CN101646782A

CN101646782A - The transgenic plant event detection

Info

Publication number: CN101646782A
Application number: CN200880002263A
Authority: CN
Inventors: M·H·G·范登比尔克; A·P·N·R·利埃旺; A·莱温达; E·G·姆邦戈罗姆贝拉; E·巴尔博-皮耶努瓦尔; M·J·S·斯奈耶斯
Original assignee: Institute For Scientific Public Health (iph)
Current assignee: Institute For Scientific Public Health (iph)
Priority date: 2007-01-29
Filing date: 2008-01-29
Publication date: 2010-02-10

Abstract

The present invention relates to detection to the material that is derived from the transgenic plant incident.Particularly, the invention provides the existence that is used for the test sample genetic stocks or method, reagent, test kit and the control material of disappearance, described genetic stocks is derived from or owing to selected transgenic plant incident.

Description

The transgenic plant event detection

Technical field

The present invention relates to be derived from the detection of the material of transgenic plant incident.Particularly, the invention provides the existence that is used for the test sample genetic stocks or method, reagent, test kit and the control material of disappearance, the transgenic plant incident that described genetic stocks is derived from and is attributable to select.

Background technology

The plant of the organism of genetic modification (GMO), particularly genetic modification has occupied critical role in the production and selling of agricultural and food and feed.

Yet, owing to there be the concern of GMO to environment and consumer health's influence, the introducing of new GMO needs rules examining usually, comprising the majority state of European Union, comprising GMO or originate from the food of GMO and feeds product self all will be through authorizing and forcing label (referring to for example: regulations (EC) the 829/2003rd.Off J Eur Communities:Legis.2003, L268:1-23; Regulations (EC) the 1830/2003rd.Off?J?Eur?Communities：Legis.2003，L268：24-28)。

Therefore, follow the trail of in the environment, in the cultivation process and the GMO in food or the fodder production chain is basic for Environmental risk assessment,, and satisfy or the observation (comprising the GMO product labelling) of the checking mandatory rules of law also is essential for the protection consumer confidence.

Therefore need to obtain such method, described method can be determined in the running stores of for example food and feedstuff raw material, composition and/or processing, and GMO perhaps causes or be derived from existence, character and/or the quantity of the material of GMO.Aspect this, be very effective based on the method for DNA, important reasons is that DNA generally handles than the food-processing that other molecules (for example protein) more tolerate physics and chemistry.For example, confirmed that the DNA that is derived from GMO for indication exists, real-time polymerase chain reaction (PCR) is the special and sensitive technology that is used for quantitative described nucleic acid.

Can obtain such mensuration, be derived from the existence or the disappearance of the genetic stocks of selected Plant Transformation incident in the final conclusion sample that described mensuration can be clear and definite.Usually, this type of mensuration can detect existence unique, incident-specificity nucleotide sequence, and described sequence finds in the target plant transformation event, and is not present in other incidents.For example, can there be this type of special nucleotide sequence in the joint in the gene construct sequence of the native gene group sequence of GMO and conversion, and the genome that described joint is positioned at described gene construct inserts site; For example, utilize the special primer be positioned at the joint flank, detection can relate to described joint pcr amplification (referring to for example Hernandez etc., 2003.Transgenic Res 12:179-189; Hernandez etc., 2004.J Cereal Sci 39:99-107; Berdal etc., 2001.Eur Food Res Technol213:432-438; Nielsen etc., 2004.Eur Food Res Technol 219:421-427; Or Ronning etc., 2003.Eur Food Res Technol 216:347-354).

Yet these incident-specific assay as the expensive reagent box production that can only use the limited number of time test, are limited to the material that detects individual event, and use very specific reaction conditions usually usually.But the GMO quantity with listing that has occurred, authorize is keeping increasing.Therefore, the GMO of the clear and definite product of random sample really forms, and needs in principle each sample is carried out ever-increasing independently incident-special mensuration, both labor intensive, consuming cost again.

Thus, because the character as a result of incident-special mensuration determines that this type of mensuration is used in hope always, thereby need use this type of mensuration in more effective and directed mode, for example, improve the detectivity that GMO detects, as aspect time cost, cost and the labour intensity.

Summary of the invention

On the one hand, the invention provides method, reagent, test kit and control material, can solve the needs of one or more this areas discussed above.

Generally speaking, invention provides method, reagent, test kit and the control material of improvement, is used for the material that test sample is derived from GMO, and preferred source is from the material of the plant of heredity modification.

More particularly, the contriver recognizes, by some particular sequence feature to be determined in the careful selection sample---wherein, described sequence signature needs not be incident-special, can in fact share by two or more incidents---can infer whether potential contains the material that is derived from one or more transformation events to sample, perhaps opposite, whether sample does not contain the material that is derived from one or more these type of transformation events.Therefore, the mensuration of invention can provide the important indication to the potential GMO content of sample, when thereby the material that is derived from one or more specific transformation events in the favourable minimizing verification sample existed, needed subsequent detection (for example: the quantity special mensuration of incident); Can improve cost, time and/or the labor force-efficient of GMO detection method conversely.For example, the mensuration of invention can reduce the quantity of the incident-special mensuration that needs when the GMO that characterizes sample forms greatly.

The assessment that the contriver is also conscientious known, the commercially important and/or transformation event of authorizing, with the sequence signature of selecting to be used for to measure at sample, for example, reduce the quantity of the independent detection reaction of every duplicate samples needs, guaranteed enough information simultaneously according to GMO system spectrum of the present invention (profiling).

The present invention is incorporated into its each different aspect with above-mentioned relevant fact.

Therefore, aspect particularly preferred (aspect herein " A1 "), invention relates to such method, is derived from the existence or the disappearance of the material of one or more transgenic plant incidents in the described method sample for reference, and it may further comprise the steps:

(1) existence of test sample amplifying nucleic acid or disappearance, described nucleic acid comprise or are made up of following:

A) " Zm ": Zea mays (Zea mays) taxonomical unit source and special nucleic acid, preferred Zea Zea mays the source with special nucleic acid,

B) " Bn ": colea (Brassica napus) taxonomical unit source and special nucleic acid,

C) " Gm ": soybean (Glycine max) taxonomical unit source and special nucleic acid, and

A kind of or more than a kind of or all following nucleic acid that is selected from:

D) " p35S ": be derived from the nucleic acid of the 35S promoter of cauliflower mosaic virus,

E) " tNOS ": be derived from the nucleic acid of 3 ' terminator of agrobacterium tumefaciens (Agrobacterium tumefaciems) rouge alkali synthetase gene,

F) " Cry1Ab ": be derived from the nucleic acid of bacillus thuringiensis (Bacillus thuringiensis) crystal protein gene Cry1Ab,

G) " PAT/bar ": be derived from the nucleic acid of phosphinothricin acetyl transferase (PAT) the gene bar of streptomyces hygroscopicus (Streptomyces hygroscopicus),

H) " PAT/pat ": be derived from phosphinothricin acetyl transferase (PAT) the gene pat that produces green streptomycete (Streptomycesviridochromogenes) nucleic acid and

I) " CP4-EPSPS ": the nucleic acid that is derived from 5-enolpyrul-shikimate acid-3-phosphate synthase (5-Enol-pyruvylshikimate-3-phosphate synthase) EPSPS gene of edaphic bacillus (Agrobacterium) species CP4; With

(2) infer existence or the disappearance that is derived from the material of one or more transgenic plant incidents in the sample, described incident for example is selected from the incident in the group (group) that comprises following incident or be made up of following incident: incident Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, its hybridization, and dependent event; Incident Topas 19/2, MS1, RF1, RF2, RF3, MS8, GT73, T45, LiberatorpHoe6/Ac, GS40/90pHoe6/Ac, its hybridization comprises MS1/RF1, MS1/RF2, MS1/RF3, and dependent event; Incident MON 40-3-2, MON89788, A2704-12, A5547-127, its hybridization, and dependent event.

The A1 aspect can study sample in may the existing or lack of material, described material is implemented the detection step of relatively limited quantity simultaneously from a plurality of transgenic plant incidents that belong to different plant classification units.Advantageously, the transgenic plant incident that method by the A1 aspect detects has contained major part, even most at present (for example in Europe) obtain the authorization and/or business-like transgenic plant incident, that is, and and the transgenic plant incident that in for example environment or commercial sample, runs into especially easily.Therefore, this aspect of invention provides unfastidious relatively mensuration, is used to check the relevant transgenic plant incident of suitable wide region.

Preferably, the step of A1 aspect (1) relates to the existence or the disappearance of test sample amplifying nucleic acid, all nucleic acid that described nucleic acid comprises as defined above a)-i) enumerates or be made up of above-mentioned nucleic acid.The improvement that it is favourable the information that obtains by specimen, make it possible to infer potential existence or disappearance from the material of quite a large amount of transgenic plant incidents.

And in the step aspect A1 (2), detect the transgenic plant incident that to predict specific existence especially, should be appreciated that, other incident, the transgenic event that comprises any future that will produce, also can detect, if its belong to a)-c) definition taxonomical unit and comprise d)-i) definition one or more nucleic acid.As make suitable modification, this observation also is applicable to the incident that detects the following any aspect of invention.

Simultaneously, the method for A1 aspect makes it possible to belong in the while sample for reference existence or the disappearance of the transgenic plant incident of at least 3 kinds of different taxonomical units, and the contriver also imagines makes method be applicable to single taxonomical unit.If only need the information of specific classification unit, just can effectively reduce the quantity of detection of nucleic acids step.

Therefore, aspect other of invention (" A2 "), provide in the sample for reference existence of material or the method for disappearance, described material source may further comprise the steps from one or more Zea mays transgenic plant incidents:

(1) existence of test sample amplifying nucleic acid or disappearance, described nucleic acid comprise or are made up of following nucleic acid: the nucleic acid of enumerating in a) defined above, and be selected from d defined above)-a kind of, more than one or the whole nucleic acid enumerated in i); With

(2) infer existence or the disappearance that is derived from the material of one or more Zea mays transgenic plant incidents in the sample, described incident for example is selected from the incident in the group that comprises following incident or be made up of following incident: incident Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, its hybridization, and dependent event.

Preferably, the step of A2 aspect (1) can relate to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises or is made up of following nucleic acid: defined above a) and d)-all nucleic acid of enumerating in i).It has increased the information that obtains by specimen, makes it possible to infer potential existence or disappearance from the material of more substantial relatively Zea mays transgenic plant incident.

Aspect other of invention (" A3 "), the existence of material or the method for disappearance are provided in the sample for reference, described material source may further comprise the steps from the transgenic plant incident of one or more rapes (oilseed rape):

(1) existence of test sample amplifying nucleic acid or disappearance, described nucleic acid comprise or are made up of following nucleic acid: the nucleic acid of enumerating b defined above), and be selected from d defined above)-a kind of, more than one or the whole nucleic acid enumerated in i); With

(2) infer existence or the disappearance that is derived from the material of one or more rape transgenic plant incidents in the sample, described incident for example is selected from the incident in the group that comprises following incident or be made up of following incident: incident Topas 19/2, MS1, RF1, RF2, RF3, MS8, GT73, T45, Liberator pHoe6/Ac, GS40/90pHoe6/Ac, its hybridization comprises MS1/RF1, MS1/RF2, MS1/RF3, and dependent event.

B defined above) and all nucleic acid of enumerating d)-i) preferably, the step of A3 aspect (1) can relate to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises or is made up of following nucleic acid:.It has increased the information that obtains by specimen, makes it possible to infer potential existence or disappearance from the material of more substantial relatively rape transgenic plant incident.

In another preferred embodiment, the step of A3 aspect (1) relates to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises or is made up of following nucleic acid: b defined above) and d), e) and g)-i) in all nucleic acid of enumerating.It should be noted that many rape incidents (for example incident of special narration in the step of A3 aspect (2)) can not comprise f defined above) in the nucleic acid enumerated.Therefore, from the step (1) of A3 aspect, omit f) the described nucleic acid enumerated, can reduce the test number under the condition of loss of information not.

Aspect other of invention (" A4 "), the existence of material or the method for disappearance are provided in the sample for reference, described material source may further comprise the steps from one or more soybean transgene plant incidents:

(1) existence of test sample amplifying nucleic acid or disappearance, described nucleic acid comprise or are made up of following nucleic acid: the nucleic acid of enumerating c defined above), and be selected from d defined above)-a kind of, more than one or the whole nucleic acid enumerated in i); With

(2) infer existence or the disappearance that is derived from the material of one or more soybean transgene plant incidents in the sample, described incident for example is selected from the incident in the group that comprises following incident or be made up of following incident: incident MON 40-3-2, MON89788, A2704-12, A5547-127, its hybridization, and dependent event.

C defined above) and all nucleic acid of enumerating d)-i) preferably, the step of A4 aspect (1) can relate to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises or is made up of following nucleic acid:.It has increased the information that obtains by specimen, makes it possible to infer potential existence or disappearance from the material of more substantial relatively soybean transgene plant incident.

In another preferred embodiment, the step of A4 aspect (1) relates to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises or is made up of following nucleic acid: c defined above) and d), e), h) and i) in all nucleic acid of enumerating.It should be noted that many soybean events (for example incident of special narration in the step of A4 aspect (2)) can not comprise f defined above) and g) in the nucleic acid enumerated.Therefore, from the step (1) of A4 aspect, omit f) and the described nucleic acid g) enumerated, can reduce the test number under the condition of loss of information not.

Should also be understood that other aspects can instruct any two combination in the above-mentioned A2-A4 aspect.For example, when being intended to from selected taxonomical unit, detect transgenic event, can advantageously reduce the quantity of test activity.

Therefore, aspect other of invention (" A5 "), provide in the sample for reference existence of material or the method for disappearance, described material source may further comprise the steps from one or more Zea mayss and/or rape transgenic plant incident:

(1) existence of test sample amplifying nucleic acid or disappearance, described nucleic acid comprise or are made up of following nucleic acid: defined above a) and b) in the nucleic acid enumerated, and be selected from d defined above)-a kind of, more than one or the whole nucleic acid enumerated in i); With

(2) infer existence or the disappearance that is derived from the material of one or more Zea mayss and/or rape transgenic plant incident in the sample, described incident for example is selected from the incident in the group that comprises following incident or be made up of following incident: incident Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, its hybridization, and dependent event; With incident Topas 19/2, MS1, RF1, RF2, RF3, MS8, GT73, T45, LiberatorpHoe6/Ac, GS40/90pHoe6/Ac, its hybridization comprises MS1/RF1, MS1/RF2, MS1/RF3, and dependent event.

For the above reasons, the step of A5 aspect (1) can preferably relate to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises or is made up of following nucleic acid: defined above a), b) and d)-i) in all nucleic acid of enumerating.

(" A6 ") in yet another aspect, invention provides in the sample for reference existence of material or the method for disappearance, and described material source may further comprise the steps from one or more Zea mayss and/or soybean transgene plant incident:

(1) existence of test sample amplifying nucleic acid or disappearance, described nucleic acid comprise or are made up of following nucleic acid: defined above a) and c) in the nucleic acid enumerated, and be selected from d defined above)-a kind of, more than one or the whole nucleic acid enumerated in i); With

(2) infer existence or the disappearance that is derived from the material of one or more Zea mayss and/or soybean transgene plant incident in the sample, described incident for example is selected from the incident in the group that comprises following incident or be made up of following incident: incident Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, its hybridization, and dependent event; With incident MON 40-3-2, MON89788, A2704-12, A5547-127, its hybridization, and dependent event.

For the above reasons, the step of A6 aspect (1) can preferably relate to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises or is made up of following nucleic acid: defined above a), c) and d)-i) in all nucleic acid of enumerating.

(" A7 ") in yet another aspect, invention provides in the sample for reference existence of material or the method for disappearance, and described material source may further comprise the steps from one or more rapes and/or soybean transgene plant incident:

B defined above) and the nucleic acid of enumerating c) (1) existence of test sample amplifying nucleic acid or disappearance, described nucleic acid comprise or are made up of following nucleic acid:, and be selected from d defined above)-a kind of, more than one or the whole nucleic acid enumerated in i); With

(2) infer existence or the disappearance that is derived from the material of one or more rapes and/or soybean transgene plant incident in the sample, described incident for example is selected from the incident in the group that comprises following incident or be made up of following incident: incident Topas 19/2, MS1, RF1, RF2, RF3, MS8, GT73, T45, Liberator pHoe6/Ac, GS40/90pHoe6/Ac, its hybridization, comprise MS1/RF1, MS1/RF2, MS1/RF3, and dependent event; With incident MON 40-3-2, MON89788, A2704-12, A5547-127, its hybridization, and dependent event.

For the above reasons, the step of A7 aspect (1) can preferably relate to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises or is made up of following nucleic acid: b defined above), c) and d)-i) in all nucleic acid of enumerating.

In another preferred embodiment, the step of A7 aspect (1) relates to the existence or the disappearance of test sample amplifying nucleic acid, described nucleic acid comprises or is made up of following nucleic acid: b defined above), c) and d), e) and g)-i) in all nucleic acid of enumerating, that is, do not detect f) nucleic acid enumerated.

Therefore, (" A8 ") in yet another aspect, invention provides in the sample for reference existence of material or the method for disappearance, and described material source may further comprise the steps from one or more Zea mayss and/or rape and/or soybean transgene plant incident:

(1) existence of test sample amplifying nucleic acid or disappearance, described nucleic acid comprises or is made up of following nucleic acid: defined above a), b) and c) in a kind of, more than one or all nucleic acid and the d defined above that enumerate)-a kind of, more than one or the whole nucleic acid enumerated in i); With

(2) infer existence or the disappearance that is derived from the material of one or more transgenic plant incidents in the sample, described incident for example is selected from the incident in the group that comprises following incident or be made up of following incident: incident Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, its hybridization, and dependent event; Incident Topas 19/2, MS1, RF1, RF2, RF3, MS8, GT73, T45, Liberator pHoe6/Ac, GS40/90pHoe6/Ac, its hybridization comprises MS1/RF1, MS1/RF2, MS1/RF3, and dependent event; With incident MON 40-3-2, MON89788, A2704-12, A5547-127, its hybridization, and dependent event.

For the above reasons, the step of A8 aspect (1) can preferably relate to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises d defined above)-all nucleic acid of enumerating in i).

As explained above, above the method for A1-A8 aspect very is fit to be derived from the test sample existence or the disappearance of the material of relevant transgenic plant incident, has for example authorized and/or the conventional incident of using.Yet, should be appreciated that advantageously, described method also is flexibly, in embodiments, can better assess the existence or the disappearance of the material that is derived from other transgenic events, for example above there is not the incident of special narration in the A1-A8 aspect step (2).Therefore, can collect the more information of forming about sample.

Therefore, in embodiments, above the step (1) of A1, A2, A5, A6 or A8 aspect can also comprise the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid is j) " mCryA ": the nucleic acid of crystal protein gene Cry3A that is derived from the modification of bacillus thuringiensis; And arbitrarily in the step (2) of all respects the event group of definition also comprise the Zea mays event mir 604, the hybridization of itself and other Zea mays incident, and the incident relevant with MIR604.

In other embodiments, any above step (1) of A1, A2, A5, A6 or A8 aspect can also comprise the existence or the disappearance of test sample amplifying nucleic acid, described nucleic acid is k) " cordapA ": the insensitive dihydrodipicolinic acid synthase of Methionin (the dihydrodipicolinate synthase that is derived from corynebacterium glutamicum (Corynebacterium glutamicum), cDHDPS) nucleic acid of gene cordapA, and/or i) " Glb1 ": be derived from the nucleic acid of zeistic Glb1 promotor one or its both; And arbitrarily in the step (2) of all respects the event group of definition also comprise Zea mays incident LY038, the hybridization of itself and other Zea mays incident, and the incident relevant with LY038.

In other embodiments, any above step (1) of A1, A2, A5, A6 or A8 aspect can also comprise the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid is m) " Cry3Bb1 ": the nucleic acid that is derived from the crystal protein gene Cry3Bb1 of bacillus thuringiensis; And arbitrarily in the step (2) of all respects the event group of definition also comprise Zea mays incident MON88017, the hybridization of itself and other Zea mays incident, and the incident relevant with MON88017.

Therefore, in embodiments, arbitrarily above the step (1) of A1, A2, A5, A6 or A8 aspect can also comprise j defined above in the test sample)-existence or the disappearance of a kind of, more than one or all nucleic acid enumerated in m); And arbitrarily in the step (2) of all respects the event group of definition also comprise among Zea mays event mir 604, LY038 and the MON88017 a kind of, more than one or all, with and with the hybridization and the relative incident of other Zea mays incidents.Yet, though detect j as defined above)-each nucleic acid of m) enumerating, the sample detection of improvement can be provided, in the test sample from the existence of the material of Zea mays event mir 604, LY308 and/or MON88017, but, the detected result of the nucleic acid of enumerating d defined above)-i) can allow deduction (referring to table 3) is made in the potential existence from the material of described event mir 604, LY308 and/or MON88017 in the sample.

In embodiments, any above step (1) of A1, A3, A5, A7 or A8 aspect can also comprise the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid is n) " Bxn ": be derived from the nucleic acid that Klebsiella pneumoniae belongs to the nitrilase gene Bxn of klebsiella pneumoniae ozaenae (Klebsiella pneumoniae ssp.ozaenae); And arbitrarily in the step (2) of all respects the event group of definition also comprise rape incident OXY235, the hybridization of itself and other rape incident, and the incident relevant with OXY235.Yet, though detect n as defined above) in the nucleic acid enumerated, the sample detection of improvement can be provided, in the test sample from the existence of the material of rape incident OXY235, but, the detected result of the nucleic acid of enumerating d defined above)-i) can allow to make deduction (referring to table 3) with regard to the potential existence from the material of described incident OXY235 in the sample.

Therefore, (" A9 ") in one aspect, invention provides in the sample for reference existence of material or the method for disappearance, and described material source may further comprise the steps from one or more Zea mayss and/or rape and/or soybean transgene plant incident:

(1) existence of test sample amplifying nucleic acid or disappearance, described nucleic acid comprise or are made up of following nucleic acid:

-be selected from defined above a), b) and c) in enumerate a kind of, more than one or all nucleic acid and

-be selected from d defined above)-enumerate in i) a kind of, more than one or all nucleic acid and

-optional, be selected from j defined above)-a kind of, more than one or the whole nucleic acid enumerated in n); With

(2) infer existence or the disappearance that is derived from the material of one or more transgenic plant incidents in the sample, described incident for example is selected from the incident in the group that comprises following incident or be made up of following incident: incident Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, MIR604, LY038 and MON88017, its hybridization, and dependent event; Incident Topas 19/2, MS1, RF1, RF2, RF3, MS8, GT73, T45, Liberator pHoe6/Ac, GS40/90pHoe6/Ac, OXY235, its hybridization comprises MS1/RF1, MS1/RF2, MS1/RF3, and dependent event; With incident MON40-3-2, MON89788, A2704-12, A5547-127, its hybridization, and dependent event.

For the above reasons, the step of A9 aspect (1) can preferably relate to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises d defined above)-all nucleic acid of enumerating in i).

In other advantageous embodiment, above the method for A1-A8 aspect can also extra assessment be derived from the potential existence or the disappearance of the material of the transgenic event that belongs to other taxonomical units.

Therefore, in embodiments, the step (1) of A1-A8 aspect (the perhaps embodiment of aspect mentioned above) above arbitrarily can also comprise the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid is o) " Or ": rice (Oryza sativa) taxonomical unit source or special nucleic acid; And arbitrarily in the step (2) of all respects the event group of definition also comprise one, more than one or all rice incident LL62, LL06 and LL601, its hybridization, and relevant incident.

In other embodiments, the step (1) of A1-A8 aspect (the perhaps embodiment of aspect mentioned above) above, can also comprise the existence or the disappearance of test sample amplifying nucleic acid, described nucleic acid is p) " Bv ": beet (Beta vulgaris) taxonomical unit source or special nucleic acid; And arbitrarily in the step (2) of all respects the event group of definition also comprise one, more than one or all beet incident T120-7, H7-1 and A5-15, its hybridization, and relevant incident.

In other embodiments, the step (1) of A1-A8 aspect (the perhaps embodiment of aspect mentioned above) above, can also comprise the existence or the disappearance of test sample amplifying nucleic acid, described nucleic acid is q) " Gs ": Gossypium (Gossypium) source or special nucleic acid; And arbitrarily in the step (2) of all respects the event group of definition also comprise one, more than one or all cotton event LLcotton 25, MON 1445, MON 531, MON15985, its hybridization, and relevant incident.

Further, the last period, the step (1) of any embodiment can also comprise the existence or the disappearance of one or more nucleic acid in the test sample, described nucleic acid is r) " Cry1Ac ": be derived from the nucleic acid of the crystal protein gene Cry1Ac of bacillus thuringiensis, and/or s) " Cry2Ab2 ": the nucleic acid that is derived from the crystal protein gene Cry2Ab2 of bacillus thuringiensis; And the detection cotton event MON 531 that the event group of definition can be especially good in the step (2) and one of MON15985 or its both, with and with the hybridization of other cotton events, and relevant incident.

In other embodiments, the step (1) of A1-A8 aspect (the perhaps embodiment of aspect mentioned above) above, can also comprise the existence or the disappearance of test sample amplifying nucleic acid, described nucleic acid is t) " St ": potato (Solanum tuberosum) source or special nucleic acid; And the event group of the middle definition of the step (2) of all respects also comprises potato incident EH92-527-1 and dependent event thereof arbitrarily.

Further, the last period, the step (1) of any embodiment can also comprise the existence or the disappearance of test sample amplifying nucleic acid, described nucleic acid is u) " GBSS ": be derived from the nucleic acid of starch small grain (granule) the bonded starch synthase gene Gbss of potato, further improved detection confidence from the material of described incident EH92-527-1.

Should be appreciated that, can implement aforesaid method, make it possible to detect the incident of expectation and reduce labor force's input with multiple suitable combination.

Therefore, (" A10 ") in one aspect, invention provides in the sample for reference existence of material or the method for disappearance, described material source may further comprise the steps from one or more Zea mayss and/or rape and/or soybean and/or rice and/or beet and/or cotton and/or potato transgenic plant incident:

-be selected from defined above a), b), c), o), p), q) and t) in enumerate a kind of, more than one or all nucleic acid and

-optional, be selected from j defined above)-n), r), s) and u) in a kind of, more than one or the whole nucleic acid enumerated; With

(2) infer existence or the disappearance that is derived from the material of one or more transgenic plant incidents in the sample, described incident for example is selected from the incident in the group that comprises following incident or be made up of following incident: incident Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, MIR604, LY038 and MON88017, its hybridization, and dependent event; Incident Topas 19/2, MS1, RF1, RF2, RF3, MS8, GT73, T45, Liberator pHoe6/Ac, GS40/90pHoe6/Ac, OXY235, its hybridization comprises MS1/RF1, MS1/RF2, MS1/RF3, and dependent event; Incident MON 40-3-2, MON89788, A2704-12, A5547-127, its hybridization, and dependent event; Incident LL62, LL06 and LL601, its hybridization, and relevant incident; Incident T120-7, H7-1 and A5-15, its hybridization, and relevant incident; Incident LL cotton 25, MON 1445, MON 531, MON15985, its hybridization, and relevant incident; With incident EH92-527-1 and dependent event thereof.

For the above reasons, the step of A10 aspect (1) can preferably relate to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises d defined above)-all nucleic acid of enumerating in i).

At more preferably (" A11 ") aspect one, invention provides in the sample for reference existence of material or the method for disappearance, described material source may further comprise the steps from one or more Zea mayss and/or rape and/or soybean and/or rice and/or beet and/or cotton and/or potato transgenic plant incident:

(2) infer existence or the disappearance that is derived from the material of one or more transgenic plant incidents in the sample, described incident for example is selected from the incident in the group that comprises following incident or be made up of following incident: incident Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, optional MIR604, LY038 and MON88017, its hybridization, and dependent event; Incident Topas 19/2, MS1, RF1, RF2, RF3, MS8, GT73, T45, Liberator pHoe6/Ac, GS40/90pHoe6/Ac, optional OXY235, its hybridization comprises MS1/RF1, MS1/RF2, MS1/RF3, and dependent event; Incident MON 40-3-2, MON89788, A2704-12, A5547-127, its hybridization, and dependent event; Incident LL62, LL06 and LL601, its hybridization, and relevant incident; Incident T120-7, H7-1 and A5-15, its hybridization, and relevant incident; Incident LL cotton 25, MON 1445, MON 531, MON15985, its hybridization, and relevant incident; With incident EH92-527-1 and dependent event thereof.

For the above reasons, the step of A11 aspect (1) can preferably relate to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises d defined above)-all nucleic acid of enumerating in i).

Preferably, in any method aspect the A1-A11 above, perhaps in any embodiment of described aspect, utilize the amplification that is included in the amplicon in each nucleic acid to come the existence or the disappearance of test sample amplifying nucleic acid, for example preferably utilize PCR, more preferably utilize PCR in real time.

In order effectively to use pcr amplification in aforesaid method, the inventor is through careful search and test, thereby it is right to have selected in described method particularly advantageous primer and primer.

It is right to have enumerated in the table 1 through the preferred primer of differentiating.They have following significant advantage especially.Primer shows essentially identical or gratifying similar annealing temperature, thereby can be in identical temperature cycle condition, and in identical instrument different nucleic acid is implemented pcr amplification thus.The flux that this has promoted method has greatly reduced the quantity of needed labor force, handled thing and instrument.Primer is to producing the amplicon of about 100bp, and therefore, even the most of fragmentation of the genetic stocks in the sample, the target nucleic acid that also can therefrom increase is for example under the situation of food of processing or feed.Primer and primer be to showing enough specific amplifications, and be fit to the sensitivity of amplification in real time.In addition, in order to guarantee to invent the method that provides and the sensitivity and the homogeneity of test kit, the right design of primer and primer is in order to circulate and to use under the template conditions of 10000 copies at 40, produce the fluorescence of at least 2500 relative fluorescence units (RFU), wherein, different primers are preferably placed in 3 times of intervals the fluorescent value that is produced.In addition, each primer of design is ignored the potential sequence difference (for example: because optimizing codon is used) that exists in the described nucleic acid between this type of incident to increasing from the various nucleic acid of nearly all object event.

Table 1. is by PCR, be used for detecting defined above a)-i), o), p), q) and the favourable primer of the nucleic acid t) enumerated right.

Target nucleic acid	Primer
Target nucleic acid	Primer	??″Zm″	??Fwd：5′TCTCTTCCTCCTTTAGAGCTACCACTA?3′(SEQ?ID?NO：56)??Rev：5′AATCGATCCAAAGCGAGATGA?3′(SEQ?ID?NO：57)
??″Bn″	??Fwd：5′CAGCTCAACAGTTTCCAAACGA?3′(SEQ?ID?NO：24)??Rev：5′CGACCAGCCTCAGCCTTAAG?3′(SEQ?ID?NO：25)	??″Zm″
??″Bn″		??″Gm″	??Fwd：5′AACCGGTAGCGTTGCCAG?3′(SEQ?ID?NO：58)??Rev′：5′AGCCCATCTGCAAGCCTTT?3′(SEQ?ID?NO：59)
??″p35S″	??Fwd：5′AAAGCAAGTGGATTGATGTGATA?3′(SEQ?ID?NO：60)??Rev：5′GGGTCTTGCGAAGGATAGTG?3′(SEQ?ID?NO：61)	??″Gm″
??″p35S″		??″tNOS″	??Fwd：5′-GATTAGAGTCCCGCAATTATACATTTAA-3′(SEQ?ID?NO：9)??Rev：5′-TTATCCTAGKTTGCGCGCTATATTT-3′(SEQ?ID?NO：10)
??″Cry1Ab″	??Fwd：5′-ACCGGTTACACTCCCATCGA-3′(SEQ?ID?NO：11)??Rev：5′-CAGCACCTGGCACGAACTC-3′(SEQ?ID?NO：12)????????	??″tNOS″
??″Cry1Ab″		??″PAT/bar″	??Fwd：5′-CGTCAACCACTACATCGAGACAA-3′(SEQ?ID?NO：13)??Rev：5′-GTCCACTCCTGCGGTTCCT-3′(SEQ?ID?NO：14)
??″PAT/pat″	??Fwd：5′-CCGCGGTTTGTGATATCGTT-3′(SEQ?ID?NO：15)??Rev：5′-TCTTGCAACCTCTCTAGATCATCAA-3′(SEQ?ID?NO：16)	??″PAT/bar″
??″PAT/pat″		??″CP4-EPSPS″	??Fwd：5′GCATGCTTCACGGTGCAA?3′(SEQ?ID?NO：22)??Rev：5′GGACCTGTGGGAGATAGACTTGTC?3′(SEQ?ID?NO：23)??Rev?1：5′TGAAGGACCGGTGGGAGAT?3′(SEQ?ID?NO：62)??Rev?2：5′TGAAGGACCTGTGGGAGAT?3′(SEQ?ID?NO：63)
??″Or″	??Fwd′：5′GCTTAGGGAACAGGGAAGTAAAGT?3′(SEQ?ID?NO：51)??Rev：5′CTTAGCATAGTCTGTGCCATCCA?3′(SEQ?ID?NO：21)	??″CP4-EPSPS″
??″Or″		??″Bv″	??Fwd：5′GACCTCCATATTACTGAAAGGAAG?3′(SEQ?ID?NO：64)??Rev：5′GAGTAATTGCTCCATCCTGTTCA?3′(SEQ?ID?NO：65)
??″Gs″	??Fwd：5′AGTTTGTAGGTTTTGATGTTACATTGAG?3′(SEQ?ID?NO：66)??Rev：5′GCATCTTTGAACCGCCTACTG?3′(SEQ?ID?NO：67)	??″Bv″
??″Gs″		??″St″	??Fwd：5′GGACATGTGAAGAGACGGAGC?3′(SEQ?ID?NO：68)??Rev：5′CCTACCTCTACCCCTCCGC?3′(SEQ?ID?NO：69)

Therefore, invention provides the method for each definition in the A1-A11 aspect as mentioned, perhaps any embodiment of described aspect, wherein, utilize in pcr amplification and the table 1 each primer that shows right, in the test sample as defined above a)-i), o), p), q) and t) in the existence or the disappearance of the nucleic acid enumerated.

When table 1 pair a kind of specific nucleic acid (for example: " CP4-EPSPS ") when having enumerated more than one forwards that are used to increase and/or reverse primer, any or any built up section of any or any combination and described reverse primer of described forward primer can be used, obtain amplification.

Should be appreciated that, though the primer sequence of enumerating in the table 1 provides the ideal sequence of optimizing amplification,, when using the variant primer, also can implement the present invention fully, the primer in the described variant primer phase his-and-hers watches 1 shows the sequence variation of certain limit.

Therefore, above-mentioned aspect and embodiment have also contained such method, wherein, detect target nucleic acid by the pcr amplification that uses the variant primer, described variant primer comprises that a place or many places sequence change, for example a place or many places disappearance, insertion and/or replacement with respect to the corresponding primer of enumerating in the table 1, in the change scope, described variant primer/primer is to still realizing its abundant amplification of amplicon separately.Preferably, the primer that this type of variant primer and table 1 are enumerated shows at least 85%, and more preferably at least 90%, more preferably at least 95%, more preferably at least 96%, at least 97%, at least 98% or at least 99% sequence identity.For example can utilizing, basic local comparison research tool (BLAST) carries out sequence alignment, and definite sequence identity, described instrument is described in people such as Altschul at first, among 1990 (the J MoI Biol 215:403-10), " Blast 2sequences " algorithm of describing among Tatusova and the Madden 1999 (FEMS Microbiol Lett 174:247-250) for example.

Be also to be understood that primer or its variant enumerated in the table 1 can advantageously derive.For example, can the described primer of mark or its variant, make it possible to detect the product that is increased, for example in the PCR in real time amplification.Therefore, this type of derivatization can be responsible for for example introducing one or more mark parts and/or one or more extention (for example: cancellation part, FRET part etc.), optional when needs, the Mdification primer sequence makes it can introduce the work that described one or more part and/or described one or more part can be correct.Those skilled in the art generally are known as the mark purpose and the right method of Mdification primer and primer.Institute's deutero-primer and primer be to can be effective especially in PCR in real time, particularly needs to follow the trail of two or more not during the amplified production of isolabeling in multiplex amplification reaction.

Therefore, above-mentioned aspect and embodiment have also contained such method, wherein, utilize primer and the primer enumerated in the table 1 right, and variant, detect target nucleic acid by pcr amplification.

As an example, aspect preferably (" A12 "), invention provides in the sample for reference existence of material or the method for disappearance, described material source may further comprise the steps from one or more transgenic plant incidents (particularly one or more Zea mayss and/or rape and/or soybean and/or rice and/or beet and/or cotton and/or potato transgenic plant incident):

Wherein, each primer and the primer that utilize table 1 to show in the step (1) are right, or its variant or derivative, utilize pcr amplification to come the existence or the disappearance of test sample amplifying nucleic acid.

For the above reasons, the step of A12 aspect (1) can preferably relate to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises d defined above)-all nucleic acid of enumerating in i).In preferred embodiments, the step of A12 aspect (1) can preferably relate to the existence or the disappearance of test sample amplifying nucleic acid, and described nucleic acid comprises the nucleic acid of enumerating in a)-i) defined above at least.

In one aspect, invention also provide the primer that is fit to from nucleic acid, amplify amplicon, primer to and variant or derivative, described nucleic acid comprises or is made up of the nucleic acid of above a)-u) enumerating.Especially, the primer of discriminating table 1 being enumerated according to the inventor is to input extensive work, and primer and primer that invention provides table 1 to enumerate are right, and variant and derivative, choose wantonly, described primer and/or primer to or any suitable combination of its variant or derivative.

In addition, invention also provides and has utilized preferred primer and the amplified production of primer to being obtained, and comprises the carrier and the plasmid of described amplified production, comprises with described carrier and plasmid recombinant microorganism that transform or described carrier and plasmid.

Therefore, in preferred embodiments, invention also relates to according to budapest treaty, in the biological product collecting center (BCCM) of Norme Belge, Laboratorium voor MoleculaireBiologie-Plasmidencollectie (BCCM/LMBP) (Universiteit Gent, Technologiepark 927, B-9052 Gent-Zwijnaarde, Belgium), in on January 10th, 2007 with LMBP preserving number LMBP 5452, LMBP 5453, LMBP 5454, LMBP 5455, LMBP 5456, LMBP 5457, LMBP 5458, the intestinal bacteria (E.coli) of the reorganization of LMBP 5459 and LMBP 5460 preservations, on March 6th, 2007 is with the intestinal bacteria of the reorganization of LM BP preserving number LMBP 5451 preservations, on April 19th, 2007 is with LMBP preserving number LMBP 5587, LMBP 5588, the intestinal bacteria of the reorganization of LMBP 5589 and LMBP 5590 preservations, and from described recombination bacillus coli obtainable isolating recombinant plasmid, and the isolating insertion fragment of described plasmid, preferably, its isolating EcoRI-EcoRI inserts fragment.

This type of plasmid or carrier or its insert fragment, and combination, in the amplified reaction of aforesaid method, are effective especially as positive control, object of reference and/or the caliberator of each amplicon.

In addition, test kit has also been contained in invention, and described test kit is included in the method for one or more above-mentioned aspects and embodiment effectively one or more reagent.For example, this type of test kit can comprise one or more above-mentioned primers and/or primer right, particularly enumerate in the table 1, or the variant of described primer or derivative, and/or one or more above-mentioned amplified productions, comprise the carrier or the plasmid of described product, the insertion fragment of perhaps described carrier or plasmid, and/or comprising the data carrier of specification sheets, described specification sheets is used to carry out the programmable computing device (vide infra) of inventive method step (2).This type of test kit can also comprise specification sheets usually, is used for the method that the user carries out an invention and explains the data that obtained.

Simple, the direct mode of the step (2) of implementing above-mentioned aspect and embodiment has also been instructed in invention,, infers the potential existence or the disappearance that are derived from the material of different target transgenic plant incident in the sample that is.Especially, with one group of " G _SAM" sample obtains in the step (1) of expression above-mentioned aspect and embodiment result, described " G _SAM" form by following nucleic acid; or in other words; be expressed as the set of following nucleic acid; described nucleic acid is selected from the group of the nucleic acid that comprises above a)-u) enumerate; or be selected from the group that forms by the nucleic acid of above a)-u) enumerating; when having described nucleic acid in the sample, can in step (1), detect (step (i)).

In addition, any target transgenic plant incident can be expressed as one group of (set) " G _x" (wherein X represents object event), described G _xForm by the nucleic acid of finding in the described incident, or in other words, it is illustrated in the set of the nucleic acid of finding in the described incident, the nucleic acid that described nucleic acid comprises above a)-u) enumerates, or form by the nucleic acid of above a)-u) enumerating, therefore, then can in step (1), detect (step (ii)) if sample contains and is derived from described incident or relates to the hybridization of described incident or the material of dependent event.

In special exemplary, G _xGroup preferably can be selected from the group of the incident that expression above describes especially, for example, comprises following group: Zea mays event group G _Bt176∈ { Zm; P35S; Cry1Ab; PAT/bar}, G _Bt11∈ { Zm; P35S; TNOS; Cry1Ab; PAT/pat}, G _Bt10∈ { Zm; P35S; TNOS; Cry1Ab; PAT/pat}, G _MON810∈ { Zm; P35S; TNOS; Cry1Ab}, G _MON863∈ { Zm; P35S; TNOS}, G _TC1507∈ { Zm; P35S; PAT/pat}, G _NK603∈ { Zm; P35S; TNOS; CP4-EPSPS}, G _T25∈ { Zm; P35S; PAT/pat}, G _GA21∈ { Zm; TNOS}, G _DAS-59122∈ { Zm; P35S; PAT/bar}, G _MIR604∈ { Zm; TNOS; MCry3A}, G _LY038∈ { Zm; P35S; TNOS; CordapA; Glb1} and G _MON88017∈ { Zm; P35S; TNOS; CP4-EPSPS; Cry3Bb1}; Rape event group G _{Topas 19/2}∈ { Bn; P35S; PAT/pat}, G _MS1∈ { Bn; TNOS; PAT/bar}, G _RF1∈ { Bn; TNOS; PAT/bar}, G _RF2∈ { Bn; TNOS; PAT/bar}, G _MS1/RF1∈ { Bn; TNOS; PAT/bar}, G _MS1/RF2∈ { Bn; TNOS; PAT/bar}, G _MS8∈ { Bn; TNOS; PAT/bar}, G _RF3∈ { Bn; TNOS; PAT/bar}, G _MS8/RF3∈ { Bn; TNOS; PAT/bar}, G _GT73∈ { Bn; CP4-EPSPS}, G _T45∈ { Bn; P35S; PAT/pat}, G _{LiberatorpHoe6/Ac}∈ { Bn; P35S; PAT/pat}, G _{GS40/90pHoe6/Ac}∈ { Bn; P35S; PAT/pat}, G _OXY235∈ { Bn; P35S; Bxn}; Soybean event group G _MON40-3-2∈ { Gm; P35S; TNOS; CP4-EPSPS}, G _MON89788∈ { Gm; CP4-EPSPS}, G _A2704-12∈ { Gm; P35S; PAT/pat}, and G _A5547-127∈ { Gm; P35S; PAT/pat}, rice event sets G _LL62∈ { Or; P35S; PAT/bar}, G _LL06∈ { Or; P35S; PAT/bar}and G _LL601∈ { Or; P35S; TNOS; PAT/bar} beet event group G _T120-7∈ { Bv; P35S; PAT/pat}, G _H7-1∈ { Bv; P35S; CP4-EPSPS}, and G _A5-15∈ { Bv; P35S; TNOS; CP4-EPSPS}; Cotton event group G _LL _{Cotton 25}∈ { Gs; P35S; TNOS; PAT/bar}, G _MON1445∈ { Gs; P35S; TNOS; CP4-EPSPS}, G _MON531∈ { Gs; P35S; TNOS; Cry1Ac}and G _MON15985∈ { Gs; P35S; TNOS; Cry1Ac; Cry2Ab2}; With potato event group G _EH92-527-1∈ { St; TNOS; Gbss}; Name between its bracket { } refers to that those nucleic acid of enumerating, described nucleic acid find in this type of incident in above a)-u), thereby can be detected in the material in its source.Should be appreciated that, relate to except above-mentioned other nucleic acid enumerating in a)-u) if detect step (1), favourable, can comprise this type of nucleic acid in above-mentioned group.

Should be appreciated that, aforesaid method do not detect above-mentioned a)-u) in the existence of all nucleic acid, can define sample sets and event group according to effective those nucleic acid that exist that detected.Be intended to example and and unrestricted, when not detecting j defined above)-n), r), s) and u) in during the existing of the nucleic acid enumerated, described nucleic acid is equivalent to d)-j) in the definition nucleic acid outside feature, can define the group of more corresponding incidents with the mode of more reduction, particularly: Zea mays event group G _MIR604∈ { Zm; TNOS}, G _LY038∈ { Zm; P35S; TNOS}, and G _MON88017∈ { Zm; P35S; TNOS; CP4-EPSPS}; Rape event group G _OXY235∈ { Bn; P35S}; Cotton event group G _MON531∈ { Gs; P35S; TNOS}, G _MON15985∈ { Gs; P35S; TNOS}; And potato event group G _EH92-527-1∈ { St; TNOS}.

Therefore, by implementing the following target G that respectively organizes _XLogical operation (step I ii) can determine to be derived from the sample existence of the material of target X incident:

If-G _XEqual G _SAM(G _X=G _SAM), then potential existence is derived from the material of transgenic plant incident X or its hybridization or its dependent event in the sample;

If-G _XBe G _SAMProper subclass

(G_{X} &Subset; G_{SAM}),

Then potential existence is derived from the material of transgenic plant incident X or its hybridization or its dependent event in the sample;

If-G _XBe not equal to G _SAMAnd neither G _SAMProper subclass (G _X≠ G _SAMAnd

G_{X} &NotSubset; G_{SAM}

), then be not derived from the material of transgenic plant incident X or its hybridization or its dependent event in the sample.

In preferred embodiments, by calculating device can be favourable this logic of class computing of carrying out.

Should be appreciated that, the above-mentioned algorithm that uses in the step of present method (2), be interpreted as and utilize the detection of specific nucleic acid in this article, the existence of inferring the material that is derived from particular event is relevant, described algorithm is mainly used in the method for following purpose, and described purpose is to utilize the detection of any nucleic acid (for example, outside enumerating in above a)-u) or to its other nucleic acid that replenish), infer the existence of any incident, outside the incident of for example above mentioning especially or to its incident of replenishing.

Above-mentioned each side of the present invention and other aspects will be described in following chapters and sections and the additional claim, and embodiment preferred.

Description of drawings

Fig. 1 (A-F) expression utilize enumerate in the table 4 and cloning vector (particularly pUC18) in the primer that exists right, the selected sequence of the amplicon that is increased, the plasmid that described carrier is for example enumerated in the table 5.Be appreciated that sequence can comprise the partial sequence from the multiple clone site of the amplicon side that inserts.

The result of the multiplex PCR test of Fig. 2 (A) p35S/tNOS, (B) dissociation curve of p35S/tNOS specificity multiple testing.

Fig. 3 provide as enumerate in the table 8+diagram of the data that/-8300 templates copies obtains.

Detailed Description Of The Invention

Unless context is clearly narrated, otherwise singulative used herein " a ", " an " and " the " comprise the denoted object of odd number and plural number.

Term used herein " has comprised ", " comprising " and " comprising " and " having comprised ", " comprising " or " having contained ", " containing " be synonym, be compatible or open, do not get rid of the step of member, element or method extra, that do not describe.

Term " about " used herein, when the expression measurable magnitude, such as parameter, amount, time period etc., mean to have contained and particular value+/-20% or deviation still less, preferred+/-10% or still less, more preferably+/-5% or still less, more preferably+/-1% or still less, more preferably+/-0.1% or still less, in the scope of this type of deviation, it is suitable implementing disclosed invention. Should be appreciated that the value self that qualifier " pact " refers to also is special and preferably disclosed.

The number range of describing by endpoint value comprises all numerical value and the interval of including in this scope, and described end points.

The All Files of quoting in this specification all is integrated into herein by reference in full. The instruction of the All Files of mentioning especially herein especially, all is incorporated into herein by reference.

Therefore, in some respects, more particularly, in aspect the A1-A12 that summary section is described, invention relates to the method that material exists or lacks in the sample for reference, described material source is from one or more genetically modified plants events, existence or the disappearance of test sample amplifying nucleic acid that the method comprising the steps of (1), described nucleic acid comprises a)-u) enumerate in the summary section a kind of, more than one or whole (the specific target of selecting to depend on described mensuration) nucleic acid, or formed by above-mentioned nucleic acid, (2) infer existence or the disappearance that is derived from the material of one or more genetically modified plants events in the sample, described event is selected from such group, described group comprises the part or all of event that summary section describes in detail, or the part or all of event that is described in detail by summary section forms.

" genetically modified plants event " follows following event to occur: with heterologous nucleic acids independence transformed plant cells, generally be to have comprised the genetically modified nucleic acid construct of one or more targets; Comprise the genetically modified construct of described one or more target or one partial insertion Plant Genome, the plant population that regeneration obtains; Select specific plant, it is characterized in that one or more, a preferred specific genome position has described insert. Therefore, the conversion of plant of original above-mentioned selection contained in term " genetically modified plants event ", and any subculture that inserts nucleic acid that comprised, and described insertion nucleic acid comprises the target transgenosis; For example described offspring can be semizygote or the homozygote of described insert; Can be by for example nourishing and generating or sexual hybridization obtains described offspring.

Plant cell contained usually in term used herein " plant "; Plant protoplast; Plant tissue; Plant cell or tissue culture that can the aftergrowth body; Plant corpus callosum or agglomerate; Plant or its part, such as but not limited to, flower, tapel, petal, sepal, flower pesticide, pollen, seed, fruit, pericarp, fruit pod, leaf, petiole, stem, root, root-like stock, stolon, stem tuber, bud etc. Term used herein has generally been contained this area and has been sorted in any plant classification unit in the plant kingdom. In addition, the plant of understanding herein can preferably belong to terrestrial plant (embryophyte), includes but not limited to non-vascular plant (bryophyte) and vascular plant (vascular plant); Preferred, for vascular plant (vascular plant), include but not limited to Lycopodiophyta (lycopodiophyta), Equisetineae (equisetophyta), Pteridophyta (pteridophyta), Psilotophyta (psilotophyta), adder tongue herb door (ophioglossophyta), and seed plant (seed plant); Preferred, for seed plant (seed plant), include but not limited to seed bearing plant (gymnosperm), for example: Coniferae (pinophyta), Cycadophyta (cycadophyta), ginkgo door (ginkgophyta) and sweetberry jointfir door (gnetophyta), and phanerogam (angiosperm) Magnoliophyta for example, comprise monocotyledon (Liliopsida (liliopsida)) and dicotyledon (Magnoliatae (Magnoliopsida)). Preferred plant can be conventional plant of using in agricultural or horticulture. Be intended to example and unrestricted, preferred crop plant can comprise maize, wheat, rice, barley, Chinese sorghum, tobacco, tomato, potato, rape (rapeseed (rapeseed)), soybean, beet, pea, sunflower, cotton, peanut, flowers (such as: carnation) etc.

Term " material " refers generally to the physics material. Be intended to example and unrestricted, term " is derived from the material of genetically modified plants event " has contained following genetically modified plants event, comprises genetically modified plants event organism; Any part of genetically modified plants event organism, for example: flower, tapel, petal, sepal, flower pesticide, pollen, seed, fruit, pericarp, fruit pod, leaf, petiole, stem, root, root-like stock, stolon, stem tuber, bud, or its part; The cell of genetically modified plants event, protoplast, tissue, corpus callosum or agglomerate; Perhaps with any above-mentioned material through a step or the material that obtains of multistep downstream step. This class downstream step can comprise in agricultural, horticulture or any downstream industry any behavior for the treatment of the specified plant material, described downstream industry such as: comprise wine-making industry food industry, feed industry, textile industry (such as cotton, flax, bamboo etc.), fuel industry (such as: rape), the lubricant industry (such as: castor oil), coatings industry (such as linseed oil, tung oil), cosmetics and pharmacy industry etc.

Be intended to example and unrestricted, this type of downstream can comprise harvesting; Remove undesired skin, such as: peeling, peeling etc.; Drying, dry such as air, dry, spray-drying, freeze-drying, concentration of juices etc.; Downsizing (diminution), such as grinding, powder process, chopping, section etc.; Liquefaction, for example fruit juice is collected; Anticorrosion, such as vacuum bottling, tinning, manufacturing can, pasteurization, interpolation anticorrisive agent etc.; Compacting, for example oil-collecting; Hydrogenation, for example vegetable oil saturation; Dipping; Emulsification; Heat treatment is such as boiling, pressure cooking, steam processing, baking box baking, sootiness, fry in shallow oil, scorch etc.; Fermentation is for example by yeast, bacterium and/or fungi; Freezing etc.

Term used herein " sample " substantially confession under directions checks, for example supplies quality control, representative part or the fragment of complete larger material. Preferably, can suspect the material that is derived from one or more target transgenic events by potential the comprising of the sample of the inventive method inspection. Be intended to example, can have this type of suspection for the material of any sample representativeness, as long as known described sample comprises, suspect that perhaps it probably maybe may comprise the material of plant or its part or plant-derived or its part. In the preferred embodiment, sample can represent such material, described material is known to be comprised, suspect that perhaps it probably maybe may comprise the material of plant or its part or plant-derived or its part, taxonomical unit under wherein said plant or its part is with will to check that (whether) is present in the taxonomical unit of the target transgenic event in the sample identical. For example, sample can On behalf of plant or its part, such as the plant of collecting or gathering in the crops or its part (such as but not limited to fruit, seed, fruit pod, flower etc.), or intermediate materials or the whole material of representative by using a step or multistep downstream step to obtain to it, the product that perhaps comprises materials, for example food or the feed product of processing.

Therefore, in embodiments, sample can comprise plant or its part, comprises flower, tapel, petal, sepal, flower pesticide, pollen, seed, fruit, pericarp, fruit pod, leaf, petiole, stem, root, root-like stock, stolon, stem tuber, bud, or its part; The material of plant cell, plant protoplast and/or plant tissue and/or plant origin, described material are preferably food or feed material, comprise food or the feed material of processing.

The method of invention detects existence or the disappearance of the sample amplifying nucleic acid (being genetic stocks and preferred gene group DNA) that starts from or be derived from target genetically modified plants event. The existence of this type of nucleic acid or disappearance represent respectively described material and potential existence and the disappearance of other materials in sample, and described other materials is to be derived from each genetically modified plants event; For example: be used for the different procedure of processings of genetically modified plants event, with described nucleic acid copurification or be divided into from material.

Known nucleic acid particularly genomic DNA is relatively durable, and can tolerate the multiple procedure of processing that is used for vegetable material in agricultural and the industry (for example: grocery trade or feed industry), therefore, after this type of step, even in finished product, can also there be the dna molecular that can carry out the length of sequence-specific detection.

Therefore, the preferred sample of invention comprises nucleic acid, more preferably genomic DNA, more preferably have at least like this genomic DNA of length, described length allows that it is carried out sequence-specific and detects, for example, on average at least about 20bp, for example at least about 30bp, preferably at least about 50bp, for example at least about 75bp, more preferably at least about 100bp, about 150bp for example, perhaps more preferably at least about 200bp, or at least about 300bp, or at least about 500bp, or at least about 1kb, or longer.

Although can think, in practice, but most of procedure of processing of the conventional experience of genetically modified plants event can keep the above-mentioned nucleic acid of detection limit in finished product, thereby can check the sample of described product, but the inventor has also designed positive control, but is intended to verify whether described sample comprises the nucleic acid of the plant origin of detection limit.

Especially, the method for invention can also comprise existence or the disappearance of general plant origin nucleic acid in the test sample. In preferred embodiments, this type of general plant origin nucleic acid is to be derived from the gene that exists in different plant classification units, preferred described gene be high conservative (for example: 〉=80%, preferably 〉=90%, more preferably 〉=95%, more preferably 〉=96%, 〉=97%, 〉=98% or 〉=99% sequence homogeneity); Preferably at least in seed plant; Or at least in angiosperm, for example in monocotyledon and dicotyledon and/or between; Or preferred at least between agricultural and the conventional plant classification unit that uses of industry, such as but not limited to, in maize, wheat, rice, barley, Chinese sorghum, tobacco, tomato, potato, rape (rapeseed), soybean, beet, pea, sunflower, cotton, peanut and flowers (for example: carnation); Or between the plant classification unit of the genetically modified plants event that preferably in comprising sample, detects at least, or between the plant classification unit that is formed by described event.

In preferred embodiments, described general plant origin nucleic acid is the small subunit from chloroplaset Rubisco gene, or from the CHL-tRNA synthase gene.

As mentioned above, the method for invention comprises existence or the disappearance of step (1) test sample amplifying nucleic acid, and described nucleic acid comprises a)-u) enumerate in the summary section a kind of, more than one or all nucleic acid, or is comprised of described nucleic acid. Term used herein " detection " or " detection effect " have contained the existence of appointment nucleic acid in any definite sample or the mode of disappearance.

Preferably, can utilize the existence of specific nucleic acid molecule in one or more reagent test sample, the specific hybridization of each nucleotide sequence that comprises in described reagent and the described nucleic acid molecules.

Term " hybridization " and " hybridization " refer to nucleic acid chains and the complementary series or the basic complementary series that are positioned on the identical or different polynucleotide chain, by base pairing, and the process of preferably annealing by the Watson-Crick base pairing.

Term " complementary " and " complementarity " refer under the salt (ionic strength) that allows and temperature conditions, by base pairing, and preferably Watson-Crick base pairing, the normal combination of polynucleotides. Be intended to example, complementary Watson-Crick base pairing occurs in base A and T, A and U, or between G and the C. For example, sequence A-G-T (that is, 5 '-A-G-T-3 ') is complementary series with A-C-T (that is, 5 '-A-C-T-3 ').

" the complementary degree " of nucleic acid chains (A) and nucleic acid chains (B) can be expressed as when described nucleic acid chains (A) and (B) when annealing, preferably under high stringent condition, the nucleotide proportion (percentage) of nucleic acid chains (A) and nucleic acid chains (B) expection coupling (namely forming the Watson-Crick base pairing).

" complementation " used herein refers to complete complementary, thus when chain is annealed, each nucleotides of all of nucleic acid chains all in connection with. Be intended to example, relatively short nucleic acid chains can show the full complementarity with relatively long nucleic acid chains, if a rear chain has comprised the sequence with the sequence complete complementary of last chain. " substantially complementary " refer to major part but be not complete complementary, especially, and at least 85% complementation, for example at least 90% complementation, preferably at least 95% complementation, for example at least 96%, 97%, 98% or at least 99% complementation.

" specifically hybridization " and " specific hybridization " reflected such state, that is, when reagent and particular sequence are hybridized, than with at random, incoherent sequence hybridization is easier. For example, the reagent of hybridizing specifically with specific nucleotide sequence (A), preferably show: under the condition that can hybridize specifically with described polynucleotides (A), hybridize or do not hybridize with other mononucleotides are few, preferably seldom hybridize or do not hybridize with nucleotide sequence (A) homologue or ortholog thing.

Preferably, can be probe or primer with the reagent of corresponding nucleotide sequence specific hybridization, in the nucleic acid molecules that described nucleotide sequence is included in above a)-u) enumerates.

" probe " is the nucleic acid that separates, and its expectation has connected detectable label or report subdivision, for example radio isotope (as:³²P、 ³³P), aglucon, chemical illuminating reagent, fluorogen (as: luciferin, tetrachloro generation-luciferin, TAMRA, ROX, Cy3, Cy3.5, Cy5, Cy5.5, texas Red etc.), vitamin (as: biotin), steroids (as: digoxin), enzyme (as: HRP, AP etc.) etc. The sequence that comprises in this type of probe and the target nucleic acid chain is complementary or substantially complementary, in situation of the present invention described nucleic acid for to be set forth in above a)-nucleic acid in u), be preferably genomic DNA. According to probe of the present invention, can be deoxyribonucleotide, ribonucleotide or the nucleic acid that comprises simultaneously ribodesose and ribose; Can comprise purine and/or the pyrimidine bases (A, G, T, C, U and/or I) of standard, but can comprise also that other are natural, (for example: methylate) of chemistry or biochemical modification, the non-natural or nucleotide base of deriving; Can comprise and contain sugar and the skeleton of phosphate, exist such as typical case among RNA or the DNA, and one or more modifications or replace (for example: 2 '-O-alkylation methylates or 2 '-O-ethylization such as 2 '-O-; Or 2 '-O, 4 '-C-alkylation, such as 2 '-O, 4 '-C-ethylizes) glycosyl, or the phosphate of one or more modifications or replacement---for example, skeleton analog in the nucleic acid can comprise di-phosphate ester, phosphorothioate, phosphorodithioate, methyl phosphonate, phosphoramidate, alkyl phosphotriester, sulfamate, 3 '-mercaptal, methylene (methyl-imino), 3 '-N-carbamate, morpholinyl carbamate, and peptide nucleic acid (PNA).

The length of probe can be at least 10 nucleotides, for example length is at least 11, at least 12, at least 13 or at least 14 nucleotides, preferred length is at least 15 nucleotides, for example length is at least 16, at least 17, at least 18 or at least 19 nucleotides, more preferably length is at least 20 nucleotides, for example length is at least 21, at least 22, at least 23 or at least 24 nucleotides, more preferably length is at least 25 nucleotides, and for example length is at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100 or at least 200 nucleotides or more nucleotides.

" primer " is the nucleic acid that separates, be preferably deoxyribonucleotide, or be ribonucleotide or PNAS in other preferred embodiments, described nucleic acid is complementary or substantially complementary (in situation of the present invention with the sequence that is included in the target nucleic acid, with the sequence that comprises in the nucleic acid, be preferably genomic DNA, comprise or formed by the nucleic acid of enumerating in above a)-u)), can anneal with described target nucleic acid, and in the situation that has nucleotides and nucleic acid multimerization reagent (for example DNA dependence or RNA dependence polymerase), the synthetic starting point that can be used as primer extension product plays a role.

Primer needs long enough, thereby initial extension products is synthetic in the situation that has multimerization reagent. Therefore, the length of typical primer can be at least 10 nucleotides, at least 11, at least 12, at least 13 or at least 14 nucleotides such as length, preferred length is at least 15 nucleotides, for example length is at least 16, at least 17, at least 18 or at least 19 nucleotides, and more preferably length is at least 20 nucleotides. More preferably primer length is between about 10 and about 40 nucleotides, and more preferably length is between about 15 and about 30 nucleotides, and most preferably length is between about 20 and about 25 nucleotides.

" primer to " guides the combination of thing, it is fit to by suitable nucleic acid amplification method, amplification from target nucleic acid (in situation of the present invention, from such nucleic acid, in preferred such genomic DNA, described nucleic acid comprises or is comprised of the nucleic acid of above a)-u) enumerating) interior amplicon. Therefore, can use primer pair, amplify the ability of the amplicon that is positioned at specific objective nucleic acid, represent described target nucleic acid existing in sample (optional, quantize), described primer is to being designed to and described target nucleic acid specific hybridization.

For the preparation of being described in the exemplary unrestricted method of using probe and primer, Molecular Cloning:A Laboratory Manual for example, the 2nd edition, the 1-3 volume, the people such as Sambrook write, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989 (" people such as Sambrook, 1989 "); Current Protocols in Molecular Biology, the people such as Ausubel write, Greene Publishing and Wiley-lnterscience, New York, 1992 (have and periodically update) (" people such as Ausubel, 1992 "); With the people such as lnnis, PCR Protocols:A Guide to Methods and Applications, Academic Press:San Diego, in 1990. The PCR-primer is to being derived from known array, for example, utilization is intended to the computer program of this purpose, such as Primer3 (Rozen and Skaletsky.2000.Primer3on the WWW for general users and for biologist program mers.In:Krawetz S, Misener S (writing) Bioinformatics Methods and Protocols:Methods in Molecular Biology. Humana Press, Totowa, NJ, 365-386 page or leaf) or from the GCG of Accelrys^TMV.11.1.2 program package.

Preferably, can realize probe, primer or the primer pair of invention under high stringent condition, with the specific hybridization of corresponding complementary series in the target nucleic acid, described target nucleic acid for example comprises or is comprised of the nucleic acid of above a)-u) enumerating.

" high strict " condition comprises and the condition of following exemplary condition equivalence that when using the probe of the about 500bp of length, hybridization is under 65 ℃, carries out: 5xSSPE (43.8g/l NaCl, 6.9g/l NaH in the solution that is made of following material₂PO ₄-H ₂O and 1.85g/l EDTA regulate pH to 7.4 with NaOH), 0.1%SDS, 5x Dehardt (the 50x Dehardt of every 500ml contains: the 5g Fick (model 400, Pharmacia), 5g BSA (Fraction V; Sigma) and 100 μ g/ml denatured salmon sperm dnas), then with comprising the solution of 5x SSPE, 0.1% SDS 65 ℃ of washings. For the about 20-100 of a length nucleotides, the about 30-100 of a preferred length nucleotides, accounting such as the about 30-50 of a length nucleotides, other exemplary condition of " high strict " hybridization comprise the condition with following equivalence: under 45 ℃, hybridize among the 6xSSC, then under 65 ℃, at 0.2xSSC, among the 0.1%SDS, or at 0.1xSSC, wash one or many among 0.1% SDS. Can change stringent condition with a large amount of condition of equivalences; For example consider the various factors: the length of probe and character (DNA, RNA, base composition), and the character of target (DNA, RNA, base composition, be arranged in solution or immobilized etc.), the concentration (for example: the existence of formamide, dextran sulfate, polyethylene glycol or disappearance) of salt and other compositions, can change hybridization solution and produce low strict or high strict condition of hybridizing, the latter is different from the condition of above enumerating but of equal value. In addition, the condition (for example: increase hybridization temperature and/or washing step, in hybridization solution, use formamide etc.) that under high stringent condition, promotes hybridization known in the art. The instruction of implementing hybridization reaction is found in for example Current Protocols in Molecular Biology, John Wiley ﹠ Sons, and N.Y., 6.3.1-6.3.6, in 1989, and the version of recent renewal, these all are integrated into herein by reference.

About utilizing primer to the amplicon in the amplification target nucleic acid, " stringent condition " or " high stringent condition " is to allow primer to only its corresponding target nucleic acid sequence hybridization, and produce the condition of unique amplified production, in other words, amplification does not produce basically not to be expected, i.e. non-specific amplified production. For example, when under stringent condition (for example: by quantitative gel electrophoresis analysis, or determine by Tm etc.) when implementing this type of reaction, in the amplified reaction, what preferably account for amplified production total amount (for example weight) is less than 20%, more preferably less than 10%, more preferably less than 5%, as be less than 4%, be less than 3%, or be less than 2%, more preferably less than 1%, as be less than 0.1% or be less than 0.01%, can be non-specific.

Can use the specific hybridization of target nucleic acid in any conventional method detector probe and the sample. For example, the nucleic acid from sample can be preferably DNA and be fixed on the solid support, and sex change, like this and corresponding Probe Hybridization (such as: Southern trace, slot blot, Dot blot etc.). If probe---inevitable, its detectable mark---be retained on the solid support, just represent to exist in the sample target nucleic acid of described probe specificity.

Similarly, any existing nucleic acid amplification method may be used to amplify amplicon from the target sequence, thus the existence of respective target sequence in the prompting sample, and described method includes but not limited to that (US 4 in PCR (PCR), 683,202; US 4,965,188), strand displacement amplification (SDA) (US 5,455,166; EP 0684315), LCR, TAS, 3SR, NASBA (US 5,409,818; EP 0329822), RCA and Q-β amplified reaction.

In particularly preferred embodiments, the method of invention is used the amplicon in the amplifying target nucleic acid of PCR (PCR), described target nucleic acid is selected from such group, the nucleic acid that described group comprises above a)-u) enumerates, or formed by these nucleic acid. Term " PCR " and " PCR " have generally covered any method that this area refers to this title, method especially for amplifying target nucleic acid sequence, particularly utilize heat-staple archaeal dna polymerase and two kinds of primers (particularly Oligonucleolide primers), the target dna sequence dna, a kind of complementary at sequence one end to be amplified and (+) chain, another kind of complementary at the other end and (-) chain in the described primer. The modification of PCR prototype contained in this term, such as: High fidelity PCR, heat start PCR, touchdown PCR, nest-type PRC, multiplex PCR, quantitative PCR, quantitatively PCR in real time, long range PCR, RT-PCR etc. are (referring to for example: PCR Protocols:A Guide to Methods and Applications, the people such as lnnis write, Academic Press, San Diego, 1990).

Can be by the conventional method of any this area, the amplified production that assessment utilizes above-mentioned amplification method, particularly PCR to obtain, for example: its existence or disappearance, specificity and/or amount. For example, can utilize size (as the indication of specific amplification) and/or the amount of gel electrophoresis (as: agarose or polyacrylamide gel electrophoresis) estimation amplified production, wherein, utilize the suitable visual amplified production of DNA combination dye, for example ethidium bromide.

Optionally, by using the method for probe, can estimate amplified production, the particular sequence hybridization in described probe and the amplified production. For example, amplified production can be fixed on the solid support, and sex change, then use the Probe Hybridization of mark.

In addition, also can mark amplified production itself, for example by in one or both primers, introducing detectable mark (such as fluorogen), and/or by the substrate nucleotides that is incorporated in the amplification procedure in the amplified production, then, can be with the PCR product sex change that obtains, and with specific (oligonucleotides) Probe Hybridization that is attached on the solid support. The existence of the detectable label on the select location of solid support and amount have been indicated respectively specificity and the amount of amplified production. For example, this type of scheme is fit to use probe array, such as microarray.

In other illustrative methods, can utilize Cloning and sequencing; Direct Sequencing; Oligonucleotide mediated pyrophosphoric acid order-checking (oligonucleotide-mediated pyrosequencing, the people such as Ahmadian, 2000.Anal Biochem 280:103-110); Chromatography such as DHPLC; Oligonucleotide ligation assay (people such as Landegren, 1988.Science 241:1077; The people such as Eggerding, 1995.Hum Mutat 5:153-165; The people such as Nickerson, 1990. PNAS 87:8923-8927); RNA enzyme protection analytic approach etc. is assessed amplified production.

The particularly advantageous method of assessment amplified production is real-time amplification, particularly PCR in real time. Term " in real time amplification " means any amplification technique, preferred PCR (" PCR in real time "), its progress that can monitor ongoing amplified reaction is (referring to for example: Real-Time PCR:An Essential Guide, the people such as Edwards write, Horizon Scientific Press, 2004; The people such as Marras SAE, 2006.Real-time assays with molecular beacons and other fluorescent nucleic acid hybridization probes.Clin Chim Acta 363:48-60; Discussion about various PCR in real time platforms).

Be intended to example and unrestricted, all conventional systems have been contained in the real-time amplification of indication herein, particularly PCR in real time, for example: the TaqMan of Applied Biosystems exploitation^TMSystem, it depends on every release and detection (people such as Holland, 1991.Detection of specific polymerase chain reaction product by utilizing the 5 '-3 ' exonuclease activity of Thermus aquaticus DNA polymerase.PNAS 88:7276-80) of taking turns fluorescence probe in the dna amplification reaction. The method has been utilized the 5 '-exonuclease activity of Taq polymerase in primer extension process, the fluorescence probe of the double labeling of hybridizing with target DNA between the cutting PCR primer. Before cutting, the report fluorogen of probe 5 ' end, such as 6-Fluoresceincarboxylic acid (6-FAM) by 6-carboxyl-tetramethylrhodamin (TAMRA) by fluorescence resonance energy transmission (FRET) cancellation. After digestion, discharge FAM. In the logarithmic phase of product accumulation, the fluorescence that measures in real time at 518nm and the copy number of target sequence are proportional.

Other increase in real time, PCR in real time particularly, and detection system can also be used FRET, for example based on the system of molecular beacon (molecular beacon). Molecular beacon is the strand polynucleotide probes with stem-environment-development card structure. Loop section be with amplicon to be assessed in the probe sequence of sequence complementation, formed stem by the short complementary series that is positioned at the molecular beacon opposite end. One end of molecular beacon fluorogen (such as 6-FAM) mark, other end quencher (such as TRAMA) mark. In the time of in being free in solution, stem makes fluorogen and quencher keep close proximity, causes the fluorescence of fluorogen by the FRET cancellation. Yet when when its complementary target is combined, the hybridization power of probe-target forces stem to stretch, and fluorogen is separated with quencher, has recovered fluorescence. Therefore, when the amount of amplicon increases in amplification procedure, can monitor by the fluorescence increase of respective beacon (referring to such as the people such as Manganelli, 2001.Real-time PCR using molecular beacons.Methods MoI Med 54:295-310; Marras SAE. 2006.Selection of fluorophore and quencher pairs for fluorescent nucleic acid hybridization probes.Methods MoI Biol 335:3-16; The people such as Marras SAE, 2006.Real-time assays with molecular beacons and other fluorescent nucleic acid hybridization probes.Clin Chim Acta 363:48-60 is about other discussion of molecular beacons detection).

Being particularly conducive to PCR in real time amplification and the detection system used in the present invention is the commercial Light Upon of Invitrogen (Carlsbad, CA) Extension (LUX^TM) system, it is described in detail in the people such as Nazarenko, and the people such as 2002 (Nucleic Acids Research 30:e37) and Nazarenko are among 2002 (the Nucleic Acids Research 30:2089-2095). The primer centering that this system uses, usually use a primer of fluorogen (for example: FAM or JOE or Alexa Fluor 546) the described primer centering of mark, " dissociate " primer the special construction cancellation with the fluorescence signal of its combination, when in a single day primer is incorporated into amplified production, when showing the configuration of stretching, extension, the signal strength signal intensity of fluorogen has just increased. According to people such as above-mentioned Nazarenko, the explanation of 2002 publications, or the Software tool that uses Invitrogen to provide at www.invitrogen.com/lux, can modify primer of the present invention (the particularly preferably primer of for example showing to enumerate in l and 4) sequence, to implement LUX^TMTechnology. LUX^TMTechnology is particularly suitable for using multiplexing (multiplexing namely, implements) of two right classes of different primers or multiclass amplified reaction in single reaction, because can use different each primer of fluorogen mark pair.

About to real-time detection and the assessment amplified production other modes description (for example: use adjacent primer; 5 '-nuclease primer such as Taqman^TM The Light-up probe; Duplex scorpion primer (du plex scorpion primer); The Amplifluor primer; With other optional fluorescent hybridization probe patterns), referring to such as people such as Marras SAE, 2006.Real-time assays with molecular beacons and other fluorescent nucleic acid hybridization probes.Clin Chim Acta 363:48-60, particularly the 6th part and list of references wherein.

In preferred embodiments, the real-time amplification of invention, preferred PCR in real time uses the nonspecific reagent of (basically) sequence to detect and assess the accumulation of amplified production. These systems usually use in conjunction with DNA (namely, the DNA-combination), the fluorescent dye of preferred combination double-stranded DNA (fluorescent dye), described combination is the nonspecific mode of sequence substantially, based on this type of combination, obtain or strengthened the fluorescence of described reagent. Therefore, the observed result that fluorescence increases is the appearance of (two strands) amplified production of accumulation and the indication of amount. If described fluorescent dye preferred or single-minded in conjunction with double-stranded DNA, if and/or its preferred or single-minded increase of its fluorescence when double-stranded DNA is combined, then can be by " melt curve analysis " and the Tm that determines product that implements described dyestuff, determine the specificity of amplified production, wherein, described melt curve analysis is fluorescence vs. temperature spot, thus the temperature that Tm is 50% product when melting the fluorescence that loses its enhancing. The observed result of the single expection Tm of single amplified production (or in the multiplex amplification a plurality of expection Tm) has been verified the specificity of amplification.

The exemplary fluorescent dye that uses in the non-specific detection method of above-mentioned sequence includes but not limited to: major groove bond, minor groove binding, chimeric dyestuff etc.; For example SYBR Green I (2-[N-(3-dimethylamino-propyl)-N-Propylamino]-4-[2,3-dihydro-3-methyl-(benzene-1,3-thiazoles-2-yl)-methine]-1-phenyl-quinoline; The people such as Zipper, 2004.Nucleic Acid Res 32:e 103), ethidium bromide, Hoechst 33258, PicoGreen^TM(molecular probe), preferred SYBR Green I or PicoGreen^TM。

In other preferred embodiments, the real-time amplified reaction of this method can be multiplexing,, in same reaction, can utilize two or more corresponding primers pair, the two or more amplicons in the same sample that increases that is. The primer of inventor's design, the primer or derivatives thereof of particularly enumerating in table 1 or the table 4, can be particularly suitable for multiplexing type uses, because they can (for example: reaction composition and temperature cycles condition) fully be implemented under basic identical or similar reaction condition, and because they produce the product of similar size.

Be appreciated that fully multiplexing General Requirements can distinguish the different amplified productions that produce in the reaction. In this context, if use non-sequence-specific method (for example SYBR Green or other DNA-combination dyes) to detect amplified production, when amplified production have when implementing different Tm that solubility curve enough distinguishes (for example: Tm difference about 5 ℃ or more), just can predict especially (use) multiplex technique. Yet when using the amplicon method for detecting specificity (for example: the different labeled primers or the different label probe that are used for different amplicons), the multiplex technique of multiple test can use in principle.

Therefore, the target of above-described use probe in detecting, and/or use primer to the template of amplification, be the nucleic acid that starts from each genetically modified plants event that comprises in the sample. Preferably, this target and/or template nucleic acid can be the genomic DNAs that starts from described transgenic event, because described DNA has larger stability, expect it than other nucleic acid types, for example hnRNA or mRNA, can be more stable be kept in the sample. Yet, invent and also considered under the feasible condition, to the detection (for example analyzing by corresponding RT-PCR) of mRNA or cDNA, or the detection of the DNA in plasmid source.

Therefore, means as the existence of test sample amplifying nucleic acid or disappearance, this method is preferably used such amplified reaction, wherein, the primer of described amplified reaction utilization is to being designed to and described nucleic acid specificity hybridization, and can therefrom amplify corresponding amplicon, existence or the disappearance of described nucleic acid in sample is to need to detect, the nucleic acid for example preferred, that described nucleic acid comprises above a)-u) enumerates, or formed by the nucleic acid of above a)-u) enumerating.

Aspect this, the inventor recognizes, if the material of genetically modified plants event once carried out one or more Downstream processing steps, as indicated above, then the genomic DNA of nucleic acid such as material will fragmentation. Therefore, in order to increase the probability that typically amplifies each amplicon from the DNA of fragmentation like this, the size that advantageously reduces amplicon has also been instructed in invention.

Therefore, in preferred embodiments, amplicon is less than about 300bp, as less than 280bp, less than 260bp, less than 240bp or less than 220bp, be more preferably less than about 200bp, as less than 190bp, less than 180bp, less than 170bp or less than 160bp, even be more preferably less than about 150bp, as less than 140bp, less than 130bp, less than 120bp or less than 110bp, also be more preferably less than about 100bp, be more preferably less than about 90bp, according to appointment 85bp, about 80bp, about 75bp, about 70bp, about 65bp, about 60bp, about 55bp or about 50bp.

In a more preferred embodiment, amplicon is between about 50bp and about 150bp, between about 50bp and about 100bp, preferably between about 50bp and about 90bp, more preferably between about 60bp and about 80bp, more preferably between about 65bp and about 75bp.

As described, specific nucleic acid, particularly genomic DNA in the said method test sample. Be appreciated that the detection method that some are strong, such as some PCR methods, can its composition nucleic acid do not carried out under the condition of prepurification or enrichment sample being implemented. On the other hand, if at first enrichment or isolate nucleic acid from sample, preferably such as genomic DNA, the detection that carries out an invention that then can be more stable. The method of (particularly from the sample that comprises vegetable material) isolating nucleic acid such as genomic DNA is that this area is set up already from sample, as example and unrestricted, comprise based on following method: the organic solvent extracting (for example: the phenol-chloroform extracting) and ethanol or isopropanol precipitating; The coupled ion exchanger resin; The calcium chloride Density Separation; Spin-column chromatography; Magnetic Isolation etc. are (referring to for example: Milligan 1992.Plant DNA isolation, Hoelzel writes, Molecular genetic analysis of populations:a practical approach.IRL Press, Oxford, UK, the 59-88 page or leaf).

Can pass through for example gel electrophoresis, and/or by measuring A₂₆₀/A ₂₈₀The light absorption value ratio is assessed the quality of the DNA that separates. The A of the nucleic acid that preferably, uses in the detection method of invention₂₆₀/A ₂₈₀Ratio can be between 1.6 and 2.3, more preferably between 1.6 and 2.0, even more preferably between 1.7 and 1.9, more preferably between 1.75 and 1.85, most preferably are about 1.8 also. For example, can be by measuring A₂₆₀Light absorption value (Sambrook 1989), or preferably utilize PicoGreen^TMOr SYBR Green I fluorescent dye (people such as Ahn, 1996.Nucleic Acids Res 24:2623-5; The people such as Schneeberger, 1995.PCR Methods Appl 4:234-8) assesses the amount of the DNA that separates.

In preferred embodiments, be used for the preparation of the nucleic acid material, particularly genomic DNA of inventive method, can also need the fragmentation effect, obtain the nucleic acid fragment than the harmonic(-)mean size, for example use enzymatic digestion known in the art or ultrasonic. The average length of the nucleic acid of institute's fragmentation preferably can be 200 and 2000bp between, more preferably 300 and 1500bp between, even more preferably 500 and 1000bp between, according to appointment 500, about 600, about 700, about 800, about 900 or about 1000bp.

Therefore, said method preferably uses the aforesaid detection system of this paper and rules, comes existence and the disappearance of selected nucleic acid in the test sample. As used in this article, when utilizing suitable determination method (such as fluorescence signal, chemiluminescence signal, enzymatic reaction signal etc.), the nucleic acid signal intensity level (semaphore) that obtains in the sample greater than, when preferably statistically significant ground is greater than the amount in the negative control, usually infer " existence " of specific nucleic acid in the sample.

Negative control does not contain nucleic acid to be analyzed, but advantageously, in other respects, preferred most of other aspects, with sample be comparable, the type of the vegetable material that for example contains therein and amount, the Downstream processing step that material once experienced etc.

Preferably, can be to the nucleic acid that from sample, separates, preferred gene group DNA, the detection method that carries out an invention (referring to above). In this type of example, negative control can be comprised of the nucleic acid that separates basically, does not comprise examined nucleic acid. Preferably, use in the detection method from sample, identical or basic identical with the amount of the nucleic acid that from the negative control as object of reference, separates. Same preferred, purity and/or the quality of the nucleic acid that separates from negative control from the sample neutralization also can be identical or almost identical; Preferred, can use identical method from sample and negative control in isolating nucleic acid.

In these cases, the signal strength values (semaphore) that obtains when the nucleic acid from sample is than the value in the negative control greatly at least during 2x, can preferably infer the existence of specific nucleic acid in the sample, for example than the signal in the negative control greatly at least 3x or 4x at least, more preferably 5x greatly at least, such as 6x greatly at least, greatly at least 7x, greatly at least 8x or 9x greatly at least, even more preferably 10x greatly at least, such as 15x greatly at least, more preferably greatly at least 20x, such as greatly at least 30x or greatly at least 40x, more preferably greatly at least 50x, such as 100x greatly at least, greatly at least 200x, greatly at least 300 x, greatly at least 400x, greatly at least 500x, greatly at least 1000x or more times.

Therefore, when signal value (semaphore) that nucleic acid to be analyzed from sample obtains is not more than the signal value of nucleic acid acquisition to be analyzed in (for example: equal, almost equal or less than) negative control, or when preferably being not more than above-mentioned preferred multiple, usually can infer " disappearance " of nucleic acid described in the sample.

In preferred embodiments, assess existence and the disappearance of target nucleic acid in the sample by real-time amplification (PCR in real time preferably is provided). In this type systematic, the general measure value that is used for the template amount of the given nucleic acid of expression sample is C_tValue. In brief, C_tValue has been described the period when the fluorescence of the generation of the amplified production (AR π) in the accumulation surpasses the setting fluorescence threshold, described threshold value is determined according to the fluorescence baseline, but be positioned at the logarithmic phase scope of amplification (namely, in described scope, the log2 point value vs circulation # number of fluorescence shows as linearity).

Therefore, in real time amplification, as the C of sample_tValue (" SAM C_t") be lower than the C of negative control_tValue (" NC C_t") time, usually can infer the existence of given nucleic acid in the sample; As SAM C_t≤(NC C _t-1) time, can preferably infer, for example SAM C_t≤(NC C _t-2)、SAM C _t ≤(NC C _t-3) or SAM C_t≤(NC C _t-4), preferred, as SAM C_t≤(NC C _t-5) time, such as SAM C_t≤(NC C _t-6)、SAM C _t≤(NC C _t-7)、SAM C _t≤(NC C _t-8) or SAM C_t≤(NC C _t-9), in addition preferred, as SAM C_t≤(NC C _t-10) time, such as SAM C_t≤(NC C _t-11)、SAM C _t≤(NC C _t-12)、SAM C _t≤(NC C _t-13)、 SAM C _t≤(NC C _t-13) or SAM C_t≤(NC C _t-14), also preferred, as SAM C_t ≤(NC C _t-15) time, such as SAM C_t≤(NC C _t-16)、SAM C _t≤(NC C _t-17)、SAM C _t≤(NC C _t-18) or SAM C_t≤(NC C _t-19), also preferred, as SAM C_t≤(NC C _t-20) time, such as SAM C_t≤(NC C _t-25)、SAM C _t≤(NC C _t-30) or SAM C_t≤ (NC C _t-15)。

Therefore, in real time amplification, as SAM C_tBe not less than (for example: equal, no better than or greater than) NC C_tThe time, perhaps, when preferably being not less than above-described preferred difference, usually can infer " disappearance " of nucleic acid described in the sample.

As above-mentioned, in not using the real-time amplification system of sequence-specific probe (for example: when using the non-specific DNA dyestuff of sequence to detect amplified production, described dyestuff such as SYBR Green I), can verify by implementing melt curve analysis analysis and definite Tm the specificity of amplified production. When the thaw temperature of determining when the Tm that observes and calculated value and/or the experiment of expection amplicon is identical or basic identical (preferably in ± 3 ℃ of scopes, more preferably ± 2 ℃, more preferably ± 1 ℃, even more preferably ± 0.5 ℃, more preferably ± 0.2 ℃ or ± 0.1 ℃), can infer the existence of specific amplified product.

Further, when the melt curve analysis analytical table of amplified production reveals single Tm, can preferably infer specific amplified reaction. Optionally, or in addition, when amplified production when gel electrophoresis shows single, expection big or small, can preferably infer specific amplified reaction. Yet, in practice, the appearance of one or more non-specific amplification products can tolerate also that to a certain extent that preferably works as this type of non-specific amplification product formation amplified production total amount (w/w) is lower than 50%, more preferably less than 40%, even more preferably less than 30%, more preferably less than 20%, more preferably less than 10%, further more preferably less than 5%, even more preferably less than 2%, and most preferably be lower than 1%, as be lower than 0.5% or be lower than 0.1%. Can observe this type of non-specific amplification product, one or more extra Tm peaks occur in for example analyzing by melt curve analysis, and/or occur one or more extra product sizes in the gel electrophoresis.

Further developing of invention, notice that the amplicon that uses identical combination of primers, increases can show different Tm values from the nucleic acid in different event source, may be owing to some differences on the sequence between this type of amplicon. And unrestricted, use combination of primers SEQ ID NO:11 and 12 (tables 4) are to the amplicon of Bt11 and Bt176 amplification as example, and its Tm shows this type of difference. Therefore, the Tm value of observing can be used as other distinctive information of using in the inventive method, thereby obtains existence and the more detailed prompting of disappearance from the nucleic acid of this type of particular event.

Optionally, or in addition further variant, although can use specific combination of primers, from one or more events, amplify specific nucleic acid, but, in one or more other events, use identical primer possibly can't amplify corresponding nucleic acid, this may be because some sequence differences in the primer binding site. In this type of situation, must use two or more combination of primers from different event, to increase corresponding nucleic (in this regard, it is unfavorable selecting a kind of combination of primers amplification of nucleic acid from all target plant events), this has also produced advantage, can provide about in the sample from the existence of the nucleic acid of particular event and the extraneous information of disappearance. For example, it is favourable using combination of primers SEQ ID NO:30 and 31 to detect CryAb nucleic acid from MON810, is favourable and use combination of primers SEQ ID NO:11 and 12 (tables 4) to detect from Bt11 and Bt176.

It will be understood by those skilled in the art that amplified reaction such as PCR, can produce accessory substance non-specific, " primer-dimer ". By different sizes and/or Tm (normally less), can distinguish easily the product of this type of primer-dimer product and one or more specific amplifieds. Therefore, those skilled in the art can identify the impact that this type of artefact is analyzed amplified reaction, and minimize it. Invent preferred primer, for example enumerate in the table 1 and 4, through design the impact of primer dimer is minimized.

Another problem is the sensitivity of the detection method used of the present invention, it can preferably be expressed as method " detectability (LOD) ", this paper middle finger can detect easily, but minimum flow or the concentration of analyte in sample that needn't be quantitative (specific nucleic acid that detects herein). " easily detect " means to contain the sample of the analyte of LOD amount or concentration as used in this article, in 〉=50% duplicate detection, can produce positive findings, preferably duplicate detection 〉=60% in, more preferably 〉=70%, even more preferably 〉=80%, still more preferably 〉=90%, most preferably 〉=95% even 〉=99%.

Preferably, the LOD that is fit to the detection method of invention use, be expressed as in this article the LOD copy number of the given target nucleic acid in the examined sample, it can be 10000 or lower, such as 9000 or lower, and 8000 or lower, 7000 or lower or 6000 or lower, more preferably 5000 or lower, such as 4000 or lower, 3000 or lower or 2000 or lower, even more preferably 1000 or lower, such as 900 or lower, 800 or lower, 700 or lower or 600 or lower, still more preferably 500 or lower, such as 400 or lower, 300 or lower or 200 or lower, still more preferably 100 or lower, such as 90 or lower, 80 or lower, 70 or lower or 60 or lower, most preferably 50 or lower, preferred embodiment as example, comprise 40 or lower, 30 or lower, 20 or lower or even 10 or lower, such as 1,2,3,4,5,6,7,8 or 9. Inventing preferred primer, as enumerating in table 1 and 4, is to realize highly sensitive especially (low LOD) through design.

As used in this article, term " maize " refers to maize (Zea mays), preferred maize species mays, comprise can with all botanical varieties of maize hybridization, comprise the teosinte kind; Term " rapeseed (rapeseed) ", " rape (oilseed rao) " or " canola oil dish (canola) " interchangeable finger colea (Brassica napus), comprise can with all botanical varieties of rapeseed hybridization, comprise Wild Rape seed species; Term " soya bean (soya) ", " soybean (soy) ", " soybean (soya bean) " or " soybean (soybean) " interchangeable finger soybean (Glycine max), comprise can with all botanical varieties of soybean hybridization, comprise the wild soybean species; Term " rice " refers to rice (Oryza sativa), includes but not limited to India's species and Japanese species, comprise can with all botanical varieties of rice hybridization, comprise the wild rice species; Term " beet " refers to beet (Beta vulgaris), comprise can with all botanical varieties of beet hybridization, comprise wild beet species; Term " cotton " refers to Gossypium (Gossypium species), preferred upland cotton (Gossypium hirsutum), comprise can with all botanical varieties of cotton hybrid, comprise the wild cotton Pittosporum; Term " potato " refers to potato (Solanum tuberosum), comprise can with all botanical varieties of potato hybridization, comprise wild potato species.

Herein, the name of being familiar with those of skill in the art by the conventional usefulness in this area refers to the genetically modified plants event. Yet as further help, following table 2 has been summed up other information, is enough to specifically differentiate described event.

The discriminating of table 2. genetically modified plants event

The unique identification of above enumerating (UI) has been described the system of the genetically modified plants event unique classification of OECD (OECD) formulation, and be described in the publication of this tissue: the ENV/JM/MONO (2002) 7 on October 20th, 2004: " OECD Guidance for the Designation of a Unique Identifier for Transgenic Plants ", and on ENV/JM/MONO (2002) 7/REV1 on November 7th, 2006. Described unique identification is international, identification and distributes, comprise Europe domestic (referring to for example: executive committee's regulations (EC) No 65/2004 on January 14th, 2004, set up as the organism growth of genetic modification and distribute the uniquely identified system).

Can be by the public visit port of different management organizations, acquisition is about the details of above and other target genetically modified plants event, such as the information about host's taxonomical unit, transformation construct, insetion sequence etc., described management organization for example comprises: OECD BioTrack Product database (http://www2.oecd.org/biotech/default.aspx), US FDA (http://www.cfsan.fda.gov/), the GM of European Economic Community food and feed registration section (http://ec.europa.eu/food/dyna/gm_register/index_en.cfm), Agbios database (www.agbios.com), or EC GMO Compass database (http://www.gmo-compass.org/), and in the scientific literature etc. Those skilled in the art are very clear and can use this type of database source.

In addition, event-specific detection method and construct method for detecting specificity (for example referring to Codex Alimentarium) are commercially available, and the above-mentioned event of difference that can be clear and definite and other events. For example, European Economic Community's reference laboratories (CRL) (http://gmo-crl.jrc.it/; Http:// gmo-crl.jrc.it/statusofdoss.htm) enumerated and be used for the method that event-specific detects, as that provided by the manufacturer, that describe in the scientific literature or CRL oneself develops.

As mentioned above, invention allows to infer existence and the disappearance of material in the sample, and described material source is from selected event, its hybridization, or its dependent event.

In context, term " its hybridization (cross) " refers to by two or more compatible events (namely, can hybridize, the event that particularly belongs to same category unit) one or many is hybridized in succession, the offspring who obtains, thus make the offspring of described acquisition comprise transgenosis Insert Fragment from two or more parent's events of hybridization.

In context, term " its dependent event " refers to introduce in the identical taxonomical unit by transformation construct that will be identical with each description event, and the event that produces, but with described event difference is arranged, for example: generally can be the quantity of transformation construct and/or the difference of genomic integration site. Usually, this type of event itself can be obtained the authorization. In other examples, this type of dependent event can show as unwanted pollutant. Therefore, by detecting from the genetic elements in the transformation construct, the method for invention allows favourable this type of event of detection.

As mentioned above, the method for invention relates to existence and the disappearance of one or more nucleic acid in the test sample, and described nucleic acid comprises those nucleic acid of a)-u) enumerating defined above, or is comprised of those nucleic acid of a)-u) enumerating.

Aspect this, described " nucleic acid source from and special for " specific classification unit, for example be defined as a) " Zm ", b) " BN ", c) " Gm ", o) " Or ", p) " Bv ", q) " Gs " and t) " St " nucleic acid of enumerating, mean to be derived from the sample the described nucleic acid of the genetic stocks of described specific classification unit, preferred gene group DNA, be derived from other taxonomical units, thereby for example outside the taxonomical unit of above enumerating, do not existing in the genetic stocks in the remaining taxonomical unit---it is undetectable using selected detection method. As example and unrestricted, the described nucleic acid that is derived from specific classification unit can not have homologue in other taxonomical units, perhaps its its homologue in other taxonomical units can have enough diversity sequences, thereby can not detect by selected detection method. For example, in detection site, such as the site of given nucleic acid internal probe or the hybridization of one or more amplimers, this type of homologue can show with given nucleic acid and be lower than 100% sequence homogeneity, preferably be lower than 95%, more preferably less than 90%, more preferably less than 85%, more preferably less than 80%, more preferably less than 75%, in the preferred illustrative embodiment, be lower than 70%, be lower than 65%, be lower than 60%, be lower than 55% or be lower than 50% sequence homogeneity.

In addition, the term nucleic acid that particularly uses in a)-u) " is derived from ", mean described nucleic acid source from separately taxonomical unit, genetic elements, gene, ORFs etc., even they---when finding---can have part-structure difference with its source in sample.

For example, the Downstream processing of vegetable material can cause the change of nucleic acid (for example DNA) structure, may be the fragmentation that causes nucleic acid the most significantly. In addition, sometimes can use function fragment or the variant of total length element in the genetically modified plants. Therefore, the nucleic acid that " being derived from " describes in above a)-u) can be, its fragment for example belongs to original nucleic acid as long as this type of fragment can be special. For example, this type of fragment can comprise at least 15 continuous base-pairs (bp) that it comes source sequence, preferred at least 20 continuous bp, such as at least 30 or at least 40 continuous bp, more preferably at least 50 continuous bp, such as at least 60 or at least 70 continuous bp, even more preferably at least 80 continuous bp, such as at least 90 continuous bp, more preferably at least 100 continuous bp, such as at least 150 continuous bp, more preferably at least 200 continuous bp, such as at least 300 continuous bp, at least 400 continuous bp or at least 500 continuous bp, or more, even can comprise the total length element.

Expection is from other nucleic acid modifications of the Downstream processing of vegetable material, and for example the part deamination is also considered under term " is derived from ".

In preferred embodiments, nucleic acid a) " Zm " be derived from zeistic endogenous alcohol dehydrogenase I gene (adh-1). The example of maize adh-1 gene but nonrestrictive sequence are found in accession number AF123535.1. in the GenBank database (http://www.ncbi.nlm.nih.gov/).

In other preferred embodiments, nucleic acid b) the endogenous acetyl of " Bn " From Europe rape-CoA carboxylase gene (acc) or endogenous Cruciferae albumen (cruciferin) gene. The example of colea acc gene but nonrestrictive sequence is found in the accession number X77576.1 of GenBank database; The example of Cruciferae GFP but nonrestrictive sequence is found in the accession number X14555.1 of GenBank database.

In other preferred embodiments, nucleic acid c) " Gm " is derived from the endogenous lectin gene (lec) of soybean. The example of soybean lec gene but nonrestrictive sequence is found in the accession number K00821.1 of GenBank database.

In other preferred embodiments, nucleic acid o) " Or " is derived from the endogenous phospholipase D (pld) of rice. The example of rice pld gene but nonrestrictive sequence is found in the accession number AB001919 of GenBank database.

In other preferred embodiments, nucleic acid p) " Bv " is derived from the endogenous glutamine synthetase gene (GluA3) of beet. The example of beet GluA3 gene but nonrestrictive sequence is found in the accession number AY026353.1 of GenBank database.

In preferred embodiments, nucleic acid q) " Gs " is derived from endogenous cinnabar arabidopsis homologue 7 genes (sah-7) of cotton. The example of cotton sah-7 gene but nonrestrictive sequence is found in the accession number AY117067 (author: the people such as Senchina, 2003. MoI Biol Evol 20 (4): 633-643) of GenBank database.

In preferred embodiments, nucleic acid t) " St " is derived from the endogenous UDP-glucose pyrophosphorylase gene (UDP-glucose pyrophosphorylase, UGPase) of potato. The example of potato UGPase gene but nonrestrictive sequence is found in the accession number U20345 of GenBank database.

In other preferred embodiments, the nucleic acid source in general plant-source is from zeistic endogenous chloroplaset RBCL enzyme gene (rbcl). The example of maize rbcl gene but nonrestrictive sequence is found in the accession number Z11973.1 of GenBank database.

Those skilled in the art can be according to above-mentioned sequence, the specific probe that design and checking are used in the detecting step of the inventive method or primer pair.

In this specification to d)-n), r), s) and the list of references of the described sequential element of the nucleic acid of u) enumerating and gene, it is known to be that plant genetic is modified the those of skill in the art in field. Therefore, it will be appreciated by those skilled in the art which sequence these names refer to, also understand when producing genetically modified plants, to the routine change level of these sequences.

In embodiments, the nucleic acid that occurs in the genetically modified plants can comprise the ORFs of gene described herein or its funtion part (namely, described gene f above particularly)-n), r), s) and the gene of u) enumerating the part of the effect of in genetically modified plants, realizing ideal).

But, as further instruction and unrestricted, hereinafter enumerated about d)-n), r), s) and the u) exemplary sequence of indication specific gene and element, and the nucleic acid in the general plant of example-source:

Sequential element/gene GenBank accession number

CMV p35S promoter V00140 (complete CAMV genome)

NOS terminator V00087.1

Cry1Ab ORF AF465640

Bar gene ORF AY346130.1

Pat gene ORF DQ156557.1

EPSPS gene ORF AY125353.1

The Cry3A gene ORF AR836206.1 that modifies

Glb1 promoter CS155614.1

Cry3Bb1 gene ORF CS410008.1

Bxn gene ORF E01313.1

Cry1Ac gene ORF EF094884.1

Cry2Ab2 gene ORF DQ361266.1

Gbss gene ORF X58453.1

Maize Chloroplast rbcL Gene Z11973.1

Should be appreciated that in esse nucleic acid can comprise with above-mentioned exemplary sequence having the to a certain degree sequence of difference in the genetically modified plants event. For example, this type of difference can comprise base deletion, interpolation and/or replacement, brachymemma (for example, comprising function fragment), with the fusion of other elements (such as: merge with film transhipment or organelle sorting signals) etc.

In many examples, determined the actual sequence of the above and other element found in the transgenic event, and can obtain by GenBank and other sequence libraries. Therefore, in order to differentiate the zone of the most suitable derive probe or amplicon in the above-mentioned nucleic acid, should the implementation sequence comparison.

Therefore, the part that is derived from each above-mentioned nucleic acid that probe or amplicon (and corresponding combination of primers) can be favourable, described nucleic acid is present in most of transgenic event, and/or shows the highest sequence homogeneity between different transgenic events. This type of probe or primer are to increasing the probability that detects specific nucleic acid from different transgenic events. Those skilled in the art can illustrate according to this, implement essential sequence alignment.

As described in summary section, invention also provide use in the step (2) at said method, the potential existence of deduction material and the favorable method of disappearance, wherein said material is from one or more target genetically modified plants events. Especially, the sample result that obtains in the step (1) is expressed as G_SAMGroup, its representative detects the set of those nucleic acid in sample, and described nucleic acid is selected from the nucleic acid group that comprises above a)-u) enumerate, or is selected from the group that is comprised of the nucleic acid of a)-u) enumerating; And more described G_SAMGroup and one or more groups target G that represents individual event to be assessed_X Target G_XGroup is comprised of such nucleic acid, or in other words, represents the set of such nucleic acid, and wherein, described nucleic acid is selected from the nucleic acid group that comprises above a)-u) enumerate, or is selected from the group that is comprised of the nucleic acid of a)-u) enumerating; Described nucleic acid is present in each event, if and sample contains and be derived from each event, relate to the hybridization of described event or the material of dependent event, then can in step (1), detect (in described step (1) can detect the scope of existence of described nucleic acid).

Following table 3 has been enumerated those nucleic acid a)-u) enumerated that exist in the specific objective incident:

The feature of table 3. incident

Incident	?a	??b	??c	??d	??e	??f	??g	??h	??i	??j	??k	??l	??m	??n	??o	??p	??q	??r	??s	??t	??u
Incident	?a	??b	??c	??d	??e	??f	??g	??h	??i	??j	??k	??l	??m	??n	??o	??p	??q	??r	??s	??t	??u	??Bt176	?+	??-	??-	??+	??-	??+	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??Bt11	?+	??-	??-	??+	??+	??+	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??Bt176	?+	??-	??-	??+	??-	??+	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??Bt11	?+	??-	??-	??+	??+	??+	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??Bt10	?+	??-	??-	??+	??+	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??MON810	?+	??-	??-	??+	??+	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??Bt10	?+	??-	??-	??+	??+	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??MON810	?+	??-	??-	??+	??+	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??MON863	?+	??-	??-	??+	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??TC1507	?+	??-	??-	??-	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??MON863	?+	??-	??-	??+	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??TC1507	?+	??-	??-	??-	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??NK603	?-	??-	??-	??+	??+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??T25	?+	??-	??-	??+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??NK603	?-	??-	??-	??+	??+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??T25	?+	??-	??-	??+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??GA21	?+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??DAS-59122	?+	??-	??-	??+	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??GA21	?+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??DAS-59122	?+	??-	??-	??+	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??MIR604	?+	??-	??-	??-	??+	??-	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??LY038	?+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??MIR604	?+	??-	??-	??-	??+	??-	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??LY038	?+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??MON88017	?+	??-	??-	??+	??+	??-	??-	??-	??+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-
??Topas?19/2	?-	??+	??-	??+	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??MON88017	?+	??-	??-	??+	??+	??-	??-	??-	??+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-
??Topas?19/2	?-	??+	??-	??+	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??MS1	?-	??+	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??RF1	?-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??MS1	?-	??+	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??RF1	?-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??RF2	?-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??RF3	?-	??+	??-	??-	??+	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??RF2	?-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??RF3	?-	??+	??-	??-	??+	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??MS8	?-	??+	??-	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??GT73	?-	??+	??-	??-	??-	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??MS8	?-	??+	??-	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??GT73	?-	??+	??-	??-	??-	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??T45	?-	??+	??-	??+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??Liberator??pHoe6/Ac	?-	??+	??-	??+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??T45	?-	??+	??-	??+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??Liberator??pHoe6/Ac	?-	??+	??-	??+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??GS40/90pHoe6/Ac	?-	??+	??-	??+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??MS1/RF1	?-	??+	??-	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??GS40/90pHoe6/Ac	?-	??+	??-	??+	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
??MS1/RF1	?-	??+	??-	??-	??-	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??MS1/RF2	?-	??+	??-	??-	??+	??-	??+	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-

Incident	a	b	c	d	e	f	g	h	i	j	k	l	m	n	o	p	q	r	s	t	u
Incident	a	b	c	d	e	f	g	h	i	j	k	l	m	n	o	p	q	r	s	t	u	MS8/RF3	-	+	-	-	+	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-
OXY235	-	+	-	+	-	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	MS8/RF3	-	+	-	-	+	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-
OXY235	-	+	-	+	-	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	MON?40-3-2	-	-	+	+	+	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-
MON89788	-	-	+	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	MON?40-3-2	-	-	+	+	+	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-
MON89788	-	-	+	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	A2704-12	-	-	+	+	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-
A5547-127	-	-	+	+	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	A2704-12	-	-	+	+	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-
A5547-127	-	-	+	+	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	LL62	-	-	-	+	-	-	+	-	-	-	-	-	-	-	+	-	-	-	-	-	-
LL06	-	-	-	+	-	-	+	-	-	-	-	-	-	-	+	-	-	-	-	-	-	LL62	-	-	-	+	-	-	+	-	-	-	-	-	-	-	+	-	-	-	-	-	-
LL06	-	-	-	+	-	-	+	-	-	-	-	-	-	-	+	-	-	-	-	-	-	LL601	-	-	-	+	+	-	+	-	-	-	-	-	-	-	+	-	-	-	-	-	-
T120-7	-	-	-	+	-	-	-	+	-	-	-	-	-	-	-	+	-	-	-	-	-	LL601	-	-	-	+	+	-	+	-	-	-	-	-	-	-	+	-	-	-	-	-	-
T120-7	-	-	-	+	-	-	-	+	-	-	-	-	-	-	-	+	-	-	-	-	-	H7-1	-	-	-	+	-	-	-	-	+	-	-	-	-	-	-	+	-	-	-	-	-
A5-15	-	-	-	+	+	-	-	-	+	-	-	-	-	-	-	+	-	-	-	-	-	H7-1	-	-	-	+	-	-	-	-	+	-	-	-	-	-	-	+	-	-	-	-	-
A5-15	-	-	-	+	+	-	-	-	+	-	-	-	-	-	-	+	-	-	-	-	-	LL?cotton?25	-	-	-	+	+	-	+	-	-	-	-	-	-	-	-	-	+	-	-	-	-
MON?1445	-	-	-	+	+	-	-	-	+	-	-	-	-	-	-	-	+	-	-	-	-	LL?cotton?25	-	-	-	+	+	-	+	-	-	-	-	-	-	-	-	-	+	-	-	-	-
MON?1445	-	-	-	+	+	-	-	-	+	-	-	-	-	-	-	-	+	-	-	-	-	MoN?531	-	-	-	+	+	-	-	-	-	-	-	-	-	-	-	-	+	+	-	-	-
MON?15985	-	-	-	+	+	-	-	-	-	-	-	-	-	-	-	-	+	+	+	-	-	MoN?531	-	-	-	+	+	-	-	-	-	-	-	-	-	-	-	-	+	+	-	-	-
MON?15985	-	-	-	+	+	-	-	-	-	-	-	-	-	-	-	-	+	+	+	-	-	EH-92-527-1	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	+	+

As already explained:

If-G _XBe G _SAMProper subclass

(G_{X} &Subset; G_{SAM}),

G_{X} &NotSubset; G_{SAM}

In other embodiment preferred, if G _XEqual G _SAMIf, and G _X(special, the combination representative is selected from the incident of such group, and described group comprises following incident, or is made up of following incident: G not have other any one group or any two or more sets representative incidents in addition _Bt176, G _Bt11, G _Bt10, G _MON810, G _MON863, G _TC1507, G _NK603, G _T25, G _GA21, G _DAS-59122, G _MIR604, G _LY038, G _MON88017, G _{Topas 19/2}, G _MS1, G _RF1, G _RF2, G _MS1/RF1, G _MS1/RF2, G _MS8, G _RF3, G _MS8/RF3, G _GT73, G _T45, G _{Liberator pHoe6/Ac}, G _{GS40/90pHoe6/Ac}, G _OXY235, G _MON40-3-2, G _MON89788, G _A2704-12, G _A5547-127, GLL62, G _LL06, G _LL601, G _T120-7, G _H7-1, G _A5-15, G _{LL cotton 25}, G _MON1445, G _MON531, G _MON15985And G _EH92-527-1) and G _XEquate, then have the material that is derived from transgenic plant incident X or its hybridization or its dependent event in the sample.

In the further developing of this appraisal procedure, comprise above a)-u) enumerate or be endowed different unique values by the nucleic acid of a)-u) enumerating of forming.Therefore, G _SAMAssignment " the VG of group _SAM" be to give detected in the step (1), as to be present in the nucleic acid in the sample a plurality of unique assignment; And target G _XAssignment " the VG of group _X" be a plurality of unique assignment of giving the nucleic acid that is selected from following group, the nucleic acid that described group comprises above a)-u) enumerates, or be made up of the nucleic acid of a)-u) enumerating is present in the described incident and can detects in step (1).

Therefore, in the preferred embodiment, nucleic acid " Zm ", " Bn ", " Gm ", " p35S ", " tNOS ", " CrylAb ", " PAT/bar ", " PAT/pat ", " CP4-EPSPS ", " mCry3A ", " cordap A ", " Glb1 ", " Cry3Bb1 ", " Bxn ", " Or ", " Bv ", " Gs ", " Cry1Ac ", " Cry2ab2 ", " St " have given different unique value " V with " Gbss " _Zm", " V _Bn", " V _Gm", " V _P35S", " V _TNOS", " V _CrylAb", " V _PAT/bar", " V _PAT/pat", " V _CP4-EPSPS", " V _MCry3A", " V _{Cordap A}", " V _Glb1", " V _Cry3Bb1", " V _Bxn", " V _Or", " V _Bv", " V _Gs", " V _Cry1Ac", " V _Cry2ab2", " V _St" and " V _Gbss", and every group of target G _XAll given each value that is selected from following value group group " VG _X", described value group comprises following value, or is made up of following value: " VG _Bt176", " VG _Bt11", " VG _Bt10", " VG _MON810", " VG _MON863", " VG _TC1507", " VG _NK603", " V " G _T25", " VG _GA21", " VG _DAS-59122", " VG _MIR604", " VG _LY038", " VG _MON88017", " VG _{Topas 19/2}", " VG _MS1", " VG _RF1", " VG _RF2", " VG _MS1/RF1", " VG _MS1/RF2", " VG _MS8", " VG _RF3", " VG _MS8/RF3", " VG _GT73", " VG _T45", " VG _{Liberator pHoe6/Ac}", " VG _{GS40/90pHoe6/Ac}", " VG _OXY235", " VG _MON40-3-2", " VG _MON89788", " VG _A2704-12", " VG _A5547-127", " VG _LL62", " VG _LL06", " VG _LL601", " VG _T120-7", " VG _H7-1", " VG _A5-15", " VG _{LL cotton 25}", " VG _MON1445", " VG _MON531", " VG _MON15985"

" VG _EH92-527-1",, wherein

-VG _Bt176＝V _Zm×V _p35S×V _Cry1Ab?×V _PAT/bar，

-VG _Bt11＝V _Zm×V _p35S×V _tNOS×V _Cry1Ab×V _PAT/pat，

-VG _Bt10＝V _Zm×V _p35S×V _tNOS×V _Cry1Ab×V _PAT/pat，

-VG _MON810＝V _Zm×V _p35S×V _tNOS×V _Cr/1Ab，

-VG _MON863＝V _Zm×V _p35S×V _tNOS，

-VG _TC1507＝V _Zm×V _p35S×V _PAT/pat，

-VG _NK603＝V _Zm×V _p35S×V _tNOS×V _CP4-EPSPS，

-VG _T25＝V _Zm×V _p35S×V _PAT/pat，

-VG _GA21＝V _Zm×V _tNOS，

-VG _DAS-59122＝V _Zm×V _p35S×V _PAT/bar，

-VG _MIR604＝V _Zm×V _tNOS×V _mCry3A，

-VG _LY038＝V _Zm×V _p35S×V _tNOS×V _cordapA×V _Glb1，

-VG _MON88017＝V _Zm×V _p35S×V _tNOS×V _CP4-EPSP×V _Cry3Bb1，

-VG _Topas?19/2＝V _Bn×V _p35S×V _PAT/pat，

-VG _MS1＝V _Bn×V _tNOS×V _PAT/bar，

-VG _RF1＝V _Bn×V _tNOS×V _PAT/bar，

-VG _RF2＝V _Bn×V _tNOS×V _PAT/bar，

-VG _MS8＝V _Bn×V _tNOS×V _PAT/bar，

-VG _RF3＝V _Bn×V _tNOS×V _PAT/bar，

-VG _MS1/RF1＝V _Bn×V _tNOS×V _PAT/bar，

-VG _MS1/RF2＝V _Bn×V _tNOS×V _PA?T/bar，

-VG _MS8/RF3＝V _Bn×V _tNOS×V _PAT/bar，

-VG _GT73＝V _Bn×V _CP4-EPSPS，

-VG _T45＝V _Bn×V _p35S×V _PAT/pat，

-VG _{LiberatorpHoe6/Ac}＝V _Bn×V _p35S×V _PAT/pat，

-VG _{GS40/90pHoe6/Ac}＝V _Bn×V _p35S×V _PAT/pat，

-VG _OXY235＝V _Bn×V _p35S×V _Bxn，

-VG _MON40-3-2＝V _Gm×V _p35S×V _tNOS×V _CP4-EPSPS，

-VG _MON89788＝V _Gm×V _CP4-EPSPS，

-VG _A2704-12＝V _Gm×V _p35S×V _PAT/pat，

-VG _A5547-127＝V _Gm×V _p35S×V _PAT/pat，

-VG _LL62＝V _Or×V _p35S×V _PAT/bar，

-VG _LL06＝V _Or×V _p35S×V _PAT/bar，

-VG _LL601＝V _Or×V _p35S×V _tNOS×V _PAT/bar，

-VG _T120-7＝V _Bv×V _p35S×V _PAT/pat，

-VG _H7-1＝V _Bv×V _p35S×V _CP4-EPSPS，

-VG _A5-15＝V _Bv×V _p35S×V _tNOS×V _CP4-EPSPS，

-VG _LL?cotton?25＝V _Gs×V _p35S×V _tNOS×V _PAT/bar，

-VG _MON1445＝V _Gs×V _p35S×V _tNOS×V _CP4-EPSPS，

-VG _MON531＝V _Gs×V _p35S×V _tNOS×V _Cry1Ac，

-VG _MON15985＝V _Gs×V _p35S×V _tNOS×V _Cry1Ac×V _Cry1Ac，

Or-VG _EH92-527-1=V _StxV _TNOSXV _Gbss

Notice, in above-mentioned scope, this method do not test a)-u) in the existence of all nucleic acid, should define above-mentioned value according to the nucleic acid that its existence obtains Validity Test.As example and unrestricted, j defined above)-n), r), s) and the nucleic acid u) enumerated, corresponding d)-i) characteristic beyond the nucleic acid of definition, when not detecting last class nucleic acid, just can define the value corresponding, especially: Zea mays incident value VG in narrower mode with some incidents _MIR604=V _ZmXV _TNOS, VG _LY038=V _ZmXV _P35SXV _TNOS, VG _MON88017=V _ZmXV _P35SXV _TNOSXV _CP4-EPSPSRape incident value VG _OXY235=V _BnXV _P35SCotton event value VG _MON531=V _GsXV _P35SXV _TNOS, VG _MON15985=V _GsXV _P35SXV _TNOSWith potato incident value VG _EH92-527-1=V _StXV _TNOS

Therefore, the step of this embodiment (iii) can comprise every group of target G of enforcement _XLogical operation:

If-VG _SAM/ VG _XEqual 1, then potential existence is derived from the material of transgenic plant incident X or its hybridization or its dependent event in the sample;

If-VG _SAM/ VG _XEqual a value, or the multiplier of two or more values, then potential existence is derived from the material of transgenic plant incident X or its hybridization or its dependent event in the sample, and wherein said value is selected from the group that comprises following value, or is selected from the group that is made up of following value: V _Zm, V _Bn, V _Gm, V _P35S, V _TNOS, V _CrylAb, V _PAT/bar, V _PAT/pat, V _CP4-EPSPS, V _MCry3A, V _{Cordap A}, V _Glb1, V _Cry3Bb1, V _Bxn, V _Or, V _Bv, V _Gs, V _Cry1Ac, V _Cry2ab2, V _StAnd V _Gbss

If-VG _SAM/ VG _XBe not equal to 1, and be not equal to a such value, or during the multiplier of so two or more values, then be not derived from the material of transgenic plant incident X or its hybridization or its dependent event in the sample, wherein said value is selected from the group that comprises following value, or is selected from the group that is made up of following value: V _Zm, V _Bn, V _Gm, V _P35S, V _TNOS, V _CrylAb, V _PAT/bar, V _PAT/pat, V _CP4-EPSPS, V _MCry3A, V _{Cordap A}, V _Glb1, V _Cry3Bb1, V _Bxn, V _Or, V _Bv, V _Gs, V _Cry1Ac, V _Cry2ab2, V _StAnd V _Gbss

In other preferred work-around solutions of above-mentioned embodiment, if VG _SAM/ VG _XEqual 1, and if except that VG _XOutside, represent in the group of incident without any a value, or equal VG without any the multiplier of two or more values _X(especially, described value is selected from the group that comprises following value, or is selected from the group that is made up of following value: VG _Bt176, VG _Bt11, VG _Bt10, VG _MON810, VG _MON863, and VG _TC1507, VG _NK603, VG _T25, VG _GA21, VG _DAS-59122, VG _MIR604, VG _LY038, VG _MON88017, VG _{Topas 19/2}, VG _MS1, VG _RF1, VG _RF2, VG _MS1/RF1, VG _MS1/RF2, VG _MS8, VG _RF3, VG _MS8/RF3, VG _GT73, VG _T45, VG _Liberator _PHoe6/Ac, VG _{GS40/90pHoe6/Ac}, VG _OXY235, VG _MON40-3-2, VG _MON89788, VG _A2704-12, VG _A5547-127, VG _LL62, VG _LL06, VG _LL601, VG _T120-7, VG _H7-1, VG _A5-15, VG _{LL cotton 25}, VG _MON1445, VG _MON531, VG _MON15985And VG _EH92-527-1), then there is the material that is derived from transgenic plant incident X or its hybridization or its dependent event in the sample.

In other embodiment preferred, the unique value of giving nucleic acid is unique primer number, and those nucleic acid that described nucleic acid comprises a)-u) enumerates, or be made up of those nucleic acid of a)-u) enumerating promptly, are selected from and comprise following value or the group that is made up of following value: V _Zm, V _Bn, V _Gm, V _P35S, V _TNOS, V _CrylAb, V _PAT/bar, V _PAT/pat, V _CP4-EPSPS, V _MCry3A, V _{Cordap A}, V _Glb1, V _Cry3Bb1, V _Bxn, V _Or, V _Bv, V _Gs, V _Cry1Ac, V _Cry2ab2, V _StAnd V _Gbss, and step comprises that (iii) implementing each organizes target G _XLogical operation,

If-VG _SAM/ VG _XBe the integer greater than 1, then potential existence is derived from the material of transgenic plant incident X or its hybridization or its dependent event in the sample;

If-VG _SAM/ VG _XNot integer, then be not derived from the material of transgenic plant incident X or its hybridization or its dependent event in the sample.

The contriver thinks, as described in above-mentioned chapters and sections, uses the primer number to represent each analysis proterties (nucleic acid), is especially intuitively, and helps the rationalization and the simplification of data analysis.

Given this, the contriver has also considered to use primer to count the general applicability of method in other are used that decryption is analyzed herein, for example in molecular biology or molecular medicine field etc.Therefore, in one application, method can be used for determining the composition of sample usually, wherein said sample can comprise that (the speech incident of using in this section has common definition to two or more different incidents, be not limited to the transgenic plant incident) or its material, wherein, characterize each incident (speech feature and the proterties used in this section have common definition, be not limited to but preferably include nucleic acid) by one or more features or proterties.Therefore, can be (promptly with unique primer value of the product of each test feature or proterties, computing " x ") represents sample and each incident, and (potential) of incident described in the described sample or its material exists and disappearance can be passed through division (promptly, computing "/") tests, described division is the value that obtains with sample calculated value and the assignment divided by each incident, and makes the suitably result of the described division of change back consideration as indicated above.

In preferred embodiments, come the aforementioned calculation step of manner of execution step (2), for example counter or computer by calculating device; The calculating device of aforementioned calculation has also been considered to implement in other aspects of invention; Comprise the data carrier (for example disk, CD-ROM etc.) of specification sheets, described specification sheets is used to the programmable computing device of the step (2) (comprising aforementioned calculation) of the method for carrying out an invention; Test kit, it comprises this type of data carrier and effective one or more reagent in inventive method.The application based on web of algorithm of permission implementation step (2) has also been considered in invention, and is optional, by the hyperlink that embeds, can be in the database of association the direct information of evaluate events potential existence in sample.

Should be appreciated that the sign " G that above uses at specification sheets _SAM", " G _X", " VG _SAM", " VG _X" etc., be the artificial herein inherent notion that particularly makes up and be worth of selecting to represent respectively, can use other signs (for example other letters, speech or expression mode) to replace representing described combination and value.

As described, the method utilization amplification of invention, particularly to the pcr amplification of wherein amplicon, the preferably existence of assessment objective nucleic acid and disappearance, particularly be selected from the nucleic acid of such group, those nucleic acid that described group comprises above a)-u) enumerates, or form by those nucleic acid of above a)-u) enumerating.

Be appreciated that those skilled in the art can design each combination of primers usually, be used for from the specific amplification of known nucleotide sequence.

Yet, as above-mentioned, table 1 enumerated through the careful design of contriver, particularly advantageous primer is right, when using in the our science of law, can provide multiple benefit.In addition, table 4 has been enumerated the primer of table 1, comprise that also other primer and the primer that also has the performance of making us very satisfied in the method is right, but the primer of table 1 still is contriver's optimal selection.In the various nucleic acid that these primer sets can exist, and from various finished vegetable materials, advantageously realize amplification from the corresponding plants incident, and be created in the multiple inevitable advantage that its elsewhere of this specification sheets was described.

Table 4. primer sequence

More than comprising delegation, table 4 relates to that (for example: the several rows of corresponding " Cry1Ab " and " CP-EPSPS "), any one or more primer of the described primer sets of the described different rows of table 4 all can be used for increasing when increasing a kind of specific nucleic acid by different primer sets.When table 4 in delegation, when having enumerated one or more forward and/or reverse primer and being used to increase specific nucleic acid (for example: corresponding " Bn (ACC) ", " Gm (lectin) " or " CP4-EPSPS "), the described forward primer of any one or any combination can combine with the described reverse primer of any or any combination and is used for obtaining amplification.

In addition, invention also provides the variant primer, and it is compared with the primer that table 4 is enumerated, and comprises that one or more sequences change, for example: one or more disappearances, insertion and/or replacement, as long as this type of primer/primer is to still realizing the abundant amplification to corresponding amplicon.Preferably, this type of variant primer can show the primer of enumerating with table 4 at least 85%, and more preferably at least 90%, even more preferably at least 95%, still more preferably at least 96%, at least 97%, at least 98%, or at least 99% sequence identity.For example can utilizing, basic local comparison research tool (BLAST) carries out sequence alignment, and definite sequence identity, described instrument is described in people such as Altschul at first, among 1990 (the J MoI Biol 215:403-10), " Blast 2sequences " algorithm of describing among Tatusova and the Madden 1999 (FEMS Microbiol Lett 174:247-250) for example.

In addition, invention has considered that also the nested primer and the primer of suitable amplicon amplification is right, and described amplicon is arranged in the sequence of primer to amplifying from each nucleic acid of utilizing table 1 or table 4 to enumerate.As description other in this specification sheets, primer and the right derivative of primer enumerated in table 1 or the table 4 also considered in invention.

Therefore, primer and primer that invention provides table 1 or table 4 to enumerate are right, and variant and derivative are optional, described primer and/or primer to or any suitable combination of its variant and derivative.

In other respects, invention provides and has utilized above-mentioned primer and primer right, particularly utilizes the primer of discussing in table 1 or the table 4 right, or its variant or derivative, the amplified production that can obtain from each nucleic acid.Described amplified production can also further be processed, for example: separate, be cloned in suitable carriers or the plasmid, be transformed into recombinant host, in for example suitable host bacterium such as intestinal bacteria, also therefrom separate order-checking etc. in host's internal breeding.

Advantageously, described amplified production preferably through cloning and separating, may be included in the suitable plasmid or carrier, can be used as the positive control of the detection step effect of verifying the inventive method that is intended to various nucleic acid in the test sample.Optionally, or in addition, this type of amplified production (clone's or isolating) can be used as the caliberator (calibrator) of determining the amount of specific template in the sample, for example, and in RCR in real time.

Therefore, in other respects, invention provides recombination bacillus coli, it is according to budapest treaty, the biological product collecting center of Norme Belge (BCCM) on January 10th, 2007 with LMBP preserving number LMBP 5452, LMBP 5453, LMBP 5454, LMBP 5455, LMBP 5456, LMBP 5457, LMBP 5458, LMBP 5459 and LMBP 5460 preservations; In on March 6th, 2007 with LMBP preserving number LMBP 5451 preservations; In on April 19th, 2007 with LMBP preserving number LMBP 5587, LMBP 5588, LMBP 5589 and LMBP 5590 preservations.

Described recombination bacillus coli has comprised the amplified production of primer to obtaining of enumerating in the use table 5 on the template incident, described product cloning is in the EcoRI site of pUC18 cloning vector MCS:

Table 5

Except the intestinal bacteria and plasmid of the preservation enumerated in the table 5, invention also provides other exemplary plasmids, pUC18 for example, and described plasmid contains the insertion fragment, and described insertion fragment utilizes following amplification to obtain, for example:

-primer is used for colea acc gene (the exemplary insertion sequence SEQ ID NO:44 of Fig. 1, amplification is from the OSR wild-type) to SEQ ID NO:3 and 4;

-CP4-EPSPS primer is to SEQ ID NO:18 and 19, and SEQ ID NO:50 and 19, (primer SEQ IDNO:17 also is used for making up with primer SEQ ID NO:19 (exemplary insertion fragment increases respectively from incident 40-3-2 and incident NK603, obtains SEQ ID NO:45 and 46 each exemplary insertion sequence that shows among Fig. 1); But, compare with SEQID NO:50, primer SEQ ID NO:17 contains the sequence mispairing at Nucleotide 20 places, thereby SEQ IDNO:50 is more preferably);

-primer is used for Zea mays adh-1 gene (the exemplary insertion sequence SEQ ID NO:32 of Fig. 1, amplification is from the wild-type Zea mays) to SEQ ID NO:1 and 2;

-primer is used for soybean lectin gene (the exemplary insertion sequence SEQ ID NO:33 of Fig. 1, amplification is from the wild-type soybean) to SEQ ID NO:5 and 49;

-primer is used for amplicon shorter in the Zea mays adh-1 gene (the exemplary insertion sequence SEQ ID NO:70 of Fig. 1) to SEQ ID NO:56 and 57;

-primer is used for soybean max lectin amplicon (the exemplary insertion sequence SEQ ID NO:71 of Fig. 1) to SEQ ID NO:58 and 59 (SLTM);

-primer is used for the shorter amplicon (the exemplary insertion sequence SEQ ID NO:72 of Fig. 1) in the p35S element to SEQ ID NO:60 and 61;

-primer is used for the intragenic amplicon of beet GluA3 (the exemplary insertion sequence SEQ ID NO:76 of Fig. 1) to SEQ ID NO:64 and 65;

-primer is used for the intragenic amplicon of cotton sah-7 (the exemplary insertion sequence SEQ ID NO:77 of Fig. 1) to SEQ ID NO:66 and 67;

-primer is used for the intragenic amplicon of potato UGPase (the exemplary insertion sequence SEQ ID NO:78 of Fig. 1) to SEQ ID NO:68 and 69;

-primer is used for the amplicon (the exemplary insertion sequence SEQ ID NO:73 of Fig. 1, amplification is from MON 810 materials) in the Cry1Ab proterties to SEQ ID NO:11 and 12;

-primer is to SEQ ID NO:22 and 62 (RRS), perhaps SEQ ID NO:22 and 63 (GT73), be used for the amplicon (the exemplary insertion sequence of Fig. 1: SEQ ID NO:74 increases from GT73, and SEQ ID NO:75 amplification is from RRS) in the CP4-EPSPS proterties.

Notice, because the size that corresponding amplicon is short, can preferably combination use primer to SEQ ID NO:22 and 23, with primer to arbitrary or two in 62 and 63, be used for from unprocessed vegetable material (for example: plant tissue or seed) and finished material (for example: food or feed) amplification CP4-EPSPS, and primer is to SEQ ID NO:18 and 19, or 50 and 19, define long amplicon, can be preferred for unprocessed material.Therefore, primer is to SEQ ID NO:22 and 23, perhaps arbitrary or two s' combination in SEQ ID NO:22 and primer SEQ ID NO:62 and 63, in present method and test kit more preferably.

Invention also provides obtainable, isolating recombinant plasmid from the recombination bacillus coli bacterium that table 5 is enumerated, and isolating insertion fragment, and is preferred, and its EcoRI inserts fragment.Invention also provides any other recombinant microorganism with the isolating plasmid conversion of institute.

Those skilled in the art are further appreciated that invention can also provide described plasmid or its to insert segmental combination, and wherein said combination is the representative that is intended to detected those nucleic acid in the sample.

In addition, invention also provides from the bacterium that bacterium or other of table 5 were above set forth, and finds and the recombinant plasmid that obtains or insert segmental purposes that described purposes is as positive control in the inventive method and/or caliberator.For example; this type of plasmid or its insertion fragment that can comprise appropriate amount in the method for invention and the test kit; whether there are a certain amount of one or more incidents thereby also be convenient to decision, calibrates follow-up quantitatively, or determine whether existing incident is lower than acceptable threshold value.

Further developing of invention, also considered any primer of invention, any primer of particularly enumerating in table 1 or the table 4 for example, or its variant or derivative, can be used for genome walking strategy, the sequence adjacent in the genomic dna of discriminating incident with described primer.Similar, considered any primer based on the sequences Design of any amplicon of the present invention, for example particularly be arranged within the arbitrary amplicon sequence of SEQ ID NO:34 to SEQ ID NO:78, or with any primer of described sequence eclipsed, or the variant of this type of primer or derivative, can in genome walking strategy, be used for differentiating genomic dna, the sequence adjacent with described amplicon in incident.

When the amplicon of this amplification method generation had the feature (for example: length, Tm or sequence) that clearly belongs to particular event, this aspect was effective especially.In the case, the genome walking outside the amplicon of research can provide the additional sequences information about incident, thereby helps to differentiate described incident.In particularly preferred embodiments, Auele Specific Primer can be derived from p35 or tNOS amplicon.

Usually, genome walking strategy is generally known in the art.Example is particularly including inverse PCR, or people such as Riley, the vectorette method (vectorette method) of 1990 (Nucleic Acids Res 18:2887-90), and described method commerce turns to Universal Vectorette ^TMSystem (Sigma), and up-to-date simplification version is (referring to for example: Kilstrup ﹠amp; Kristiansen 2000.Nucleic Acids Res 28:e55).

In specific embodiment, the contriver has considered two step genome walking methods.In first amplification step, use LUX ^TMThe mixture of the invention primer of mark and random primer (about 8 to 15bp length usually), the preferred use has the grads PCR condition of the strict degree that increases progressively.Mark on the primer allows to follow the tracks of the amplified reaction whether labeled primer has taken place to relate to.In second amplification step, use from another nested primer and the described random primer of amplicon and implement nest-type PRC, described nested primer preferably also is LUX ^TMMark or its mark, and the preferred PCR condition of using high strictness.Mark on the primer allows to follow the tracks of the amplified reaction whether labeled primer has taken place to relate to.Finally, with the product order-checking that is obtained, thereby differentiate the sequence adjacent with amplicon.

In yet another aspect, invention provides the test kit of the part that is used to implement the inventive method,, is used for potential existence and disappearance that sample for reference is derived from the material of one or more transgenic plant incidents that is.

In embodiments, can comprise one or more or the whole probes of nucleic acid that is fit to detect above a)-u) enumerate according to the test kit of invention.

In embodiments, can comprise primer according to the test kit of invention, preferred primer is right, and it is fit to amplification and is positioned at one or more or the whole amplicons of a)-u) enumerating of nucleic acid defined above.

In another embodiment, test kit can comprise primer, and preferred primer is right, that it is fit to increase above a)-i) enumerate is a kind of, more than one, preferred whole nucleic acid.

In another embodiment, test kit can comprise primer, and preferred primer is right, it is fit to increase above a)-i), o), p), q) and t) enumerate a kind of, more than one, preferred whole nucleic acid.

In another embodiment, test kit can comprise primer, and preferred primer is right, and that it is fit to increase above a)-c) enumerate is a kind of, more than one or whole nucleic acid, and d above)-i) enumerate a kind of, more than one, preferred whole nucleic acid.

In another embodiment, test kit can comprise primer, preferred primer is right, it is fit to increase above a)-c), o), p), q), t) a kind of, more than one or the whole nucleic acid enumerated, and d above)-i) enumerate a kind of, more than one, preferred whole nucleic acid.

In addition, test kit can also comprise that primer or primer are right, as described in elsewhere in this specification sheets, is used for the amplification of general plant sequence.

Should be appreciated that, can be according to the preferential transgenic event that detects of hope, in the test kit of different designs, comprise that the primer and the primer of the nucleic acid different, this paper instruction that is used to increase is right.

In preferred embodiments, and consider the different choice discussed in the above-mentioned paragraph for nucleic acid to be amplified, test kit can comprise any, the multiple or whole primer as definition in table 1 or the table 4, preferably a kind of, more than one or all primer is right, or its variant or derivative.

In particularly preferred embodiments, one of any primer centering that comprises in the test kit or two primers can be marks.

In another particularly preferred embodiment, any primer that comprises in the test kit be to can containing at least one, and is generally a primer, with suitable fluorophore mark, and is designed to allow to use above-mentioned LUX ^TMDetection system detects in real time.

In other embodiments, test kit can also comprise amplified production, and is that for example clone and isolating again, and may be included in the suitable plasmid or carrier, and as above-mentioned, described amplified production can be used as the positive control and/or the calibration of inventive method.For example, can provide accurate measurement quantitatively or this type of amplified production of dilution (as the clone's with isolating again, and may be included in suitable plasmid or the carrier) as this type of purposes.As above-mentioned, can also design the various combination of this type of reagent.

In specific embodiment, test kit can comprise a kind of, more than one or the whole intestinal bacteria organisms of enumerating as table 5, and/or by its obtainable plasmid, and/or the isolating insertion fragment of described plasmid, preferred EcoRI inserts fragment, or its combination.

In other embodiments, as mentioned above, test kit can also comprise data carrier, wherein contains to be useful on the carry out an invention specification sheets of step (2) running of method of programmable computing device.

Understandable, this type of test kit can comprise other components, for example is used to hybridize, the assembly of PCR, detection etc.It will be appreciated by those skilled in the art that the potential use of this type of component.

In preferred embodiments, test kit can comprise one or more reaction components, the reaction component that in porous bar (strip) or porous plate (porous pattern), provides for example, each assembly has comprised that such composition and above-mentioned one or more ideal primers are right, wherein said composition constitutes (for example: Nucleotide, salt, heat stabilized polymer etc.) by the essential all components of pcr amplification reaction, but does not comprise template DNA.Therefore, in case the user introduces sample DNA to be analyzed in described composition, just can start the PCR reaction.Choose wantonly,, can also get rid of Taq or other heat-staple polysaccharases (but can independently be included in the test kit) in the composition, need add by the user in order to guarantee stability.Usually, composition can be a liquid, and when being used to the special purpose of transporting and storing, composition also can be a refrigerated.And, can also design freeze dried composition.

Embodiment

Embodiment 1: be used for the right amplification condition of selected primer that table 1 and 4 is enumerated

Optimized SYBR Green and detected PCR in real time, each primer that is used for utilizing table 1 and 4 to enumerate is right, and amplification is from the amplicon among nucleic acid " p35S ", " tNOS ", " CrylAb ", " PAT/Bar ", " PAT/pat ", " CP4-EPSPS ".

DNA isolation from the incident that contains (positive control) or disappearance (negative control) these nucleic acid, comprise incident Bt11, Bt176, MON810, MON40-3-2, TC1507, NK603, MS8/RF3 (referring to table 5), utilize isolating CTAB from leaf texture's material.

The PCR of cumulative volume 20 μ l reaction contain 1x SYBR Green PCR Master mixture (Diagenode, catalog number (Cat.No.): GMO-GS2X-A300), forward primer 250nM, reverse primer 250nM, template DNA 50ng.The PCR circulation relates to step 1:1x[50 ℃, 120 seconds]; Step 2:1x[95 ℃, 600 seconds]; With step 3:40x[95 ℃ 15 seconds, 60 ℃, 60 seconds] follow fluorescence to catch.Use Applied Biosystems Prism 7700.At 50 ℃ to 95 ℃, carry out the melt curve analysis analysis greater than 1200 second time inside gradient.

Right for all primers, by the special amplified production of wall scroll band demonstration acquisition of monospecific Tm and agarose gel electrophoresis.Analysis has low LOD:

RBCL: primer SEQ ID NO:26 and SEQ ID NO:27; Tm=76.5 ℃; Size=95bp; LOD=± 0.039ng target dna

Zea mays ADH (long amplicon): primer SEQ ID NO:1 and SEQ ID NO:2; Tm=79.5 ℃; Size=138bp; LOD=± 0.016ng target dna (± 6 monoploid genome)

Zea mays ADH (short amplicon): primer SEQ ID NO:56 and SEQ ID NO:57; Tm=75.5 ℃; Size=83bp; LOD=± 0.016ng target dna (± 6 monoploid genome)

Rape ACC: primer SEQ ID NO:79 and SEQ ID NO:3; Tm=79 ℃; Size=103bp; LOD=± 0.05ng target dna (± 20 monoploid genome)

Rape Cruciferae albumen: primer SEQ ID NO:24 and SEQ ID NO:25; Tm=80 ℃; Size=85bp; LOD=± 0.015ng target dna (± 12 monoploid genome)

Soybean lectin (long amplicon): primer SEQ ID NO:5 and SEQ ID NO:49; Tm=81.5 ℃; Size=178bp; LOD=± 0.016ng target dna (± 13 monoploid genome)

Soybean lectin: primer SEQ ID NO:58 and SEQ ID NO:59 (SLTM); Tm=79.5 ℃; Size=81bp; LOD=± 0.063ng target dna (± 50 monoploid genome)

Rice PLD: primer SEQ ID NO:20 and SEQ ID NO:21; Tm=76.5 ℃; Size=80bp; LOD=± 0.01ng target dna (± 20 monoploid genome)

Beet GluA3: primer SEQ ID NO:64 and SEQ ID NO:65; Tm=77 ℃; Size=118bp; LOD=± 0.01ng target dna (± 13 monoploid genome)

Cotton SAH7: primer SEQ ID NO:66 and SEQ ID NO:67; Tm=75.5 ℃; Size=115bp; LOD=± 0.02ng target dna (± 9 monoploid genome)

Potato UGPase: primer SEQ ID NO:68 and SEQ ID NO:69; Tm=81 ℃; Size=87bp; LOD=± 0.0002ng target dna

P35S (long amplicon): primer SEQ ID NO:7 and SEQ ID NO:8; Tm=80.5 ℃; Size=147bp; LOD=± 0.016ng target dna (± 6 monoploid genome)

P35S (short amplicon): primer SEQ ID NO:60 and SEQ ID NO:61; Tm=76 ℃; Size=75bp; LOD:RRS 100% ± 0.032ng target dna (± 25 monoploid genome); NK6035% ± 6.25ng target dna (± 62.5 monoploid genome)

TNOS-L: primer SEQ ID NO:28 and SEQ ID NO:29; Tm=72 ℃; Size=172bp; LOD=± 0.03ng target dna (± 25 monoploid genome)

TNOS-D: primer SEQ ID NO:9 and SEQ ID NO:10; Tm=72 ℃; Size=69bp; LOD=± 0.03ng target dna (± 25 monoploid genome)

Cry1Ab: primer SEQ ID NO:11 and SEQ ID NO:12; Tm=78.5 ℃; Size=73bp; LOD=± 0.06ng target dna (± 12 monoploid genome)

PAT/Bar: primer SEQ ID NO:13 and SEQ ID NO:14; Tm=80 ℃; Size=69bp; LOD=± 0.125ng target dna (± 50 monoploid genome)

PAT/pat: primer SEQ ID NO:15 and SEQ ID NO:16; Tm=77 ℃; Size=109bp; LOD=± 0.03ng target dna (± 12 monoploid genome)

CP4-EPSP: primer SEQ ID NO:22, SEQ ID NO:62 and SEQ IDNO:63; Tm=80.5 ℃ or 84.5 ℃; Size=108bp; LOD:NK6035% ± 3.125ng (± 31 monoploid genome), RRS 100% ± 0.032ng (± 25 monoploid genome), GT73100% ± 0.016ng (± 12 monoploid genome)

CP4-EPSP: primer SEQ ID NO:17, SEQ ID NO:18 and SEQ IDNO:19; Tm=85 ℃; Size=94bp or 124bp; LOD=± 0.03ng (± 25 monoploid genome)

Embodiment 2: according to exemplary reduced method of the present invention

By adding Bt176DNA, produce the sample of hypothesis to incoherent carrier DNA.Utilize the real-time PCR method of embodiment 1, existence and the disappearance of " p35S ", " tNOS ", " CrylAb ", " PAT/Bar ", " PAT/pat ", " CP4-EPSPS " in the screening sample.

The method of this simplification is intended to infer the potential existence and the disappearance of the material that is derived from Bt176, Bt11 and NK603 in the sample.

After test, sample is p35S, CrylAb and PAT/Bar male, but other test nucleic acid are not positive.Therefore, sample can be expressed as group G _SAM∈ { p35S; CrylAb; PAT/bar}.In this exemplary analysis, (wherein, do not check the existence of Zea mays nucleic acid), by group G _Bt176∈ { p35S; CrylAb; PAT/bar} presentation of events Bt176 is by group G _Btl1∈ { p35S; TNOS; CrylAb; PAT/pat} presentation of events Bt11, and by group G _NK603∈ { p35S; TNOS; CP4-EPSP} presentation of events NK603.

Therefore, because G _Bt176=G _SAM, have material in the sample from incident Bt176.On the other hand, because G _Bt11≠ G _SAMAnd

G_{Bt 11} &NotSubset; G_{SAM},

There is not material in the sample from incident Bt11.Similarly, because G _NK603≠ G _SAMAnd

G_{NK 603} &NotSubset; G_{SAM},

There is not material in the sample from incident NK603.

In the alternate statement, " p35S ", " tNOS ", " CrylAb ", " PAT/bar ", " PAT/pat " and " CP4-EPSPS " have given primer value V separately _P35S=3, V _TNOS=5, V _CrylAb=7, V _PAT/Bar=11, V _PAT/pat=13 and V _CP4-EPSPS=17.

Therefore, give group G _SAMValue VG _SAM, be the product of each assignment of detected nucleic acid wherein, that is, and VG _SAM=V _P35SX V _CrylAbX V _PAT/bar=231.Further, group G _Bt176Value VG _Bt176, be the product of each assignment of the test nucleic acid found among the incident Bt176, that is, and VG _Bt176=V _P35SX V _CrylAbX V _PAT/bar=231.Similarly, group G _Bt11The value VG that gives _Bt11=V _P35SX V _TNOSX V _CrylAbX V _PAT/bar=1365; Group G _NK603The value VG that gives _NK603=V _P35SX V _TNOSX V _PAT/bar=255.

Therefore, because VG _SAM/ VG _Bt176=1, then there is material in the sample from incident Bt176.On the other hand, because VG _SAM/ VG _Bt11=0.169, that is, not 1 neither then not have material in the sample greater than 1 integer from incident Bt11.Similarly, because VG _SAM/ VG _NK603=0.906, that is, not 1 neither then not have material in the sample greater than 1 integer from incident NK603.

Embodiment 3: to the exemplary description (96 orifice plate setting) of test kit of the present invention

Nucleic acid to be screened: " Zm ", " Bn ", " Gm ", " p35S ", " tNOS ", " CP4-EPSPS " " CrylAb ", " PAT/bar ", " PAT/pat ", primer as definition in the table 1 in the above-mentioned use is right, and uses primer to SEQ ID NO:26 and 27 (tables 4) the general plant gene that increases.

Choose wantonly, for example as required, test kit can also comprise the taxonomical unit mark of rice (" Or "), cotton (" Gs "), beet (" Bv ") and/or potato (" St "), utilizes the corresponding primer of definition in the table 1 right.

The operational condition of SYBR Green Q-PCR method

Reagent: SYBR Green PCR Master mixture comprises HS Taq-polysaccharase; Primer 20 μ M; The water of rnase-free

Instrument:

7700 sequence detection systems, 7300 real-time PCR systems, laminar flow worktable (Laminar Flow), transfer pipet 20,200 and 1000 μ l, aseptic, aerosol-tolerance liquid-transfering gun head, optics 96-hole reaction plate, optical cover

Rules: according to manufacturer's explanation, 7700 sequence detection systems or the enterprising performing PCR of 7300 real-time PCR systems.Use a kind of PCR program of routine.

The preparation of PCR mixture: the PCR mixture contains all components except that dna profiling, the PCR reaction.Carry out this operation in the laminar flow worktable, described laminar flow worktable only is used for this generic operation.

Table 6: the reaction mixture that is used for the Q-PCR screening

Component	Final concentration	μ l/ reactant	The X reactant
Component	Final concentration	μ l/ reactant	The X reactant	SYBR Green PCR Master mixture (2x)	1x	12.5μl
Forward primer (20 μ M)	250nM	0.312μl		SYBR Green PCR Master mixture (2x)	1x	12.5μl
Forward primer (20 μ M)	250nM	0.312μl		Reverse primer (20 μ M)	250nM	0.312μl
The water of nuclease free		6.876μl		Reverse primer (20 μ M)	250nM	0.312μl
The water of nuclease free		6.876μl		Cumulative volume:		20μl

DNA preparation: use the CTAB DNA method for extracting of standard to extract template DNA, measure DNA concentration by the picogreen fluorometry.

PCR reacts pre-treatment (PCR setup): carry out PCR reaction pre-treatment in the laminar flow worktable.In different spaces, combination DNA template and PCR mixture.

PCR operation: carry out PCR according to manufacturer's specification sheets of describing in the user manual.

Enumerated the condition of thermal cycler in the following table 7.

Table 7: thermal cycler operational conditions

Then, utilizing standard program (for example, gradient is melted from 50 ℃ to 95 ℃, and monitoring fluorescence reduces) to implement " melt curve analysis " analyzes

The dull and stereotyped setting in 96 holes that is used for the GMO-screening of foods/feeds product

Following table has been described setting, and it comprises all General Foods Corporations/feed mark, rice mark (detecting undelegated rice incident) and CAMV reversed transcriptive enzyme mark (disappearance CaMV contrast).

The 96-orifice plate is provided with:

Plant

??Gm

??Zm

??Bn

??Or

??p35S

??tNOS

??CP4

??Cry1??Ab

??PAT/p??at

??PAT/??bar

??CRT

?+	??+	??+	??+	??+	??+	??+	??+	??+	??+	??+	??+
?+	??+	??+	??+	??+	??+	??+	??+	??+	??+	??+	??+	?-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-
?NTC	??NTC	??NTC	??NTC	??NTC	??NTC	??NTC	??NTC	??NTC	??NTC	??NTC	??NTC	?-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-	??-

Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A
Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1A	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B
Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B	Sample 1B
Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2A	Sample 2B	Sample 2B	Sample 2B	Sample 2B	Sample 2B	Sample 2B	Sample 2B	Sample 2B	Sample 2B	Sample 2B	Sample 2B	Sample 2B

Positive control (+) can be corresponding amplicon a certain copy number (for example 100 copy/holes), that describe herein (plasmid or an insertion fragment), the particularly amplicon in the table 5.

The technical prediction, sample well can be opened (for example: first is a positive control, is sample then, and the back is NTC and negative control) in proper order.

Write down the Ct value and the Tm value in each hole, in determine analyzing, be used for the GM-group that each sample exists and determine.

Notice, can produce each row (thereby customer flexibility that realization increases) respectively with optionally being provided with in principle.

Embodiment 4:p35S, tNOS multiplex PCR

Present embodiment has been showed the exemplary multiplex PCR amplification of p35S and tNOS amplicon, wherein, detects by SYBR Green, based on the difference of melting temp (Tm), can distinguish amplified production.

The primer that uses is to (20 μ M):

P35S:SEQ ID NO:60 and 61

TNOS:SEQ ID NO:9 and 10

Template (50ng): Roundup Ready soybean (RRS) 100% (two positive control)

The PCR program: 95 ℃ 10 ', (95 ℃ 15 ", 60 ℃ 1 ') x 40 circulations

Melt program: in 20 ' from 50 ℃ to 95 ℃

Because different Tm (referring to table 2), two amplicons are differentiable, therefore can carry out the SYBR Green multiple PCR method of p35S and tNOS.Thereby can use the exist information of step PCR (OnePCR) acquisition about two kinds of different targets (p35S and tNOS).

Embodiment 5: other multiplex technique possibility when using SYBR Green

The feasibility of following multiplexed combinations has further been determined in experiment similar to Example 4:

1. Zea mays adb-1 (SEQ ID NO:56 and 57) and soybean SLTM (SEQ ID NO:58 and 59)

2. Zea mays adh-1 (SEQ ID NO:56 and 57) and rape Cruciferae albumen (SEQ IDNO:24 and 25)

3. soybean SLTM (SEQ ID NO:58 and 59) and cotton sah-7 (SEQ ID NO:66 and 67)

4. cotton sah-7 (SEQ ID NO:66 and 67) and rape Cruciferae albumen (SEQ IDNO:24 and 25)

Embodiment 6: the parameter of using the PCR in real time of the primer of inventing

Utilize as the condition and the primer of embodiment 1 definition, to defined copy number, contain each amplicon and insert and segmentally implemented reaction with reference to plasmid, and determined the relative fluorescence (RFU) of 40 circulation backs (that is, approaching or reached plateau).Result in the table 8 (also illustrating the result of use+/-8300 template copy numbers among Fig. 3) shows that present method and primer can produce the RFU value of at least 2500 (being positioned at doubly limit of 3-) in plateau (plateou).

Table 8:

The PCR target (primer of use: SEQ ID NO: forward+oppositely)

Plasmid template

The average RFU40 circulation of 1000 copy plasmid templates

The average RFU40 circulation of+/-8300 copy plasmid templates

The amplicon size

??1	??RbcL??(26+27)	??RbcL?OSRWt	??2581，58	??4369，51	??95
??1	??RbcL??(26+27)	??RbcL?OSRWt	??2581，58	??4369，51	??95	??2	??ADH?longer??(1+2)	??ADH?long	??4248，58	??5447，4	??135
??3	??ADH?shorter??(56+57)	??ADH?alt	??2434，16	??4210，28	??84	??2	??ADH?longer??(1+2)	??ADH?long	??4248，58	??5447，4	??135
??3	??ADH?shorter??(56+57)	??ADH?alt	??2434，16	??4210，28	??84	??4	??Lectin?longer??(5+49)	??Lec?Long	??3854，97	??5969，65	??178
??5	??Lectin?SLTM??(58+59)	??SLTM	??5943，98	??6713，95	??74	??4	??Lectin?longer??(5+49)	??Lec?Long	??3854，97	??5969，65	??178
??5	??Lectin?SLTM??(58+59)	??SLTM	??5943，98	??6713，95	??74	??6	??Cru770	??Cru770	??4614，59	??6768，95	??85

	??(24+25)
	??(24+25)					??7	??p35S?longer??(7+8)	??p35S?long	??3490，22	??4792，49	??147
??8	??p35S?shorter??(60+61)	??p35S?short	??3963，27	??6173，37	??75	??7	??p35S?longer??(7+8)	??p35S?long	??3490，22	??4792，49	??147
??8	??p35S?shorter??(60+61)	??p35S?short	??3963，27	??6173，37	??75	??9	??tNOS-D??(9+10)	??tNOS-D	??2339，11	??3731，95	??69
??10	??CrylAb??(11+12)	??CrylAb?Bt11	??4299，47	??6973，77	??73	??9	??tNOS-D??(9+10)	??tNOS-D	??2339，11	??3731，95	??69
??10	??CrylAb??(11+12)	??CrylAb?Bt11	??4299，47	??6973，77	??73	??11	??CrylAb??(11+12)	??CrylAb??MON810	??3957，05	??6759，2	??73
??12	??CrylAb??(11+12)	??CrylAb?Bt11??and?CrylAb??MON810	??4028，97	??6641，04	??73	??11	??CrylAb??(11+12)	??CrylAb??MON810	??3957，05	??6759，2	??73
??12	??CrylAb??(11+12)	??CrylAb?Bt11??and?CrylAb??MON810	??4028，97	??6641，04	??73	??13	??CP4??(22+62+63)	??CP4-RRS	??3235，24	??5098，82	??108
??14	??CP4??(22+62+63)	??CP4-GT73	??2641，86	??4968，28	??108	??13	??CP4??(22+62+63)	??CP4-RRS	??3235，24	??5098，82	??108
??14	??CP4??(22+62+63)	??CP4-GT73	??2641，86	??4968，28	??108	??15	??CP4??(22+62+63)	??CP4-RRS?and??CP4-GT73	??3157，24	??5034，91	??108
??16	??Pat-Pat??(15+16)	??Pat-Pat	??2299，71	??4875，61	??109	??15	??CP4??(22+62+63)	??CP4-RRS?and??CP4-GT73	??3157，24	??5034，91	??108
??16	??Pat-Pat??(15+16)	??Pat-Pat	??2299，71	??4875，61	??109	??17	??Pat-Bar??(13+14)	??Pat-Bar	??4839，79	??7370，7	??69

Mean value:	??3642.93	??5641.17
Mean value:	??3642.93	??5641.17	Standard deviation:	??1011.93	??1106.76
Median:	??3854.97	??5447.40	Standard deviation:	??1011.93	??1106.76
Median:	??3854.97	??5447.40	Minimum value:	??2299.71	??3731.95
Maximum value:	??5943.98	??7370.7	Minimum value:	??2299.71	??3731.95

Claims

1, the method for the existence of material and disappearance in the sample for reference, described material source is from one or more transgenic plant incidents, and described method comprises step:

(1) existence of test sample amplifying nucleic acid and disappearance, described nucleic acid comprises:

A kind of, more than one or all be selected from following nucleic acid:

A) " Zm ": Zea mays taxonomical unit source and special nucleic acid, preferred Zea Zea mays the source with special nucleic acid,

B) " Bn ": colea taxonomical unit source and special nucleic acid,

C) " Gm ": soybean taxonomical unit source and special nucleic acid,

O) " Or ": rice taxonomical unit source and special nucleic acid;

P) " Bv ": beet taxonomical unit source and special nucleic acid;

Q) " Gs ": cotton taxonomical unit source and special nucleic acid;

T) " St ": potato taxonomical unit source and special nucleic acid; With

A kind of, more than a kind of or all following nucleic acid that is selected from:

D) " p35S ": be derived from the nucleic acid of cauliflower mosaic virus 35S promoter,

E) " tNOS ": be derived from the nucleic acid of 3 ' terminator of agrobacterium tumefaciens rouge alkali synthetase gene,

F) " Cry1Ab ": be derived from the nucleic acid of bacillus thuringiensis crystal protein gene Cry1Ab,

G) " PAT/bar ": be derived from the nucleic acid of streptomyces hygroscopicus phosphinothricin acetyl transferase (PAT) gene bar,

H) " PAT/pat ": be derived from the nucleic acid that produces green streptomycete phosphinothricin acetyl transferase (PAT) gene pat and

I) " CP4-EPSPS ": the nucleic acid that is derived from 5-enolpyrul-shikimate acid-3-phosphate synthase EPSPS gene of edaphic bacillus species CP4; With

(2) infer existence or the disappearance that is derived from the material of one or more transgenic plant incidents in the sample, described incident is selected from: incident Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, MIR604, LY038, MON88017, its hybridization, and dependent event; Incident Topas 19/2, MS1, RF1, RF2, RF3, MS8, GT73, T45, Liberator pHoe6/Ac, GS40/90pHoe6/Ac, OXY235, its hybridization comprises MS1/RF1, MS1/RF2, MS1/RF3, and dependent event; Incident MON 40-3-2, MON89788, A2704-12, A5547-127, its hybridization, and dependent event; Incident LL62, LL06 and LL601, its hybridization, and relevant incident; Incident T120-7, H7-1 and A5-15, its hybridization, and relevant incident; Incident LL cotton 25, MON 1445, MON 531, MON15985, its hybridization, and relevant incident; With incident EH92-527-1 and dependent event thereof,

Wherein, use pcr amplification in step (1), preferably use the existence or the disappearance of PCR in real time augmentation detection sample amplifying nucleic acid, it is right that described pcr amplification is used to from each primer of following table, or right variant or the derivative of described primer:

??″Zm″ ??Fwd：5′TCTCTTCCTCCTTTAGAGCTACCACTA?3′(SEQ?ID?NO：56)??Rev：5′AATCGATCCAAAGCGAGATGA?3′(SEQ?ID?NO：57) ??″Bn″ ??Fwd：5′CAGCTCAACAGTTTCCAAACGA??3′(SEQ?ID?NO：24)??Rev：5′CGACCAGCCTCAGCCTTAAG?3′(SEQ?ID?NO：25) ??″Gm″ ??Fwd：5′AACCGGTAGCGTTGCCAG?3′(SEQ?ID?NO：58)??Rev′：5′AGCCCATCTGCAAGCCTTT?3′(SEQ?ID?NO：59) ??″p35S″ ??Fwd：5′AAAGCAAGTGGATTGATGTGATA?3′(SEQ?ID?NO：60)??Rev：5′GGGTCTTGCGAAGGATAGTG?3′(SEQ?ID?NO：61) ??″tNOS″ ??Fwd：5′-GATTAGAGTCCCGCAATTATACATTTAA-3′(SEQ?ID?NO：9)??Rev：5′-TTATCCTAGKTTGCGCGCTATATTT-3′(SEQ?ID?NO：10) ??″Cry1Ab″ ??Fwd：5′-ACCGGTTACACTCCCATCGA-3′(SEQ?ID?NO：11)??Rev：5′-CAGCACCTGGCACGAACTC-3′(SEQ?ID?NO：12) ??″PAT/bar″ ??Fwd：5′-CGTCAACCACTACATCGAGACAA-3′(SEQ?ID?NO：13)??Rev：5′-GTCCACTCCTGCGGTTCCT-3′(SEQ?ID?NO：14) ??″PAT/pat″ ??Fwd：5′-CCGCGGTTTGTGATATCGTT-3′(SEQ?ID?NO：15)??Rev：5′-TCTTGCAACCTCTCTAGATCATCAA-3′(SEQ?ID?NO：16) ??″CP4-EPSPS″ ??Fwd：5′GCATGCTTCACGGTGCAA?3′(SEQ?ID?NO：22)??Rev：5′GGACCTGTGGGAGATAGACTTGTC?3′(SEQ?ID?NO：23)??Rev?1：5′TGAAGGACCGGTGGGAGAT?3′(SEQ?ID?NO：62)??Rev?2：5′TGAAGGACCTGTGGGAGAT?3′(SEQ?ID?NO：63) ??″Or″ ??Fwd′：5′GCTTAGGGAACAGGGAAGTAAAGT?3′(SEQ?ID?NO：51)??Rev：5′CTTAGCATAGTCTGTGCCATCCA?3′(SEQ?ID?NO：21) ??″Bv″ ??Fwd：5′GACCTCCATATTACTGAAAGGAAG?3′(SEQ?ID?NO：64)??Rev：5′GAGTAATTGCTCCATCCTGTTCA?3′(SEQ?ID?NO：65) ??″Gs″ ??Fwd：5′AGTTTGTAGGTTTTGATGTTACATTGAG?3′(SEQ?ID?NO：66)??Rev：5′GCATCTTTGAACCGCCTACTG?3′(SEQ?ID?NO：67) ??″St″ ??Fwd：5′GGACATGTGAAGAGACGGAGC?3′(SEQ?ID?NO：68)??Rev：5′CCTACCTCTACCCCTCCGC?3′(SEQ?ID?NO：69)

2, comprise d in the test sample according to the process of claim 1 wherein that step (1) relates to)-existence and the disappearance of the nucleic acid of all nucleic acid of i) enumerating.

3, according to the process of claim 1 wherein step (1) relate in the test sample comprise a)-c) and d)-existence and the disappearance of the nucleic acid of all nucleic acid of i) enumerating.

4, according to each method in the claim 1 to 3,

-wherein step (1) also comprises test sample amplifying nucleic acid j) and " mCry3A ": the existence and the disappearance of nucleic acid of crystal protein gene Cry3A that is derived from the modification of bacillus thuringiensis; And/or

-wherein step (1) also comprises test sample amplifying nucleic acid k) " cordapA ": be derived from the nucleic acid of the insensitive dihydrodipicolinic acid synthase of Methionin (cDHDPS) the gene cordapA of corynebacterium glutamicum, and/or i) " Glb1 ": be derived from a kind of or its both existence and disappearance in the nucleic acid of zeistic Glb1 promotor; And/or

-wherein step (1) also comprises test sample amplifying nucleic acid m) and " Cry3Bb1 ": the existence and the disappearance of nucleic acid that is derived from the crystal protein gene Cry3Bb1 of bacillus thuringiensis; And/or

-wherein step (1) also comprises test sample amplifying nucleic acid n) and " Bxn ": the existence and the disappearance of nucleic acid that is derived from the nitrilase gene Bxn of Klebsiella pneumonia ozena subspecies; And/or

-wherein step (1) also comprises test sample amplifying nucleic acid r) " Cry1Ac ": be derived from the nucleic acid of the crystal protein gene Cry1Ac of bacillus thuringiensis, and/or s) " Cry2Ab2 ": be derived from a kind of or its both existence and disappearance in the nucleic acid of crystal protein gene Cry2Ab2 of bacillus thuringiensis; And/or

-wherein step (1) also comprises test sample amplifying nucleic acid u) and " GBSS ": the existence and the disappearance of nucleic acid that is derived from the starch small grain bonded starch synthase gene Gbss of potato.

5, according to each method in the claim 1 to 4, wherein step (1) also comprises the existence and the disappearance of general plant origin nucleic acid in the test sample, described nucleic acid is preferably the small subunit that is derived from chloroplast(id) Rubisco gene, or is derived from the CHL-tRNA synthase gene.

6, according to the method for claim 5, the existence of wherein said general plant origin nucleic acid and disappearance utilize pcr amplification to detect, preferably utilizing PCR in real time to increase detects, described detection uses primer to 5 ' AGGTCTAADGGRTAAGCTAC3 ' (SEQ ID NO:26) and 5 ' AGYCTTGATCGTTACAAAGG3 ' (SEQ ID NO:27), or right variant or the derivative of described primer.

7, according to each method in the claim 1 to 6, wherein amplified production utilizes basically that the non-specific detection method of sequence detects, and preferably utilizes DNA-bonded detection of fluorescent dyes, more preferably utilizes SYBR Green or PicoGreen to detect.

8, according to each method in the claim 1 to 7, wherein also verified the specificity of amplified production, preferably utilize melt curve analysis analysis (Tm) and/or determine that by gel electrophoresis size verifies.

9, according to each method in the claim 1 to 6,, for example use Light Upon Extension (LUX wherein by being present in the fluorophore mark on primer centering at least one primer ^TM) technology detects amplified production.

10, according to each method in the claim 1 to 9, wherein sample comprises plant or its part, described part comprises flower, tapel, petal, sepal, flower pesticide, pollen, seed, fruit, pericarp, fruit pod, leaf, petiole, stem, root, root stock, stolon, stem tuber or bud, or its part; Vegetable cell, plant protoplast and/or plant tissue and/or vegetable-derived materials preferably include the food of processing or the food or the feed material of feed material.

11, according to each method in the claim 1 to 10, wherein in step (1), use pcr amplification, preferred existence and the disappearance of using PCR in real time augmentation detection sample amplifying nucleic acid, it is right that described pcr amplification is used to from each primer of following table, or right variant or the derivative of described primer:

??″Zm″ ?Fwd：5′CgTCgTTTCCCATCTCTTCCTCC?3′(SEQ?ID?NO：1)?Rev：5′CCACTCCgAgACCCTCAgTC?3′(SEQ?ID?NO：2) ??″Zm″ ?Fwd：5′TCTCTTCCTCCTTTAGAGCTACCACTA?3′(SEQ?ID?NO：56)?Rev：5′AATCGATCCAAAGCGAGATGA?3′(SEQ?ID?NO：57) ??″Bn″ ?Fwd1：5′GAGAATGAGGAGGACCAAGCTC?3′(SEQ?ID?NO：4)?Fwd2：5′GGTGAGCTGTATAATCGAGCGA?3′(SEQ?ID?NO：79)?Rev：5′GGCGCAGCATCGGCT?3′(SEQ?ID?NO：3) ??″Bn″ ?Fwd：5′CAGCTCAACAGTTTCCAAACGA?3′(SEQ?ID?NO：24)?Rev：5′CGACCAGCCTCAGCCTTAAG?3′(SEQ?ID?NO：25) ??″Gm″ ?Fwd：5′CATTACCTATgATgCCTCCACC?3′(SEQ?ID?NO：5)?Rev：5′AAgCACgTCATgCgATTC?3′(SEQ?ID?NO：6)?Rev′：5′AAgCACgTCATgCgATTCC?3′(SEQ?ID?NO：49) ??″Gm″ ?Fwd：5′AACCGGTAGCGTTGCCAG?3′(SEQ?ID?NO：58)?Rev′：5′AGCCCATCTGCAAGCCTTT?3′(SEQ?ID?NO：59) ??″p35S″ ?Fwd：5′-GACAGTGGTCCCAAAGATGG-3′(SEQ?ID?NO：7)?Rev：5′-GTCTTGCGAAGGATAGTGGG-3′(SEQ?ID?NO：8) ??“p35S” ?Fwd：5’AAAGCAAGTGGATTGATGTGATA?3’(SEQ?ID?NO：60)?Rev：5’GGGTCTTGCGAAGGATAGTG?3’(S?EQ?ID?NO：61) ??″tNOS″ ?Fwd：5′-GATTAGAGTCCCGCAATTATACATTTAA-3′(SEQ?ID?NO：9)?Rev：5′-TTATCCTAGKTTGCGCGCTATATTT-3′(SEQ?ID?NO：10) ??″tNOS″ ?Fwd：5′CGTTCAAACATTTGGCAATAAAG?3′(SEQ?ID?NO：28)?Rev：5′AAATGTATAATTGCGGGACTCTAATC?3′(SEQ?ID?NO：29)

?″Cry1Ab″ ??Fwd：5′-ACCGGTTACACTCCCATCGA-3′(SEQ?ID?NO：11)??Rev：5′-CAGCACCTGGCACGAACTC-3′(SEQ?ID?NO：12) ?″Cry1Ab″ ??Fwd：5′GACATCATCTGGGGYATCTT?3′(SEQ?ID?NO：30)??Rev：5′GCGCTGTTCATGTCGTTGAA?3′(SEQ?ID?NO：31) ?″Cry1Ab″ ??Fwd：5′ACGCCTTCCTGGTGCAAA?3′(SEQ?ID?NO：47)??Rev：5′CCTGGTTCCTGGCGAACTC?3′(SEQ?ID?NO：48) ?″PAT/bar″ ??Fwd：5′-CGTCAACCACTACATCGAGACAA-3′(SEQ?ID?NO：13)??Rev：5′-GTCCACTCCTGCGGTTCCT-3′(SEQ?ID?NO：14) ?″PAT/pat″ ??Fwd：5′-CCGCGGTTTGTGATATCGTT-3′(SEQ?ID?NO：15)??Rev：5′-TCTTGCAACCTCTCTAGATCATCAA-3′(SEQ?ID?NO：16) ?″CP4-EPSPS″ ??Fwd1：5′-GGCTCTGAGCTTCGTCCTCCTAAGG-3′(SEQ?ID?NO：17)??Fwd1′：5′-GGCTCTGAGCTTCGTCCTCTTAAGG-3′(SEQ?ID?NO：50)??Fwd2：5′-ATCAGTGGCTACAGCCTGCAT-3′(SEQ?ID?NO：18)??Rev：5′-GAATGCGGACGGTTCCGGAAAG-3′(SEQ?ID?NO：19) ?″CP4-EPSPS″ ??Fwd：5′GCATGCTTCACGGTGCAA?3′(SEQ?ID?NO：22)??Rev：5′GGACCTGTGGGAGATAGACTTGTC?3′(SEQ?ID?NO：23)??Rev?1：5′TGAAGGACCGGTGGGAGAT?3′(SEQ?ID?NO：62)??Rev?2：5′TGAAGGACCTGTGGGAGAT?3′(SEQ?ID?NO：63) ?″Or″ ??Fwd：5′GCTTAGGGAACAGGGAAGTAAAGTT?3′(SEQ?ID?NO：20)??Fwd′：5′GCTTAGGGAACAGGGAAGTAAAGT?3′(SEQ?ID?NO：51)??Rev：5′CTTAGCATAGTCTGTGCCATCCA?3′(SEQ?ID?NO：21) ?″Bv″ ??Fwd：5′GACCTCCATATTACTGAAAGGAAG?3′(SEQ?ID?NO：64)??Rev：5′GAGTAATTGCTCCATCCTGTTCA?3′(SEQ?ID?NO：65)

??″Gs″ ??Fwd：5′AGTTTGTAGGTTTTGATGTTACATTGAG?3′(SEQ?ID?NO：66)??Rev：5′GCATCTTTGAACCGCCTACTG?3′(SEQ?ID?NO：67) ??″St″ ??Fwd：5′GGACATGTGAAGAGACGGAGC?3′(SEQ?ID?NO：68)??Rev：5′CCTACCTCTACCCCTCCGC?3′(SEQ?ID?NO：69) General plant ??Fwd：5′AGGTCTAADGGRTAAGCTAC?3′(SEQ?ID?NO：26)??Rev：5′AGYCTTGATCGTTACAAAGG?3′(SEQ?ID?NO：27)

12, the method that requires according to each aforesaid right, wherein step (2) may further comprise the steps:

(i) define the group " G that forms by the detected nucleic acid that is present in the sample in the step (1) _SAM";

(ii) definition is selected from one or more groups target (" G of following group _X"), described group comprises following group, or constitutes by following group: " G _Bt176", " G _Bt11", " G _Bt10", " G _MON810", " G _MON863", " G _TC1507", " G _NK603", " G _T25", " G _GA21", " G _DAS-59122", " G _MIR604", " G _LY038", " G _MON88017", " G _{Topas 19/2}", " G _MS1", " G _RF1", " G _RF2", " G _MS1/RF1", " G _MS1/RF2", " G _MS8", " G _RF3", " G _MS8RRF3", " G _GT73", " G _T45", " G _Liberator _PHoe6/Ac", " G _{GS40/90pHoe6/Ac}", " G _OXY235"; " G _MON40-3-2", " G _MON89788", " G _A2704-12", " G _A5547-127", " G _LL62", " G _LL06", " G _LL601", " G _T120-7", " G _H7-1", " G _A5-15", " G _{LL cotton 25}", " G _MON1445", " G _MON531", " G _MON15985" and " G _EH92-527-1"; Its respectively corresponding each one or more targets (" X ") transgenic plant incident, described incident is selected from the group that comprises following incident, or is selected from the group that is made of following incident: Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, MIR604, LY038, MON88017, Topas 19/2, MS1, RF1, RF2, MS1/RF1, MS1/RF2, MS8, RF3, MS8/RF3, GT73, T45, Liberator pHoe6/Ac, GS40/90pHoe6/Ac, OXY235; MON 40-3-2, MON89788, A2704-12, A5547-127, LL62, LL06, LL601, T120-7, H7-1, A5-15, LL cotton 25, MON 1445, MON 531, MON15985 and EH92-527-1, wherein:

-G _Bt176∈{Zm；p35S；Cry1Ab；PAT/bar}，

-G _Bt11∈{Zm；p35S；tNOS；Cry1Ab；PAT/pat}，

-G _Bt10∈{Zm；p35S；tNOS；Cry1Ab；PAT/pat}，

-G _MON810∈{Zm；p35S；tNOS；Cry1Ab}，

-G _MON863∈{Zm；p35S；tNOS}，

-G _TC1507∈{Zm；p35S；PAT/pat}，

-G _NK603∈{Zm；p35S；tNOS；CP4-EPSPS}，

-G _T25∈{Zm；p35S；PAT/pat}，

-G _GA21∈{Zm；tNOS}，

-G _DAS-59122∈{Zm；p35S；PAT/bar}，

-G _MIR604∈{Zm；tNOS；mCry3A}，

G _MIR604∈{Zm；tNOS}

-G _LY038∈{Zm；p35S；tNOS；cordapA；Glb1}， G _LY038∈{Zm；p35S；tNOS}，

-G _MON88017∈{Zm；p35S；tNOS；CP4-EPSPS；Cry3Bb1}，

G _MON88017∈{Zm；p35S；tNOS；CP4-EPSPS}，

-G _Topas?19/2∈{Bn；p35S；PAT/pat}，

-G _MS1∈{Bn；tNOS；PAT/bar}，

-G _RF1∈{Bn；tNOS；PAT/bar}，

-G _RF2∈{Bn；tNOS；PAT/bar}，

-G _MS1/RF1∈{Bn；tNOS；PAT/bar}，

-G _MS1/RF2∈{Bn；tNOS；PAT/bar}，

-G _MS8∈{Bn；tNOS；PAT/bar}，

-G _RF3∈{Bn；tNOS；PAT/bar}，

-G _MS8/RF3∈{Bn；tNOS；PAT/bar}，

-G _GT73∈{Bn；CP4-EPSPS}，

-G _T45∈{Bn；p35S；PAT/pat}，

-G _{Liberator?pHoe6/Ac}∈{Bn；p35S；PAT/pat}，

-G _{GS40/90pHoe6/Ac}∈{Bn；p35S；PAT/pat}，

-G _OXY235∈{Bn；p35S；Bxn}，

G _OXY235∈{Bn；p35S}；

-G _MON40-3-2∈{Gm；p35S；tNOS；CP4-EPSPS}，

-G _MON89788∈{Gm；CP4-EPSPS}

-G _A2704-12∈{Gm；p35S；PAT/pat}，

-G _A5547-127∈{Gm；p35S；PAT/pat}，

-G _LL62∈{Or；p35S；PAT/bar}，

-G _LL06∈{Or；p35S；PAT/bar}

-G _LL601∈{Or；p35S；tNOS；PAT/bar}，

-G _T120-7∈{Bv；p35S；PAT/pat}，

-G _H7-1∈{Bv；p35S；CP4-EPSPS}，

-G _A5-15∈{Bv；p35S；tNOS；CP4-EPSPS}，

-G _LL?cotton?25∈{Gs；p35S；tNOS；PAT/bar}，

-G _MON1445∈{Gs；p35S；tNOS；CP4-EPSPS}，

-G _MON531∈{Gs；p35S；tNOS；cry1Ac}，

G _MON531∈{Gs；p35S；tNOS}

-G _MON15985∈{Gs；p35S；tNOS；cry1Ac；cry2Ab2}

G _MON15985∈{Gs；p35S；tNOS}，

With

-G _EH92-527-1∈ { St; TNOS; Gbss} or G _EH92-527-1∈ { St; TNOS};

(iii) to every group of target G _XImplement logical operation:

If-G _XBe G _SAMProper subclass (

), then potential existence is derived from the material of transgenic plant incident X or its hybridization or its dependent event in the sample;

If-G _XBe not equal to G _SAMAnd G _XNeither G _SAMProper subclass (G _X≠ G _SAMAnd

13, according to the method for claim 12, if G wherein _XEqual G _SAMIf, and except G _XNone group in addition, or two or more sets sums and G _XEquate, then have the material that is derived from transgenic plant incident X or its hybridization or its dependent event in the sample, described group is selected from and comprises following group group, or is selected from the group that constitutes by following group: G _Bt176, G _Bt11, G _Bt10, G _MON810, G _MON863, G _TC1507, G _NK603, G _T25, G _GA21, G _DAS-59122, G _MIR604, G _LY038, G _MON88017, G _{Topas 19/2}, G _MS1, G _RF1, G _RF2, G _MS1/RF1, G _MS1/RF2, G _MS8, G _RF3, G _MS8/RF3, G _GT73, G _T45, G _Liberatorp _Hoe6/Ac, G _{GS40/90pHoe6/Ac}, G _OXY235G _MON40-3-2, G _MON89788, G _A2704-12, G _A5547-127, G _LL62, G _LL06, G _LL601, G _T120-7, G _H7-1, G _A5-15, G _{LL cotton 25}, G _MON1445, G _MON531, G _MON15985

14, according to the method for claim 12, its amplifying nucleic acid is selected from the group that comprises following incident, or be selected from the group that constitutes by following incident: " Zm ", " Bn ", " Gm ", " p35S ", " tNOS ", " CrylAb ", " PAT/bar ", " PAT/pat ", " CP4-EPSPS ", " mCry3A ", " cordapA ", " Glb1 ", " Cry3Bb1 ", " Bxn ", " Or ", " Bv ", " Gs ", " Cry1Ac ", " Cry2ab2 ", " St " and " Gbss ", and given unique value " V separately _Zm", " V _Bn", " V _Gm", " V _P35S", " V _TNOS", " V _CrylAb", " V _PAT/bar", " V _PAT/pat", " V _CP4-EPSPS", " V _MCry3A", " V _{Cordap A}", " V _Glb1", " V _Cry3Bb1", " V _Bxn", " V _Or", " V _Bv", " V _Gs", " V _Cry1Ac", " V _Cry2ab2", " V _St" and " V _Gbss"; Every group of target G wherein _XAll given value " VG _X", described " VG _X" be selected from the group that comprises following value, or be selected from the group that constitutes by following value: " VG _Bt176", " VG _Bt11", " VG _Bt10", " VG _MON810", " VG _MON863", " VG _TC1507", " VG _NK603", " V " G _T25", " VG _GA21", " VG _DAS-59122", " VG _MIR604", " VG _LY038", " VG _MON88017", " VG _{Topas 19/2}", " VG _MS1", " VG _RF1", " VG _RF2", " VG _MS1/RF1", " VG _MS1/RF2", " VG _MS8", " VG _RF3", " VG _MS8/RF3", " VG _GT73", " VG _T45", " VG _{Liberator pHoe6/Ac}", " VG _{GS40/90pHoe6/Ac}", " VG _OXY235", " VG _MON40-3-2", " VG _MON89788", " VG _A2704-12", " VG _A5547-127", " VG _LL62", " VG _LL06", " VG _LL601", " VG _T120-7", " VG _H7-1", " VG _A5-15", " VG _{LL cotton 25}", " VG _MON1445", " VG _MON531", " VG _MON15985" and " VG _EH92-527-1", wherein:

-VG _Bt176＝V _Zm×V _p35S×V _Cry1Ab×V _PAT/bar，

-VG _Bt11＝V _Zm×V _p35S×V _tNOS×V _Cry1Ab×V _PAT/pat，

-VG _Bt10＝V _Zm×V _p35S×V _tNOS×V _Cry1Ab×V _PAT/pat，

-VG _MON810＝V _Zm×V _p35S×V _tNOS×V _Cry4Ab，

-VG _MON863＝V _Zm×V _p35S×V _tNOS，

-VG _TC1507＝V _Zm×V _p35S×V _PAT/pat，

-VG _NK603＝V _Zm×V _p35S×V _tNOS×V _CP4-EPSPS，

-VG _T25＝V _Zm×V _p35S×V _PAT/pat，

-VG _GA21＝V _Zm×V _tNOS，

-VG _DAS-59122＝V _Zm×V _p35S×V _PAT/bar，

-VG _MIR604＝V _Zm×V _tNOS×V _mCry3A，or?V _GMIR604＝V _Zm×V _tNOS，

-VG _LY038＝V _Zm×V _p35S×V _tNOS×V _cordapA×V _Glb1，or?VG _LY038＝V _Zm×V _p35S×V _tNOS，

-VG _MON88017＝V _Zm×V _p35S×V _tNOS×V _CP4-EPSP×V _Cry3Bb1，or?VG _MON88017＝V _Zm×V _p35S×V _tNOS×V _CP4-EPSP，

-VG _Topas?19/2＝V _Bn×V _p35S×V _PAT/pat，

-VG _MS1＝V _Bn×V _tNOS×V _PAT/bar，

-VG _RF1＝V _Bn×V _tNOS×V _PAT/bar，

-VG _RF2＝V _Bn×V _tNOS×V _PAT/bar，

-VG _MS8＝V _Bn×V _tNOS×V _PAT/bar，

-VG _RF3＝V _Bn×V _tNOS×V _PAT/bar，

-VG _MS1/RF1＝V _Bn×V _tNOS×V _PAT/bar，

-VG _MS1/RF2＝V _Bn×V _tNOS×V _PAT/bar，

-VG _MS8/RF3＝V _Bn×V _tNOS×V _PAT/bar，

-VG _GT73＝V _Bn×V _CP4-EPSPS，

-VG _T45＝V _Bn×V _p35S×V _PAT/pat，

-VG _{Liberator?pHoe6/Ac}＝V _Bn×V _p35S×V _PAT/pat，

-VG _{GS40/90pHoe6/Ac}＝V _Bn×V _p35S×V _PAT/pat，

-VG _OXY235＝V _Bn×V _p35S×V _Bxn， VG _OXY235＝V _Bn×V _p35S，

-VG _MON40-3-2＝V _Gm×V _p35S×V _tNOS×V _CP4-EPSPS，

-VG _MON89788＝V _Gm×V _CP4-EPSPS，

-VG _A2704-12＝V _Gm×V _p35S×V _PAT/pat，

-VG _A5547-127＝V _Gm×V _p35S×V _PAT/pat，

-VG _LL62＝V _Or×V _p35S×V _PAT/bar，

-VG _LL06＝V _Or×V _p35S×V _PAT/bar，

-VG _LL601＝V _Or×V _p35S×V _tNOS×V _PAT/bar，

-VG _T120-7＝V _Bv×V _p35S×V _PAT/pat，

-VG _H7-1＝V _Bv×V _p35S×V _CP4-EPSPS，

-VG _A5-15＝V _Bv×V _p35S×V _tNOS×V _CP4-EPSPS，

-VG _LL?cotton?25＝V _Gs×V _p35S×V _tNOS×V _PAT/bar，

-VG _MON1445＝V _Gs×V _p35S×V _tNOS×V _CP4-EPSPS，

-VG _MON531＝V _Gs×V _p35S×V _tNOS×V _Cry1Ac，

VG _MON531＝V _Gs×V _p35S×V _tNOS，

-VG _MON15985＝V _Gs×V _p35S×V _tNOS×V _Cry1Ac×V _Cry2Ab2， VG _MON15985＝V _Gs×V _p35S×V _tNOS，

-and VG _EH92-527-1=V _StX V _TNOSX V _Gbss, or VG _EH92-527-1=V _StX V _TNOS,

Wherein, group G _SAMThe value of giving " VG _SAM", it is to give the detected product that is present in the unique value of the nucleic acid in the sample in the step (1); And wherein step (iii) comprises every group of target G _XImplement logical operation:

If-VG _SAM/ VG _XBe not equal to 1, and be not equal to a value, or during the multiplier of two or more values, then be not derived from the material of transgenic plant incident X or its hybridization or its dependent event in the sample, wherein said value is selected from the group that comprises following value, or is selected from the group that is made up of following value: V _Zm, V _Bn, V _Gm, V _P35S, V _TNOS, V _CrylAb, V _PAT/bar, V _PAT/pat, V _CP4-EPSPS, V _MCry3A, V _{Cordap A}, V _Glb1, V _Cry3Bb1, V _Bxn, V _Or, V _Bv, V _Gs, V _Cry1Ac, V _Cry2ab2, V _StAnd V _Gbss

15, according to the method for claim 14, if VG wherein _SAM/ VG _XEqual 1, and if except that VG _XOutside, the none value, or do not have the multiplier of two or more values to equal VG _X, then there is the material that is derived from transgenic plant incident X or its hybridization or its dependent event in the sample, described value is selected from the group that comprises following value, or is selected from the group that is made of following value: VG _Bt176, VG _Bt11, VG _Bt10, VG _MON810, VG _MON863, VG _TC1507, VG _NK603, VG _T25, VG _GA21, VG _DAS-59122, VG _MIR604, VG _LY038, VG _MON88017, VG _{Topas 19/2}, VG _MS1, VG _RF1, VG _RF2, VG _MS1/RF1, VG _MS1/RF2, VG _MS8, VG _RF3, VG _MS8/RF3, VG _GT73, VG _T45, VG _{Liberator pHoe6/Ac}, VG _{GS40/90pHoe6/Ac}, VG _OXY235, VG _MON40-3-2, VG _MON89788, VG _A2704-12, VG _A5547-127, VG _LL62, VG _LL06, VG _LL601, VG _T120-7, VG _H7-1, VG _A5-15, VG _{LL cotton} ₂₅, VG _MON1445, VG _MON531, VG _MON15985And VG _EH92-527-1

16, according to each method in claim 14 or 15, its intermediate value: V _Zm, V _Bn, V _Gm, V _P35S, V _TNOS, V _Cry1Ab, V _PAT/bar, V _PAT/pat, V _CP4-EPSPS, V _MCry3A, V _{Cordap A}, V _Glb1, V _Cry3Bb1, V _Bxn, V _Or, V _Bv, V _Gs, V _Cry1Ac, V _Cry2ab2, V _StAnd V _GbssBe unique primer number, and wherein step comprise that (iii) enforcement respectively organizes target G _XLogical operation,

17, according to each method in the claim 1 to 16, wherein carry out step (2) by calculating device.

18, the primer and the primer of definition are right in the claim 1,6 and 11.

19, the amplified production of primer by using definition in the claim 1,6 and 11 to obtaining; The recombinant vectors and the plasmid that comprise described amplified production; Recombinant microorganism with described carrier and/or the conversion of described plasmid.

20, recombination bacillus coli bacterium, it is according to budapest treaty, in the biological product collecting center (BCCM) of Norme Belge, on January 10th, 2007 with LMBP preserving number LMBP 5452, LMBP 5453, LMBP 5454, LMBP 5455, LMBP 5456, LMBP 5457, LMBP5458, LMBP 5459 and LMBP 5460 preservations; In on March 6th, 2007 with LMBP preserving number LMBP 5451 preservations; In on April 19th, 2007 with LMBP preserving number LMBP 5587, LMBP 5588, LMBP 5589 and LMBP 5590 preservations.

21, the isolating recombinant plasmid that obtains in any recombination bacillus coli bacterium of Accessory Right requirement 20, or the isolating insertion fragment of described plasmid, preferably its isolating EcoRI-EcoRI inserts fragment.

22, recombinant microorganism, it uses the plasmid according to claim 21 to transform.

23, be used for that possibility that sample for reference is derived from the material of one or more transgenic plant incidents exists and the test kit of disappearance, described test kit comprise in the claim 1,6 and 11 definition a kind of, more than a kind of or all primers, preferably include define in the claim 1,6 and 11 a kind of, right more than a kind of or all primers, or right variant or the derivative of described primer.

24, according to the test kit of claim 23, its comprise primer to or its variant or derivative, nucleic acid " Zm ", " Bn ", " Gm ", " p35S ", " tNOS ", " CrylAb ", " PAT/bar ", " PAT/pat " and " CP4-EPSPS " of the definition of claim 1 at least that is used to increase.

25, according to the test kit of claim 23 or 24, it also comprises one or more nucleic acid, and described nucleic acid is suitable as the positive control according to each nucleic acid amplification among the claim 1-5.

26, each test kit among the claim 23-25, it comprises in the claim 20 recombinant microorganism of one or more recombination bacillus coli bacteriums, claim 22 definition of definition, according to the isolating recombinant plasmid of claim 21 or insert fragment.

27, each test kit among the claim 23-26, it also comprises data carrier, and described data carrier comprises the specification sheets that is used for programmable computing device, and described device is used for carrying out each the step (2) of method according to claim 1-17.