenced the water quality of river aspect and carried out more research.
Microorganism can produce effects such as absorption, conversion, degraded, enrichment to some objectionable impuritiess in the acid waste water of colliery, at present microorganism molecular ecology microorganism molecular ecology intersects as molecular biology and microbial ecology and the subject that forms, widespread use aspect environmental science.The molecular ecology experimental technique can be understood microbial community structure in the microecosystem, diversity and functional dependency thereof, the vital role that microorganism has in the enzymatic hydrolysis system, thereby further utilize biological reinforced means, handle to fight back pollution problem.At present, little ecological Studies of colliery acid waste water bed mud seldom, major cause is that external DNA extraction test kit costs an arm and a leg, adopt autogamy reagent to be difficult to remove PCR (archaeal dna polymerase chain reaction) supressor in the bed mud (as humic acid etc.) again, and can not be to microorganism macro genome DNA complete extraction, structure of community that can not complete understanding colliery acid waste water bottom mud microbe.The patent of relative dna extraction at present has publication number: CN1401782, CN1420124, CN1198439, CN101148664, CN101173274, CN101230342 etc.The relevant patent of external DNA extraction has: IPC:C12Q1/68; C12Q1/68; IPC:C12M1/18; C12Q1/68; C12M1/16; (+1), IPC:A61K39/04; C12N1/21; C12P21/00; (+5) etc.
This patent provides a kind of employing auxiliary agent wash-out microorganism, membrane filtration, and bacterium cracked microbial DNA extracting method, present method is not appeared in the newspapers.Utilize this patent, can deepen the little ecological of colliery acid waste water bed mud understood, help that some objectionable impuritiess in the acid waste water of colliery are carried out biology in situ and handle.
Summary of the invention
The objective of the invention is applied biochemistry, Protocols in Molecular Biology, a kind of method that can the efficiently extracting and purifying DNA from acidic mine water bed mud in coal mine is provided, not high to solve conventional DNA extraction test kit to the DNA from acidic mine water bed mud in coal mine extraction efficiency, must carry out the work of DNA subsequent purification and extract the product humic acid material more, influence the problem of subsequent P CR equimolecular biologic operation, so that better application is in the multifarious molecular ecology research of acidic mine water bed mud in coal mine.
The present invention is achieved through the following technical solutions the foregoing invention purpose.
The present invention is the extraction and purification method of DNA from acidic mine water bed mud in coal mine, and concrete grammar is:
1. the collection of acidic mine water bed mud in coal mine microbiological specimens
Collect the acidic mine water bed mud in coal mine sample and add elutriant, add the phosphoric acid buffer elutriant that contains tween (tween 80 or 40) pH5.0-7.0,37 ℃ of constant temperature vibrated 30 minutes, ultra-sonic oscillation 5 minutes, and the slow speed of revolution is centrifugal, and a large amount of thalline stay in supernatant.
2. membrane filtration is collected thalline: 0.5 μ m membrane filtration supernatant, thalline stays on the film.
3.DNA extraction
Band film thalline adding lysis buffer (100-200mM Tris-HCl[pH8.0], 50-100mM EDTA[pH8.0], 50-100mM sodium phosphate[pH8.0], 1.0-1.8M NaCl), add helicase simultaneously, N,O-Diacetylmuramidase makes its final concentration all at 10ng/ml-100ng/ml.37 ℃ of constant temperature vibrated 20-60 minute, added Proteinase K again, made its final concentration all at 10ng/ml-100ng/ml, 37 ℃ of constant temperature vibrated 20-60 minute, took out to add SDS solution, and making the SDS final concentration is 0.4-1.2%, 60 ℃ constant temperature 30-60 minute, concuss was 30 seconds in per ten minutes.Add the equal-volume chloroform: primary isoamyl alcohol (V/V 24: 1) the centrifugal 5-20 of 6000-8000g minute, is drawn supernatant in extracting solution.Add 2/3rds volume Virahol room temperatures and left standstill 2-6 hour for 15-30 ℃, the centrifugal 10-20 of 10000-12000g minute, abandon supernatant, 70% washing with alcohol twice, dry under the gnotobasis.
Embodiment
1. the collection of microorganism in the acidic mine water bed mud in coal mine sample
Selected acidic mine water bed mud in coal mine site, five point samplings are got acidic mine water bed mud in coal mine, adding 100ml contains the phosphoric acid buffer elutriant of tween (tween 80 or 40) pH5.0-7.0,37 ℃ of constant temperature oscillators vibrated 30 minutes, ultra-sonic oscillation 6 minutes took out acutely to shake up every two minutes, collect the suspension liquid after the ultra-sonic oscillation, centrifugal 10 minutes of 1000g collects supernatant.
2. membrane filtration thalline:
0.5 μ m film decompress filter, collection membrane.
3. ruptured cell
Add the 4.5mL lysis buffer, 20 μ L 20mM helicases, 20 μ L 20mM N,O-Diacetylmuramidases, 37 ℃, 250rpm constant temperature vibration 30 minutes, take out adding 20 μ L 20mM Proteinase K, 37 ℃, 250rpm constant temperature vibrated 30 minutes again, add 0.5mL 20%SDS (sodium laurylsulfonate), 60 ℃ of thermostatic water-circulator bath pots water-bath one hour was taken out on the vortex oscillation device concuss in per 10 minutes 30 seconds, obtained cell pyrolysis liquid.
4.DNA extract
Change cell pyrolysis liquid over to the 20mL centrifuge tube, add 5mL analytical pure chloroform simultaneously, centrifugal 10 minutes of 8000g takes out water, repeats operation last time, notes not introducing the albumen precipitation on water and the organic phase interface.Add 2/3rds volume integrals at for the second time centrifugal gained aqueous phase and analyse pure Virahol, room temperature (25 ℃) left standstill two hours, and centrifugal 20 minutes of 10000g abandons supernatant, 5mL 70% washing with alcohol twice, and aseptic wind is done ,-20 ℃ of freezing preservations
5. agarose gel electrophoresis is measured
Last step gained DNA melts in 200 μ L sterilization ultrapure water, and 5 μ L add 0.7% sepharose (containing the pyridine of 0.4-0.5 μ g/ml bromination second), and 5V/cm electrophoresis 30 minutes detects DNA concentration.
6. microflora measures
Selecting bacteria V3 district universal primer R518 (5 ' ATTACCGCGGCTGCTGG 3 ') and F357GC (5 ' CGCCCGCCGCGCGCGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG 3 '), 50 μ L PCR systems are: 1 * PCR buffer, 2.5mM MgCl
2, every kind of dNTP of 200 μ M, 20 pmol R518 and F357GC, 2.5 unitsTaKaRa Taq DNA polymerase, 10ng DNA.PCR response procedures: 92 ℃ of 4min; 92 ℃ of 1min, 50 ℃ 30 seconds, 72 ℃ of totally 30 circulations in 2 minutes were extended 10 minutes at last.Add 10 * Loading buffer (0.05% bromjophenol blue in the 36 μ LPCR products, 0.05% dimethylbenzene green grass or young crops, 70% glycerine) 4 μ L, 10 V/M DGGE electrophoresis 10 hours, take out polyacrylamide gel, 50 μ g/ml bromination second pyridine solution-dyeds 10 minutes, ultrapure water decolouring 10 minutes, uv photography, aseptic condition downcuts different bands down, deliver to Shanghai Sangon Biological Engineering Technology And Service Co., Ltd's order-checking, sequencing primer is R518, will measure sequence and exist
Http:// www.ncbi.nlm.nih.gov/On Genbank in inquire about, know promptly in the acidic mine water bed mud in coal mine that institute comprises microbe species in the microflora.
Claims (3)
1. a method for extracting DNA from acidic mine water bed mud in coal mine the invention is characterized in: the collection of a. acidic mine water bed mud in coal mine microbiological specimens; B. membrane filtration is collected thalline; The extraction of c.DNA.
2. the collection of the described acidic mine water bed mud in coal mine microbiological specimens of claim 1 is characterized in that: the phosphoric acid buffer elutriant that contains tween (tween 80 or 40) is by vibration, and ultrasonication fully elutes thalline from soil particle.
3. the membrane filtration of the described acidic mine water bed mud in coal mine microbiological specimens of claim 1 is characterized in that: adopt the micro-filtration technology, membrane pore size is 0.5-1.0 μ m.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810231369 CN101648985A (en) | 2008-12-15 | 2008-12-15 | Method for extracting DNA from acidic mine water bed mud in coal mine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810231369 CN101648985A (en) | 2008-12-15 | 2008-12-15 | Method for extracting DNA from acidic mine water bed mud in coal mine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101648985A true CN101648985A (en) | 2010-02-17 |
Family
ID=41671327
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200810231369 Pending CN101648985A (en) | 2008-12-15 | 2008-12-15 | Method for extracting DNA from acidic mine water bed mud in coal mine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101648985A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102485891A (en) * | 2010-12-01 | 2012-06-06 | 华中农业大学 | Method for extracting total DNA from freshwater sediment |
| CN104568680A (en) * | 2015-01-14 | 2015-04-29 | 浙江大学 | Community monitoring method of microorganism carried by air particulate matters with multiple particle sizes |
| CN108276457A (en) * | 2018-04-03 | 2018-07-13 | 河南科技大学 | A kind of method that sonic oscillation extracts D-ribose from adenylate liquid waste solution |
-
2008
- 2008-12-15 CN CN 200810231369 patent/CN101648985A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102485891A (en) * | 2010-12-01 | 2012-06-06 | 华中农业大学 | Method for extracting total DNA from freshwater sediment |
| CN102485891B (en) * | 2010-12-01 | 2013-05-01 | 华中农业大学 | Method for extracting total DNA from freshwater sediment |
| CN104568680A (en) * | 2015-01-14 | 2015-04-29 | 浙江大学 | Community monitoring method of microorganism carried by air particulate matters with multiple particle sizes |
| CN108276457A (en) * | 2018-04-03 | 2018-07-13 | 河南科技大学 | A kind of method that sonic oscillation extracts D-ribose from adenylate liquid waste solution |
| CN108276457B (en) * | 2018-04-03 | 2021-03-09 | 河南科技大学 | Method for extracting D-ribose from adenosine acidolysis waste liquid by ultrasonic oscillation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jafarinejad | Forward osmosis membrane technology for nutrient removal/recovery from wastewater: Recent advances, proposed designs, and future directions | |
| Henares et al. | Demethanization of aqueous anaerobic effluents using a polydimethylsiloxane membrane module: mass transfer, fouling and energy analysis | |
| Zhang et al. | Enhanced high-solids anaerobic digestion of waste activated sludge by the addition of scrap iron | |
| Kong et al. | Sludge yield and degradation of suspended solids by a large pilot-scale anaerobic membrane bioreactor for the treatment of real municipal wastewater at 25° C | |
| Penru et al. | Characterization of natural organic matter from Mediterranean coastal seawater | |
| Adam et al. | Fractionation of anaerobic digestates by dynamic nanofiltration and reverse osmosis: An industrial pilot case evaluation for nutrient recovery | |
| Zhang et al. | Recovery of ammonium nitrogen from human urine by an open-loop hollow fiber membrane contactor | |
| CN102174509A (en) | Extraction and purification method of total plant endophyte genome DNA for colony analysis | |
| Yu et al. | Pilot-scale hybrid bio-diatomite/dynamic membrane reactor for slightly polluted raw water purification | |
| CN106396233B (en) | A kind of device of desulfurization wastewater zero-emission | |
| Vu et al. | Seawater-driven forward osmosis for pre-concentrating nutrients in digested sludge centrate | |
| Nghiem et al. | Water reclamation and nitrogen extraction from municipal solid waste landfill leachate | |
| Brinkman et al. | Evaluation of methods using celite to concentrate norovirus, adenovirus and enterovirus from wastewater | |
| Du Preez et al. | The BIOREK® concept: a hybrid membrane bioreactor concept for very strong wastewater | |
| Grundestam et al. | Wastewater treatment with anaerobic membrane bioreactor and reverse osmosis | |
| Kolehmainen et al. | Natural organic matter (NOM) removal and structural changes in the bacterial community during artificial groundwater recharge with humic lake water | |
| CN101648985A (en) | Method for extracting DNA from acidic mine water bed mud in coal mine | |
| CN102206630A (en) | Method and kit for extracting total DNA of soil and sediment | |
| CN101712953A (en) | DNA extracting method for evaluating community diversity of the intestinal microorganisms of animals | |
| Huang et al. | Microbial community study in newly established Qingcaosha Reservoir of Shanghai, China | |
| Zhou et al. | Structural characteristics of cake layer in membrane bioreactor with chromate exposure | |
| Smith et al. | Role of membrane biofilm in psychrophilic anaerobic membrane bioreactor for domestic wastewater treatment | |
| Hafuka et al. | Phosphorus compounds in the dissolved and particulate phases in urban rivers and a downstream eutrophic lake as analyzed using 31P NMR | |
| CN103333883B (en) | A kind of high efficiency extraction is used for the method for the groundwater microbial DNA of pcr amplification | |
| Pradhan et al. | Experimental evaluation of microbial metal uptake by individual components of a microbial biosorption system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20100217 |