CN101646450A - The VEGF specific antagonists that is used for the treatment of auxiliary and neoadjuvant and infantile tumour - Google Patents

Abstract

Herein disclosed is and use anti-VEGF specific antagonists to treat method benign, cancer tumor preceding or non-metastatic.Also disclose and used that the treatment of anti-VEGF specific antagonists is in that development is benign, the curee's of tumor risk before the cancer or non-metastatic method.The application in new auxiliary and auxiliary cancer therapy of the method for using treatment of anti-VEGF specific antagonists or prophylaxis of tumours recurrence and VEGF specific antagonists is also disclosed.

Description

The VEGF specific antagonists that is used for the treatment of auxiliary and neoadjuvant and infantile tumour

Background of invention

Cancer is to one of the most fatal threat of human health.Only in the U.S., annual nearly 1,300,000 new patients of invasion and attack of cancer and be second largest main cause inferior to the death of cardiovascular disease account for dead about 1/4th.Solid tumor is the reason that causes this class death of great majority.Although on the therapeutic treatment of some cancer obvious improvement has been arranged, in the past 20 years, the 5 total annual survival rates of all cancers have only improved about 10%.Cancer or malignant tumor shift and ramp in uncontrolled mode, make to detect timely and the treatment very difficulty that becomes.

The current methods of cancer treatment is nonselective relatively and target tumor after cancer has been developed to the more virulent stage usually.Operation removes illing tissue; X-ray therapy is shunk solid tumor; And chemotherapy is killed somatoblast rapidly.Especially chemotherapy has caused a large amount of side effect, the use that has seriously consequently limited available dosage and therefore hindered the effective medicine of possibility like this in some instances.And cancer is usually to chemotherapeutic drug deposits yields drug resistance.In order to stop to development pernicious or the transitivity state, reduce the M ﹠ M relevant whereby with cancer, early stage or carcinoid treatment is needed.

Recently be diagnosed as the patient who suffers from the cancer that can perform the operation for great majority, the treatment of standard is definitiveness operation and chemotherapy afterwards.This therapeutic purposes be as much as possible remove former with disease that shift so that prevention of recurrence and improve survival rate.In fact, the great majority among these patients do not have the visible signs of residual tumor after operation.Yet the most of them can recur and die from last their disease afterwards.This is transfers because the tumor cell of a small amount of survival becomes before operation, has escaped to perform the operation and take place owing to being limited in of existing detection technique becomes after the operation to detect.

Therefore, for the cancerous cell in these residual micrometastasis begins again group feature and become to be difficult to eliminate them before the treatment, postoperative auxiliary treatment is as the aid of operation is become important.In the past few decades, the use that normally concentrates on the different chemical therapeutic agent of the development on the complementary therapy increases.Many chemotherapy schemes suffer from for example lung of early stage main cancer indication treating auxiliaryly, demonstrate clinical benefit among the patient of mammary gland and colorectal carcinoma.People .J Clin Oncol 22:7019 (2004) such as Strauss; International Adjuvant LungCancer Trial Collaboration Group (international auxiliary pulmonary carcinoma test cooperative groups) N Engl JMed 350:351-60 (2004).People .Ann Intern Med 122:321-6 (1995) such as Moertel; IMPACT Lancet 345:939-44 (1995); People .J Clin Oncol 21:1431-9 (2003) such as Citron.

Although the complementary therapy of chemical fundamentals has generally acknowledged benefit, a kind of major defect all relevant with the chemotherapy of any kind is significant toxicity.Common chemotherapeutic agent is the target tumor position not, and can not differentiate normal cell and tumor cell.Because very long treatment and its are to the persistent influence of patients ' life quality, the toxicity problem in auxiliary situation (setting) is challenging especially.And the benefit of assistant chemical therapy is not clear in the patient with low risk of recurrence, makes that whether being worth standing chemotherapeutic side effect for them becomes and have a question.

A kind of complementary therapy that provided before main definitiveness operation is that neoadjuvant occurs as another pith of cancer therapy.Before the definitiveness operation, provide new auxiliary treatment that several advantages are arranged.The first, because the minimizing of gross tumor volume, ascites and hydrothorax, it can help improve the patient at preoperative performance status.The second, the reducing of gross tumor volume can make range of operation diminish so protect organ and its function of patient.This is valuable especially for for example patient with breast cancer.The reducing of gross tumor volume also can make original inoperable tumor perform the operation.At last, neoadjuvant can improve the probability of removing tumor by operation fully, improves survival rate thus.In the past during the decade, existing many to use the different chemical therapeutic agent and or radiation suffer from the cancer patient's of for example breast carcinoma, head and neck cancer, rectal cancer, bladder cancer, nonsmall-cell lung cancer, cervical cancer, esophagus and gastric cancer and carcinoma of prostate the clinical trial of neoadjuvant with treatment.Summary is referring to people such as Tanvetyanon, Southern Med.J.98:338-344 (2005).

Say that as mentioned a kind of main defective all relevant with the chemotherapy of any kind is significant toxicity.Many new assistant chemical therapy schemes are troubles, need be in very long a period of time frequent treatment.And, the benefit of new assistant chemical therapy in having than the patient of low risk of recurrence, especially the survival rate benefit is not clear, makes that whether being worth wait rather than immediate surgery to become for them has a question.

Angiogenesis is important cell incident, and wherein vascular endothelial cell proliferation, pruning (prune) and reorganization are to form new blood vessel from existing blood vessel network.The evidence that attracts people's attention is that the growth of blood vessel connection (vascular supply) for normal and pathological breeding is necessary.The rate-limiting step in the most of growth course that takes place in the multicellular organisms has been represented in the transmission of oxygen and nutrient and catastatic removal.

Although the introducing of neovascularity is considered to the main mode of tumor-blood-vessel growth, recent data have shown that some tumor can be by using (co-opting) existing host blood vessel growth.The vascular system used is afterwards degenerated, and causes tumour regression, and it is finally reversed by the angiogenesis at the hypoxia inducible of borderline tumor.

One of forward instrumentality of the key of normal and improper angiogenesis is VEGF (VEGF)-A.VEGF-A is a part that comprises the gene family of VEGF-B, VEGF-C, VEGF-D, VEGF-E, VEGF-F and PlGF.VEGF-A mainly combines with the receptor tyrosine kinase VEGFR-1 (Flt-1) and the VEGFR-2 (Flk-1/KDR) of two high-affinities, and the latter is the main mediator of the vascular endothelial cell mitogenesis signal of VEGF-A.In addition, neuropil albumen-1 has been confirmed to be the receptor of heparin-bounding VEGF-A isotype and can have worked in vascular development.

Except being the angiogenesis factor, VEGF for example shows multiple biological effect in the stream in endotheliocyte survival and propagation, vascular permeability and vasodilation, monocyte chemotaxis and the calcium as multi-purpose somatomedin at other physiological process.And other researchs have reported that VEGF is to for example mitogenesis effect of retinal pigment epithelium, pancreatic ductal cell and Shi Wan Schwann Cells (Schwann cell) of the non-endothelial cell types of minority.

Caused the active many trials of blocking VEGF in the state that relates to the pathological angiogenesis generation as the approval of the main instrumentality of pathological state medium vessels generation for VEGF.

In most of malignant tumor vegf expression raised and VEGF cross to express with many solid tumors in stage in late period or relevant more with worse prognosis.Therefore, the molecule of inhibition VEGF signal path has been used to treat the significant solid tumor in late period relatively of wherein pathological angiogenesis generation.

Relating to the illness that pathological angiogenesis generates or the developing effect of disease (comprising late period and transitivity or diffusibility tumor) although hint VEGF on evidence, about solving less in the recurrence of VEGF tumor in early days or after the optimum cancer, dormancy or developing having acted on from the tumor at the secondary position of dormancy tumor, malignant tumor or micrometastasis (micrometastase).Tangible as summary according to following disclosure, the invention solves these and other demands.

Summary of the invention

It is useful that the use of the VEGF specific antagonists that combines with chemotherapy has shown the patient who suffers from metastatic colorectal cancer and nonsmall-cell lung cancer and other cancers, but about VEGF specific antagonists therapy to optimum or infantile tumour; The recurrence of dormancy, operation or other intervention back tumors; Development from the Secondary cases position tumor of dormancy tumor, malignant tumor or micrometastasis; Or the influence in auxiliary or newly auxiliary situation is known little about it.We provide herein proves that the VEGF specific antagonists can be used to infantile tumour and comprise benign, cancer result preceding, tumor treatment non-metastatic and that can perform the operation.Described result has proved that further the VEGF specific antagonists can be used to the neoadjuvant of cancer (for example optimum or pernicious cancer) or is used for prevention and/or reduces the probability of cancer recurrence (for example optimum or pernicious cancer), comprises the method for complementary therapy.The present invention has constituted for suffering from the patient that cancer comprises benign, early stage and the cancer that can perform the operation provides the great medical treatment of the nursing that (before the operation and operation back) is more effective, toxicity is littler to break through.

Therefore, the present invention is benign among the curee with treatment, the method for cancer before the cancer or non-metastatic is a feature, and described method comprises the VEGF specific antagonists of the curee being used effective dose.In certain embodiments, using of VEGF specific antagonists prevented canceration before benign, the cancer or non-metastatic to become diffusibility or metastatic carcinoma.For example, benign, cancer cancer preceding or non-metastatic is 0 phase, I phase or II phase cancer, and in certain embodiments, that the using of VEGF specific antagonists prevented is benign, cancer before the cancer or non-metastatic develops into down first phase for example I phase, II phase, III phase or IV phase cancer.In certain embodiments, tumor before the VEGF specific antagonists is benign among the curee with enough treatments, the cancer or non-metastatic or prevent benign, cancer before or amount and time that the tumor of non-metastatic becomes diffusibility or metastatic carcinoma use.In certain embodiments, use the VEGF specific antagonists and reduced tumor size, tumor load or tumor number benign, cancer tumor preceding or non-metastatic.Can also the VEGF specific antagonists is benign to reduce, the amount and the time of the vessel density in the tumor before the cancer or non-metastatic uses.

As described herein, method of the present invention can be used to treatment for example 0 phase (such as cancer in situ), I phase or II phase cancer.It is for example benign or virulent that method new auxiliary and complementary therapy can be used to treat the cancer of any kind.In certain embodiments of the invention, described cancer is the epithelial cell solid tumor, include but not limited to human primary gastrointestinal cancers, colon cancer, breast carcinoma, carcinoma of prostate, renal carcinoma, pulmonary carcinoma (for example nonsmall-cell lung cancer), melanoma, ovarian cancer, cancer of pancreas, head and neck cancer, hepatocarcinoma and soft tissue cancer (for example, B cell lymphoma such as NHL and multiple myeloma and leukemia are such as chronic lymphocytic leukemia).In another embodiment, described benign, tumor before the cancer or non-metastatic is a polyp, adenoma, fibroma, lipoma, gastrinoma, insulinoma, chondroma, osteoma, hemangioma, lymphangioma, meningioma, leiomyoma, rhabdomyoma, squamous cell papilloma, acoustic neuroma, neurofibroma, bile duct cystadenoma (cystanoma), leiomyoma, mesothelioma, teratoma, myxoma, trachoma, granuloma, hamartoma, transitional cell papilloma, the pleomorphic adenoma of salivary gland, fibroma durum, skin sample capsule papilloma (dermoid cystpapilloma), cystadenoma, focal nodositas hypertrophy or nodositas regenerative proliferation.In another embodiment, described method is used for the treatment of adenoma ideally.The limiting examples of adenoma comprises adenoma, renal adenoma, back renal adenoma, bronchial adenoma, alveolar adenoma, adenoma,adrenal, pituitary adenoma, parathyroid adenoma, pancreas adenoma, salivary gland adenoma, adenoma, gastrointestinal adenoma, canalicular adenoma and cholangioadenoma.

The present invention also with comprise that the VEGF specific antagonists that the curee is used effective dose is benign with prevention in the curee, the generation of cancer before the cancer or non-metastatic or the method for recurrence be feature.In certain embodiments of the invention, the curee is in the danger of suffering from cancer, polyp or carcinoma syndrome.In an example, the curee has the family history of cancer, polyp or hereditary cancer syndrome (for example 1 type multiple endocrine adenomas (MEN1)).Of the present invention aspect some in, the curee is in that development is benign, the danger of gastrointestinal tumor, fibroma durum or adenoma (for example gastrointestinal adenoma, pituitary adenoma or pancreas adenoma) before the cancer or non-metastatic.In certain embodiments, described method the curee who never suffered from tumor, never suffered from the curee of clinical detectable cancer, only suffered among the carcinoid curee generation or the recurrence of cancer before described benign, the cancer of prevention or non-metastatic.

In yet another aspect, the present invention is a feature with the method for 0 phase, I phase or II phase gastrointestinal tumor among the treatment curee, and this method comprises uses the VEGF specific antagonists to the curee with the amount and the time of enough treating 0 phase, I phase or II phase gastrointestinal tumor among the curee.But the cancer of any 0 phase, I phase or the II phase of gastrointestinal tumor gastronintestinal system comprises anus cancer, colorectal carcinoma, rectal cancer, the esophageal carcinoma, carcinoma of gallbladder, gastric cancer, hepatocarcinoma, cancer of pancreas and carcinoma of small intestine.In one embodiment, gastrointestinal tumor is 0 phase (for example high-level adenoma) or I phase tumor.In one embodiment, do not live through the excision of treatment gastrointestinal tumor before the curee.

In yet another aspect, the present invention is a feature with the method that treatment is in the curee of development gastrointestinal tumor danger, and this method comprises enough to prevent the generation of gastrointestinal tumor among the curee or the amount and the time of recurrence that the curee is used the VEGF specific antagonists.Described gastrointestinal tumor is any gastrointestinal tumor, includes but not limited to adenoma, one or more polyps or 0, I or II phase cancer.

In some embodiment of said method, the curee surpasses 50 years old the mankind, suffers from the hereditary cancer syndrome or colon cancer is arranged or the family history of polyp.The syndromic limiting examples of heritability human primary gastrointestinal cancers comprises familial adenomatous polyposis (FAP), Gardner syndrome, cancer of pancreas and hereditary nonpolyposis characteristic of disease colorectal carcinoma (HNPCC).In certain embodiments, can experience or not live through colonoscopy before the curee.In one embodiment, amount and the time of the VEGF specific antagonists being suffered from the number of adenoma colorectal polyp among the curee of FAP with minimizing uses.

In yet another aspect, the present invention is a feature with prevention or the method that reduces the probability of cancer recurrence among the curee, and this method comprised with enough preventions or the amount and time of reducing the probability of cancer recurrence among the curee uses the VEGF specific antagonists to the curee.The present invention includes prevention and suffer from the method for cancer recurrence among the curee of tumor, this method comprises the step of removing tumor (for example using the definitiveness operation) and afterwards the curee being used the VEGF specific antagonists.The present invention includes the long method of tumor regrowth among the prevention curee, this method comprises the step of removing tumor (for example using the definitiveness operation) and afterwards the curee being used the VEGF specific antagonists.In related fields, the present invention includes cancer recurrence among the prevention curee or reduce the method for the probability of cancer recurrence among the curee, this method randomly is included in effective dose is used in operation before to the curee VEGF specific antagonists, carry out the definitiveness operation, with the VEGF specific antagonists of after operation, using effective dose, the probability of using prevention cancer recurrence or reduction cancer recurrence of the back VEGF specific antagonists of wherein performing the operation.In another related fields, the present invention includes cancer recurrence among the prevention curee or reduce the method for the probability of cancer recurrence among the curee, this method is included in and does not have the VEGF specific antagonists of under any other situation of anticancer therapeutic agent the curee being used effective dose, the wherein said probability of using cancer recurrence among the prevention curee or reducing cancer recurrence among the curee.

For each aspect above, but the tumor of tumor any kind includes but not limited to solid tumor described herein, and particularly tumor and adenoma.The curee can have dormancy tumor or micrometastasis, and it or be not detectable clinically.In this embodiment on the one hand, the VEGF specific antagonists was used with the amount and the time of the neovascularization of enough minimizing dormancy tumors or micrometastasis.In another embodiment, the VEGF specific antagonists is taken place with the clinical detectable tumor of enough preventions or its transfer or increase the curee and use survive amount and time of persistent period.

In one embodiment, the VEGF specific antagonists is a monotherapy.In another embodiment, treat tumor before the curee, for example used anti-cancer therapies.In an example, anti-cancer therapies is operation.In another embodiment, before using the VEGF specific antagonists, in (for example side by side) or further treat the curee with other anti-cancer therapies afterwards.The example of anti-cancer therapies includes but not limited to the combination of operation, X-ray therapy (actinotherapy), biotherapy, immunotherapy, chemotherapy or these therapies.

Lived through in the embodiment of definitiveness operation the curee, after a period of time is restored in operation, used the VEGF specific antagonists the curee usually.Can comprise during this period of time wound healing or operative incision heal the needed time period, reduce the wound dehiscence needed time period of risk or the curee returns to and the similar in essence or better needed time period of health level of preoperative health level.Definitiveness operation finish and the using first of VEGF specific antagonists between time period also can comprise the needed time period of drug holiday, wherein the curee needs or requires a period of time between therapeutic scheme.Usually, definitiveness operation is finished and the time period of VEGF specific antagonists therapy between beginning can comprise and be less than a week, 1 week, 2 weeks, 3 weeks, 4 weeks (28 days), 5 weeks, 6 weeks, 7 weeks, 8 weeks, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years or more of a specified duration.In one embodiment, definitiveness operation and use time period between the VEGF specific antagonists greater than 2 weeks and less than 1 year.

Each above-mentioned aspect can further comprise the recurrence of monitoring curee cancer.

The present invention also provides the method for the neoadjuvant before curee's cancer that for example exenterate can be performed the operation in the human patients, this method comprises the VEGF specific antagonists bevacizumab for example that the patient is used effective dose, and wherein the patient has been diagnosed as and has suffered from tumor or cancer.The VEGF specific antagonists can be separately or is combined with at least a chemotherapeutant and to use.

The present invention comprises that also treatment suffers from curee's the method for the cancer that can perform the operation, and this method is included in to be used the VEGF specific antagonists of effective dose to the curee before the operation and undergo surgery afterwards, so as to the excision cancer.In one embodiment, described method further is included in the operation back and the curee is used the step of the VEGF specific antagonists of effective dose with the prevention cancer recurrence.

In yet another aspect, the present invention relates to the method for neoadjuvant, this method is included in before the definitiveness operation VEGF specific antagonists bevacizumab for example that the curee who suffers from the cancer that can perform the operation is used effective dose, and at least a chemotherapeutant.Described method can be used to prolong the curee the disease free survival phase (disease free survival, DFS) or overall life cycle (overallsurvival, OS).In one embodiment, at treatment beginning back assessment in about 2 to 5 years DFS or OS.

In yet another aspect, the present invention includes the method for tumor size among the curee who reduces to have unresectable tumor, this method comprises the VEGF specific antagonists of the curee being used effective dose, and wherein said using reduced the excision fully that the tumor size allows tumor thus.In one embodiment, described method further is included in the VEGF specific antagonists of the curee being used behind the complete tumor resection effective dose.

In yet another aspect, the present invention relates to treat the method for cancer among the curee, this method may further comprise the steps: the phase I that a) comprises a plurality of treatment cycle, wherein each cycle comprises the VEGF specific antagonists bevacizumab for example of the curee being used effective dose with predetermined interval, and at least a chemotherapeutant; B) definitiveness operation is so as to removing cancer; And c) comprise a plurality of second stage of keeping the cycle, wherein each cycle comprises the VEGF specific antagonists bevacizumab for example of the curee being used effective dose with predetermined interval, but without any chemotherapeutant.In one embodiment, phase I comprises first a plurality of treatment cycle, wherein use VEGF the specific antagonists for example bevacizumab and the first chemotherapy scheme, be second a plurality of treatment cycle afterwards, wherein use VEGF the specific antagonists for example bevacizumab and the second chemotherapy scheme.In one embodiment, if cancer to be treated is a breast carcinoma, the first chemotherapy scheme comprises adriamycin and cyclophosphamide and the second chemotherapy scheme comprises paclitaxel so.

The invention provides the VEGF specific antagonists method of bevacizumab for example of definitiveness operation back the curee of the cancer of suffering from transitivity or non-metastatic being used effective dose that is included in.In one embodiment, described method further comprises the use of at least a chemotherapeutant.Described method can be used to prolong curee's DFS or OS.In one embodiment, at treatment beginning back assessment in about 2 to 5 years DFS or OS.In one embodiment, the curee after treatment at least 1 to 5 year be anosis.

In one aspect, this method may further comprise the steps: the phase I that a) comprises a plurality of treatment cycle, wherein each cycle comprises the VEGF specific antagonists bevacizumab for example of the curee being used effective dose with predetermined interval, and at least a chemotherapeutant; And b) comprise a plurality of second stage of keeping the cycle, wherein each cycle comprises the VEGF specific antagonists bevacizumab for example of the curee being used effective dose with predetermined interval, but without any chemotherapeutant; Wherein Zu He first and second stages continue at least one year behind initial post-operative treatment.In one embodiment, phase I comprises first a plurality of treatment cycle, wherein use VEGF the specific antagonists for example bevacizumab and the first chemotherapy scheme, be second a plurality of treatment cycle afterwards, wherein use VEGF the specific antagonists for example bevacizumab and the second chemotherapy scheme.If cancer to be treated is a breast carcinoma, so for example, the first chemotherapy scheme comprises adriamycin and cyclophosphamide and the second chemotherapy scheme comprises paclitaxel.

In above-mentioned some embodiment aspect each, the VEGF specific antagonists is to combine with VEGF or reduce vegf expression or bioactive chemical compound.The VEGF specific antagonists can be any one in the following exemplary compounds: with the bonded polypeptide of VEGF specificity, VEGF specific ribozyme, VEGF specific peptide body (peptibody), with the complementary antisense nuclear of at least a portion base oligomer of the nucleic acid molecules of coding VEGF polypeptide, with the complementary small RNA molecular of at least a portion of the nucleic acid molecules of coding VEGF polypeptide or fit.Specificity is in conjunction with the polypeptide of VEGF for example Flt-1/Fc, KDR/Fc or Flt/KDR/Fc of soluble vegf receptor protein or its VEGF binding fragment or chimeric vegf receptor protein.Specificity is in conjunction with the polypeptide of VEGF also VEGF antibody or its Fab.But VEGF antibody or its Fab monoclonal antibody, chimeric antibody, complete human antibodies or humanized antibody.Useful in the method for the invention exemplary antibodies comprises bevacizumab G6-31, B20-4.1 and its fragment.Described antibody or its Fab also lack the antibody of Fc part, F (ab ') 2, Fab or Fv structure.

Depend on the type and the severity of disease, the VEGF specific antagonists for example preferred dose of bevacizumab is described herein and can be changed to about 50mg/kg from about 1 μ g/kg, most preferably be changed to about 15mg/kg, include but not limited to 7.5mg/kg or 10mg/kg from about 5mg/kg.The frequency of using will depend on the type of disease and severity and change.To repeat several days or more of a specified duration in order using, to depend on illness, with treatment keep up to as by described herein or treatment that methods known in the art are measured cancer or reach required therapeutic effect.In an example, with VEGF specific antagonists of the present invention (for example antibody) to be changed to about 15mg/kg from about 5mg/kg, the dosage that includes but not limited to 7.5mg/kg or 10mg/kg weekly, per two weeks or use once in per three weeks.But other dosages can be effective.Technology by routine and measure the process of easily monitoring therapy of the present invention.

In above-mentioned other embodiments aspect each, local or systematically (for example oral or intravenous ground) use the VEGF specific antagonists.In one embodiment, the treatment of using the VEGF specific antagonists being prolonged up to the patient is no cancer reaching time period of being selected from by 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years and the group formed in 12 years.

Although can be before using the VEGF specific antagonists, in or treat the curee in many different modes afterwards, in an embodiment aspect each of the present invention, the curee does not undergo surgery or chemotherapeutic treatment.In other embodiments, as being estimated by the clinician or described herein, the treatment of using the VEGF specific antagonists is the monotherapy of monotherapy or lasting VEGF specific antagonists treatment persistent period phase.

In other embodiments, using the treatment of VEGF specific antagonists is to combine with other anti-cancer therapies, and described other anti-cancer therapies includes but not limited to operation, X-ray therapy, chemotherapy, differentiation therapy (differentiating therapy), biotherapy, immunotherapy, angiogenesis inhibitor and anti-proliferative compounds.Use the treatment of VEGF specific antagonists also can comprise above any combination of the therapeutic scheme of type.In addition, cytotoxic agent, anti-angiogenic agent and antiproliferative can be used in combination with the VEGF specific antagonists.In one embodiment, anti-cancer therapies is a chemotherapy.For example, chemotherapeutant is selected from such as alkylating agent, antimetabolite, folacin, pyrimidine analogue, purine analogue and relevant inhibitor, vinca alkaloids, epipodophyllotoxin (epipodopyyllotoxin), antibiotic, the altheine enzyme, topoisomerase enzyme inhibitor, interferon, platinum coordination (cooridnation) complex, the carbamide that anthraquinone replaces, the methyl hydrazine derivant, the adrenal cortex depressant, adrenocorticosteroid (adrenocorticosteroide), progesterone, estrogen, estrogen antagonist, androgen, antiandrogen, gonadotropin releasing hormone analogues etc.In some aspects, chemotherapeutant and VEGF specific antagonists parallel (concurrently) are used.

In the embodiment of the anti-cancer therapies that comprises other, can be before using the VEGF specific antagonists, in (for example side by side) or further treat the curee with other anti-cancer therapies afterwards.In one embodiment, anti-cancer therapies is to comprise the chemotherapy of using irinotecan, fluorouracil, formyl tetrahydrofolic acid, gemcitabine or its combination.In one embodiment, can will use as maintenance therapy separately or with the VEGF specific antagonists that anti-cancer therapies is used.In one aspect, but the anti-cancer therapies hormonotherapy of carcinoma of prostate, ovarian cancer and breast carcinoma.In an exemplary, the VEGF specific antagonists combined with anti-cancer therapies use, this anti-cancer therapies (does not for example comprise anti-Her2 antibody or its fragment or derivant

Antibody).

Method of the present invention is prevented to more development in late period thus to treatment and prevention infantile tumour, and the decline that causes the M ﹠ M relevant with advanced carcinoma is especially useful.Method of the present invention is also to the recurrence of prophylaxis of tumours or the regrowth of tumor (for example dormancy tumor that exists after removing primary tumo(u)r) always or to reducing or the generation of prevention micrometastasis or breed useful.

For method of the present invention, but the cancer solid tumor is for example such as breast carcinoma, colorectal carcinoma, rectal cancer, pulmonary carcinoma, renal cell carcinoma, glioma (for example prominent less astrocytoma of anaplastic astrocytoma, anaplastic, anaplastic oligodendroglioma, glioblastoma multiforme), renal carcinoma, carcinoma of prostate, hepatocarcinoma, cancer of pancreas, soft tissue sarcoma, carcinoid (carcinoidcarcinoma), head and neck cancer, melanoma and ovarian cancer.In one embodiment, cancer is a human primary gastrointestinal cancers.

In the above-mentioned other embodiments aspect each of the present invention, the VEGF specific antagonists is used to reduce the cancerous cell number in (for example 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more) tumor or the cancer (including but not limited to cancer before benign, the cancer or non-metastatic) with a certain amount of or certain hour (All Time of for example specific therapeutic scheme); To reduce the size of tumor, polyp or adenoma; To reduce tumor load; Go among the peripheral organ to suppress (promptly be reduced to a certain degree and/or stop) cancer cell infiltration; To reduce hormone secretion; To reduce the number of polyp; To reduce tumor or cancer (including but not limited to benign, cancer cancer preceding or non-metastatic) medium vessels density; To suppress neoplasm metastasis; To reduce or inhibition tumor growth or tumor cell proliferation; To reduce or prevention dormancy growth of tumor; To reduce or to prevent the growth or the propagation of micrometastasis; Regrowth with minimizing or prophylactic treatment or removal back tumor; To increase or to prolong DFS or the OS that easily suffers from or be diagnosed as the curee who suffers from tumor before benign, the cancer or non-metastatic; And/or with one or more remissions that will be relevant with cancer to a certain degree.In an example, be measured as curee's DFS or OS life cycle, wherein at treatment beginning back assessment in about 2 to 5 years DFS or OS.In some other embodiments, the VEGF specific antagonists is used to prevent the generation or the recurrence of cancer among the curee.In an example, after about 4 years in curee's colony the prevention of assessment cancer recurrence with confirm colony at least about 80% in palindromia does not take place.In another example, the VEGF specific antagonists is used to reduce the probability of tumor among the curee or cancer recurrence.In an example, assessment cancer recurrence in the time of about 3 years is wherein compared with the curee who only treats with chemotherapy, and cancer recurrence has been reduced at least about 50%.

Method of the present invention also can comprise the recurrence of monitoring curee's cancer or tumor.

According to following detailed description, accompanying drawing and claim, other features and advantages of the present invention will be tangible.

The accompanying drawing summary

Figure 1A-1F shows Apc ^Min/+The serial microphotograph that VEGF-A expresses in adenoma and the normal fine hair.With the VEGF-A probe from big Apc of 14 weeks ^Min/+The in situ hybridization that carries out on the enteric adenoma of small intestinal of mice (Figure 1A, 1D) and large intestine (Figure 1B, 1E) and the normal fine hair (Fig. 1 C, 1F) shows the expression of VEGF-A in epithelial cell (arrow, arrow) and the stromal cell (arrow head, arrow).Bright field: Figure 1A-1C, dark ground: Fig. 1 D-1F.

Fig. 2 A-2F shows the inhibition reduction tumor load of VEGF-A and the series diagram that prolongs life cycle.Fig. 2 A is the diagram of the tumor load of independent mice in the demonstration group.Indicate tumor load by bar from the peak to peak of tumor load.White crosses indicates cell mean.*P＜0.008，**p＜5.3x10 ^-5。N indicates the number of animal.Fig. 2 B is by diameter and the series diagram that distributes as the percentages show tumor of tumor total number.N indicates the number of tumor in the group.Fig. 2 C be show 3 week of treatment back (on) and 6 week of treatment the back (in) the big small frequency of the tumor series that covers (overlay) illustrates.The diagram of bottom shows that the big small frequency of the tumor of comparing with the 0th day covers (descending).Vertical line illustrates a kind of like this size---and the tumor frequency is bigger in the animal that mAbG6-31 handles when being less than or equal to this size; It is 1.2mm for 1mm in 6 all processed group in 3 all processed group.Fig. 2 D is the diagram that shows the average tumor diameter that position in the intestinal is drawn.N indicates in the first, second, third and the 4th intestinal 1/4th districts every group tumor number respectively.Group comprised 12 animals in the 0th day, and other groups are 10.S: stomach; C: caecum, R: rectum.Bar is represented SEM.Compare * P＜1.0x10 with mAb G6-31 three or six weeks ^-10, * * p＜0.002.Fig. 2 E shows 14 Apc ^Min/+, Villin-Cre (black post) and Apc ^Min/+, VEGF ^Lox, Villin-Cre (Lycoperdon polymorphum Vitt post) mice the diagram that shows with descending of average tumor diameter.Bar is represented standard deviation (SD).Fig. 2 F is the diagram of the Kaplan-Meier of demonstration mAb G6-31 (gray line) or the mice that contrasts IgG (black line) processing.The persistent period that sword fingers Mingzhi of hollow treats.Represent intermediate value life cycle with gray arrow.*P＜2.4x10 ^-3。N indicates the number of mice in the group.

Fig. 3 A-3L shows that anti-VEGF-A handles and is changing tumor morphology but be not effect on the proliferation index.Fig. 3 A-3B is the microphotograph of jejunal segment of the small intestinal of methylene blue staining.Fig. 3 C-3D shows H﹠amp; The microphotograph of the low amplification image of the painted section from jejunum of E.Fig. 3 E-3F shows H﹠amp; The microphotograph of the high-amplification-factor image of the painted tumor biopsy from jejunum of E.Fig. 3 G-3J shows that the use Ki-67 antibody of tumor tissues and normal mucosa carries out the microphotograph of immunohistochemical staining.With H﹠amp; E redyes.Fig. 3 K is that display list is shown the diagram of the positive cell nuclear phase of Ki-67 for the proliferation index of the percentage ratio of nucleus total number.Bar is represented SEM.The western blot analysis of the normal mucosa lysate of the animal that next personal contrast IgG (N1-N4) of Fig. 3 L or mAb G6-31 (N5-N8) handle.Come the tumor lysate of the animal of personal contrast IgG (T1-T4) or mAb G6-31 (T5-T8) processing.

The tumor vessel areal concentration that Fig. 4 A-4C demonstration reduces when handling with mAb G6-31.Fig. 4 A-4B is the confocal images from the 80 μ m section of the tumor of jejunum of immunohistochemical staining.Green-CD31, vascular endothelial cell; Blueness-E-cadherin, epithelial cell; Redness-smooth muscle actin.Fig. 4 C is that display list is shown the diagram of the positive region of CD31 with respect to the vessel density of the percentage ratio of total tumor region of being analyzed.Bar is represented SEM; N indicates the tumor number of being analyzed.

Fig. 5 A-5D shows that anti-VEGF-A handles the series diagram that suppresses the pituitary tumor growth.Fig. 5 A is the diagram that shows the mean tumour volume of group when handling 9,25,39,53 and 67 days of contrast IgG (black line) and mAb G6-31 (gray line) processing.Bar is represented SEM.N indicates the number of mice in the group.Fig. 5 B is the diagram that shows the gross tumor volume of the independent mice of handling with contrast IgG (solid line) or mAb G6-31 (dotted line).Because it is unhealthy with seven mices euthanasia (line finished before the time point at 67 days) before the research terminal point.Fig. 5 C is presented at the no tumor of handling the group that the contrast IgG (black line) that estimates in the time of 9,25,39,53 and 67 days the beginning back and mAb G6-31 (gray line) handle and doubles-diagram of life cycle.Fig. 5 D is the diagram that is presented at the gross tumor volume measured value of the subcutaneous pituitary tumor graft that contrasts IgG (black line) and mAb G6-31 (gray line) processing when handling 1,7,14,21,28 and 35 day.Bar is represented SEM.N indicates the number of mice in the group.

Fig. 6 shows pituitary gland and Men1 ^+/-The diagram of pituitary adenoma VEGF expression-A, VEGFR-1 and VEGFR-2.Shown wild type pituitary gland (black post), from Men1 ^+/-The nontumorous pituitary gland tissue (Lycoperdon polymorphum Vitt) of mice, from Men1 ^+/-VEGF-A, the VEGFR-1 of the pituitary tumor (blueness) that pituitary tumor (redness) that the little untreated pituitary adenoma of mice, contrast IgG handle and mAb G6-31 handle and the relative expression of VEGFR-2.Bar is represented SEM.Ns: not remarkable.

Fig. 7 is from Men1 ^+/-The serial MRI image of the representational pituitary tumor of mice.Shown mice that contrast IgG and mAb G6-31 handle has a pituitary adenoma when handling 9,39 and 67 days coronal section.For the 9th day, given prominence to the edge of pituitary adenoma with yellow asterisk.Handling the beginning back in the time of 9,39 and 67 days, respectively, the tumor size that contrast IgG handles is 23.2,55.9 and 142.0mm ³, and the tumor size that mAb G6-31 handles is 18.9,27.2 and 35.3mm ³

Fig. 8 A-8H shows Men1 ^+/-The image series of the pituitary tumor of mice and the histological examination of pancreas tumor.Fig. 8 A-8B shows H﹠amp; The painted pituitary tumor of E and Fig. 8 E-8F show H﹠amp; The painted pancreas tumor of E.Fig. 8 C-8D shows the immunohistochemical staining of the original position pituitary tumor of carrying out with general endothelium (panendothelial) labelling MECA-32 and the immunohistochemical staining of the original position pancreas tumor that Fig. 8 G-8H demonstration is carried out with general endothelial marker MECA-32.Fig. 8 I is presented at the result's who measures pituitary tumor medium vessels density in the animal that contrast IgG and anti-VEGF handle diagram and Fig. 8 J is presented at the diagram of measuring the result of pancreas tumor medium vessels density in the animal that contrast IgG and anti-VEGF handle.Bar is represented SD.Ns=is not remarkable.

Fig. 9 A-9D be show the prolactin antagonist stained positive from Men1 ^+/-The image series of pituitary tumor of mice and pituitary tumor graft.The original position pituitary tumor (Fig. 9 A-9B) of carrying out and the immunohistochemical staining of subcutaneous pituitary tumor graft (Fig. 9 C-9D) have been shown with prolactin antagonist antibody.Fig. 9 E and 9F are that the pituitary tumor that shows the transplanting of close mammary gland shows the image that the inductive secretion of prolactin antagonist changes (left side of image).

Figure 10 A-10D is presented at that serum prolactin antagonist and level of growth hormone are raised in the mice with pituitary tumor and pituitary tumor graft.Figure 10 A shows from 19 untreated, as to have tumor Men1 ^+/-Pituitary tumor volume (the mm of mice ³) diagram of levels of serum PRL (ng/ml) level of drawing, show positive correlation.Figure 10 B shows the Men1 that contrast IgG (black triangle) and mAb G6-31 (Lycoperdon polymorphum Vitt sphere) when studying terminal point are handled ^+/-The diagram of the levels of serum PRL level that the pituitary tumor volume of mice is drawn.Figure 10 C-10D is presented at when handling 1 day and 35 days from the serum prolactin antagonist (C) of the mice with pituitary adenoma graft and the diagram of growth hormone (D) level.

Figure 11 be presented at infantile tumour in the mice Rip-T β Ag model that pancreatic islet tumor grows between period of expansion anti-VEGF handle the diagram of the effect of (" intervention ").Diagram shows with the contrast monoclonal antibody processing of mating with isotype to be compared, and handles the decline of the tumor-blood-vessel growth of the average number measurement of passing through the angiogenesis islets of langerhans during 9 to 11 weeks in the back with VEGF antibody.

Figure 12 A and 12B show the result of degradation experiment, wherein do not detect the significant difference of tumor load or life cycle in the mice Rip-T β Ag model that pancreatic islet tumor is grown between the contrast monoclonal antibody processing with VEGF antibody and isotype coupling.Figure 12 A shows with those mices of handling with the contrast monoclonal antibody of isotype coupling to compare, with the diagram of tumor load in the mice of VEGF antibody processing.Figure 12 B shows with those mices of handling with the contrast monoclonal antibody of isotype coupling to compare the diagram that the mice of handling with VEGF antibody survived along with the time.

Figure 13 is presented at taxane or gemcitabine to carry out cell and reduce the diagram of effectiveness that the secular anti-VEGF therapy in back suppresses the regrowth of tumor.

Figure 14 A-14D shows with contiguous normal antepituitary (dotted line of below) to compare, former send out pituitary adenoma (Figure 14 A is on the dotted line) untreated to growth hormone be change and a little less than male image series.In the pituitary tumor of four transplanting (contrast IgG handle) one is the weak positive (Figure 14 B) to growth hormone.Former the pituitary tumor of the mice that mab G6-31 (Figure 14 C) or contrast IgG (Figure 14 D) handle of using by oneself is the focus positive to growth hormone.

The detailed description of invention

I. definition

Term " VEGF " or " VEGF-A " are used to refer to 165 amino acid whose human blood vessels ECGF and 121,145,189 and 206 relevant amino acid whose human blood vessels ECGF (as by such as people Science such as Leung, 246:1306 (1989) and The people Mol.Endocrin. such as Houck, 5:1806 (1991) is described), with and naturally occurring Equipotential and finished form. VEGF-A be comprise VEGF-B, VEGF-C, VEGF-D, The part of the gene family of VEGF-E, VEGF-F and PlGF. VEGF-A main with two The receptor tyrosine kinase VEGFR-1 (Flt-1) of high-affinity and VEGFR-2 (Flk-1/KDR) knot Close, the latter is the main mediator of the vascular endothelial cell mitogenesis signal of VEGF-A. In addition, Neuropilin-1 be confirmed to be heparin-bounding VEGF-A isotype acceptor and can be at blood Pipe works in growing. Term " VEGF " or " VEGF-A " also refer to from the non-human species The VEGF of mouse, rat or primate for example. Sometimes for example be used for human by term The hVEGF of VEGF or the mVEGF that is used for murine VEGF indicate from specific species VEGF. Term " VEGF " also is used to refer to contain in 165 amino acid whose human blood vessels Clipped form or the fragment of the amino acid 8 to 109 of skin cell growth factor or 1 to 109 polypeptide. Can for example pass through " VEGF (8-109) ", " VEGF (1-109) " or " VEGF₁₆₅" identify this The VEGF of mentioned any this form in the application. Such as in natural VE GF sequence sign To the amino acid position of " brachymemma " natural VE GF numbering. For example, natural in brachymemma Amino acid position 17 (methionine) among the VEGF also is the position 17 (first among the natural VE GF Methyllanthionine). The natural VE GF of brachymemma has suitable for natural VE GF KDR and Flt-1 The binding affinity of acceptor.

As used herein, term " VEGF variant " refers to comprise in the natural VE GF sequence The VEGF polypeptide of one or more amino acid mutations. Randomly, one or more amino acid mutations Comprise 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor. In order to simplify the title of VEGF variant described herein, should be noted that Be that number refers to along the position of the amino acid residue of the amino acid sequence of the natural VE GF that generally acknowledges (people such as Leung, as above with people such as Houck, providing as upper).

" native sequences " polypeptide comprise have with from the same acid sequence of the polypeptide of nature Polypeptide. Therefore, the native sequences polypeptide can have from any mammiferous naturally occurring polypeptide Amino acid sequence. Can produce this natural order by restructuring or synthetic method from naturally separating maybe The row polypeptide. Term " native sequences " polypeptide especially comprises the naturally occurring brachymemma of described polypeptide Or the form (for example extracellular domain sequence), the naturally occurring variant of described polypeptide of secretion The naturally occurring allelic variant of form (for example selectively the form of montage) and described polypeptide.

Polypeptide " variant " mean have with the native sequences polypeptide at least about 80% amino acid sequence with The biologically active polypeptide of one property. This variant comprises, for example, and wherein at N or the C end of polypeptide End adds or lacks the polypeptide of one or more amino acid residues. Usually, variant has and natural order The row polypeptide is at least about 80% amino acid sequence identity, more preferably at least about 90% amino acid Sequence homogeneity and even more preferably at least about 95% amino acid sequence identity.

" VEGF biologically active " comprises with any vegf receptor and being combined or any VEGF signal Transduction activity for example regulate normal and improper Angiogenesis and blood vessel take place (Ferrara and Davis-Smyth (1997) Endocrine Rev.18:4-25; Ferrara (1999) J.Mol.Med. 77:527-543); Promote embryo's blood vessel to take place and the Angiogenesis (people (1996) such as Carmeliet Nature 380:435-439; The people such as Ferrara (1996) Nature 380:439-442); And regulate In the female reproductive tract and for bone growth and chondrogenetic periodicity vascular proliferation (Ferrara Deng people (1998) Nature Med.4:336-340; The people such as Gerber. (1999) Nature Med. 5:623-628). The angiogenesis factor in taking place as Angiogenesis and blood vessel, VEGF is logical at for example endothelial cell survival of other physiology courses, blood vessel as the growth factor of multiple-effect Thoroughly show multiple biological effect in the stream in property and vasodilation, monocyte chemotaxis and the calcium (Ferrara and Davis-Smyth (1997) are as above with people .Cell.Mol.Life such as Cebe-Suarez Sci.63:601-615 (2006)). And in nearest research reported that VEGF is non-to minority Chrotoplast type for example retinal pigment epithelium, pancreatic ductal cell and Shi Wan Schwann Cells short has silk Splitting action. The people such as Guerrin. (1995) J.Cell Physiol.164:385-394; Oberg-Welsh Deng the people. (1997) Mol.Cell.Endocrinol.126:125-132; The people such as Sondell. (1999) J. Neurosci.19:5731-5740.

This paper partly describes " VEGF specific antagonists " at III.

" VEGF antibody " is the antibody of being combined with VEGF with enough affinity and specificity. Selected antibody will have the enough strong binding affinities to VEGF usually, and for example antibody can With the K between the 100nM-1pM_dValue is in conjunction with hVEGF. Can be for example by surface plasma altogether Shaking, (for example, application disclose description among No. 2005/012359, the WO such as PCT for the mensuration on basis BIAcore measure); Enzyme linked immunosorbent assay (ELISA) (ELISA); And competition assay (for example RIA's) determine affinity of antibody. In certain embodiments, VEGF antibody of the present invention Can be used as the therapeutic agent that target and intervention wherein relate to disease or the illness of VEGF activity. Antibody Also can stand other biological activity determination, for example in order to estimate it as the effectiveness of therapeutic agent. This Kind mensuration is known in the art and depends on target antigen and the desired use of antibody. Example comprises HUVEC suppress to measure (as described in the embodiment hereinafter); The tumour cell growth inhibition is surveyed Fixed (for example, as WO 89/06692 described in); The cytotoxicity of antibody dependent cellular (ADCC) and the mensuration of the cytotoxicity of complement-mediated (CDC) (United States Patent (USP) 5,500,362); With And the mensuration (referring to WO 95/27062) of excitability activity or haemocyte generation. Anti-VEGF is anti-Body usually not can with other VEGF homologues for example VEGF-B or VEGF-C be combined, not yet For example PlGF, PDGF or bFGF are combined with other growth factor. About VEGF antibody Other information can be in the III part, and A finds.

Spread all in the specification and claims, in the heavy chain immunoglobulin numbering of residue be as The people such as Kabat, Sequences of Proteins of Immunological Interest (pay close attention to by immunology The sequence of protein), the 5th edition, Public Health Service (public health bureau), National Institutes of Health (NIH), Bethesda, among the Md. (1991) The numbering of EU index is incorporated this paper clearly by reference into. " such as the EU index among the Kabat " Refer to the residue numbering of IgG 1EU antibody.

Term " antibody " is used with wide significance and is contained especially monoclonal antibody (bag Draw together full length monoclonal antibodies), polyclonal antibody, multi-specificity antibody (for example bispecific antibody) And antibody fragment, as long as they show required biologically active.

According to " Kd " of the present invention or " Kd value " be in one embodiment by as the described radiolabeled VEGF that carries out with Fab form and the VEGF molecule of antibody of following mensuration measure in conjunction with mensuration (RIA): by make Fab and Cmin (¹²⁵I) mark VEGF (109) is balance in the situation that unlabelled VEGF titration series exists, afterwards with anti-The plate of Fab antibody sandwich is caught the VEGF of combination, measure Fab to the solution of VEGF in conjunction with the parent And power (people such as Chen, (1999) J.Mol Biol 293:865-881). Be the condition of establishment mensuration, Catch anti-Fab antibody (Cappel Labs) with the 5ug/ml that is dissolved in 50mM sodium carbonate (pH 9.6) Spend the night microtiter plate (Dynex) is coated, and subsequently with the ox blood of 2% (w/v) that be dissolved in PBS Pure albumen was in room temperature (about 23 ℃) sealing two to five hours. At non-adsorptivity (non-adsorbant) In the plate (Nunc#269620), with 100pM or 26pM [¹²⁵I] VEGF (109) and interested The serial dilutions of Fab such as Fab-12 is mixed (people such as Presta, (1997) Cancer Res. 57:4593-4599). Afterwards with interested Fab overnight incubation; But hatched sustainable 65 hours To guarantee to reach balance. After this, mixture is transferred to capture board so that incubated at room one hour. Remove afterwards solution and plate is washed eight times with 0.1% the Tween-20 that is dissolved in PBS. When plate dried, Scintillator (the MicroScint-20 that adds the 150ul/ hole; Packard), and with plate at Topcount The upper counting of gamma counter (Packard) ten minutes. The selection generation is less than or equal to maximum combination The concentration of every kind of Fab of 20% is used for competitive binding assay. According to another embodiment, Kd or Kd value are that surface plasmon resonance measurement is fixed (to have used BIAcore by using^TM-2000 or BIAcore^TM-3000 (BIAcore, Inc., Piscataway, NJ)) in 25 ℃ with fixing HVEGF (8-109) CM5 chip is measured with～10 response units (RU). Briefly, According to supplier's specification with carboxymethyl dextran resin biologic sensor chip (CM5, BIAcore Inc.) with N-ethyl-N '-(3-dimethylamino-propyl)-carbodiimide hydrochloride (EDC) and N-hydroxyl fourth Imidodicarbonic diamide (NHS) activation. Before with 5ul/ minute flow velocity injection, use the 10mM sodium acetate, pH 4.8 with human VEGF be diluted to 5ug/ml (～0.2uM) to obtain about 10 response units (RU) Coupling protein. Inject after the human VEGF, the monoethanolamine that injects 1M is unreacted to seal Group. For kinetic measurement, with the Fab serial dilutions (0.78nM to 500nM) of twice Inject the PBS (PBST) that contains 0.05% polysorbas20 with the flow velocitys of about 25ul/min in 25 ℃ In. With Langmuir combination model (BIAcore assessment software 3.2 editions) is logical simply one to one Cross simultaneously match association and dissociate induction spectrum (sensorgram) calculating association rate (k_on) and the speed (k that dissociates_off). Equilibrium dissociation constant (Kd) is calculated as k_off/k _onRatio. Referring to for example Chen, the people such as Y., (1999) J.Mol Biol 293:865-881. If the surface by above etc. The association rate (on-rate) that gas ions resonance is measured surpasses 10⁶M ^-1S ^-1, can pass through so Increase gradually the human VEGF short-form (8-109) of concentration or the situation that mouse VEGF exists Lower at spectroscope, for example equipped spectrophotometer (the spectrophometer) (Aviv that arrheas Instruments) or have 8000 serial SLM-Aminco spectrophotometers that stir absorption cell Be dissolved in PBS when measured use is measured 25 ℃ (ThermoSpectronic), pH's 7.2 The fluorescent emission intensity of 20nM VEGF antibody (Fab form) (excites=295nm; Send out Penetrate=340nm, 16nm band is logical) increase or the fluorescent quenching technology that reduces determine association rate.

" closure " antibody or antibody " antagonist " are the lifes that suppresses or reduce the antigen of its combination The antibody of thing activity. For example, VEGF specific antagonists antibody is in conjunction with VEGF and suppress VEGF The ability of induction of vascular endothelial cell proliferation. Preferred blocking antibody or antagonist antibody are complete The biologically active that suppresses antigen.

Unless otherwise point out, spread all over this specification and use phrase " multivalent antibody " expression to contain The antibody that three or more antigen binding sites are arranged. For example, multivalent antibody is transformed into and has three Or more antigen binding sites are not IgM or the IgA antibody of native sequences usually also.

" Fv " fragment is the antibody fragment that comprises complete antigen recognizing and binding site. This district by A heavy chain that closely associates and the dimer of a light chain variable domain form, for example at scFv Described in associate in nature covalency. It is in such configuration---each variable domains Three CDR interact to define V_H-V _LThe lip-deep antigen binding site of dimer. Six Individual CDR or its subset are given antibody with antigen-binding specificity jointly. But single is variable Domain (or only comprising three to half Fv of the CDR of antigen-specific) also has identification and knot Close the ability of antigen, although usually with the affinity lower than complete binding site.

As used herein, " antibody variable territory " refers to comprise complementary determining region (CDR; Be CDR1, CDR2 and CDR3) and the antibody molecule of the amino acid sequence of framework region (FR) Light chain and the part of heavy chain. V_HRefer to the variable domains of heavy chain. V_LWhat refer to light chain can Become domain. According to employed method among the present invention, can be according to Kabat (Sequences of Proteins of Immunological Interest (sequence of the protein that immunology is paid close attention to) (National Institutes of Health (NIH), Bethesda, Md., 1987 and 1991)) amino acid position of CDR and FR is distributed in definition. Antibody or antigen combination The amino acid of fragment numbering is also according to the numbering of Kabat.

As used herein, term " complementary determining region " (CDR; Be CDR1, CDR2 and CDR3) refer to that its existence is that antigen is in conjunction with the amino acid residue in necessary antibody variable territory. Each variable domains has three CDR that are accredited as CDR1, CDR2 and CDR3 usually The district. Each complementary determining region can contain to come freely by Kabat's defined " complementary determining region " Amino acid residue (that is, the about 24-34 (L1) in the light chain variable domain, 50-56 (L2) and 31-35 (H1) in 89-97 (L3) and the weight chain variable domain, 50-65 (H2) and 95-102 (H3) are residual Base; The people such as Kabat, Sequences of Proteins of Immunological Interest (immunity Learn the sequence of the protein of paying close attention to), the 5th edition .Public Health Service (public health bureau), National Institutes of Health (NIH), Bethesda, MD. (1991)) and/or from those residues of " hypermutation ring " (that is, big in the light chain variable domain 26-32 (H1) in about 26-32 (L1), 50-52 (L2) and 91-96 (L3) and the weight chain variable domain, 53-55 (H2) and 96-101 (H3) residue; Chothia and Lesk J.Mol.Biol.196:901-917 (1987)). In some instances, complementary determining region can comprise from the CDR according to the Kabat definition The amino acid of district and hypermutation ring. For example, the CDRH1 of the heavy chain of antibody 4D5 comprises amino Acid 26 to 35.

" framework region " (FR after this) is those variable domains except the CDR residue Residue. Each variable domains usually has and is accredited as four of FR1, FR2, FR3 and FR4 Individual FR. If according to Kabat definition CDR, light chain FR residue is positioned at approximately so 1-23 (LCFR1), 35-49 (LCFR2), 57-88 (LCFR3) and 98-107 (LCFR4) residue and Heavy chain FR residue be arranged in the heavy chain residue about 1-30 (HCFR1), 36-49 (HCFR2), 66-94 (HCFR3) and 103-113 (HCFR4) residue. If CDR contains the ammonia from the hypermutation ring The base sour residue, so light chain FR residue be arranged in light chain about 1-25 (LCFR1), 33-49 (LCFR2), 53-90 (LCFR3) and 97-107 (LCFR4) residue and heavy chain FR residue position About 1-25 (HCFR1) in the heavy chain residue, 33-52 (HCFR2), 56-95 (HCFR3) and 102-113 (HCFR4) residue. In some instances, Kabat decides when CDR contains to come freely When the CDR of justice and those amino acid whose amino acid of hypermutation ring, the FR residue will be by corresponding so Ground is adjusted. For example, when CDRH1 comprised amino acid H26-H35, heavy chain FR1 residue was In the 1-25 position and the FR2 residue is in the 36-49 position.

" Fab " fragment contains the variable and constant domain of light chain and the variable domains of heavy chain With first constant domain (CH1). F (ab ')₂Antibody fragment contain a pair of usually by them it Between near hinge cysteine covalently bound Fab fragment their carboxyl terminal. The antibody sheet Other chemical couplings of section also are known in the art.

" scFv " or " scFV " antibody fragment contains the V of antibody_HAnd V_LDomain, its In these domains be present in the single polypeptide chain. Usually the Fv polypeptide further comprises V_HAnd V_LPolypeptide chain junctor between the domain, it makes scFv can form antigen in conjunction with needed knot Structure. The summary of scFv, referring to Pluckthun at The Pharmacology of Monoclonal Antibodies (pharmacology of monoclonal antibody), 113 volumes, Rosenburg and Moore edit, Springer-Verlag, New York, 269-315 page or leaf (1994).

Term " double antibody " refers to have the little antibody fragment of two antigen binding sites, and this fragment comprises and same polypeptide chain (V_HAnd V_L) in light chain variable domain (V_L) continuous weight chain variable domain (V_H). Do not allow by using too short on the same chain two domains it Between the connector of pairing, force the complementary structure territory of domain and another chain to be matched and produce two Antigen binding site. Double antibody more intactly is described in for example EP 404,097; WO 93/11161 and the people such as Hollinger, Proc.Natl.Acad.Sci.USA, 90:6444-6448 (1993) in.

Phrase " linear antibody " refers to the people such as Zapata, Protein Eng., 8 (10): 1057-1062 (1995) antibody of describing in. Briefly, these antibody contain the Fd section of pair of series (V_H-C _H1-V _H-C _H1), its light chain polypeptide with complementation forms a pair of antigen binding domain. Line But property antibody bispecific or monospecific.

As used herein, term " monoclonal antibody " refers to from the group of the antibody of homogeneous basically The middle antibody that obtains, namely the described group of single antibody that comprise may except what can exist more in a small amount Identical beyond the abiogenous sudden change. Monoclonal for single antigenic site is anti-Body is high specific. In addition, anti-from the difference that generally includes for different determinants (epi-position) The routine of body (polyclone) antibody preparation is compared, and each monoclonal antibody is for single on the antigen Determinant. Modifier " monoclonal " shows that the feature of antibody is from the antibody population of homogeneous basically Obtain, needing not to be interpreted as producing antibody by any specific method. For example, will comply with Nature 256:495 can be passed through first by people such as Kohler according to the monoclonal antibody that the present invention uses (1975) hybridoma method of describing makes, method that maybe can be by recombinant DNA (referring to, example Such as United States Patent (USP) the 4th, 816, No. 567) make. Also can use such as people such as Clackson Nature Retouch among the people .J.Mol.Biol.222:581-597 (1991) such as 352:624-628 (1991) and Marks The technology of stating is separated " monoclonal antibody " from phage antibody library.

This paper monoclonal antibody is particularly including " chimeric " antibody (immunoglobulin (Ig)), and these The fragment of antibody is as long as they show required biologically active (United States Patent (USP) the 4th, 816,567 Number; With the people such as Morrison, Proc.Natl.Acad.Sci.USA 81:6851-6855 (1984)), In described " chimeric " antibody, the part of heavy chain and/or light chain with from the individually defined thing species or genus in The identical or homology of corresponding sequence in the antibody of specific antibody class or subclass, and all the other of chain Part with from another species or belong to corresponding order in the antibody of another antibody class or subclass Be listed as identical or homology.

" humanization " form of non-human (for example murine) antibody be contain minimum from The chimeric antibody of the sequence of non-human immunoglobulin (Ig). For major part, humanized antibody is Human immunoglobulin (receptor's antibody), wherein from the residue of receptor hypervariable region by from having The non-human species of needed specificity, affinity and ability is mouse, rat, rabbit or non-for example The residue of the hypervariable region (donor antibody) of human primate replaces. In some instances, people Fv framework region (FR) residue of immunoglobulin like protein is replaced by corresponding non-human residue. In addition, Humanized antibody can be included in the residue that can not find in receptor's antibody or the donor antibody. Carrying out these repaiies Be decorated with and further improve the antibody performance. Usually, humanized antibody will comprise basically at least whole One, common two variable domains, wherein whole hypermutation ring and non-human all or basically The hypermutation ring of immunoglobulin (Ig) unanimously and all or basically whole FR district is the human immunity ball The FR district of protein sequence. Humanized antibody also will randomly contain constant region for immunoglobulin (Fc), At least a portion of the constant region of human immunoglobulin normally. For further details, ginseng See the people such as Jones, Nature 321:522-525 (1986); The people such as Riechmann, Nature 332:323-329 (1988); And Presta, Curr.Op.Struct.Biol.2:593-596 (1992).

" human antibodies " is to have with the antibody of producing by the people and/or use as disclosed herein The amino of consensus amino acid sequence of the antibody that makes of the technology of any one manufacturer's antibody-like The antibody of acid sequence. This definition of human antibodies has especially been got rid of and has been contained non-human antigen in conjunction with residual The humanized antibody of base. Can use different technologies known in the art to produce human antibodies. At one In the embodiment, human antibodies is selected from phage library, wherein the phage library express human antibody (the people .Nature Biotechnology 14:309-314 (1996) such as Vaughan; The people such as Sheets. Proc.Natl.Acad.Sci.95:6157-6162 (1998)); Hoogenboom and Winter, J. Mol.Biol., 227:381 (1991); The people such as Marks, J.Mol.Biol., 222:581 (1991)). Also Can for example make the mankind in the mouse by the human immunoglobulin gene seat is introduced transgenic animals Antibody, the endogenous immunoglobulin gene in the described transgenic animals is lost partially or completely Live. After the attack, observed the generation of human antibodies, it is comprising gene rearrangement, assembling and antibody The spectrum all aspects on all with seen in the mankind, arrive closely similar. This method is described in example Such as United States Patent (USP) the 5th, 545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; In 5,661, No. 016 and the following scientific publications: the people such as Marks, Bio/Technology 10: 779-783 (1992); The people such as Lonberg, Nature 368:856-859 (1994); Morrison, Nature 368:812-13 (1994); The people such as Fishwild, Nature Biotechnology 14:845-51 (1996); Neuberger, Nature Biotechnology 14:826 (1996); Lonberg and Huszar, Intern.Rev.Immunol.13:65-93 (1995). Selectively, can be via for order Mark antigen produce antibody human B lymphocyte (this quasi-lymphocyte can from individuality, be recovered or Can external by the immunity) immortalization prepare human antibodies. Referring to, such as people such as Cole, Monoclonal Antibodies and Cancer Therapy (monoclonal antibody and cancer therapy), Alan R.Liss, the 77th page (1985); The people such as Boerner, J.Immunol., 147 (1): 86-95 (1991) With United States Patent (USP) the 5th, 750, No. 373.

" affinity maturation " antibody be in its one or more CDR, have one or more The antibody of change, the antibody antagonism is compared in described change generation with the maternal antibody that does not have those changes Improvement on the former affinity. The antibody of preferred affinity maturation has the Na Mo to target antigen You or even the affinity of picomole quantities. Produce affinity maturation by program known in the art Antibody. The people .Bio/Technology 10:779-783 (1992) such as Marks described by VH and The affinity maturation of VL domain reorganization (shuffling). By following CDR and/or the framework described The mutagenesis at random of residue: the people .Proc Nat.Acad.Sci such as Barbas, USA 91:3809-3813 (1994); The people such as Schier, Gene 169:147-155 (1995); The people .J.Immunol. such as Yelton 155:1994-2004 (1995); The people such as Jackson, J.Immunol.154 (7): 3310-9 (1995) With the people such as Hawkins, J.Mol.Biol.226:889-896 (1992).

" the functional antigen binding site " of antibody be can combining target antigen the site. Antigen The maternal antibody that the antigen-binding affinity of binding site needn't come from antigen binding site Equally strong, but the ability of conjugated antigen must be to use known assessment antibody to the combination of antigen Any measurable in the several different methods. And, each antigen of the multivalent antibody of this paper The antigen-binding affinity of binding site quantitatively needn't be identical. Polymer antibody for this paper , can use such as institute among the embodiment 2 of No. the 20050186208th, U.S. Patent Application Publication and retouch The number of the ultracentrifugal analysis Function of Evaluation antigen binding site of stating. According to this analysis side Method, with target antigen than the different ratios associating of polymer antibody and suppose functional binding site Different numbers and calculate the mean molecule quantity of compound. With these theoretical values and the reality that obtains Experiment value contrast so that the number of Function of Evaluation binding site.

Antibody with " biological nature " of specifying antibody is that with this antibody one or more make It is different from the antibody of the biological nature of other antibody of being combined with same antigen.

Antibody for the epi-position combination of examination on antigen that interested antibody is combined can advance For example Antibodies, the A Laboratory Manual (reality of antibody are measured in the conventional intersection sealing of row Test the chamber handbook), Cold Spring Harbor Laboratory (cold spring harbor laboratory), Ed Harlow With the mensuration of describing among the David Lane (1988).

" species dependence antibody " is the antigen from first mammalian species to be had comparison come From the stronger binding affinity of the affinity of the homologue of this antigen of second mammalian species Antibody. Usually, species dependence antibody " specifically combination " (namely has not in human antigen Surpass about 1x10^-7M preferably is no more than about 1x10^-8M, and most preferably be no more than about 1x10^-9Binding affinity (the K of M_d) value), but have from the second non-human mammal species The binding affinity of the homologue of antigen than the binding affinity of described antibody on human class antigen a little less than extremely Few about 50 times, or at least about 500 times, or at least about 1000 times. Species dependence antibody can Any in the dissimilar antibody as hereinbefore defined, but normally humanization or people Antibody-like.

As used herein, " antibody mutation body " or " antibody variants " are meant the aminoacid sequence variant of species dependency antibody, and wherein one or more amino acid residues of species dependency antibody are modified.This mutant must have with species dependency antibody less than 100% sequence homogeneity or similarity.In one embodiment, the antibody mutation body will have with the heavy chain of species dependency antibody or the aminoacid sequence of light chain variable domain and have at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, and most preferably at least 95% amino acid sequence identity or the aminoacid sequence of similarity.This paper be defined in aligned sequences about the homogeneity of this sequence or similarity and introduce room (if desired) with the sequence homogeneity that reaches largest percentage after, the percentage ratio of the amino acid residue of identical in the candidate sequence (being same residue) or similar (promptly, vide infra) from phase amino acid residue on the same group based on common side chain characteristic with species dependency antibody residue.To the terminal or inner extension of N-end, the C-of the antibody sequence of variable domains outside, disappearance or insert and be not appreciated that and influence sequence homogeneity or similarity.

In order to increase the antibody that contains aminoacid sequence of the present invention or the half-life of polypeptide, as for example United States Patent (USP) 5,739, described in 277, but additional one of antagonist (especially antibody fragment) is remedied the receptors bind epi-position.For example, the nucleic acid molecules that coding can be remedied the receptors bind epi-position is connected with the nucleic acid of coding peptide sequence of the present invention in framework so that the fusion rotein by the nucleic acid molecules expression of transforming contains and remedies receptors bind epi-position and peptide sequence of the present invention.As used herein, IgG molecule (IgG for example " remedied the receptors bind epi-position " and be meant in term ₁, IgG ₂, IgG ₃Or IgG ₄) the epi-position in Fc district, it plays the effect (for example people such as Ghetie, Ann.Rev.Immunol.18:739-766 (2000), table 1) of serum half-life in the body that increases the IgG molecule.Have the antibody that replaces and have the serum half-life of increase in its Fc district and also be described in WO00/42072, WO 02/060919; People such as Shields, J.Biol.Chem.276:6591-6604 (2001); Hinton, J.Biol.Chem.279:6213-6216 (2004)) in.In another embodiment, also can increase serum half-life by for example additional other peptide sequences.For example, can will be used for that the antibody of the inventive method or other polypeptide are additional to FcRn receptor or the bonded serum albumin of serum albumin binding peptide or a sero-abluminous part in case serum albumin and antibody or polypeptide for example among the WO01/45746 disclosed these peptide sequences combine.In one embodiment, will be contained the aminoacid sequence of DICLPRWGCLW by additional serum albumin peptide.In another embodiment, increased the half-life of Fab by these methods.For the serum albumin peptide binding sequence also referring to people such as Dennis, J.Biol.Chem.277:35035-35043 (2002).

" chimeric vegf receptor protein " is the vegf receptor molecule that has from the aminoacid sequence of at least two different proteins (wherein at least one is a vegf receptor protein).In certain embodiments, chimeric vegf receptor protein can and suppress the biological activity of VEGF in conjunction with VEGF.

" isolating " polypeptide or " isolating " antibody are polypeptide or the antibody of discerning and separating and/or reclaim from a component of its natural environment.The contaminant component of its natural environment is to disturb polypeptide or the diagnosis of antibody or the material of therapeutic use, can comprise enzyme, hormone and other solutes proteinic or nonprotein.In certain embodiments, polypeptide or antibody will be purified (1) so that greater than as the polypeptide measured by Luo Shi method (Lowry method) or 95% weight of antibody, and it is most preferred greater than 99% weight, (2) down to the degree that is enough to by at least 15 residues that use rotary-cup type sequenator acquisition N-end or internal amino acid sequence, or (3) are so that reach homogeneity by use Coomassie blue or silver-colored painted SDS-PAGE under reduction or non-reduced condition.Isolating polypeptide or antibody comprise the polypeptide or the antibody of original position in the reconstitution cell, because at least one component of polypeptide natural surroundings will not exist.Yet, will prepare isolating polypeptide or antibody by at least one purification step usually.

So-called " fragment " means the part of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more polypeptide or nucleic acid molecules of the total length that preferably contains reference nucleic acid molecule or polypeptide.Fragment can contain 10,20,30,40,50,60,70,80,90 or 100,200,300,400,500,600 or polynucleotide or 10,20,30,40,50,60,70,80,90,100,120,140,160,180,190,200 or amino acids more more.

" anti-angiogenic agent " or " angiogenesis inhibitor " is meant and suppresses directly or indirectly that angiogenesis, blood vessel take place or protein, antibody or its conjugates or the fusion rotein of the small molecular weight material of unwanted vascular permeability, polynucleotide, polypeptide, isolating protein, reorganization.Should be understood that anti-angiogenic agent comprises in conjunction with angiogenesis factor or its receptor and blocks those agent of its angiogenic activity.For example, anti-angiogenic agent is antibody or other antagonist of the angiogenic agent that defines as mentioned, and for example the antibody of VEGF-A or VEGF-A receptor (such as KDR receptor or Flt-1 receptor), anti-PDGFR inhibitor are such as Gleevec ^TM(imatinib mesylate).Anti-angiogenic agent also comprises natural angiogenesis inhibitor for example angiostatin, endostatin etc.Referring to, for example Klagsbrun and D ' Amore, Annu.Rev.Physiol., 53:217-39 (1991); Streit and Detmar, Oncogene, 22:3172-3179 (2003) (for example listing the table 3 of the anti-angiogenic therapy of malignant melanoma); Ferrara ﹠amp; Alitalo, NatureMedicine 5:1359-1364 (1999); People such as Tonini, Oncogene, 22:6549-6556 (2003) (for example listing the table 2 of known anti-angiogenesis) and Sato.Int.J.Clin.Oncol., 8:200-206 (2003) (for example table 1 is listed employed anti-angiogenic agent in the clinical trial).

" treatment " is meant therapeutic treatment and prophylactic or preventative measure.Those that need treatment comprise suffer from tumor before benign, the cancer or non-metastatic those and wherein cancer generation or recurrence remains to be prevented those.

Term " in the treatment effectively amount " is meant the amount of the VEGF specific antagonists of disease in treatment or the prevention mammal or disease.In the example before cancer, benign or infantile tumour, in the treatment effectively the VEGF specific antagonists of amount can reduce the number of cancerous cell; Reduce the size of primary tumo(u)r; Suppressing (promptly slow to a certain degree and preferably and stop) cancer cell infiltration goes among the peripheral organ; Suppress (promptly slow to a certain degree and preferably and stop) neoplasm metastasis, suppress (to a certain degree) tumor growth; And/or make one or more remissions relevant extremely to a certain degree with described disease.For the treatment of tumor dormancy or micrometastasis, the VEGF specific antagonists of effectively measuring in the treatment can reduce the number or the propagation of micrometastasis; Reduce or prevention dormancy growth of tumor; Or in the recurrence for the treatment of or removing (for example, using anti-cancer therapies such as operation, X-ray therapy or chemotherapy) back minimizing or prophylaxis of tumours.Medicine can prevent to a certain degree to grow and/or kill the cancerous cell of existence, and it is cytostatic and/or Cytotoxic.For the cancer treatment, the time and/or the quality of life of the persistent period that effectiveness can for example be survived by evaluation in the body, disease progression time (TTP), responsiveness (RR), duration of response, alleviation measure.Effectively amount can increase the disease free survival phase (DFS), increase overall life cycle (OS), the probability that reduces to recur, prolong recurrence time, prolong recurrence at a distance the time recurrence of outside, former position (promptly), cure cancer, improve cancerous symptom (for example use the specific inspection of cancer measured), reduce the appearance of second primary carcinoma etc.

The cancer of " can performing the operation " is the cancer that is limited to former organ and is suitable for performing the operation.

" life cycle " is meant that the patient still lives, and comprises disease free survival phase (DFS), nothing development life cycle (PFS) and overall life cycle (OS).Can assess life cycle by the Kaplan-Meier method, and use stratified sequence check (stratified log-rank test) to calculate any difference of life cycle.

" disease free survival phase (DFS) " is meant that the patient was from treatment beginning or definite a period of time of keeping living, do not recur cancer and continued from initial diagnosis, for example about 1 year, about 2 years, about 3 years, about 4 years, about 5 years, about 10 years etc.In one aspect of the invention, according to the regulation analysis DFS of purpose treatment, i.e. assess patient on their basis of specified therapy.The incident that is used for the analysis of DFS can comprise the original place (local) of cancer, zone and recurrence at a distance, the generation of secondary carcinoma and not before death among the patient of incident (for example, the breast cancer relapse or second primary carcinoma) owing to any reason.

" overall life cycle " is meant that the patient was from a period of time of determining for the treatment of beginning or keeping living and being continued from initial diagnosis, for example about 1 year, about 2 years, about 3 years, about 4 years, about 5 years, about 10 years etc.In research of the present invention, the incident that is used for analyzing life cycle is the death owing to any reason.

So-called " prolonging life cycle ", mean in the patient who has treated with respect to untreated patient (promptly with respect to VEGF specific antagonists of no use for example the patient of VEGF Antybody therapy), or for example only increase DFS and/or OS with the treatment of chemotherapeutant such as paclitaxel with respect to the contrast therapeutic scheme.After treatment beginning or after initial diagnosis, monitor life cycle at least about six months, or at least about 1 year, or at least about 2 years, or at least about 3 years, or at least about 4 years, or at least about 5 years, or at least about 10 years etc.

" hazard ratio " in analyzing life cycle is the summary of difference between two life cycle curves, is illustrated in the reduction on the mortality risk when treating compared with the control in the time period of following up a case by regular visits to.Hazard ratio is the statistics definition of event rates.For the present invention, hazard ratio is defined as the probability of the probability of the incident in the specified point experimental group (arm) that is illustrated on any time divided by the incident in the matched group.

This paper term " concurrently " is used to refer to using of two or more therapeutic agents, and wherein said at least a portion of using is overlapping in time.Therefore, parallel use comprise when stopping one or more agent use the using of back one or more other agent of continuation the time dosage regimen.

So-called " monotherapy ", mean the treatment phase process in only comprise a kind of therapeutic scheme that is used for the therapeutic agent of cancer or oncotherapy.The monotherapy of use VEGF specific antagonists means is using the VEGF specific antagonists under the situation of the anti-cancer therapies that does not have other during the treatment phase.

So-called " maintenance therapy " means the therapeutic scheme of the probability that is provided to reduce palindromia or development.Maintenance therapy can be provided the time that reaches any length, comprise the time period up to curee's life-span of prolongation.Maintenance therapy can be joined together to provide after initial therapy or with initial or other therapy.The employed dosage of maintenance therapy can change and can comprise the dosage of comparing minimizing with the dosage that is used for the other types therapy.

This paper " neoadjuvant " or " therapy before the operation " are meant the therapy in the confession of operation prerequisite.The purpose of neoadjuvant provides the treatment of instant system, eradicates micrometastasis (not so it can be bred, and follows standard order by systematic treatment if abide by operation) possibly.Neoadjuvant also can help to reduce the tumor size and allow to excise fully initial unresectable tumor thus, or reserve part organ and its function.And neoadjuvant allows to evaluate in vivo pharmaceutical efficacy, and this can instruct treatment subsequently to select.

The therapy that this paper " complementary therapy " provides when being meant the sign that can not detect residual disease after operation is to reduce the risk of palindromia.The purpose of complementary therapy is the recurrence of pre-anti-cancer and therefore lowers the probability of the relevant death of cancer.

This paper " nursing of standard " chemotherapy is meant the conventional chemotherapeutant that uses with the treatment particular cancer.

Use " definitiveness operation " as in medical community, using the mode of this term.The definitiveness operation comprises the program that causes tumor to remove or excise for example operation or otherwise, and described program comprises those programs that cause all very visible tumors removals or excision.The definitiveness operation comprises, for example complete or medicable excision or complete completely tumor resection.The definitiveness operation is included in the program that takes place in one or more stages and comprises: the program of for example carrying out the multistage operation of one or more operations or other program before the tumor resection.The definitiveness operation comprises to be removed or tumor resection, comprises for example program of lymph node, part organ or tissue of related organ, part organ and tissue and peripheral organs.

Term " cancer " or " cancer " are meant or describe the physiology illness that is grown to feature in the mammal usually with the cell of not regulated.Comprise the tumor or the micrometastasis of benign and virulent cancer and dormancy in this definition.So-called " early cancer " or " infantile tumour " mean not diffusion or shift or be classified as 0, the cancer of I or II phase cancer.

Term " before the cancer " is meant usually prior to cancer or develops into situation or the growth of cancer." before the cancer " growth will have abnormal Cycle Regulation with marker determination that can be by Cycle Regulation, cell proliferation or differentiation, breed or be divided into the cell of feature.

So-called " abnormal development " means any abnormal growth or the growth of tissue, organ or cell.Preferably, abnormal development be high-level or cancer before.

So-called " transfer " means the diffusion of cancer from its other places in body, former position.Cancerous cell can break away from from primary tumo(u)r, infiltrates lymphatic vessel and blood vessel, by blood flow circulation and growth (transfer) in the distant place focus in the normal structure in other places in vivo.Transfer can be original place or distant place.Transfer is a process in succession, look tumor cell and break away from from primary tumo(u)r, by blood flow move and a long way off position situation about stopping decide.At new position, cell is set up blood supply and can be grown to form life-threatening (mass).Tumor cell moderate stimulation and inhibition molecular pathway all regulate this behavior and a long way off in the position interaction between tumor cell and the host cell also be significant.

So-called " micrometastasis " means from the small amounts of cells of primary tumo(u)r to other part diffusions of health.Micrometastasis can or can not be detected in examination or diagnostic test.

So-called " non-metastatic " means to be benign or to be retained in the cancer that the tissue beyond lymphatic vessel or vascular system or former the position is not infiltrated at former position.Usually, the cancer of non-metastatic be for 0, I or II phase cancer, and be any cancer of III phase cancer once in a while.

Mention tumor or cancer and be meant use overall grouping in period known in the art or the tumor of Roman number allotment method (Overall StageGrouping or Roman Numeral Staging method) or the classification of cancer for " 0 phase ", " I phase ", " II phase ", " III phase " or " IV phase ".Although the actual stage of cancer depends on the type of cancer, usually, 0 phase cancer is the original position pathological changes, and I phase cancer is little partial tumor, and II and III phase cancer are to show the local late tumor and the IV phase cancer that relate to regional nodes to represent metastatic carcinoma.The concrete stage of every type of tumor is that skilled clinician is known.

" tumor " is meant before all tumorous cells growths and propagation (no matter pernicious or benign) and all cancers and cell and tissue cancer as used herein.

So-called " primary tumo(u)r " or " primary carcinoma " mean cancer originally rather than are positioned metastatic pathological changes in intravital its hetero-organization of curee, organ or position.

So-called " benign tumor " or " optimum cancer " means and keeps the position that is confined to originate from and do not have infiltration, invade or be transferred to the tumor of the ability at position at a distance.

This paper " cancer recurrence " is meant the generation once more of treatment back cancer, and comprises taking place once more and the distant place recurrence of cancer when taking place once more former organ outside of cancer in former the organ.

So-called " tumor dormancy " means wherein tumor cell existence but tumor development is not significantly long-time clinically resting state.The dormancy tumor can or can not be detected in examination or diagnostic test.

So-called " tumor load " means number, the size of tumor or the amount of cancer of cancerous cell in the body.Tumor load is also referred to as the tumor load.

So-called " tumor number " means the number of tumor.

So-called " curee " means mammal, includes but not limited to human or inhuman mammal, for example bovid, equine species, Canis animals, sheep section animal or felid.Preferably, the curee is human.

Curee " colony " is meant the curee group of suffering from cancer, for example in clinical trial, or as oncologist according to FDA ratify to be used for specific adaptations disease, for example cancer neoadjuvant is seen.In one embodiment, colony comprises at least 3000 routine curees.

Term " anti-cancer therapies " is meant useful therapy in the treatment cancer.The example of anticancer therapeutic agent includes but not limited to for example to perform the operation, chemotherapeutant, growth inhibitor, cytotoxic agent, be used for other agent of radiotherapeutic dose, anti-angiogenic agent, apoptosis agent, antitublin and treatment cancer, and for example anti-HER-2 antibody, anti-CD 20 antibodies, (for example tyrosine kinase inhibitor HER1/EGFR inhibitor is (such as erlotinib (Tarceva for EGF-R ELISA (EGFR) antagonist ^TM), the inhibitor of platelet-derived somatomedin is (such as Gleevec ^TM(imatinib mesylate)), cox 2 inhibitor (for example celecoxib), interferon, cytokine; With one or more bonded antagonist (for example neutralizing antibody) and other biological activity and the organic chemical agent etc. among following target ErbB2, ErbB3, ErbB4, PDGFR-β, BlyS, APRIL, BCMA or vegf receptor, the TRAIL/Apo2.Also comprise its combination among the present invention.

As used herein, term " cytotoxic agent " is meant and suppresses or block cell function and/or cause the material of cytoclasis.This term is intended to comprise radiosiotope (I for example ¹³¹, I ¹²⁵, Y ⁹⁰And Re ¹⁸⁶), chemotherapeutant and toxin for example toxin or its fragment of the enzymatic activity of antibacterial, fungus, plant or animal origin.

" chemotherapeutant " is chemical compound useful in the treatment of cancer.The example of chemotherapeutant is included in chemical compound useful in the treatment of cancer.The example of chemotherapeutant comprise alkylating agent for example thiophene for the group and

Cyclophosphamide (cyclosphosphamide); Alkyl sulfonic ester is busulfan, an improsulfan and piposulfan for example; Aziridine is benzodepa (benzodopa), carbaxilquinone, meturedepa (meturedopa) and uredepa (uredopa) for example; Ethylenimine and methylmelamine (methylamelamines) comprise altretamine, bent its amine, triethylenephosphoramide (trietylenephosphoramid), triethylene thiophosphoramide (triethiylenethiophosphoramide) and tri methylol melamine (trimethylolomelamine); Acetogenin (especially its hot and its octanone of Bradley of Bradley); Camptothecine (comprising the synthetic analogues topotecan); Bryostatin; Callystatin; CC-1065 (comprising its adozelesin, carzelesin and bizelesin synthetic analogues); From beads algal rim peptide (especially from beads algal rim peptide 1 with from beads algal rim peptide 8); Dolastatin; Duocarmycin (comprising synthetic analogues KW-2189 and CB1-TM1); Ai Liusu (eleutherobin); Water ghost any of several broadleaf plants alkali (pancratistatin); A Corallium Japonicum Kishinouye alcohol (sarcodictyin) of crawling; Spongistatin; Chlormethine is chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, chlormethine, Mechlorethaminoxide Hydrochloride, melphalan, novoembichin, phenesterin, prednimustine, trofosfamide, uracil mustard for example; Nitroso ureas is Carmustine, chlorozotocin, fotemustine, lomustine, nimustine and Ranimustine (ranimnustine) for example; Antibiotic for example enediyne class antibiotic (such as Gary stop mycin, especially Gary stop mycin γ 1I and Gary stop mycin ω I1 (referring to, Agnew for example, Chem Intl.Ed.Engl., 33:183-186 (1994)); Reaching endomycin comprises and reaches endomycin A; Diphosphate is clodronate for example; The Ai Sipeila mycin; And neocarzinostain NCS chromophore and relevant chromoprotein enediyne class antibiotic chromophore), aklavine (aclacinomysins), D actinomycin D, authramycin, azaserine, bleomycin, actinomycin C, carubicin (carabicin), carminomycin, carzinophillin, chromomycin (chromomycinis), actinomycin D, daunomycin, detorubicin, 6-diazonium-5-oxygen-L-nor-leucine,

Amycin (comprising that morpholino amycin, cyano group morpholino amycin, 2-pyrrolin are for amycin and deoxidation amycin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycin be ametycin, Mycophenolic Acid, nogalamycin, Olivomycin, peplomycin, porfiromycin (potfiromycin), puromycin, triferricdoxorubicin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin for example; Antimetabolite is methotrexate and 5-fluorouracil (5-FU) for example; Folacin is 9,10-dimethylpteroylglutamic acid, methotrexate, pteropterine, trimetrexate for example; Purine analogue is fludarabine, Ismipur, ITG, thioguanine for example; Pyrimidine analogue is ancitabine, azacitidine, 6-azauridine, carmofur, cytosine arabinoside, two uracil deoxyriboside, doxifluridine, enocitabine, floxuridine for example; Androgen is calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone for example; Anti-adrenal gland's thing is aminoglutethimide, mitotane, trilostane for example; The folic acid fill-in is folinic acid (frolinic acid) for example; Aceglatone; The aldophosphamide glucosides; Aminolevulinic acid (ALA); Eniluracil; Amsacrine; Hundred lappets former times (bestrabucil); Bisantrene; Edatrexate (edatraxate); Defofamine; Demecolcine; Diaziquone; Eflornithine (elfornithine); Elliptinium acetate; Epothilones; Etoglucid; Ganite (Fujisawa).; Hydroxyurea; Lentinan; Lonidamine (lonidainine); Maytansinol (maytansinoid) is maytansine and ansamitocin for example; Mitoguazone; Mitoxantrone; Mopidamol (mopidanmol); C-283 (nitraerine); Pentostatin; Phenamet; Pirarubicin; Losoxantrone; Acid podophyllinic 2-ethylhydrazide (podophyllinic acid; 2-ethylhydrazide); The methylbenzyl hydrazine;

Polysaccharide complex (JHS Natural Products, Eugene, OR); Razoxane; Rhizomycin; Sizofiran; Spirogermanium; Tenuazonic acid; Triaziquone; 2,2 ', 2 " RA3s; Trichothecene (especially T-2 toxin, wart p0-357 (verracurin) A, Roridine A and Diacetoxysciroenol (anguidine)); Urethane; Vindesine; Dacarbazine; Mannomustine; Mitobronitol; Mitolactol; Pipobroman; Gacytosine; Galactoside (" Ara C "); Cyclophosphamide; Thiophene is for group; Taxane for example

Paclitaxel (Bristol-Myers Squibb Oncology, Princeton, N.J.), ABRAXANE ^TMThe taxol nanoparticle preparation that no Cremophor and albumin are transformed (American Pharmaceutical Partners, Schaumberg, Illinois) and

Docetaxel (doxetaxel) (

-Poulenc Rore Antony, France); Chlorambucil (chloranbucil); Gemcitabine; The 6-thioguanine; Purinethol; Methotrexate; Platinum analogs is cisplatin and carboplatin for example; Vinblastine; Platinum; Etoposide (VP-16); Ifosfamide; Mitoxantrone; Vincristine;

Vinorelbine; Novantrone; Teniposide; Edatrexate; Daunomycin; Aminopterin; Xeloda; Ibandronate; (Camptosar CPT-11) (comprises the therapeutic scheme with the irinotecan of 5-FU and formyl tetrahydrofolic acid) to irinotecan; Topoisomerase enzyme inhibitor RFS 2000; Er Fujiajiniaoansuan (difluorometlhylornithine) (DMFO); Retinoid is tretinoin for example; Capecitabine; Combretastatin; Formyl tetrahydrofolic acid (LV); Oxaliplatin comprises oxaliplatin treatment scheme (FOLFOX); Reduce PKC-α, Raf, H-Ras, the EGFR (erlotinib (Tarceva for example of cell proliferation ^TM)) and the inhibitor of VEGF-A and pharmaceutically acceptable salt, acid or the derivant of above-mentioned any material.

Also comprise in this definition act as regulate or inhibitory hormone to the antihormone agent of the effect of tumor for example antiestrogen and selective estrogen receptor modulators (SERM), comprise such as tamoxifen (comprising

Tamoxifen), raloxifene, droloxifene, 4-hydroxy tamoxifen, trioxifene, RALOXIFENE HCL (keoxifene), LY117018, onapristone and FARESTON toremifene; Be suppressed among the adrenal gland aromatase inhibitor of the aromatase of regulating estrogen production, for example, such as 4 (5)-imidazoles, aminoglutethimide,

Megestrol acetate,

Exemestane, formestane (formestanie), fadrozole, Vorozole, Letrozole and

Anastrozole; And antiandrogen medicine for example flutamide, nilutamide, bicalutamide, leuprorelin and goserelin; And troxacitabine (1,3-dioxolane nucleoside cytosine analog); Antisense oligonucleotide especially is suppressed at those of expression of the gene (for example, such as PKC-α, Raf and H-Ras) in the signal path that relates in adherent cell (abherant cell) propagation; Ribozyme for example the vegf expression inhibitor (such as

Ribozyme) and the HER2 expression inhibitor; Vaccine is the gene therapy vaccine for example, such as

Vaccine,

Vaccine and

Vaccine;

Topoisomerase 1 inhibitor; Pharmaceutically acceptable salt, acid or the derivant of vinorelbine and Ai Sipeila mycin (referring to United States Patent (USP) the 4th, 675, No. 187) and above-mentioned any material.

When using " growth inhibitor ", this paper is meant cytostatic chemical compound or compositions in external and/or body.Therefore, growth inhibitor significantly reduces the agent of the percentage ratio of the interim cell of S.The example of growth inhibitor comprises that the blocking-up cell cycle carries out the agent in (in the somewhere except the S phase), for example induces the agent that G1 stagnates and the M phase stagnates.Typical M phase blocker comprise vinca (vincas) (vincristine and vincaleucoblastine),

With topoisomerase II inhibitor for example amycin, epirubicin, daunomycin, etoposide and bleomycin.Those agent of stagnating G1 are also expanded to overflow to the S phase and are stagnated, for example DNA alkylating agent such as tamoxifen, prednisone, dacarbazine, chlormethine, cisplatin, methotrexate, 5-fluorouracil and cytosine arabinoside.Further information can be at The Molecular Basis of Cancer (molecular basis of cancer), Mendelsohn and Israel edit, the 1st chapter, people such as Murakami autograph is " Cell cycleregulation; oncogenes, and antineoplastic drugs (Cycle Regulation, oncogene and antitumor drug) ", (WB Saunders:Philadelphia, 1995), can in the 13rd page, find particularly.

Term " cytokine " " be to be used for other cells being played the proteinic generic term of iuntercellular medium effect by what a kind of cell mass discharged.The example of this cytokine is lymphokine, monokine and traditional polypeptide hormone.Comprise growth hormone for example human growth hormone, N-methinyl human growth hormone and bovine growth hormone in the cytokine; Parathyroid hormone; Thyroxine; Insulin; Proinsulin; Relaxin; Relaxation precipitinogen; Glycoprotein hormones is follitropin (FSH), thyrotropin (TSH) and lutropin (LH) for example; Epidermal growth factor; Hepatocyte growth factor; Fibroblast growth factor; Prolactin antagonist; Galactagogin; Tumor necrosis factor and β; Miller pipe inhibiting substances; Mice promoting sexual gland hormone related peptides; Inhibin; Activin; VEGF; Integrin; Thrombopoietin (TPO); Nerve growth factor is NGF-α for example; PDGF; Transforming growth factor (TGF) is TGF-α and TGF-β for example; Insulin-like growth factor I and II; Erythropoietin (EPO); Bone-inducing factor; Interferon is interferon-ALPHA, β and γ for example; Colony stimulating factor (CSF) is macrophage-CSF (M-CSF), granulocyte-macrophage-CSF (GM-CSF) and granulocyte CSF (G-CSF) for example; Interleukin (IL) is IL-1, IL-1 α, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12 for example; Tumor necrosis factor for example TNF-α or TNF-β and other polypeptide factors comprises LIF and kit aglucon (KL).As used herein, the term cytokine comprises from natural origin or from the protein of reconstitution cell culture and the biological activity equivalent of native sequences cytokine.

Term " prodrug " is meant the pharmaceutically precursor or the derivative form of active substance as used in this application, and it is less and can or change into more activated parent form by the enzymatic activatable that itself and parent drug compare the cytotoxicity of tumor cell.Referring to, Wilman for example, " Prodrugs inCancer Chemotherapy (cancerization is learned the prodrug in the therapy) " Biochemical SocietyTransactions, 14, the 375-382 page or leaf, people such as the 615th phase Meeting Belfast (1986) and Stella, " Prodrugs:A Chemical Approach to Targeted Drug Delivery (prodrug: the chemical method of targeted delivery of drugs) ", Directed Drug Delivery, people such as Borchardt (editor), the 247-267 page or leaf, Humana Press (1985).Prodrug of the present invention includes but not limited to the phosphoric acid ester prodrugs, contains the thiophosphate prodrug, the sulfur acid ester prodrugs, contain peptide prodrug, D-amino acid modified prodrug, glycosylated prodrug, contain the beta-lactam prodrug, contain the prodrug of the phenoxy-acetamide that randomly replaces or contain the prodrug, 5-flurocytosine of the phenyl-acetamides that randomly replaces and other can be converted into the 5-floxuridine prodrug of the medicine of more activated no cytotoxicity.Can be derived and be included but not limited to those chemotherapeutants of above describing for use in the example of cytotoxic drug of the present invention for prodrug forms.

So-called " X-ray therapy " mean use directed gamma-rays or β ray with enough infringements of producing pair cell so that limit its ability that normally works or damage cell fully.Should be understood that many methods known in the art determine the treatment dosage and persistent period.Typical treatment is a dosage that provide as applied once and typical from 10 unit change to 200 unit (gray(Gy)) every days.

So-called " reduce or suppress " means and causes preferably 20% or more, and more preferably 50% or more and most preferably 75%, 85%, 90%, 95% or the more overall ability that descends.Reduce or the existence of the size of the existence of symptom, transfer or the micrometastasis of the disease of being treated of suppressing to make a comment or criticism or size, primary tumo(u)r, dormancy tumor or size or at the size or the number of angiogenesis disease medium vessels.

No matter so-called " antisense nuclear base oligomer " mean length, with the coding strand of gene or the complementary nuclear base of at least a portion oligomer of mRNA.

So-called " nuclear base oligomer " means and contains at least eight nuclear bases that connect together by linking group, preferably at least ten two and the chemical compound of the chain of at least ten six bases most preferably.Comprise natural and non-natural oligonucleotide (modification with unmodified) in this definition, and oligonucleotide mimetic for example protein nucleic acid, locked nucleic acid and arabinose nucleic acid (arabinonucleic acid).Many nuclear bases and linking group can be used to nuclear base oligomer of the present invention, comprise No. 20030114412 (referring to the 27-45 section of for example publication) and No. 20030114407 (referring to the 35-52 section of for example publication) middle those that describe of U.S. Patent Publication of incorporating this paper by reference into.Nuclear base oligomer also can be by targeting to translation initiation and termination site.In certain embodiments, antisense nuclear base oligomer comprises from about 8 to 30 nucleotide.Antisense nuclear base oligomer also can comprise at least 40,60,85,120 or more a plurality of and VEGF mRNA or the complementary successive nucleotide of DNA, and can be the same with full length mRNA or gene long.

So-called " little RNA " means length and is at least 15 nucleotide, preferably 17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34 or 35 nucleotide and length even nearly any RNA molecule of the individual nucleotide of 50 or 100 (all integers between comprising) (strand or double-stranded).In certain embodiments, little RNA can mediate rna i.As used herein, phrase " mediate rna i " is meant and distinguishes which RNA will be by the ability by RNAi mechanism (machinery) or process degraded.Comprise " siRNA " and " Microrna " among the little RNA of term.Usually, Microrna (miRNA) is by cutting hair clip precursor RNA processing next little (for example 17-26 nucleotide), the strand noncoding RNA of enzyme (Dicer) from about 70 nucleotide.SiRNA (siRNA) has a similar size and also is non-coding; But siRNA is that come from long dsRNA processing and normally double-stranded.SiRNA also can comprise short hairpin RNA, and wherein two of the siRNA duplex chains all are contained in the single RNA molecule.Little RNA can be used to describe two types RNA.These terms comprise the RNA of double-stranded RNA, single stranded RNA, isolating RNA (partially purified RNA, pure RNA, synthetic RNA, the RNA that reorganization produces) in essence and the change different with naturally occurring RNA by adding, lack, replace and/or change one or more nucleotide.This change can comprise adds the non-nucleotide material, for example at terminal or inner (at the one or more nucleotide place of RNA) of little RNA.Nucleotide in the RNA molecule of the present invention also can comprise off-gauge nucleotide, comprises nucleotide or deoxyribonucleotide that non-natural exists.Other of nucleic acid molecules modified " nuclear base oligomer " referring to above.In one embodiment, the RNA molecule comprises 3 ' oh group.

Term " intravenous infusion " is meant greater than about 5 minutes, preferably in a period of time between about 30 to 90 minutes medicine is introduced in animal or human's class patient's vein, but according to the present invention, selectively intravenous infusion is used 10 hours or shorter.

Term " intravenous group annotate " or " intravenous push " be meant with medicament administration in the vein of animal or human's class so that health at about 15 minutes or shorter, is preferably accepted medicine in 5 minutes or shorter time.

Term " subcutaneous administration " is meant by sending constantly lentamente relatively and medicine is introduced under animal or human's class patient's the skin from the medicine storage, preferably skin and below tissue between capsule (pocket) in.Can be by upwards pinching or pull-up skin and leave following tissue and produce capsule.

Term " h inf " is meant by sending a period of time constantly lentamente relatively from the medicine storage, include but not limited to 30 minutes or shorter, perhaps 90 minutes or shorter, and medicine is introduced under animal or human's class patient's the skin, preferably skin and below tissue between capsule in.Randomly, can carry out infusion by the subcutaneous implantation of the drug delivery pump implanted under animal or human's class patient's skin, wherein pump is preset time section for example 30 minutes, 90 minutes or cross over the medicine of sending scheduled volume in time period of length of therapeutic scheme.

Term " subcutaneous group annotate " is meant drug administration below animal or human's class patient's skin, wherein rolls into a ball the injection thing and sends and preferably be less than about 15 minutes, more preferably less than 5 minutes and most preferably be less than 60 seconds.Preferably skin and below tissue between capsule in use, wherein by for example upwards pinching or pull-up skin and leave following tissue and produce capsule.

Word " labelling " is meant directly or indirectly the detectable chemical compound or the compositions of closing with the polypeptide yoke when this paper uses.Labelling itself can be detected (for example labelled with radioisotope or fluorescent labeling), perhaps under the situation of enzyme labelling, but the substrate compounds that catalysis can be detected or the chemical change of compositions.

II. use the VEGF specific antagonists to carry out infantile tumour treatment and neoadjuvant and complementary therapy

The present invention suffers from the curee of tumor before benign, the cancer or non-metastatic to use the treatment of VEGF specific antagonists; Treatment suffers from the curee of dormancy tumor or micrometastasis; Perhaps treatment suffers from the curee that the curee of developing cancer or treatment have the risk of development cancer and is feature.For example, use two kinds independently method suppress VEGF, promptly use the monotherapy of monoclonal antibody (mAb) of targeting VEGF-A and the genetic defect of VEGF-A, use the neoplastic Apc of early stage enteraden ^Min/+We are verified for mouse model, and the inhibition of VEGF signal transduction is enough to stop tumor growth and secular existence benefit is provided in the enteric adenoma model.Use the monoclonal antibody (mAb) of targeting VEGF-A, we are also verified, and the inhibition of VEGF-A is enough to suppress the growth of pituitary adenoma and reduce excessive hormone secretion in the mouse model of 1 type multiple endocrine adenomas (MEN1).And, use the monoclonal antibody (mAb) of mouse islets tumor model (RIP-T β Ag) and targeting VEGF-A, the inhibition of we are verified VEGF causes tumor-blood-vessel growth significantly to reduce, and during the therapy after being used as the cell minimizing of using operation or chemotherapeutant, stoped the regrowth of tumor.The present invention also is feature with using of VEGF antagonist in neoadjuvant and auxiliary situation.

The III.VEGF specific antagonists

The VEGF specific antagonists is meant and can combines with VEGF, reduce the vegf expression level, or neutralize, block, suppress, cancel, reduce or disturb the VEGF biological activity molecule (peptide or non-peptide) of (comprising VEGF combines with one or more vegf receptors and VEGF mediates angiogenesis and endotheliocyte survival or propagation).Preferably, the VEGF specific antagonists reduces or suppresses at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or expression or the biological activity of more VEGF.Preferably, the VEGF that suppresses by the VEGF specific antagonists is VEGF isotype or multiple VEGF isotype, for example VEGF (8-109), VEGF (1-109), VEGF ₁₆₅, VEGF ₁₂₁, VEGF ₁₄₅, VEGF ₁₈₉Or VEGF ₂₀₆

Useful in the method for the invention VEGF specific antagonists comprises that specificity is in conjunction with the peptide of VEGF or the chemical compound of non-peptide, for example VEGF antibody and its Fab, antagonist variant or its fragment with the bonded VEGF polypeptide of VEGF specificity, and the acceptor molecule and derivant (for example soluble vegf receptor protein or its VEGF binding fragment that combine isolated thus itself and one or more receptors bind with the VEGF specificity, or chimeric vegf receptor protein), fusion rotein (for example VEGF-Trap (Regeneron)) and VEGF ₁₂₁-gelonin (Peregrine).The VEGF specific antagonists also comprises the antisense nuclear base oligomer with at least one fragment complementation of the nucleic acid molecules of coding VEGF polypeptide; Little RNA with at least one fragment complementation of the nucleic acid molecules of coding VEGF polypeptide; The ribozyme of targeting VEGF; The peptide body of VEGF; And VEGF is fit.

A. VEGF antibody

Useful in the method for the invention VEGF antibody comprises bioactive any antibody or its Fab that combines and can reduce or suppress VEGF with enough affinitys and specificity with VEGF.VEGF antibody usually not can with other the VEGF congener for example VEGF-B or VEGF-C combine, also for example PlGF, PDGF or bFGF do not combine with other somatomedin.

In certain embodiments of the invention, VEGF antibody includes but not limited to, with the identical bonded monoclonal antibody of epi-position of monoclonal anti VEGF antibody A 4.6.1 of producing by hybridoma ATCC HB 10709; The anti-VEGF monoclonal antibody of humanization of the reorganization that produces according to people such as Presta (1997) Cancer Res.57:4593-4599 includes but not limited to be called as bevacizumab (BV;

) antibody.Bevacizumab comprises IgG 1 framework region of sudden change and combines complementarity-determining region from the human VEGF of blocking-up with the mouse-anti hVEGF monoclonal antibody antigen A.4.6.1 of its receptors bind.About 93% aminoacid sequence (comprising most framework region) of bevacizumab is derived from human IgG1, and about 7% sequence derived from murine antibody A.4.6.1.Bevacizumab has about 149,000 daltonian molecular weight and is glycosylated.Bevacizumab and other humanization VEGF antibody are further described in No. the 6th, 884,879, the United States Patent (USP) of issue on February 26th, 2005.The more example of antibody include but not limited to as PCT application disclose the G6 that describes in WO2005/012359 number or the serial antibody of B20 (G6-31 for example, B20-4.1).More antibody is referring to United States Patent (USP) the 7th, 060, and 269,6,582,959,6,703, No. 020; The 6th, 342, No. 219; The 6th, 054, No. 297; WO98/45332; WO 96/30046; WO94/10202; EP 0666868B1; No. the 2006009360th, 20050186208,20030206899,20030190317,20030203409 and 20050112126, U.S. Patent Application Publication; And people such as Popkov, Journal of Immunological Methods 288:149-164 (2004).Other examples of the antibody that can use in the present invention comprise and comprise residue F17, M18, D19, Y21, Y25, Q89, I91, K101, E103 and C104's or selectively comprise bonded those antibody of functional epitope on the human VEGF of residue F17, Y21, Q22, Y25, D63, I83 and Q89.

According to G6 of the present invention series antibody is a kind of VEGF antibody, and it is derived from disclose the derive sequence of antibody of any one G6 antibody among WO2005/012359 number Fig. 7,24-26 and the 34-35 or G6 according to the PCT application.In one embodiment, G6 series antibody combines with functional epitope on the human VEGF that comprises residue F17, Y21, Q22, Y25, D63, I83 and Q89.

According to B20 of the present invention series antibody is a kind of VEGF antibody, and it is derived from disclose the derive sequence of antibody of any one B20 antibody among Figure 27-29 of WO2005/012359 number or B20 according to the PCT application.In one embodiment, B20 series antibody combines with functional epitope on the human VEGF that comprises residue F17, M18, D19, Y21, Y25, Q89, I91, K101, E103 and C104.

Be meant that according to the present invention's " functional epitope " antagonist is in conjunction with the antigenic amino acid residue that has a positive effect.Any one sudden change in the residue that has a positive effect in the antigen (for example, the alanine mutation of wild type VEGF or homologue sudden change) will upset the combination of antibody so that the relative affinity ratio of antibody (IC50 saltant VEGF/IC50 wild type VEGF) will be greater than 5 (referring to the embodiment 2 of WO2005/012359).In one embodiment, determine the relative affinity ratio by solution in conjunction with phage display ELISA.Briefly, 96 hole Maxisorp immunity plates (NUNC) are spent the night with the concentration bag that is dissolved in 2ug/ml among the PBS in 4 ℃ of Fab forms with antibody to be measured, and sealed 2h in room temperature with PBS, 0.5%BSA and 0.05% polysorbas20 (PBT).Phage display hVEGF alanine point mutation body (residue 8-109 form) or the serial dilutions of wild type hVEGF (8-109) in PBT are at first cleaned with PBS, 0.05% polysorbas20 (PBST) in incubated at room 15 minutes and with plate on the plate of Fab bag quilt.Anti-M13 monoclonal antibody horseradish peroxidase (Amersham Pharmacia) conjugates that is used among the PBT dilution in 1: 5000 detects bonded phage, with 3,3 ', 5,5 '-tetramethyl benzidine (TMB, Kirkegaard ﹠amp; Perry Labs, Gaithersburg, MD) substrate developed the color about 5 minutes, with the H3PO4 cancellation reaction of 1.0M and at 450nm spectrophotography reading.The ratio of IC50 value (IC50, ala/IC50, wt) multiple of representing binding affinity (RA) to reduce.

The B.VEGF acceptor molecule

Two kinds of vegf receptors that characterize the most fully are VEGFR1 (being also referred to as Flt-1) and VEGFR2 (being also referred to as the FLK-1 of KDR and Muridae homologue).Each receptor to each VEGF family member's specificity difference but VEGF-A all combine with Flt-1 and KDR.Total length Flt-1 receptor comprises ectodomain, membrane spaning domain with seven Ig domains and the born of the same parents' intracellular domain with tyrosine kinase activity.Ectodomain relates to the combination of VEGF and born of the same parents' intracellular domain relates to the signal conduction.

Can be used in the method for the present invention to make it can not carry out signal transduction thus with the bonded vegf receptor molecule of VEGF specificity or its fragment to combine vegf protein and vegf protein is sheltered.In certain embodiments, vegf receptor molecule or its VEGF binding fragment are for example Flt-1 of soluble form.Biological activity to vegf protein applies the inhibition effect to the soluble form of receptor by combining with VEGF, make thus its can not be present in lip-deep its natural receptor of target cell and combine.Also comprise the vegf receptor fusion rotein, the example is described in hereinafter.

Chimeric vegf receptor protein is to have can combine and suppress the bioactive acceptor molecule of VEGF with VEGF derived from the aminoacid sequence of at least two kinds of different proteins (wherein at least a is vegf receptor protein (for example flt-1 or KDR receptor)).In certain embodiments, chimeric vegf receptor protein of the present invention is by constituting derived from the aminoacid sequence of two kinds of different vegf receptor molecules only; But can be connected with aminoacid sequence (for example immunoglobulin sequences) comprising from the aminoacid sequence in, two, three, four, five, six of the outer ligand binding domain of flt-1 and/or KDR receptor born of the same parents or all Ig spline structure territories of seven from other irrelevant proteins.With bonded other aminoacid sequences in Ig spline structure territory be tangible for a person skilled in the art.The example of chimeric vegf receptor protein comprise for example soluble Flt-1/Fc, KDR/Fc or FLt-1/KDR/Fc (being also referred to as VEGF Trap) (referring to, for example the PCT application discloses WO97/44453 number).

Soluble vegf receptor protein of the present invention or chimeric vegf receptor protein comprise the vegf receptor protein that is not fixed on cell surface via membrane spaning domain.Therefore usually like this, the soluble form of vegf receptor comprises chimeric receptor protein, although can combine and make the VEGF inactivation with VEGF, does not comprise membrane spaning domain and can not become and express the cell membrane of cell of molecule relevant.

C. ribozyme

Ribozyme is the ribozyme molecule of specificity cutting that can catalysis RNA.Ribozyme is by carrying out sequence-specific hybridization to complementary target RNA, carry out endonuclease afterwards and work.Can be by the specific ribozyme cleavage site in the possible RNA target of known technology identification.Further details is referring to, Rossi for example, and Current Biology, 4:469-471 (1994) and PCT apply for disclosing WO No. 97/33551.A kind of exemplary ribozyme that with the vegf expression is target is Angiozyme ^TM(referring to, for example No. the 20060035278th, U.S. Patent Application Publication).

D. fit

Fit is to form and the target molecule nucleic acid molecules of the bonded tertiary structure of VEGF polypeptid specificity for example.Fit generation and treatment are used in the art and are extensively set up.Referring to No. the 5th, 475,096, United States Patent (USP) for example.VEGF is fit to be the oligonucleotide that Pegylation is modified, its adopt make its can with the outer bonded three-dimensional conformation of VEGF of born of the same parents.Effectively be that the fit example that target is treated relevant degeneration of macula of age is piperazine Jia Tani (pegaptanib) (Macugen in the treatment with VEGF ^TM, Eyetech, New York).Can in U.S. Patent Application Publication the 20060148748th, find about fit more information.

E. peptide body

The peptide body is the peptide sequence that is connected with the aminoacid sequence of a fragment of coding immunoglobulin molecules or a part.Polypeptide can be derived from sequence at random, and it is selected by being used for the bonded any method of specificity (including but not limited to display technique of bacteriophage).In one embodiment, selected polypeptide can be connected to the aminoacid sequence of coding immunoglobulin Fc part.Combining also with the VEGF specificity, the peptide body of antagonism VEGF also is useful in the method for the invention.

F.VEGF specificity antagonism nucleic acid molecules

Method of the present invention also is feature with using of VEGF specificity antagonism nucleic acid molecules (comprising antisense nuclear base oligomer and little RNA).

In one embodiment, the present invention is feature with the using of antisense nuclear base oligomer at VEGF RNA.By combining with complementary nucleic acid sequence (justice or coding strand are arranged), antisense nuclear base oligomer can be probably cuts the expression of Profilin matter by the enzyme action via the RNA chain of RNA enzyme H.

An example of the antisense nuclear base oligomer that is particularly useful in method and composition of the present invention is the morpholino oligomer.Morpholino material (morpholinos) is used to block other molecules approaching to specific sequence in the nucleic acid molecules.Their other molecules capable of blocking are approaching to little (～25 base) of ribonucleic acid (RNA) zone.The morpholino material is known as PMO sometimes, the acronym of phosphoryl diamine morpholino oligonucleotide (phosphorodiamidate morpholino oligo).

The morpholino material is used to by stoping cell manufacturing objective protein or striking low gene function by the montage of modifying the mRNA precursor.The morpholino material is by the nucleic acid base pairing of standard and the bonded synthetic molecules of complementary series of RNA.Although the morpholino material has the nucleic acid base of standard, those bases are with the morpholine ring rather than the deoxyribose ring is bonded and be connected by phosphoryl diamine group rather than phosphate.Replace anionic phosphate with uncharged phosphoryl diamine group and eliminated ionizing in common physiological pH scope, therefore, the morpholino material in organism or the cell is no electric charge molecule.

The morpholino material combines by " space blocking-up " or with target sequence among the RNA and blocking-up can be worked with the otherwise interactional molecule of RNA.Because complete non-natural skeleton of morpholino material, cell protein can't be discerned the morpholino material.Nuclease is not degraded, and morpholino material and morpholino material can not activate toll sample receptor and therefore they can not activate for example inflammatory response of interferon system or NF-κ B mediation of inherent immune response.Methylating of also unknown morpholino material modifying DNA.Therefore, the expression or the bioactive morpholino material that reduce or suppress VEGF at any part of VEGF is particularly useful in method and composition of the present invention.

The present invention is also to use RNA to disturb (RNAi) to suppress the feature that is expressed as of VEGF.RNAi is the form of the PTGS initial by introducing double-stranded RNA (dsRNA).The double-stranded RNA (being commonly called " siRNA ", " little RNA " or " Microrna ") of 15 to 32 short nucleotide is nematicide (people such as Zamor, Cell 101:25-33) and (people such as Elbashir of mammalian tissues cultured cell system, Nature 411:494-498,2001, incorporate into by reference in view of the above) in effective aspect down-regulation of gene expression.The further treatment of this method is renderd a service and is confirmed in vivo by people such as McCaffrey (Nature 418:38-39.2002) in mammal.Little RNA is 15 nucleotide at least on length, 17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35 nucleotide preferably, and even at the individual nucleotide of 50 or 100 (all integers between comprising) nearly on the length.The consistent basically or complementary little RNA in this any zone with VEGF is included as VEGF specific antagonists of the present invention.

The specific (special) requirements of little RNA and modification are known in the art and for example are described in that the PCT application disclose WO01/75164 number and U. S. application discloses in the 20060134787th, 20050153918,20050058982,20050037988 and No. 20040203145 that its part of being correlated with is incorporated this paper by reference into.In specific embodiment, can synthesize siRNA or by for example under the situation that the enzyme action enzyme exists dsRNA be processed into about 17 to the condition of the RNA molecule of about 26 nucleotide the long double-stranded RNA of processing produce siRNA.The expression that also can pass through corresponding D NA fragment (for example hair clip DNA construct) produces siRNA.Usually, siRNA has 3 ' of distinctive 2-to the 3-nucleotide end that dangles, and preferably these are (2 '-deoxidation) thymidine or uracil.SiRNA contains 3 ' oh group usually.In certain embodiments, use strand siRNA or flush end dsRNA.In order further to strengthen the stability of RNA, make 3 ' dangle stable to degrading.In one embodiment, for example adenosine or guanosine make RNA stable by containing purine nucleotides.Selectively, by the analog substituted pyrimidines nucleotide of modifying, for example dangling by (2 '-deoxidation) thymidine (thymide) replacement uridnine 2-nucleotide is the effectiveness that can tolerate and do not influence RNAi.The shortage of 2 ' oh group has significantly strengthened the nuclease resistance of dangling in the tissue culture medium (TCM).

Can be by comprising chemosynthesis or using the multiple scheme of the recombinant production of fruit bat vitro system to obtain the siRNA molecule.Can for example Dharmacon Research Inc. or Xeragon Inc. obtain them commercially or can use the commercial test kit that gets for example from the Silencer of Ambion from company ^TMSiRNA makes up test kit (catalog number 1620) or from the HiScribe of New EnglandBioLabs ^TMRNAi transcript reagent box (catalog number E2000S) synthesizes them.

Selectively, can use the standardization program of RNA in vitro transcription and dsRNA cycle of annealing to prepare siRNA, described program is people (Genes ﹠amp such as Elbashir for example; Dev.15:188-200,2001), people such as Girard (Nature 442:199-202 (2006)), people such as Aravin (Nature 442:203-207 (2006)), people such as Grivna (Genes Dev.20:1709-1714 (2006))) and describe among the people (Science 313:363-367 (2006)) such as Lau those.

As people (Genes ﹠amp such as people such as Yu (Proc.Natl.Acad.Sci USA, 99:6047-6052,2002) or Paddison; Dev, 16:948-958,2002) the middle short hairpin RNA of describing (shRNA), also can be used for method of the present invention.Design shRNA is connected so that will have justice and antisense strand to be contained in the RNA molecule and by nucleotide (3 or more) ring.Can use as the outer T7 of the standard body of people such as preamble and Yu described in as above and transcribe the synthetic synthetic and purification shRNA of coming.Also the shRNA sub-clone can be advanced have mice U6 promoter sequence after can be transfected advance in the cell and be used for the expression vector of the expression in vivo of shRNA.

Can obtain to be used for the dsRNA transfection or introduce the several different methods of mammalian cell.For example, some commercially available transfection reagents useful to the transfection based on lipid of siRNA are arranged, include but not limited to TransIT-TKO ^TM(Mirus, catalog number (Cat.No.) MIR 2150), Transmessenger ^TM(Qiagen, catalog number (Cat.No.) 301525), Oligofectamine ^TMAnd Lipofectamine ^TM(Invitrogen, catalog number (Cat.No.) MIR 12252-011 and catalog number (Cat.No.) 13778-075), siPORT ^TM(Ambion, catalog number (Cat.No.) 1631), DharmaFECT ^TM(FisherScientific, catalog number (Cat.No.) T-2001-01).Also can commercial obtain to be used for reagent, for example siPORTer based on the method for the siRNA transfection of electroporation ^TM(Ambion Inc. catalog number (Cat.No.) 1629).Also can use microinjection technique.Also can transcribe little RNA from the expression construct that is introduced into cell, wherein expression construct comprises the coded sequence that is used to transcribe the little RNA that operationally is connected with one or more transcriptional regulatory sequences.When needs, it is known in the art that plasmid, carrier or viral vector also can be used to send dsRNA or siRNA and this carrier.The scheme of every kind of transfection reagent can obtain from manufacturer.

IV. treatment is used

Although known bulk information about the effect of VEGF in angiogenesis, about in the VEGF cancer before benign, cancer or non-metastatic or the effect in auxiliary or newly auxiliary situation relatively know little.We have found that the VEGF specific antagonists can be used to treat benign, cancer cancer preceding or non-metastatic; Be used for the treatment of dormancy tumor or micrometastasis; Be used for prophylaxis of tumours recurrence or regrowth; Or be used for treating or pre-anti-cancer the curee of the risk that is in the development cancer.The VEGF specific antagonists also can be used to treat the curee's who suffers from the non-metastatic cancer complementary therapy after definitiveness is performed the operation; Or be used for the treatment of the curee's who suffers from the cancer that can perform the operation neoadjuvant, wherein provide described therapy before the cancer that in the exenterate curee, can perform the operation.Although hereinafter treatment is used and is divided into therapy, prevention, neoadjuvant and complementary therapy, those skilled in the art should be understood that these kinds needn't be mutually exclusive.

A. the classification of tumor

The term cancer comprises the set of proliferative disorders, includes but not limited to growth, benign tumor, malignant tumor and dormancy tumor that cancer is preceding.Benign tumor keeps being confined to initial position and not having the ability of soaking into, invading or shift to the position, distant place.Its hetero-organization around them can be invaded and damage to malignant tumor.They also can obtain to break away from from position originally and pass through blood flow usually or pass through the ability of the lymphsystem at lymph node place to other part diffusions (transfer) of health.The dormancy tumor is immobilized tumor, and wherein tumor cell exists but tumor development is not tangible clinically.

With the types of organization classification of primary tumo(u)r by its generation; Metastatic tumor is classified by the types of organization that cancerous cell comes from.In the course of time, the cell of malignant tumor becomes more undesired and seems more unlike normal cell.Apparent this variation of cancerous cell is called as tumor grade, and cancerous cell is described to (low level), the moderate differentiation, PD or undifferentiated (high-level) of good differentiation.The cell of good differentiation shows quite normal and is similar to the normal cell that they originate from.Undifferentiated cell is the cell that has become so undesired so that can not determine the source of cell again.

Cancer by stages system description anatomically cancer how far spread and the patient that attempts having similar prognosis and treatment puts into same group by stages.Several checks be can carry out to help by stages, biopsy and some imaging inspection example such as chest X ray, mammogram, bone scanning, CT scan and MRI scanning comprised cancer.Blood test and clinical assessment also are used to the general health of assess patient and detect cancer whether diffused to some organ.

For with cancer by stages, American Joint Committee on Cancer (american cancer joint committee) uses the TNM categorizing system first with cancer, and solid tumor especially is with alphabetical classification formal classification.Cancer is indicated tee (tumor size), N (but tuberosity of palpation) and/or M (transfer).T1, T2, T3 and T4 describe the ever-increasing size of primary affection; N0, N1, N2, N3 indicate nodular complex situations in progressive late period; And M0 and M1 have reflected not existing of metastasis or have existed.

Second kind of method by stages, be also referred to as in overall grouping in period or the Roman number allotment method, in conjunction with the size of primary affection and the existence of tuberosity diffusion and metastasis, cancer was divided into for 0 to IV phase.In this system, case is divided into four periods being represented by Roman number I to IV, or is classified as " recurrence ".For some cancer, 0 phase was known as " original position " or " Tis ", for example ductal carcinoma in situ(DCIS) of breast carcinoma or lobular carcinoma in situ.High-level adenoma also can be classified as for 0 phase.Usually I phase cancer is little partial common recoverable cancer, and can not perform the operation or the metastatic cancer of the common representative of IV phase cancer.Normally local participation late period and/or that show regional nodes of II and III phase cancer.Usually, higher numeral by stages is disease widely, comprises the diffusion to the adjacent organs of near lymph node and/or primary tumo(u)r of bigger tumor size and/or cancer.Accurately defined these periods, but definition is different and is well known by persons skilled in the art for every kind of cancer.

Many cancer archives (registry), the Surveillance of NCI for example, Epidemiology, andEnd Results Program (monitoring, epidemiology and final result project) (SEER) have used and have summed up by stages.This system is used to all types of cancers.It is divided into five main classifications with the carninomatosis example:

Original position be the early cancer, it exists only in its cellular layer that begins.

Partial is to be limited to the organ that it begins, and does not spread the cancer of sign.

Regional is to have exceeded the cancer of initial (former) position to contiguous lymph node or organ and tissue diffusion.

At a distance be from former position to the cancer of distant place organ or lymph node diffusion at a distance.

Unknown be used to describe do not have enough information to show the case in period.

In addition, for cancer after removing primary tumo(u)r some months or several years recurrence be common.The cancer of having reappeared after all visible tumors have been uprooted is called as the recurrence disease.The disease of reappearing in the zone of primary tumo(u)r is the original place recurrence, and is called as recurrence at a distance as shifting the disease of reappearing.The dormancy tumor is there to be tumor cell but tumor development is not the tumor that tangible clinically resting state exists.Micrometastasis be from primary tumo(u)r to the little transfer of other parts of health diffusion perhaps many cells.Micrometastasis can or can not be detected in examination or diagnostic test.Method of the present invention is useful to prevention dormancy tumor or the generation of micrometastasis or the recurrence of tumor, for example exists but under can or can not be by the situation of Clinical detection in dormancy tumor or micrometastasis.

Method of the present invention is useful to early cancer's treatment also, includes but not limited to benign, cancer tumor preceding or non-metastatic.This comprises any 0, I or the tumor of II phase; The II phase tumor of any non-metastatic; Any usually prior to cancer or develop into the illness of cancer, include but not limited to abnormal development; And any maintenance tumor of being confined to initial position and not soaking into, invade or shift to the position, distant place.Benign, the example of tumor before the cancer or non-metastatic comprises polyp, adenoma, fibroma, lipoma, gastrinoma, insulinoma, chondroma, osteoma, hemangioma, lymphangioma, meningioma, leiomyoma, rhabdomyoma, squamous cell papilloma, acoustic neuroma, neurofibroma, bile duct cystadenoma, leiomyoma, mesothelioma, teratoma, myxoma, trachoma, granuloma, hamartoma, transitional cell papilloma, the pleomorphic adenoma of salivary gland, fibroma durum, skin sample capsule papilloma, cystadenoma, focal nodositas hypertrophy and nodositas regenerative proliferation.

Owing to all relate to angiogenesis in the primary tumo(u)r growth with in shifting, therefore angiogenesis inhibitor treatment provided by the invention can suppress tumor in the tumprigenicity growth at former position and prophylaxis of tumours in the transfer at secondary position, allow thus to attack tumor by the other treatment agent.This paper has the example of cancer to be treated to comprise the tumor of entity and non-entity or soft tissue.Example includes but not limited to cancer, lymphoma, blastoma, sarcoma and leukemia.The example more specifically of this cancer comprises squamous cell carcinoma; Pulmonary carcinoma (comprising the adenocarcinoma of small cell lung cancer, nonsmall-cell lung cancer, lung and the squamous cell carcinoma of lung); Peritoneal cancer, hepatocarcinoma, stomach (gastric) or stomach (stomach) cancer (comprising human primary gastrointestinal cancers); Cancer of pancreas; Glioblastoma; Cervical cancer; Ovarian cancer; Hepatocarcinoma (liver cancer); Bladder cancer; Hepatoma; Breast carcinoma; Colon cancer; Colorectal carcinoma; Endometrium or uterus carcinoma, salivary-gland carcinoma; Kidney (kidney) or kidney (renal) cancer; Hepatocarcinoma (liver cancer); Carcinoma of prostate; Carcinoma vulvae; Thyroid carcinoma; Hepatocarcinoma (hepatic carcinoma); With dissimilar head and neck cancers, and B cell lymphoma (comprises low level/folliculus non-Hodgkin lymphoma (NHL); Small lymphocyte (SL) NHL; Medium rank/folliculus NHL; Medium rank diffusivity NHL; High-level immunoblast NHL; High-level lymphoblast NHL; High-level small non-cleaved cell NHL; Lump disease NHL; Lymphoma mantle cell; The lymphoma that AIDS is relevant; And macroglobulinemia Waldenstron); Chronic lymphocytic leukemia (CLL); Acute lymphoblastic leukemia (ALL); Hairy cell; Chronic myeloblastic leukemia and transplanting back lymphocytic hyperplasia disease (PTLD), and the improper blood vessel hyperplasia relevant with phakomatose, edema (for example relevant) and meigs' syndrome with cerebroma.More specifically, can comprise breast carcinoma, colorectal carcinoma, rectal cancer, nonsmall-cell lung cancer, non-Hodgkin lymphoma (NHL), renal cell carcinoma, carcinoma of prostate by the cancer of VEGF specific antagonists treatment of the present invention; Hepatocarcinoma; Cancer of pancreas; Soft tissue sarcoma, Kaposi sarcoma, carcinoid, head and neck cancer, cerebroma, glioma (for example prominent less astrocytoma of anaplastic astrocytoma, anaplastic, anaplastic oligodendroglioma, glioblastoma multiforme), melanoma, ovarian cancer, mesothelioma and multiple myeloma.More preferably, method of the present invention is used to treat the colorectal carcinoma in the human patients.

B. adenoma

In one embodiment, method of the present invention is used for the treatment of the optimum epithelial cell tumor that is called as adenoma.Adenoma is the benign tumor with gland origin.Adenoma originates from usually and is used for excretory epithelial cell.Epithelial cell spreads all over health but only is that a part of this cell is used for secretion.Be used to excretory epithelial cell and constituted the special part of the health that is called as gland.Gland is born the responsibility that forms many materials in the health, and described material includes but not limited to antiperspirant, saliva, breast milk, mucus and hormone.Adenoma can form by the cell of most of glands from health.

Adenoma can form to mode pernicious or that cancerous tumour is similar.Adenoma is benign and therefore can shift or diffusion to other organ or tissues.Although it is optimum that most of adenomas keep, some adenomas can develop into malignant tumor, and if its generation, new malignant adenoma is called as adenocarcinoma.Can be used as adenoma or polyp when for example, colon and rectal cancer begin but developed into adenocarcinoma afterwards; Bronchial adenoma can develop into pulmonary carcinoma.

Usually, adenoma develops in wherein organ or glandular tissue them and has appreciable impact.Adenoma is often secreted the hormone of excessive levels.When this took place, this effect may be quite uncomfortable for affected individuality.In some situation, this effect can be fatal.Yet, some adenomas development and without any verifiable effect.

There is the adenoma of some type more common in the women, for example the adenoma of liver.Other for example adenoma of colon is for example to surpass among the quinquagenary adult modal at advanced age.In addition, the factor that makes the patient develop adenoma is easily arranged.For example, the women of use oral contraceptive may have the risk of the development adenoma of liver of increase.The adenoma of some type, for example adenoma of colon may be heritable.

The symptom variation relevant with adenoma is very big.For example, be called the adenoma of breast of fibroadenoma, do not produce usually symptom and can be very little thus affected individuality can not realize it.But other adenoma of breast can be even as big as noticing by touch.By contrast, the lung adenoma can produce heating, shiver with cold, short of breath and hemoptysis (bloody cough).

Use multiple technologies diagnosis adenoma, comprise and gather blood and urine samples, ultra sonic imaging, computerized tomography (CT) scanning and nuclear magnetic resonance (MRI).Biopsy is normally used for determining that tumor is benign or virulent.Method of the present invention is particularly useful for the treatment of the treatment of adenoma, adenoma recurrence or prevention (for example in the curee with dormancy tumor or micrometastasis) or for the prevention of adenoma among the curee with any risk factor relevant with adenoma.

C. gastrointestinal tumor

In another embodiment, method of the present invention be used to before benign, the cancer, gastrointestinal tumor non-metastatic or dormancy or from the treatment of the micrometastasis of gastrointestinal tumor.This comprises any 0, I or II phase tumor; Usually prior to human primary gastrointestinal cancers or develop into any tumor or the illness of human primary gastrointestinal cancers; And keep any gastrointestinal tumor be confined to initial position and do not soak into, invade or shift to the position, distant place.Comprise digestive system especially any polyp, adenoma, tumor or the cancer of esophagus, stomach, liver, biliary tract (gallbladder, bile duct, ampulla hepatopancreatica (ampulla of vater)), intestinal, pancreas, colon, rectum and anus in the gastrointestinal tumor.These are at following detailed description.

(i) anus cancer

Anus cancer is the malignant tumor of anal canal or haemorrhoidal ring.Anus cancer often begins to be anus abnormal development.Anus abnormal development is by having undesired variation, but do not demonstrate the anus cellularity of the sign that tissue towards periphery invades.Anus the most serious dysplastic form is called as cancer in situ, and wherein the performance of cell is as cancerous cell, but does not invade the one side at normal cell place.Pass by in time, anus abnormal development finally is changed to the point that cell becomes diffusibility and obtains to shift or break away from the ability of other parts of health.Anus abnormal development is called as anal intraepithelial neoplasia sample pathological changes (AIN) sometimes.When anus cancer begin the diffusion, it normally spreads by directly invading to surrounding tissue or passing through lymphsystem.Although may take place, the diffusion ratio of the anus cancer by blood is more uncommon.

That several factors are relevant with anus cancer.Most important ground, the infection of human papillomavirus (HPV) have demonstrated relevant with anus cancer and have been correlated with several other cancers (comprising cervical cancer and head and neck cancer).The another kind viral HIV (human immunodeficiency virus) (HIV) that spreads through sex intercourse is associated with anus cancer, and the individuality of infected by HIV has the risk of the infection HPV of increase.Because anus cancer at first began to show as anus abnormal development before developing into anus cancer, therefore there is the patient of AIN history to have the risk of the development anus cancer of increase.In addition, suffering from the anus cancer ratio that optimum Anal disorder for example shows increase among the patient of hedrosyrinx, anal fissure, perianal abscess or hemorrhoid.

Method of the present invention is for the treatment of early stage anus cancer, and the treatment or the prevention (for example in the curee who suffers from dormancy tumor or micrometastasis) of anus cancer recurrence or the prevention with anus cancer among the curee of any risk factor relevant with anus cancer are particularly useful.

(ii) colorectum and rectal cancer

Colon is the longest part in the large intestine ((large intestine) is also referred to as large intestine (large bowel)).In the masculinity and femininity of the Western countries, colon cancer all is the modal cancer of the 3rd class.Sickness rate is the highest in the African American, and they also more may die from this disease.The risk of colon cancer raise after 50 years old greatly, but annual also have a large amount of cases to be reported in younger crowd.Usually, colon is divided in together with rectal cancer and has and they relevant identical risk factor.Have the individual of colon cancer, polyp or HCC syndrome (for example FAP and HNPCC) or the individuality of family history, and the patient who suffers from ulcerative colitis or crohn is in the higher risk and may just needs examination at the age more Zao than general crowd.The probability of suffering from the ontogenetic development cancer with first degree relative relation (father and mother, siblings or children) of colon cancer is 2 to 3 times of people that do not have infected relatives.

The known multiple technologies diagnosing colon cancer of available clinician.Because these periods are not usually relevant with any symptom, the examination test is to diagnose the effective method that is in early stage colon cancer (for example polyp or adenoma).Usually when polyp grows up to tumor, it can be hemorrhage or obstruction colon and produce symptom.These symptoms comprise behind hemorrhage of rectum, defecation change (promptly thinning), the abdominal colic of blood stool or the lavatory, stool shape and feel when not needing defecation needs defecation.Because tumor and polyp can be hemorrhage off and on, can detect blood in the stool sample by the test that is called fecal occult blood testing (FOBT).FOBT can only find about 24% cancer separately.Flexible sigmoidoscopy or colonoscopy also can be used to diagnosis of colorectal cancer.

Usually, colorectal carcinoma is by stages following:

0 phase (being also referred to as cancer in situ)-cancer is confined to the outmost part of colon wall.

I phase-cancer has diffused to second and the 3rd layer of colon wall, but not to the outside of colon wall or exceed colon wall.This is also referred to as Du Kesi A phase colon cancer.

II phase-cancer has diffused through colon wall, but does not invade any lymph node (these are the minor structures that help infection and disease).This is also referred to as Du Kesi B phase colon cancer.

III phase-cancer has diffused through colon wall and in lymph node, has not still diffused to other zones of health.This is also referred to as Du Kesi C phase colon cancer.

IV phase-cancer has diffused to other zones of health (being liver and lung).This is also referred to as Du Kesi D phase colon cancer.

Method of the present invention is for the treatment of early stage colorectal carcinoma, and the treatment of colorectum cancer recurrence or prevention (for example in the curee who suffers from dormancy tumor or micrometastasis) or the prevention with colorectal carcinoma among the curee of any risk factor relevant with colorectal carcinoma (for example as described above those) are particularly useful.

The (iii) esophageal carcinoma

Esophagus is the muscle matter pipe that connects throat and stomach.Most esophageal carcinoma be from esophagus internal membrane (mucosa) rather than from the muscle that constitutes the esophagus remainder or chondrocyte development.Some is unique because it is changing when stomach stretches from throat for the film of esophagus.In the esophagus of upper end (near-end), the film of esophagus and the film of throat are similar, are made of squamous cell.Therefore when cancer developed in this district, they are squamous cell carcinoma normally.In low side (end) esophagus, the cancer of more common type is called as adenocarcinoma.

Except diffusible cancer, the patient is diagnosed as precancerous lesion sometimes, is called cancer in situ.These precancerous lesions can be found before developing into squamous cell carcinoma or adenocarcinoma.Generation cancer in situ when the experience variation similar of the film of esophagus but when invading in without any the Xiang Gengshen tissue to the variation of cancer.Therefore,, do not take place, therefore do not have the risk of diffusion owing to invade although cell itself has cancer sample characteristic.The pathological changes itself of another kind of type that is considered to the omen of cancer is called as Barrett esophagus, and it is in depth explained hereinafter.

The annual esophageal carcinoma betides among about 13,500 Americans, causes about 12,500 examples dead.Most patients is over fifty years old or diagnosed out in more than 60 year old at them, and the male who is diagnosed out is about four times of the women.In the past, the esophageal carcinoma that most (～85%) is diagnosed is the squamous cell carcinoma that takes place in the esophagus of upper end.The risk factor of such cancer comprise smokes and drink (alcohol use).Although they all are considered to independently risk factor (smoking for stronger), in esophageal carcinoma development, between these two kinds of factors as if synergism is arranged.Other potential carcinogens of esophageal squamous cell carcinoma development are nitrosamine, asbestos fibre and oil product.

There are the patient colony of adenocarcinoma (being generally the low side esophagus) risk and this completely different.When comparing, be not too common disease before the adenocarcinoma with squamous cell carcinoma.But it has become even is more general than squamous cell carcinoma recently.Usually adenocarcinoma is considered to result from the environment of Barrett esophagus, and described Barrett esophagus is that the normal film of esophagus is by the alternate a kind of disease of film similar to stomach.By splanchnoscopy diagnosis Barrett esophagus, wherein use fiber-optics camera to enter in the esophagus and any suspicious region of biopsy to overlook.Barrett esophagus is considered to low side esophagus long term exposure in gastric acid caused.This exposure betides among the suffer from gastroesophageal reflux disease patient of (GERD), and it causes patient's heartburn, flatulence, forfeiture appetite or along with the symptom of having a stomachache in bed in food or evening.The patient who suffers from chronic GERD has the risk of development Barrett esophagus and therefore has the risk of higher development adenocarcinoma of esophagus.

Although by definition, Barrett esophagus takes place when the film of esophagus is undesired, and the undesired degree of varying level can be arranged.It is come classification from dysplastic aspect, and it is used to determine that Barrett esophagus will have muchly may be developed to cancer.Because these change before being considered to have the canceration of high likelihood of the cancer of being developed to, have the patient of high-level dysplastic Barrett esophagus and should every three months accept a splanchnoscopy or receive treatment practically.For the local esophageal carcinoma of proof or the most sensitive dysplastic detection is splanchnoscopy.Use splanchnoscopy, the position of being concerned about in the usable fibers photographic camera direct observation esophagus, and with abnormal position, deposit or do not exist and bleed, and the amount of blocking is visual.The position and the degree that depend on the esophageal carcinoma may also need to carry out laryngoscopy (checking throat) or bronchoscopy (checking trachea and air flue).Standard medical care of today is carried out ultrasound wave during also being included in splanchnoscopy, is called endoscopic ultrasonography (EUS).For correct diagnosis cancer and by stages, carry out CT scan usually, gulp down barium test, X-ray and other more conventionally tests (comprising the blood screening test) cancer.

Method of the present invention is for the treatment of the early stage esophageal carcinoma, and the treatment or the prevention (for example in the curee who suffers from dormancy tumor or micrometastasis) of esophageal carcinoma recurrence or the prevention with esophageal carcinoma among the curee of any risk factor relevant with the esophageal carcinoma (for example as described above those) are particularly useful.

(iv) carcinoma of gallbladder

Gallbladder is to store the also little pyriform organ of inspissated bile.The gallbladder regulating liver-QI links to each other by common hepatic duct.About 6000 adults of the annual infection of the primary carcinoma of U.S.'s gallbladder.The major part of these cancers is an adenocarcinoma, and it is for example papilary, tubercular, piped to have hypotype, and this depends on the outward appearance of microscopically tumor cell.More uncommon hypotype comprises squamous cell, signet ring cell and adenosquamous carcinoma (adenoacanthoma).

Carcinoma of gallbladder is the most common in the gerontal patient, and median age is 62-66 year during diagnosis.It is more common in the women, and the women is about 3: 1 than the masculinity ratio.

Although carcinoma of gallbladder and cholelithiasis, high estrogen level, smoking, ethanol, obesity and female gender are associated, the cause of disease of carcinoma of gallbladder is unknown.And the probability that the patient who suffers from inflammatory bowel (ulcerative colitis and crohn) is developed the extrahepatic biliary passages cancer is 10 times.

Usually, diagnose carcinoma of gallbladder by (thorough) medical history and physical examination and laboratory work (it comprises that metabolic chemistry and liver function group are to seek the undesired level as different material in the blood of the generally prompting of liver and gall diseases).Usually also carry out urinalysis to assess level in some the urine in these materials.Also can use other technology for example ultrasonic, MRI, cholangiography and CT scan.

Method of the present invention is for the treatment of early stage carcinoma of gallbladder, and the treatment or the prevention (for example in the curee who suffers from dormancy tumor or micrometastasis) of carcinoma of gallbladder recurrence or the prevention with carcinoma of gallbladder among the curee of any risk factor relevant with carcinoma of gallbladder (for example as described above those) are particularly useful.

(v) gastric cancer

Gastric cancer is the cancer of stomach.In the U.S., gastric cancer is classified the 14th the most general big cancer at present as.Rare gastric cancer before 40 years old, but its sickness rate increased with the age afterwards.

Gastric cancer above 90% results from the film of stomach.Because this film has gland, therefore be called as adenoma or for the form in late period more, be called adenocarcinoma from its cancer of coming.Although other cancers that can produce from stomach (lymphoma-from lymphoid tissue, leiomyosarcoma-from muscular tissue, squamous cell carcinoma-from the film that does not have gland) are arranged, the overwhelming majority is an adenocarcinoma.

Research has also been infected helicobacter pylori (Helicobacter pylori) and has been associated with gastric cancer.Helicobacter pylori is relevant with gastric ulcer and chronic atrophic gastritis, the high incidence of gastric cancer among the patient of this soluble Helicobacter pylori infection.Yet the definite effect of helicobacter pylori in development of gastric carcinoma is not clear.

Gastric cancer is accurately discerned in available multiple detection, comprises dual comparison of barium ray (doublecontrast barium radiograph) (so-called " upper end gastrointestinal tract " or " gulping down barium (bariumswallow) ") and upper end endoscopy.Comprise that CT scan, PET scanning and Laparoscopic other programs are used to the diagnosis of gastric cancer.

Method of the present invention is for the treatment of early gastric cancer, and the treatment or the prevention (for example in the curee who suffers from dormancy tumor or micrometastasis) of gastric cancer recurrence or the prevention with gastric cancer among the curee of any risk factor relevant with gastric cancer (for example as described above those) are particularly useful.

(vi) hepatocarcinoma

Many benign liver tumors are arranged.Hemangioma is modal benign tumor of liver and takes place when forming the tumor of benign hyperemia in liver.Other benign tumors comprise adenoma drawn game focal nodular hyperplasia.Although tissue or transfer around these tumors do not have to invade usually are difficult to differentiate the difference between optimum and the malignant tumor during radiophotography imaging.

Hepatocarcinoma (HCC) is to result from hepatocellular cancer, is the primary hepatic carcinoma of common type and accounts for about 70% of all hepatocarcinoma.The cancer that results from the bile duct in the liver is called as cancer of biliary duct and accounts for the 10-20% of all hepatocarcinoma.These cancers can result from the bile duct (being called the stones in intrahepatic bile duct cancer) in the liver or result from from the bile duct that liver is derived (being called cholangiocarcinoma).The rare cancer of other types can take place in liver.This comprises angiosarcoma (pernicious congested tumor) and hepatoblastoma (a kind of rare cancer that develops) in very little child.

Many risk factor relevant with hepatocarcinoma are arranged.In the U.S., the modal risk factor of hepatocarcinoma are liver cirrhosis.Infecting in U.S.'s chronic hepatitis C virus (HCV) also is the common cause of disease of hepatocarcinoma.In the world wide, for example chronic HBV (HBV) infects other risk factor and the AFB1 food pollution is more common.

Several examination tests that are used to detect hepatocarcinoma are arranged.A kind of possible examination test relates to the detection of the blood levels of α-fetoprotein (AFP).Find that AFP is the protein that exists with high level in fetal blood, but normally after birth, disappear.The AFP level raises and but the mark of hepatocarcinoma development under the situation that HCC exists.Although some high risk patients with development hepatocarcinoma are tested the AFP level routinely, not all hepatocarcinoma all produces high-caliber AFP in the blood, and is found when having high AFP level to Most patients, and tumor has been in late period.Other blood protein might be used as the screening instruments of hepatocarcinoma.Several research shown protein for example go-use of γ-carboxyl thrombinogen (DCP) and the reactive part of lens culinaris agglutinin (AFP-L3) also can be used as the mark that hepatocarcinoma forms; Yet, in fact seldom use these protein.

In addition, when suspection is hepatocarcinoma, carry out ultrasonic, CT scan, MRI, angiography, fluorodeoxyglucose (fluorodexoyglucose)-PET (positron emission tomography) (FDG-PET), biopsy and laparotomy exploration (exploratory laporatomy) and by stages with hepatocarcinoma with further diagnosis.

Method of the present invention is for the treatment of early hepatocarcinoma, and the treatment of liver cancer recurrence or prevention (for example in the curee who suffers from dormancy tumor or micrometastasis) or the prevention with hepatocarcinoma among the curee of any risk factor relevant with hepatocarcinoma (for example as described above those) are particularly useful.

(vii) cancer of pancreas

Pancreas is to be about six inches pyriform gland, is positioned at the abdominal part depths, between the harmonization of the stomach vertebra.Be pointed out that pancreas is divided into three parts: the wideest part is called as head, and intermediary part is a body and the smalls end is called as afterbody.The enzyme that pancreas is responsible for making hormone (comprising the insulin that helps the blood sugar regulation level) and is used for digest food via intestinal.Transport these enzymes by the conduit in the pancreas, these enzymes flow into common bile duct, and described bile duct is transported intestinal with enzyme.The sickness rate of cancer of pancreas 60 and 80 years old between be the highest, and very rare in being lower than 40 years old crowd.Sickness rate in the masculinity and femininity is roughly suitable, although women's sickness rate raises in recent years, this may be because the higher smoking rate of women.The probability that the smoker is developed cancer of pancreas is two to three times.If mother of a people, father or siblings have suffered from described disease, his risk triplication so.The family history of breast carcinoma or colon cancer also increases risk.The risk of this increase is because the genetic mutation on the oncogene.The actual cause of disease of this disease also do not know, but is considered to the variation in the heredity of heredity and the result of the variation associating that caused by environmental exposure.

When the doctor suspected that the patient may suffer from cancer of pancreas, ultrasonic, CT scan and splanchnoscopy were used to diagnosis and with cancer by stages.Some patient who suffers from cancer of pancreas may have carbohydrate antigen 19-9 (CA 19-9) level of rising.In the patient of the level with rising, described level is confirmed in the diagnosis and is useful to the described disease of monitoring during treating uniting with other tests.Can be in the described level of inspection of treatment period so that to observe cancer be stable or worsen.

Method of the present invention is for the treatment of early stage cancer of pancreas, and the treatment or the prevention (for example in the curee who suffers from dormancy tumor or micrometastasis) of cancer of pancreas recurrence or the prevention with cancer of pancreas among the curee of any risk factor relevant with cancer of pancreas (for example as described above those) are particularly useful.

(viii) carcinoma of small intestine

Small intestinal (small bowel) is also referred to as small intestinal (small intestine), is the digestive tract part that connects harmonization of the stomach large intestine (being also referred to as colon).Small intestinal has three different parts: 1) duodenum, 2) jejunum and 3) ileum.Surprisingly, although to compare small intestinal length shockingly long with gastral remainder, the cancer of small intestinal is very rare.This is included in cancer that begins in the intestinal or the cancer that is diffused into the there from another body part.Especially, account for about 0.5% of all cancers of having diagnosed what U.S.'s carcinoma of small intestine accounted for all intestinal cancer less than 5%.

The cause of disease of most of carcinoma of small intestine is unknown.Yet there are some can increase the possible risk factor of the chance of development carcinoma of small intestine.Some examples comprise crohn, celiac disease, peutz-jegher Cotard and intestinal polyposis.

The cell that depends on the outward appearance and the origin of microscopically has the carcinoma of small intestine of four kinds of main types.Adenocarcinoma is modal type.It begins in the film of intestinal or internal layer usually, and takes place in duodenum usually.Another kind of type is that sarcoma and typical hypotype are leiomyosarcomas, and it begins in the muscular wall of small intestinal and takes place in ileum usually.The third type is a carcinoid, and it begins in the cell of the special generation hormone of small intestinal and usually occurs in the ileum, sometimes in vermiform appendix (it is the first of large intestine).The 4th type is lymphoma, and it begins in the lymphoid tissue of small intestinal and takes place in jejunum usually.Lymphadenomatous most typical hypotype is a non-Hodgkin lymphoma.A kind of uncommon hypotype of carcinoma of small intestine is the gastrointestinal tract mesenchymal neoplasm, and it can take place in any one of three parts of small intestinal.

Usually use complete medical history, physical examination and stool sample, splanchnoscopy or colonoscopy, barium C ray, CT scan, ultrasonic or other x roentgenodiagnosis carcinoma of small intestine.

Method of the present invention is for the treatment of early stage carcinoma of small intestine, and the treatment or the prevention (for example in the curee who suffers from dormancy tumor or micrometastasis) of carcinoma of small intestine recurrence or the prevention with carcinoma of small intestine among the curee of any risk factor relevant with carcinoma of small intestine (for example as described above those) are particularly useful.

V. prevention

In another aspect of the present invention, we have found that the VEGF specific antagonists can be used to benign, cancer the treatment preceding or early cancer, the perhaps treatment of tumor recurrence or prevention.Can use described method treatment cancer itself or give protection against cancer in advance to transitivity or diffusion period or to the development in higher level or period.For example, can use method treatment of the present invention to suffer from the curee of 0 phase cancer or polyp so that prevent to I phase or higher phase tumor development.Equally, in the patient who suffers from II phase cancer, can use the pre-anti-cancer of described method to III phase or the development of IV phase cancer.

Also can use the recurrence of VEGF specific antagonists prophylaxis of tumours.For example, if tumor is identified and treats (for example with chemotherapy or exenterate), can use the recurrence of VEGF specific antagonists prevention colorectum tumor original place or the transfer of colorectum tumor.Be the recurrence of prophylaxis of tumours, can use the VEGF specific antagonists, for example treat the growth or the regrowth of dormancy tumor or micrometastasis or prevention dormancy tumor or micrometastasis, it or be not detectable clinically.

We also have been found that the prevention that the VEGF specific antagonists can be used to never to suffer from cancer or have cancer among the curee of risk of development cancer.There are multiple known risk factor relevant with cancer and above described many in them.Exemplary risk factor comprise viral infection, use oral contraceptive, liver cirrhosis, ulcerative colitis, Barrett esophagus, Helicobacter pylori infection and polyp or the dysplastic existence of family history, HPV, HIV, HBV and the HCV of advanced age (promptly above 50 years old), cancer.In addition, think known suffer from the syndromic curee of hereditary cancer have the development cancer risk.This syndromic limiting examples comprises APC, HNPCC, Gardner syndrome and MEN1.The other risk factor of development cancer can be determined and comprise the hormone of elevated levels or blood protein for example PSA (carcinoma of prostate), CA-125 (ovarian cancer), AFP (hepatocarcinoma), DCP (hepatocarcinoma) and CA 19-9 (cancer of pancreas) according to clinical assessment.

VI. neoadjuvant

The invention provides the curee, the method of the neoadjuvant before the cancer that exenterate can be performed the operation in the human patients for example, it comprises the VEGF specific antagonists of patient's (for example, wherein the patient has been diagnosed as tumor and/or cancer) being used effective dose, for example VEGF antibody.Randomly, VEGF specific antagonists and at least a chemotherapeutant is co-administered.The VEGF specific antagonists of after operation the curee being used effective dose also can use with neoadjuvant described herein with other step of prevention cancer recurrence.For being included in operation back concerning the curee uses the method for other step of VEGF specific antagonists of effective dose, can use any householder method described herein.

For example, a kind of method is included in and treats cancer among the curee, this method comprises the following steps: a) to comprise the phase I of a plurality of treatment cycle, wherein each cycle comprises the VEGF specific antagonists bevacizumab for example of the curee being used effective dose with predetermined interval, and randomly at least a chemotherapeutant; B) definitiveness operation is so as to removing cancer; And randomly, c) comprise a plurality of second stage of keeping the cycle, wherein each cycle comprises the VEGF specific antagonists bevacizumab for example of the curee being used effective dose with predetermined interval, and is with or without any chemotherapeutant.

For neoadjuvant, the VEGF specific antagonists can be used to reduce the number of cancerous cell in (for example 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more) tumor with a certain amount of or certain hour (All Time of for example specific therapeutic scheme); With the size (for example to allow excision) that reduces tumor; To reduce tumor load; Go among the peripheral organ to suppress (promptly be reduced to a certain degree and/or stop) cancer cell infiltration; To reduce tumor medium vessels density; To suppress neoplasm metastasis; To reduce or inhibition tumor growth or tumor cell proliferation; To reduce or prevention dormancy growth of tumor; To reduce or to prevent the growth or the propagation of micrometastasis; To increase or to prolong DFS or the OS that easily suffers from or be diagnosed as the curee who suffers from tumor before benign, the cancer or non-metastatic; And/or with one or more remissions that will be relevant with cancer to a certain degree.

In an example, use neoadjuvant, wherein about 2 to 5 years assessment DFS or OS after the beginning administration of antibodies to prolong DFS or OS.In certain embodiments, about 3-5, about 4-5 after treatment begins or after the initial diagnosis, or at least about 4 years or at least about the DFS or the OS that assessed the curee in 5 years.Usually, the VEGF specific antagonists is a for example bevacizumab of VEGF antibody.

In another example, with independent with chemotherapy (taxane for example, such as paclitaxel) treatment the curee compare, antibody and/or chemotherapeutic using can be in curee colony be reduced the palindromia (cancer recurrence former organ and/or recurrence at a distance) of about 50% (" about 50% " comprises from about 45% to about 70% scope) 3 years the time wherein herein, for example reduce about 52% the recurrence in former organ 3 years the time, and/or reduce about 53% distant place recurrence 3 years the time.

Can be in accordance with known methods to the curee for example human patients use for example VEGF antibody of VEGF specific antagonists, known method for for example intravenous use (such as annotating) or the lasting infusion by a period of time for group, by intramuscular, intraperitoneal, marrowbrain interior (intracerobrospinal), subcutaneous, intraarticular, synovial membrane is interior, sheath is interior, oral, part or inhalation route are used.It is preferred that the intravenous of antibody is used.

Although can with the VEGF specific antagonists for example VEGF antibody use as single dose, randomly use the combined therapy patient of VEGF antibody and one or more chemotherapeutants.In one embodiment, at least a in the chemotherapeutant is taxane.The using of combination comprises uses preparation separately or single pharmaceutical formulations is co-administered or parallel using, and with the continuous administration of any order, wherein preferably for some time two kinds of (or all) activating agents bring into play their biological activity simultaneously.Therefore, can for example use chemotherapeutant before or after the using of VEGF antibody at the VEGF specific antagonists.In this embodiment, the applied once at least of chemotherapeutant and VEGF specific antagonists for example the time between the applied once at least of VEGF antibody be preferably about 1 month or be shorter, and be most preferably about 2 the week or shorter.Selectively, with chemotherapeutant and VEGF specific antagonists for example VEGF antibody with unitary agent or the preparation that separates is parallel that the patient is used.Use the treatment of chemotherapeutant (for example taxane) and VEGF antibody (for example bevacizumab) combination to produce collaborative or than adding and bigger treatment benefit to the patient.

Usually chemotherapeutant (if using) is randomly used with the dosage that reduces with known dosage or owing to the compound action of medicine or owing to the passive side effect of using of antimetabolic chemotherapeutant for this reason.Can or rule of thumb come to determine to use the preparation and the administration time table of this chemotherapeutant by skilled practitioners according to the operation instructions of manufacturer.When described chemotherapeutant is paclitaxel, preferably with it weekly (for example with 80mg/m ²) or per 3 weeks (for example with 175mg/m ²Or 135mg/m ²) use.The dosage of suitable Docetaxel comprises 60mg/m ², 70mg/m ², 75mg/m ², 100mg/m ²(per 3 weeks); Or 35mg/m ²Or 40mg/m ²(weekly).

Various chemotherapeutants capable of being combined are above disclosed.In certain embodiments of the invention, will with the VEGF specific antagonists for example the chemotherapeutant of VEGF antibody combination include but not limited to taxane (comprising Docetaxel and paclitaxel) for example, vinca (vinca) (for example vinorelbine or vincaleucoblastine), platinum compounds (for example carboplatin and cisplatin), aromatase inhibitor (letrozole for example, Anastrozole or exemestane), antiestrogen (for example fulvestrant and tamoxifen), etoposide, thiophene is for group, cyclophosphamide, methotrexate, Mycocet, the Mycocet of Pegylation, capecitabine, gemcitabine, cox 2 inhibitor (for example celecoxib) or albuminous body inhibitor (for example PS342).

When the curee being used anthracycline antibiotics (for example amycin or epirubicin), preferably using the VEGF specific antagonists for example before the bevacizumab and/or provide this to use afterwards.Yet, can be with modified anthracycline antibiotics with the cardiac toxicity that reduces Mycocet (TLC D-99 for example

The Mycocet of Pegylation

Or epirubicin and for example bevacizumab combination of VEGF specific antagonists.

In an embodiment of time of application table, neoadjuvant of the present invention comprises first step, wherein in a plurality of new auxiliary cycles, the patient is used VEGF specific antagonists for example bevacizumab and one or more chemotherapeutant, undergo surgery afterwards and remove tumor with definitiveness ground.Each newly auxiliary cycle is depended on specific treatment plan, by forming in one to three week.For example, treatment cycle is three weeks, and it means that the patient accepts the chemotherapy of a dosage and the bevacizumab of a dosage in per three weeks.Treatment cycle is two weeks also, and it means that the patient accepts the chemotherapy of a dosage and the bevacizumab of a dosage week about.Whole phase I in sustainable about 4-8 cycle of new auxiliary treatment.In certain embodiments of the invention, neoadjuvant continues to be no more than 1 year before operation, is no more than six months in one embodiment.The type and the severity that depend on disease, the VEGF specific antagonists for example the preferred dosage of bevacizumab be from about 1 μ g/kg to about 50mg/kg, most preferably in from about 5mg/kg to the scope of about 15mg/kg, include but not limited to 7.5mg/kg or 10mg/kg.In some respects, the chemotherapy scheme intermittently that relate to traditional high dose is used.At some other aspect, do not have predetermined space and use less but more frequent dosage to use chemotherapeutant (" rhythmical chemotherapy ").Be easy to monitor the progress of therapy of the present invention by routine techniques and mensuration.

Except VEGF antibody and chemotherapeutant, also other therapeutic scheme can be made up with it.For example, chemotherapeutant, wherein second chemotherapeutant or another kind of different taxane chemotherapeutant or the chemotherapeutant of non-taxane such as (the 3rd, the fourth class) of can using second.For example, but second chemotherapeutant taxane (for example paclitaxel and Docetaxel), vinca (for example vinorelbine), platinum compounds (for example cisplatin and carboplatin), antihormone agent (for example aromatase inhibitor or antiestrogen), gemcitabine, capecitabine etc.Exemplary combined comprises taxane/platinum compounds, gemcitabine/taxane, gemcitabine/vinorelbine, vinorelbine/taxane, capecitabine/taxane etc.Can use " mixture " of different chemical therapeutic agent.

Can comprise following any or multiple with the other treatment agent of VEGF antibody combination: another kind of VEGF antagonist or vegf receptor antagonist for example second VEGF antibody, VEGF variant, soluble vegf receptor fragment, can blocking VEGF or fit, the anti-VEGFR antibody of neutrality, VEGFR tyrosine kinase inhibitor and any combination thereof of VEGFR.The useful other treatment agent of combination tumor therapy of using antibody of the present invention is comprised other factors antagonist of EGFR, ErbB2 (being also referred to as Her2), ErbB3, ErbB4 or TNF for example that relates to tumor growth.In an exemplary, (for example do not comprise anti-ErbB antibody or its fragment or derivant in the compositions of VEGF specific antagonists

Antibody).In certain embodiments of the invention, can be with VEGF antibody with for example vegf receptor, FGF receptor, EGF receptor and pdgf receptor be that the micromolecule receptor tyrosine kinase inhibitors (RTKI) of target is used in combination with one or more tyrosine kinase receptors.Many curative micromolecule RTKI are known in the art, include but not limited to Wa Talani (vatalanib) (PTK787), erlotinib

OSI-7904, ZD6474

ZD6126 (ANG453), ZD1839, Sutent

Si Mashani (semaxanib) (SU5416), AMG706, AG013736, imatinib

MLN-518, CEP-701, PKC-412, Lapatinib (lapatinib) (GSK572016),

AZD2171, Sorafenib XL880 and CHIR-265.

Above co-administered any dose the dosage that is fit to is that those that use at present also can be lowered owing to the compound action (working in coordination with) of this agent and VEGF antibody.

Except therapeutic scheme above, can make the patient through receiving radiation therapy.

In certain embodiments of the invention, the VEGF antibody of being used is complete unshielded antibody.But VEGF antibody and cytotoxic agent yoke can be closed.In certain embodiments, antibody that yoke closes and/or antigen bonded with it is by cell internalizing, cause conjugates kill its treatment of bonded cancerous cell render a service and increase.In one embodiment, the nucleic acid in cytotoxic agent targeting or the interfere with cancer cells.The example of this cytotoxic agent comprises maytansinol (maytansinoids), Gary stop mycin, ribonuclease and DNA Cobra venom endonuclease.

VII. complementary therapy

The invention provides the method for complementary therapy, it is included in definitiveness operation back the curee of the cancer of suffering from non-metastatic is used for example VEGF antibody of VEGF specific antagonists.

For example, method can may further comprise the steps: the phase I that a) comprises a plurality of treatment cycle, wherein each cycle comprises the VEGF specific antagonists bevacizumab for example of the curee being used effective dose with predetermined interval, and randomly at least a chemotherapeutant; And b) comprise a plurality of second stage of keeping the cycle, wherein each cycle comprises the VEGF specific antagonists bevacizumab for example of the curee being used effective dose with predetermined interval, but without any chemotherapeutant; Wherein Zu He first and second stages continue at least one year behind initial post-operative treatment.In one embodiment, phase I comprises first a plurality of treatment cycle, wherein use VEGF the specific antagonists for example bevacizumab and the first chemotherapy scheme, be second a plurality of treatment cycle afterwards, wherein use VEGF the specific antagonists for example bevacizumab and the second chemotherapy scheme.

For complementary therapy, the VEGF specific antagonists can be used to reduce the number of cancerous cell in (for example 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more) tumor with a certain amount of or certain hour (All Time of for example specific therapeutic scheme); To reduce the size of tumor; To reduce tumor load; Go among the peripheral organ to suppress (promptly be reduced to a certain degree and/or stop) cancer cell infiltration; To reduce tumor medium vessels density; To suppress neoplasm metastasis; To reduce or inhibition tumor growth or tumor cell proliferation; To reduce or prevention dormancy growth of tumor; To reduce or to prevent the growth or the propagation of micrometastasis; Regrowth with minimizing or prophylactic treatment or removal back tumor; And/or with one or more remissions that will be relevant with cancer to a certain degree.In other the embodiment, can use of generation or the recurrence of VEGF specific antagonists at some with cancer among the prevention curee.In an example, after about 4 years in curee colony the prevention of assessment cancer recurrence with confirm colony at least about 80% in no palindromia generation.In another example, the prevention of assessment palindromia in the time of about 3 years is wherein compared with the curee who only treats with chemotherapy, and palindromia has descended at least about 50%.

Usually restoring a period of time from operation after, the curee uses the VEGF specific antagonists.Can comprise that during this period of time wound healing or operative incision heal the needed time period, the needed time period of risk or the curee that reduce wound dehiscence returns to and the similar substantially or better needed time period of health level of preoperative health level.Definitiveness operation finish and the using first of VEGF specific antagonists between time period also can comprise the needed time period of drug holiday, wherein the curee needs or requires a period of time between therapeutic scheme.Usually, definitiveness operation is finished and the time period of VEGF specific antagonists therapy between beginning can comprise and be less than a week, 1 week, 2 weeks, 3 weeks, 4 weeks (28 days), 5 weeks, 6 weeks, 7 weeks, 8 weeks, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years or more of a specified duration.In one embodiment, definitiveness operation and use time period between the VEGF specific antagonists greater than 2 weeks and less than 1 year.

In an example, use for example VEGF antibody of VEGF specific antagonists, wherein about 2 to 5 years assessment DFS or OS after the antibody initial application with the amount of effective prolongation disease free survival phase (DFS) or overall life cycle (OS).In certain embodiments, about 3-5, about 4-5 or after treatment beginning back or initial diagnosis at least about 4 years or at least about the DFS or the OS that assessed the curee in 5 years.

In accordance with known methods to the curee for example human patients use for example VEGF antibody of VEGF specific antagonists, known method for intravenous for example use (such as annotating) or the lasting infusion by a period of time for group, by in intramuscular, intraperitoneal, the marrowbrain, in subcutaneous, the intraarticular, synovial membrane, in the sheath, oral, part or inhalation route uses.It is preferred that the intravenous of antibody is used.

The VEGF specific antagonists can be used as single dose.In other embodiment, with the combined therapy patient of VEGF specific antagonists and one or more chemotherapeutants.In some embodiments, at least a in the chemotherapeutant is taxane.The using of combination comprises uses the preparation separately or co-administered or parallel the using of single pharmaceutical formulations, and with the continuous administration of any order, wherein randomly for some time two kinds of (or all) activating agents bring into play their biological activity simultaneously.Therefore, can for example use chemotherapeutant before or after the using of VEGF antibody at the VEGF specific antagonists.In this embodiment, the applied once at least of chemotherapeutant and VEGF specific antagonists for example the time between the applied once at least of VEGF antibody be preferably about 1 month or be shorter, and be most preferably about 2 the week or shorter.Selectively, with chemotherapeutant and VEGF antibody with unitary agent or the preparation that separates is parallel that the patient is used.Use the treatment of chemotherapeutant (for example taxane) and VEGF antibody (for example bevacizumab) combination to produce collaborative or than adding and bigger treatment benefit to the patient.

Usually chemotherapeutant (if using) is randomly used with the dosage that reduces with known dosage or owing to the compound action of medicine or owing to the passive side effect of using of antimetabolic chemotherapeutant for this reason.Can or rule of thumb come to determine to use the preparation and the administration time table of this chemotherapeutant by skilled practitioners according to the operation instructions of manufacturer.When described chemotherapeutant is paclitaxel, preferably with it weekly (for example with 80mg/m ²) or per 3 weeks (for example with 175mg/m ²Or 135mg/m ²) use.The dosage of suitable Docetaxel comprises 60mg/m ², 70mg/m ², 75mg/m ², 100mg/m ²(per 3 weeks); Or 35mg/m ²Or 40mg/m ²(weekly).

Various chemotherapeutants capable of being combined are above disclosed.To include but not limited to the example of the chemotherapeutant of VEGF antibody combination, for example taxane (comprising Docetaxel and paclitaxel), vinca (for example vinorelbine or vincaleucoblastine), platinum compounds (for example carboplatin and cisplatin), aromatase inhibitor (letrozole for example, Anastrozole or exemestane), antiestrogen (for example fulvestrant and tamoxifen), etoposide, thiophene is for group, cyclophosphamide, methotrexate, Mycocet, the Mycocet of Pegylation, capecitabine, gemcitabine, cox 2 inhibitor (for example celecoxib) or albuminous body inhibitor (for example PS342).

When the curee being used anthracycline antibiotics (for example amycin or epirubicin), preferably before using VEGF antibody and/or provide this to use afterwards, for example with disclosed scheme among the embodiment hereinafter, wherein after the operation but the combination of before the using of VEGF antibody and taxane, the curee being used anthracycline antibiotics/cyclophosphamide.Yet, can be with modified anthracycline antibiotics with the cardiac toxicity that reduces Mycocet (TLC D-99 for example

The Mycocet of Pegylation

Or epirubicin and the combination of VEGF antibody.

In a time of application table, complementary therapy of the present invention comprises the phase I, wherein in a plurality of treatment cycle the patient is used VEGF specific antagonists for example VEGF antibody and one or more chemotherapeutant; And second stage, wherein with the VEGF specific antagonists for example VEGF antibody use a plurality of keeping in the cycle as single dose.Each treatment cycle depends on specific treatment plan, by forming in one to three week.For example, treatment cycle can comprise bevacizumab as the VEGF specific antagonists and can be for three weeks, and it means that the patient accepts the chemotherapy of dosage and the bevacizumabs of a dosage in per three weeks.Treatment cycle is two weeks also, and it means that the patient accepts the chemotherapy of a dosage and the bevacizumab of a dosage week about.Whole phase I in sustainable about 4-8 cycle of treatment.Second maintenance stage, depend on the length in specific cycle, bevacizumab can biweekly or once be provided in three weeks and continue about 30-50 cycle.In certain embodiments, complementary therapy begins lasting at least one year from treatment, and keeps a close eye on curee's progress after this.The type and the severity that depend on disease, the preferred dosage of VEGF antibody are from about 1ug/kg to about 50mg/kg, most preferably in from about 5mg/kg to the scope of about 15mg/kg, include but not limited to 7.5mg/kg or 10mg/kg.In some respects, the chemotherapy scheme intermittently that relate to traditional high dose is used.At some other aspect, do not have predetermined space and use less but more frequent dosage to use chemotherapeutant (" rhythmical chemotherapy ").Be easy to monitor the progress of therapy of the present invention by routine techniques and mensuration.

Compare with independent curee with chemotherapy (for example taxane is such as paclitaxel) treatment, antibody and the chemotherapeutic probability that can be in curee colony reduces the palindromia (cancer recurrence former organ and/or recurrence at a distance) of about 50% (" about 50% " comprises from about 45% to about 70% scope) 3 years the time wherein herein of using reduce about 53% distant place recurrence when for example reducing about 52% the recurrence in former organ and/or 3 years in the time of 3 years.

The present invention provides the method for the cancer of the non-metastatic in the colony of human subject of the cancer that treatment suffers from non-metastatic at this paper, it is included in after the definitiveness operation VEGF specific antagonists for example VEGF antibody and at least a chemotherapeutant that the curee is used effective dose, and 4 years or the curee of back assessment more for many years to confirm after about 4 years, not having palindromia to take place among the curee at least about 80% (preferably at least about 85%).Described colony can comprise 3000 example or more human subject.

The invention further relates to the method that in the colony of the human subject of the cancer of suffering from non-metastatic, reduces the probability of palindromia, it is included in effective dose is used in the definitiveness operation afterwards to the curee bevacizumab and at least a chemotherapeutant, wherein compare with the curee who treats with taxane separately, the probability of palindromia reduces at least about 50% in the time of 3 years.

Except VEGF antibody and chemotherapeutant, also other therapeutic scheme can be made up with it.For example, chemotherapeutant, wherein second chemotherapeutant or another kind of different taxane chemotherapeutant or the chemotherapeutant of non-taxane such as (the 3rd, the fourth class) of can using second.For example, but second chemotherapeutant taxane (for example paclitaxel and Docetaxel), vinca (for example vinorelbine), platinum compounds (for example cisplatin and carboplatin), antihormone agent (for example aromatase inhibitor or antiestrogen), gemcitabine, capecitabine etc.Exemplary combined comprises taxane/platinum compounds, gemcitabine/taxane, gemcitabine/vinorelbine, vinorelbine/taxane, capecitabine/taxane etc.Can use " mixture " of different chemical therapeutic agent.

Can comprise following any or multiple with the other treatment agent of VEGF antibody combination: another kind of VEGF antagonist or vegf receptor antagonist for example second VEGF antibody, VEGF variant, soluble vegf receptor fragment, can blocking VEGF or fit, the anti-VEGFR antibody of neutrality, VEGFR tyrosine kinase inhibitor and any combination thereof of VEGFR.The useful other treatment agent of combination tumor therapy of using antibody of the present invention is comprised other factors antagonist of EGFR, ErbB2 (being also referred to as Her2), ErbB3, ErbB4 or TNF for example that relates to tumor growth.In an exemplary, (for example do not comprise anti-ErbB antibody or its fragment or derivant in the compositions of VEGF specific antagonists

Antibody).In certain embodiments, can be with VEGF antibody with for example vegf receptor, FGF receptor, EGF receptor and pdgf receptor be that the micromolecule receptor tyrosine kinase inhibitors (RTKI) of target is used in combination with one or more tyrosine kinase receptors.Many curative micromolecule RTKI are known in the art, include but not limited to Wa Talani (PTK787), erlotinib

OSI-7904, ZD6474

ZD6126 (ANG453), ZD1839, Sutent Si Mashani (SU5416), AMG706, AG013736, imatinib

MLN-518, CEP-701, PKC-412, Lapatinib (GSK572016),

AZD2171, Sorafenib

XL880 and CHIR-265.

Above co-administered any dose the dosage that is fit to is that those that use at present also can be lowered owing to the compound action (working in coordination with) of this agent and VEGF antibody.

Except therapeutic scheme above, can make the patient through receiving radiation therapy.

In certain embodiments, the VEGF antibody of being used is complete unshielded antibody.But VEGF antibody and cytotoxic agent yoke can be closed.In certain embodiments, antibody that yoke closes and/or antigen bonded with it is by cell internalizing, cause conjugates kill its treatment on the bonded cancerous cell render a service and increase.In one embodiment, the nucleic acid in cytotoxic agent targeting or the interfere with cancer cells.The example of this cytotoxic agent comprises maytansinol, Gary stop mycin, ribonuclease and DNA Cobra venom endonuclease.

VIII. dosage, preparation and persistent period

With the mode that is consistent with good medical practice prepare, administration and use VEGF specific antagonists compositions.The factor of being considered with this angle comprises the clinical symptoms of the specific disease of being treated, the specific curee who is treated, individual patients, the cause of disease of disease, the site of delivery of agent, the method for using, the timetable of using and known other factors of medical practitioner." in the treatment effectively amount " of VEGF specific antagonists to be administered will by these Considerations decisions and to prevention, improve or treatment or stablize benign, cancer before or the early cancer; Or the generation of treatment or prophylaxis of tumours, dormancy tumor or micrometastasis or the recurrence (for example in new auxiliary or auxiliary situation) amount of essential minimum.The VEGF specific antagonists does not need, but randomly formulated together with one or more agent in order to the risk of prevention or treatment cancer or development cancer at present.The effective dose of these other agent depends on the type of amount, disease or treatment of the VEGF specific antagonists that exists in the preparation and other factors of above being discussed.Usually use these or from 1% to 99% use these approximately with same dosage used in as mentioned and route of administration with the dosage that uses so far.

The type and the severity that depend on disease, the VEGF specific antagonists of about 1 μ g/kg to 100mg/kg (for example 0.1-20mg/kg) is initial candidate's dosage that the patient is used, and no matter for example is using or using by continuous infusion by what one or many separated.Depend on factor referred to above, typically every day, dosage can be changed to about 100mg/kg or more from about 1 μ g/kg.Especially ideal dosage comprises for example 7.5mg/kg, 10mg/kg and 15mg/kg.For several days or repetitive administration for more time, depend on illness, treatment is kept up to cancer treated, measure by above-described or methods known in the art.But other dosages can be useful.In an example, if the VEGF specific antagonists is an antibody, so with antibody of the present invention with dosage range from about 5mg/kg to about 15mg/kg, include but not limited to 7.5mg/kg or 10mg/kg weekly, per two the week or use once in per three weeks.Monitor the progress of therapy of the present invention at an easy rate by routine techniques and mensuration.

In an example, bevacizumab is the VEGF specific antagonists.With 100mg and 400mg preservative free, disposable bottle serves as that the treatment application provides the bevacizumab (25mg/ml) of bevacizumab to send 4ml or 16ml.At the α of 240mg dehydration, preparation 100mg product in α-trehalose, 23.2mg sodium phosphate (single alkali, monohydrate), 4.8mg sodium phosphate (two alkali, anhydrous), 1.6mg polysorbate20 and the water for injection (USP).At the α of 960mg dehydration, preparation 400mg product in α-trehalose, 92.8mg sodium phosphate (single alkali, monohydrate), 19.2mg sodium phosphate (two alkali, anhydrous), 6.4mg polysorbate20 and the water for injection (USP).

The persistent period of therapy will continue to the length that medically shows or up to reaching needed therapeutical effect (for example described herein those).In certain embodiments, VEGF specific antagonists therapy continued 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 2 years, 3 years, 4 years, 5 years or up to the lifelong years of curee.

Auxiliary or the neoadjuvant of alleviation before benign usually, the cancer or the early cancer or treatment or cancer (benign or virulent) relates to and alleviating and Cancer-Related one or more symptoms or medical care problem.The medicine of effective dose can be realized a kind of or combination in following in the treatment: to reduce the number of cancerous cell in (for example 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more) tumor; To reduce the size of tumor; To reduce tumor load; Go among the peripheral organ to suppress (promptly be reduced to a certain degree and/or stop) cancer cell infiltration; To reduce tumor medium vessels density; To suppress neoplasm metastasis; To reduce or inhibition tumor growth or tumor cell proliferation; To reduce or prevention dormancy growth of tumor; To reduce or to prevent the growth or the propagation of micrometastasis; Regrowth (for example in complementary therapy) with minimizing or prophylactic treatment or removal back tumor; To increase or to prolong DFS or the OS that easily suffers from or be diagnosed as the curee who suffers from tumor before benign, the cancer or non-metastatic or malignant tumor; To reduce the tumor size to allow operation (for example in neoadjuvant); And/or with one or more remissions that will be relevant with cancer to a certain degree.In other the embodiment, can use of generation or the recurrence of VEGF specific antagonists at some with cancer among the prevention curee.In an example, after about 4 years in curee colony the prevention of assessment cancer recurrence with confirm colony at least about 80% in no palindromia generation.In another example, the prevention of assessment palindromia in the time of about 3 years is wherein compared with the curee who treats with chemotherapy separately, and palindromia has descended at least about 50%.

In an example, use for example VEGF antibody of VEGF specific antagonists, wherein about 2 to 5 years assessment DFS or OS after the initial application of antibody with the amount of effective prolongation DFS or OS.In certain embodiments, about 3-5, about 4-5 or after treatment beginning back or initial diagnosis at least about 4 years or at least about the DFS or the OS that assessed the curee in 5 years.

In one embodiment, the present invention can be used to increase easy trouble or be diagnosed as existence persistent period of the curee who suffers from tumor before benign, the cancer or non-metastatic.The existence persistent period is defined as being administered to from the first time of medicine the time of death.Also can measure the existence persistent period than the stratified hazard ratio (HR) of matched group by the treatment group of representing patient's dead risk during treating.

In another embodiment, one group of curee that treatment of the present invention has increased easy trouble significantly or has been diagnosed as the treatment of the various anti-cancer therapies of the usefulness of suffering from cancer is the responsiveness in the human patients for example.Responsiveness is defined as treatment is had the percentage of patients of being treated of response.In one aspect, compare with independent group with operation, X-ray therapy or chemotherapy treatment, the combined therapy of the present invention of use VEGF specific antagonists and operation, X-ray therapy or one or more chemotherapeutants has increased the responsiveness in subject patient's group significantly, and described increase has the card side p value less than 0.005.

The generation of tumor, dormancy tumor or micrometastasis or the treatment of recurrence or prevention relate to usually in tumor initial treatment or removal (for example using anti-cancer therapies such as operation, chemotherapy or X-ray therapy) back prophylaxis of tumours and micrometastasis formation.Operation can stay the tubercle of the micrometastasis of residual tumor cell or dormancy, and it has and reactivates " angiogenesis program " and promote the more potentiality of the tumor growth of multi index option level.Although the existence of dormancy tumor or micrometastasis may not be to use clinical measurement or screening method detectable, it is to be enough to prevent or to reduce to use the amount of the known technology for detection of clinician to dormancy tumor, micrometastasis, transfer or tumor recurrence that amount is gone up effectively in treatment.In an example, after will the patient by exenterate oncotherapy tumor with the treatment of VEGF specific antagonists and along with the detection of time supervision dormancy tumor, micrometastasis or tumor recurrence.Can and a kind of or all two kinds of therapies can be continued as maintenance therapy VEGF specific antagonists and another kind of anti-cancer therapies (for example before the VEGF specific antagonists, simultaneously or afterwards) combined administration.

The measuring method of other that treatment is renderd a service in the treatment of cancer is described in No. the 20050186208th, the U.S. Patent Application Publication.

Use conventional method known in the art, active component by will having needed purity mixes with optional physiologically acceptable carrier, excipient or stabilizing agent prepare the preparation for the treatment of (Remington ' s Pharmaceutical Sciences (Lei Mingdun pharmaceutics) (the 20th edition), A.Gennaro edits, 2000, Lippincott, Williams ﹠amp; Wilkins, Philadelphia, PA).Acceptable carrier comprises saline or buffer agent for example phosphate, citrate and other organic acid; Antioxidant comprises ascorbic acid; The polypeptide of low-molecular-weight (being less than about 10 residues); Protein is serum albumin, gelatin or immunoglobulin for example; Hydrophilic polymer is polyvinylpyrrolidone for example; Aminoacid is glycine, glutamic acid, agedoite, arginine or lysine for example; Monosaccharide, disaccharide and other carbohydrates comprise glucose, mannose or dextrin; Chelating agen is EDTA for example; Sugar alcohol is mannitol and Sorbitol for example; The salt formation equilibrium ion is sodium for example; And/or non-ionic surface active agent TWEEN for example ^TM, PLURONICS ^TMOr PEG.

Randomly, but preferably, preparation preferably contains pharmaceutically acceptable salt with about physiological concentration, typically, and sodium chloride for example.Preparation randomly of the present invention can contain pharmaceutically acceptable antiseptic.In some embodiments, concentration of preservatives is changed to 2.0% (being generally v/v) from 0.1%.Suitable preservatives comprise in the pharmaceutical field known those.Benzyl alcohol, phenol, metacresol, methyl hydroxybenzoate and propylparaben are the examples of antiseptic.Randomly, the concentration that preparation of the present invention can 0.005% to 0.02% comprises pharmaceutically acceptable surfactant.

The preparation of this paper also can comprise the reactive compound to essential more than one of the specific indication for the treatment of, and what preferably have complementary activity does not have those of adverse effect each other.These molecules are suitably to be present in the combination institute's effective amount of intended purposes.

Also active component can be embedded into the microcapsule that for example passes through condensation technique or prepare by interfacial polymerization, for example respectively in hydroxy methocel or gelatin-microcapsule and poly-(methylmethacrylate) microcapsule, be embedded in colloid drug delivery system (for example liposome, albumin microsphere, microemulsion, nano-particle and Nano capsule) or the thick emulsion.These technology are disclosed in Remington ' sPharmaceutic Sciences (Lei Mingdun pharmaceutics), as above in.

Can prepare sustained release formulation.The example that is fit to of sustained release formulation comprises the semi permeability substrate of the solid hydrophobic polymer that contains antibody, and this substrate is for example form of thin film or microcapsule of formed article.The example that continues the substrate of release comprises polyester, hydrogel (for example poly-(2-ethoxy-methacrylate) or poly-(vinyl alcohol)), polyactide (United States Patent (USP) the 3rd, 773, No. 919), L-glutamic acid and the copolymer of γ ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-ethanol copolymer LUPRON DEPOT for example ^TM(the injectable microsphere of forming by lactic acid-ethanol copolymer and leuprorelin acetate) and poly--D-(-)-3-hydroxybutyric acid.Though polymer for example ethylene-vinyl acetate and lactic acid-ethanol can discharge molecule and surpasses 100 days, some hydrogel discharges protein with the short time period.When encapsulated antibody stays in the body for a long time, but, cause the possible variation on bioactive forfeiture and the immunogenicity as their variabilities or the polymerization as a result that are exposed to aqueous vapor at 37 ℃.Depend on related mechanism, can be the stable reasonably strategy that proposes.For example, if finding flowcollector aggregation scheme FlowCollector is to exchange intermolecular S-S key by sulfur-disulphide to form, so can by modify sulfhydryl residue, from the acid solution lyophilizing, control moisture, use proper additive and develop specific polymer matrix composition and reach stable.

In accordance with known methods to the curee for example human patients use VEGF specific antagonists of the present invention, known method for intravenous for example use (such as annotating) or the lasting infusion by a period of time for group, by in intramuscular, intraperitoneal, the marrowbrain, in subcutaneous, the intraarticular, synovial membrane, in the sheath, oral, part or inhalation route uses.If a large amount of side effect or toxicity are relevant with the VEGF antagonism, local application especially needs so.Stripped strategy also can be used to treatment and use.Stripped strategy relates to the polynucleotide transfection of coding VEGF antagonist or transforms the cell that obtains from the curee.Afterwards the curee is returned in transfection or cell transformed.But any in the cell various kinds includes but not limited to hematopoietic cell (for example medullary cell, macrophage, mononuclear cell, dendritic cell, T cell or B cell), fibroblast, epithelial cell, endotheliocyte, keratinocyte or myocyte.

For example, if the VEGF specific antagonists is an antibody, can come administration of antibodies by any suitable mode so, that described mode comprises is parenteral, subcutaneous, endoperitoneal, in the lung and intranasal, and local immunity suppression therapy if desired, then use in lesion.The parenteral infusion comprises intramuscular, intravenous, intra-arterial, intraperitoneal or subcutaneous administration.In addition, antibody is fit to especially use with the antibody dosage that reduces gradually by the pulsed infusion.Preferably, by injection, most preferably by intravenous or subcutaneous injection administration, this part ground depends on that use short-term or secular.

In another example, when the disease of tumor or position allow, can for example pass through direct injection local application VEGF specific antagonists chemical compound, and can periodically repeat to inject.In order to prevent or to reduce local recurrence or transfer, the local recurrence of for example dormancy tumor or micrometastasis or transfer also can systematically be sent the VEGF specific antagonists or directly tumor cell for example be sent the VEGF specific antagonists to tumor or tumor bed the curee after ocal resection the curee.

Selectively, inhibition nucleic acid molecules or the polynucleotide that contain the nucleotide sequence of coding VEGF specific antagonists can be delivered to curee's suitable cell.In certain embodiments, nucleic acid can be delivered to tumor itself.

Can nucleic acid be introduced in the cell by any method that is suitable for employed carrier.Many this methods are to know (people Recombinant DNA (recombinant DNA) such as people such as Sambrook and Watson, the 12nd chapter, the 2nd edition, Scientific AmericanBooks, 1992) as mentioned in this area.The example of gene delivery method comprises liposome-mediated transfection, electroporation, calcium phosphate/deae dextran method, particle gun and microinjection.

IX. combination treatment

The present invention also with the combination of using two or more VEGF specific antagonists of the present invention or at least a VEGF specific antagonists and one or more other anti-cancer therapies be combined as feature.The example of anti-cancer therapies includes but not limited to the combination of operation, X-ray therapy (actinotherapy), biotherapy, immunotherapy, chemotherapy or these therapies.In addition, can be used in combination cytotoxic agent, anti-angiogenic agent and antiproliferative with the VEGF specific antagonists.

In an example, the VEGF specific antagonists is used as the definitiveness operation complementary therapy of the treatment of the cancer of non-metastatic afterwards.In this example, can with or do not provide VEGF specific antagonists with at least a other chemotherapeutant.

In another example, the VEGF specific antagonists is used as the neoadjuvant of the treatment of the cancer that can perform the operation before the operation.In this example, can be before operation with or do not provide VEGF specific antagonists with at least a other chemotherapeutant.

In an example, the present invention is feature with VEGF specific antagonists and using together of one or more chemotherapeutants (for example mixture).The limiting examples of chemotherapeutant comprises Irinotecan, fluorouracil, formyl tetrahydrofolic acid or its any combination.The using of combination comprises uses when using preparation separately or single medicine preparation and with the continuous administration of arbitrary order, wherein preferably for some time two kinds of (or all) activating agents bring into play their biological activity simultaneously.Can or rule of thumb come to determine to use the preparation and the administration time table of this chemotherapeutant by skilled practitioners according to the operation instructions of manufacturer.Chemotherapeutic preparation and administration time table also are described in Chemotherapy Service (chemotherapy service), and M.C.Perry edits, Williams ﹠amp; Wilkins, Baltimore is among the Md. (1992).Chemotherapeutant can be before or after the using of VEGF specific antagonists, or provide simultaneously with it.

The preparation of this paper also can comprise the reactive compound to essential more than one of the specific indication for the treatment of, and what preferably have complementary activity does not have those of adverse effect each other.For example can wish in a kind of preparation, further to provide with EGFR, VEGF (for example with VEGF go up the different bonded antibody of epi-position), VEGFR and ErbB2 (for example

) bonded antibody.In an exemplary, the compositions of VEGF specific antagonists (does not for example comprise anti-ErbB antibody or its fragment or derivant

Antibody).Selectively, or in addition, compositions can comprise cytotoxic agent, cytokine, growth inhibitor and/or micromolecule VEGFR antagonist.These molecules are suitably to be present in the combination the effective amount of desired purpose.

In order to prevent or treat disease, the suitable dosage of VEGF specific antagonists will depend on the severity of disease type to be treated (as hereinbefore defined), disease and process (no matter be for prevent or the purpose for the treatment of and use the VEGF specific antagonists), before therapy, patient's clinical history and to the response of VEGF specific antagonists, and attending doctor's judgement.Be fit to disposable or the patient used the VEGF specific antagonists through a series of treatment.In the combination treatment scheme, VEGF specific antagonists of the present invention and one or more anticancer therapeutic agents are used to treat effective or collaborative amount.As used herein, in the treatment effectively amount be VEGF specific antagonists and one or more other treatment agent co-administered or compositions of the present invention use the minimizing that causes cancer as described above or those amounts of inhibition.Collaborative amount is the VEGF specific antagonists essential concerning reducing or eliminating situation relevant with specified disease and symptom synergistically or significantly and the amount of one or more other treatment agent in the treatment.

Can be enough to reduce or eliminate the amount of the generation of tumor, dormancy tumor or micrometastasis or recurrence and time simultaneously or use VEGF specific antagonists and one or more other treatment agent successively.Can be used as maintenance therapy and use VEGF specific antagonists and the probability of one or more other treatment agent with prevention or minimizing tumor recurrence.

Can with the VEGF specific antagonists separately packing or with other anticancer therapy chemical compound assembly packagings be medicine box.Medicine box can comprise that help for example makes the IV delivery system, inhaler etc. of syringe, the customization of bottle that powder type reconstitutes, injection to the optional assembly of patient's administration of unit doses.In addition, the unit dose medicine box can comprise preparation of compositions and the description of using.Medicine box can be fabricated to the nonrecoverable unit dose of a routine patient, particular patient and repeatedly use (can on rendeing a service, change with the therapy progress) with constant dosage or wherein individual compound; Perhaps medicine box can comprise the multidose (" big packing ") that is suitable for the many cases patient is used.Can be in carton, blister package (blister pack), bottle, pipe and analog with the medicine box assembly set.

X. manufacture

In another embodiment of the invention, provide the manufacture that contains the useful material of above-described treatment of conditions.Manufacture comprises container, label and packing attached sheet (packageinsert).The container that is fit to comprises for example bottle, bottle, syringe etc.Container can for example glass or plastics form by various materials.Container be equipped with to treatment illness effective composition and can have aseptic enter hole (access port) (but for example container intravenous solution bag or have can be by the bottle of the stopper of subcutaneous injection needle-penetration).At least a activating agent in the compositions is a VEGF antibody.On the container or container with label indication compositions be used to treat special illness.Manufacture can further comprise second container, and this container contains pharmaceutically acceptable buffer agent for example phosphate buffered saline (PBS), Ringer's mixture and glucose solution.It can comprise further that other for commercial and the needed material of user position, comprise other buffers, diluent, filter, pin and syringe.In addition, manufacture comprises the packing attached sheet with operation instructions, and it for example comprises the warning about compositions and another kind of combination of compositions not being used; Or instruct the user of compositions that the VEGF antibody compositions is used the patient separately or with the anti-cancer composition combination.Term " operation instructions " means by any way, for example provides guidance to spendable therapy, medicine, treatment, therapeutic scheme and analog with the form of file such as the form with packing attached sheet or other written publicity materials.

X. the preservation of material

Following hybridoma cell line according to the regulation of budapest treaty by American type culture collection (ATCC), Manassas, VA, USA preservation.

Antibody label ATCC numbers preservation date

A4.6.1 ATCC HB-10709 on March 29th, 1991

Embodiment

The inhibition of embodiment 1.VEGF-A causes checking and Apc of enteric adenoma growth ^Min/+The long term survival of mice

The syndrome of familial adenomatous polyposis (FAP) and most of sporadic colorectal carcinoma are caused by the sudden change in the apc gene.Outside the tumor, FAP patient has grown up to a hundred to thousands of adenomatous polyp in their lower end gastrointestinal (GI) road except the colon that comprises upper end gastrointestinal fibroma durum and tumor.The truncate allelic Apc of heterozygosity with codon 850 places ^Min/+Mice has been simulated some feature people such as (, Science 247:322-324 (1990), people such as Su, Science 256:668-670 (1992)) Moser of polyposis with the FAP patient who kind is the APC sudden change.Apc ^Min/+Beginning that tumor forms in the mice is to grow 60-150 polyp intestinal under grow up early stage and the genetic background of animal at C57BL/6 usually.Tumor is grown and to be caused mouse life to be badly damaged, usually about five months age because anemia and/or hypoproteinemia cause death people such as (, Science 247:322-324 (1990)) Moser.Although suffer from human adenoma of colon, the Apc of growing usually of FAP ^Min/+Mice is because the former thereby polyp of also fully the not understanding growth overwhelming majority in small intestinal.These polyps reach the size of diameter 1-2mm, and big more polyp (diameter reaches 4mm) occurs with low more frequency.Only observe adenoma of colon once in a while, every animal 0-3 usually.

Reported that Apc participates in comprising the cell processes (at Nathke, summary among the Annu.Rev.Cell.Dev.Biol.20:337-366 (2004)) of propagation, apoptosis, cell migration, cell adhesion, microtubule assembling, signal conduction and chromosome separation.The research of Apc function the most completely is its effect (at Nathke, summary among the Mol.Pathol.52:169-173 (1999)) as the regulon that beta-catenin is white on the Wnt signal path.Briefly, under the situation that lacks the Wnt signal transduction, Apc combines to form the white destructive complex of cytoplasmic beta-catenin with axle albumen (axin) and GSK-3 beta kinase, stops the activation subsequently of T cytokine/lymph enhancer (TCF/LEF) family of its nuclear translocation and transcription factor thus.The target of transcribing of TCF/LEF comprises the molecule that participates in cell pathway mentioned above.

The mechanism of tumor growth has some defectives in the research xenograft, because the tumor that these models can not reproduce under the natural environment is grown.In order to check anti-angiogenic therapy to the easily effect of the non-malignant tumors model of trouble in the abiogenous heredity, we have studied the Apc of enteraden tumor ^Min/+Model.In the following example, after carrying out short-term and secular processing and in enterocyte, pass through the Cre-LoxP technology with VEGF-A genetic defect post analysis Apc with the promptly anti-VEGF-AmAb of exemplary VEGF specific antagonists ^Min/+The tumor phenotypes of mice.

For hereinafter described experiment, (Bar Harbor ME) obtains Apc from The Jackson Laboratory ^Min/+Mice (stock's numbering 002020,5) and 12.4KbVilCre mice (after this stock's numbering 004586 is VillinCre, people such as Madison, J.Biol.Chem.277:33275-33283 (2002)).VEGF is disclosed before ^Lox/loxMice (is later on VEGF ^Lox) (people such as Gerber, Development 126:1149-1159 (1999)).Be housed in mice in little isolator cage (micro isolator cage) in the barrier facility and random feeding.The maintenance of carrying out animal and the experimental program ratified according to federal government's regulations and Institutional Animal Care and Use Committee (management of laboratory animal with use committee).

Apc ^Min/+The expression of VEGF-A in the enteric adenoma

In order to study Apc ^Min/+The expression pattern of VEGF-A in the intestinal neoplasms of mice, we have carried out in situ hybridization on the adenoma from big mice of 14 weeks.For these experiments, as described in situ hybridization people such as (, Am.J.Pathol.162:1881-1893 (2003)) Ferrara that carries out in the early time.Briefly, the formalin fixed of neutral buffered, dehydration and paraffin-embedded intestinal tissue section is deproteinization took off paraffin and hydration before 15 minutes in 37 ℃ of 20 μ g/ml E.C. 3.4.21.64.Will [ ³³P] the have justice and the antisense RNA probes (riboprobe) of UTP labelling spend the night in 55 ℃ of hybridization, high stringency cleaning 2 hours in 55 ℃ of standard saline citrates at 0.1X afterwards.Exsiccant microscope slide is exposed to Kodak BioMax MR autoradiography film (Eastman Kodak Co. in room temperature, Rochester, NY) 3 days, afterwards film is steeped in NTB2 nuclear-track emulsion (Eastman Kodak Co.), exposure is 28 days in the plastic slide box of 4 ℃ of sealings that containing desiccant, develop, and with (haematoxylin Yihong) H﹠amp; E redyes.Prepare VEGF-A probe (people .Am.J.Pathol.162:1881-1893 (2003) such as Ferrara) as previously described.Corresponding to the nucleotide 297-645 of NM_031836, the VEGF-A probe length is 349 nucleotide.The forward primer sequence is 5 '-CAA CGT CAC TAT GCA GAT CATGCG (SEQ ID NO:1); The downstream primer sequence is 5 '-GGT CTA GTT CCC GAAACC CTG AG (SEQ ID NO:2).

In these hybridization in situ experiment, compare with normal bowel chorioepithelium cell and in epithelial cell, to observe VEGF-A and express with varying strength, in the substrate of the stromal cell of adenoma and normal fine hair, observe the outstanding signal of focus (Figure 1A-F) simultaneously.

The inhibition of VEGF-A reduces Apc ^Min/+The tumor load of mice

For determining whether anti-VEGF-A therapy is effective to the tumor load that reduces optimum intestinal neoplasms in the mice, and we have handled Apc in order to the mAb G6-31 of the anti-VEGF-A of mice-human chimeric form (bringing out the probability of immune response with reduction) ^Min/+Mice.The mAbG6-31 of anti-VEGF-A comes freely (people .J.Biol.Chem.281:951-961 (2006) such as Liang) described human Fab phage library.For generation is suitable for the antibody used in the mice midium or long term, variable domains is grafted in the Muridae IgG2a constant domain.The contrast Muridae IgG2a (anti-GP120) of mAb G6-31 people such as (, J.Biol.Chem.281:951-961 (2006)) Liang or isotype coupling is used with the weekly intraperitoneal of volume that is dissolved in 90-140 μ l among the PBS with the dosage of 5mg/kg.To handle continued for 3 weeks, 6 weeks, up to 1 year, or up to finding that mice is dying.Began the processing of 5-14 mice of each group when big at 91 ± 3 days.

We select mAb G6-31 to be because it blocks ability people such as (, J.Biol.Chem.281:951-961 (2006)) Liang of mice and human VEGF-A forcefully.This with suppress human but do not suppress the mAb of anti-VEGF of well-characterized of mice VEGF-A A.4.6.1 different people such as (, Cancer Res.60:6253-6258 (2000), people such as Liang, J.Biol.Chem.281:951-961 (2006)) Gerber.In order to assess the short-term effect of mAb G6-31, begin the processing of every group of 10 mices and continued for 3 or 6 weeks when big in 13 weeks to tumor load.The tumor phenotypes at age when determine handling beginning is analyzed 12 mices of untreated matched group when 13 weeks big (the 0th days).

MAb processing with anti-VEGF-A significantly reduced Apc in 3 or 6 weeks ^Min/+Total tumor load in the mice.In the time of the 0th day, Apc ^Min/+The average tumor load of mice is 39.3mm ³(from 12.3mm ³Change to 97.0mm ³) (Fig. 2 A).The average tumor load of handling the mice in three weeks with contrast IgG is 96.8mm ³(47.1-299.9mm ³), and the average tumor load of handling the mice in 3 weeks with mAb G6-31 is 23.5mm ³(4.5-58.2mm ³).Average tumor load has on the statistics significant 76% minimizing or reduces to 1/4, p＜0.008 when mAb G6-31 handles.After IgG used for 6 weeks with contrast, tumor load reached 198.6mm ³Meansigma methods (40.5-315.7mm ³), and still be low to moderate 28.4mm with the tumor load in the mice of mAb G6-31 processing ³(3.2-75.9mm ³), show the minimizing of significant 86% on the average tumor load or reduce to 1/7, p＜5.3x10 ^-5(Fig. 2 A).

Descend with respect to the adenoma number, handling the remarkable decline of tumor load afterwards of three and six weeks with mAb G6-31 is because the adenoma size descends.After IgG handled for three weeks with contrast, the average tumor number be 116 ± 9 (± SEM), and mAb G6-31 to use back average tumor number be 107 ± 11 (p＜0.28).After IgG handled for six weeks with contrast, the average tumor number was 120 ± 11, and it is 100 ± 10 (p＜0.09) and mAb G6-31 uses the back.In the time of the 0th day, mice has the meansigma methods of 100 ± 9 tumors.

In order to analyze tumor size and number, the intestinal from glandular stomach to rectum vertically to be opened, rinsing is also open and flat on filter paper.With Notox Histo fixative (Scientific Design Laborator Inc., Des Plaines, IL) fixedly spend the night and with after the dyeing of the aqueous solution of methylene blue 0.1%, the number of each enteric adenoma of small intestinal and large intestine, position and diameter by single to handle unwitting observer under the amplification of 20X on the Leica anatomic microscope by eyepiece scale counting.By this method, reliable recording has the polyp of 0.3mm or bigger diameter.Calculate gross tumor volume with hemisphere.The tumor load of every mice is calculated as the summation of its gross tumor volume.The P value is calculated in Student ' s t check with two tails.As the contrast of the mice of antibody treatment, when handling the age (13 week) of beginning, analyze the mice (the 0th day) of non-processed group.

The adenoma growth does not escape the evidence that anti-VEGF-A handles during the processing in 3 or 6 weeks: with size distribution (Fig. 2 B of the broad of the tumor of the mice of handling with contrast IgG, from the top second with the 4th diagram) compare, has size distribution (Fig. 2 B, centre and lower illustration) more closely with the tumor in the mice of mAb G6-31 processing.To use average polyp diameter in the mice in three weeks be 1.28mm and be 0.85mm (p＜9.2x10 with mAb G6-31 with contrast IgG ^-117), and to use average polyp diameter in the mice in six weeks be 1.64mm and be 0.86mm (p＜2.7x10 with mAb G6-31 with contrast IgG ^-214).The average tumor diameter is 0.97mm in the time of the 0th day.

What is interesting is that as if anti-VEGF-A handle the growth that suppresses all size tumor.Use after the 3 weeks processing of mAb G6-31, (diameter 0.3-1.0mm is for handling in 6 weeks for little tumor, 0.3-1.2mm) the group of frequency ratio control treatment in height, (for 6 weeks, the frequency of＞1.2mm) tumor has reduced (Fig. 2 C, top and central illustration) greater than the 1.0mm diameter and have.Tumor size distribution during with the 0th day (Fig. 2 C, bottom diagram) comparison shows that mAb G6-31 use beginning the time adenoma growth checked basically.

And the mAb G6-31 of anti-VEGF-A is effective to the adenoma growth that suppresses in all small intestinal zones.After the treatment in three and six weeks, handle to compare with contrast IgG and when mAb G6-31 handles, observe significantly reduced average tumor diameter (Fig. 2 D).Observed (double asterisk among Fig. 2 D) significantly reduces mice when in addition, the average adenoma diameter in first intestinal, 1/4th districts of the mice of handling with mAb G6-31 was from the 0th day.The minimizing of the average tumor diameter of adenoma of colon does not reach statistical significance (Fig. 2 D).The average diameter of handling colorectal polyp in the mice in three weeks with mAb G6-31 be 1.3 ± 0.3mm (± SEM), and the average diameter in the mice that contrast IgG handles is 2.5 ± 0.4mm, has p＜0.064.The average diameter that mAb G6-31 handles the large bowel neoplasm after six weeks be 2.2 ± 0.3mm and use with contrast IgG after be 2.6 ± 0.3mm, have p＜0.37.

The disappearance of VEGF-A reduces the average tumor diameter in the enterocyte

Next we will scrutinize at Apc ^Min/+The contribution that the VEGF-A that originates from enterocyte in the model grows adenoma.For this purpose, as described above, at big Apc of 13 weeks ^Min/+Diameter of tumor and number have been assessed in the mice, described mice and the mice (VEGF that wherein in enterocyte, has lacked VEGF-A conditionally with the Cre/loxP technology ^LoxThe Villin-Cre mice) hybridization.Analyze Apc when big in 13 weeks ^Min/+Villin Cre and Apc ^Min/+VEGF ^LoxThe Villin-Cre mice.

Embryo in the back gut entoderm that is expressed in intestinal of villin (the primary structure component of the brush border of actin binding protein and special absorptive cell) began between the emergence period, and extend through the entoderm (people such as Braunstein of small intestinal and large intestine afterwards, Dev.Dyn.224:90-102 (2002), people such as Ezzell, Development 106:407-419 (1989), people such as Maunoury, EMBO is people such as (1988) and Maunoury J.7:3321-3329, Development115:717-728 (1992)).In adult, people such as (, Proc.Natl.Acad.Sci.82:8488-8492 (1985)) Robine filled the air in distribute strong polarization and becoming in the brush border of the polarization of gentle top and the cell of differentiation fully of lining in intestinal villi in the immature proliferating cells along with crypts of villin.The previous expression that has characterized by the Cre recombinase (Villin-Cre) of villin promoters driven, reproduced from the crypts to the fluff tip and the people such as villin expression of gene pattern Madison of duodenum to each cell of the epithelium of the intestinal of colon J.Biol.Chem.277:33275-33283 (2002).

Phenotype analytical shows contrast Apc ^Min/+The average tumor diameter of Villin-Cre mice be 1.02 ± 0.3mm (± SEM), and Apc ^Min/+VEGF ^LoxThe average tumor diameter of Villin-Cre mice is 0.82 ± 0.3mm (Fig. 2 E), has shown minimizing (p＜7.2x10 of 19.8% ^-5).The tumor number does not have significant difference between two groups.Work as Apc ^Min/+When the Villin-Cre mice has 137 ± 11 enteric adenomas, Apc ^Min/+VEGF ^LoxThe Villin-Cre mice has 150 ± 17 adenomas (p＜0.27).

These data show from duodenum to colon and the disappearance of the VEGF-A of crypts to all enterocytes of fluff tip causes the remarkable inhibition of tumor growth, descend although compare degree with the inhibition that systemic application from anti-VEGF-A antibody obtains.Therefore, these data suggest the VEGF-A of epithelium external source to Apc ^Min/+The growth of the enteric adenoma of mice has contribution.

The inhibition of VEGF-A has prolonged Apc ^Min/+The intermediate value life cycle of mice

Consider the effectiveness of anti-VEGF-A treatment in tumor growth suppresses, whether we want to study the processing of using mAb G6-31 can be Apc ^Min/+Mice produces long-term benefit.For this purpose, using of mAb G6-31 or contrast IgG continued up to 52 weeks or dying up to observing mice.What is interesting is, mAb G6-31 handle with intermediate value life cycle from using 33.6 weeks of using mAb G6-31 that were increased in 24.0 weeks of contrast IgG, have sequential p＜2.4x10 ^-3(Fig. 2 F).

Tumor phenotypes when four mices using mAb G6-31 to handle at the age euthanasia post analysis in 32,51,64 or 66 weeks (respectively after handling for 19,38,51 or 53 weeks) with mAb G6-31.As shown in table 1, the average tumor diameter still with the level of being on close level seen in 19 weeks big mices (handle in the mice in six weeks is 1.64mm with contrast IgG).Similarly, the tumor number still with the tumor number quite (the group mice had the meansigma methods of 59-161 enteric adenoma and 100 in the 0th day) of big mice of 13 weeks.Three (each one of the 2nd, 3 and No. 4 mice of table 1) in 15 adenoma of colon (total number of differentiating among the mice 1-4) of finding on the plane of cutting into slices in the fabric analysis show there is not virulent transformation.

Table 1. is about the tumor data of the mice of G6-31 long-term disposal

* test terminal point by the animal of the health of euthanasia

Generally speaking, secular anti-VEGF-A handles normally well tolerable and has produced the Apc that increases ^Min/+The life cycle of mice.And, consistent with the new inhibition that adenoma forms and adenoma is grown, in view of the mice age, keep very lowly with the equal diameter of tumor of tumor number peace in the mice of mAb G6-31 long-term disposal.

At the Apc that handles with anti-VEGF-A ^Min/+The extramedullary hematopoiesis of spleen effect of normal total serum protein, albumin and triglyceride level and minimizing in the mice

As common observation, with the Apc of mAb G6-31 processing ^Min/+Mice is than the vigilance and much responsive more that seems with the mice that contrasts the IgG processing.And in the animal of handling, observe pale pawl regularly with contrast IgG, make and to associate at first by the carrying out property anemia of people such as Moser report (people such as Moser, but in the animal of handling, do not observe Science 247:322-324 (1990)), with mAb G6-31.Conform to this observed result, with contrasting the Apc that IgG uses ^Min/+Average total serum albumen of mice and serum albumin descend, and are in normal range (table 2) with total protein and albumin level in the mice of mAb G6-31 processing.

Table 2. serum chemistry

* reference value 3.9-5.5g/dl

* reference value 2.3-3.2g/dl

* * reference value 35-244mg/dl

The standard error of ± meansigma methods (SEM)

As about Apc ^Min/+(the people such as Moser that mice is reported, Science 247:322-324 (1990)) and consistent with hypoproteinemia, in the animal of handling with contrast IgG, average triglyceride level has raise, yet it is reduced to the level (table 2) suitable with reference value when handling with mAb G6-31.

Although after the processing in three or six weeks, there is not the difference not relevant on the body weight with processing, the quality of average spleen significantly increases (p＜2.3x10 in the mice of handling with contrast IgG ^-3).After IgG used for three weeks with contrast, mice had 1.17% average spleen quality of 0.26g or body weight, was 0.11g (body weight 0.49%) and handle average spleen quality in the mice in three weeks with mAb G6-31.With the increase and extramedullary hemopoiesis effect (EMH, compensatory erythropoiesis are secondary to enterorrhagia in this example) unanimity of average spleen quality in the mice of contrast IgG processing, its histological examination by spleen is confirmed.Ten that handle in ten mices in 6 weeks with contrast IgG demonstrate significant EMH, and two EMH that mice has moderate that handle with mAb G6-31, five have slight EMH and three diagnosis variations in their spleen.Be diagnosed as the slight EMH widely that arrives in the spleen with four in mAbG6-31 five mices in 18 to 53 weeks of processing.

The EMH than low degree in the spleen of the mice of handling with mAb G6-31 short-term illustrates that anti-VEGF-A therapy has reducing the favorable influence of enterorrhagia.

Variation with mAb G6-31 long-term disposal metanephros

In order to study the possible toxicity relevant, pancreas, liver and kidney have been carried out histologic analysis in short-term (3-6 week) and long-term (18-53 week) processing back with the mAb G6-31 that uses the anti-VEGF-A of high-affinity.In order to carry out histologic analysis, with the fixed intestinal tissue dehydration of Notox and be embedded in the paraffin, H﹠amp is also used in section; E dyeing is so that carry out histologic analysis by standard scheme.

Not to be noted significant toxicity in the animal of handling 3-6 week.After mAb G6-31 long-term disposal, in five mices five demonstrate the substrate edema (reflection hypoproteinemia) of the pancreas of the dispersivity ball glomerular sclerosis (diffuse global glomerulosclerosis) of variable (slight to serious) and moderate.These observed results are with consistent owing to the viewed toxicity of chronic administration mAb G6-31 before.Importantly, the overall improvement by the health of intermediate value reflection life cycle that increases surpasses side effect.

The tumor morphology that changes when mAb G6-31 handles is not followed the variation on the proliferation index

Handle back Apc in order further to characterize the mAb G6-31 that uses anti-VEGF-A ^Min/+Polyp intestinal in the mice, carrying out as described above macroscopic and histological analysis.The gross morphology of the polyp of handling with mAb G6-31 and gross morphology significantly different (Fig. 3 A-B) with the polyp of contrast IgG processing.Although come the tumor of the mice that personal contrast IgG uses to have intact relatively slick surface usually, the tumor of the animal of the mAb G6-31 that uses by oneself processing is showed in its surface and is had dark caving in.Histologic analysis shows that the tumor from the mice of mAb G6-31 and contrast IgG processing is canalicular adenoma (Fig. 3 C-F).Come the adenoma of the mice that personal contrast IgG handles to have epitheliosis in the significant fine hair, vertical and extend laterally, and usually from its bottom (base) to chamber surface broadening above twice.The fibre substrate that minimum is arranged.The adenoma of the mice that the mAb G6-31 that uses by oneself handles idiocratically has epithelial cell in the less fine hair, and width is narrower in the surface, chamber, and is more shallow and relate to the fine hair of less vicinity.The histologic analysis of the polyp of colon in two kinds of processed group demonstrates (pendunculated) canalicular adenoma that the base of a fruit is arranged of the dysplastic epithelium with a large amount of fiber vascular stromas and not commensurability (as many as 100%).

In order to assess the degree of the propagation in tumor tissues and the normal mucosa, carried out using the indirect immunohistochemical staining (Fig. 3 G-J) of Ki-67 antibody.For these experiments, Notox is fixed, as to dewater cuts into slices in 99 ℃ at Target Retrieval (DAKO with paraffin-embedded intestinal tissue, Glostrup, Denmark) take off paraffin and hydration before hatching in, stop endogenous peroxidase activity subsequently and block avidin and biotin (Vector, Burlingame, CA).With section further with 10% the sealing serum sealing that is dissolved in PBS 30 minutes with 3% bovine serum albumin.Tissue slice and the first antibody that is diluted in the sealing serum were hatched 60 minutes, clean and hatched 30 minutes with TBST buffer (DAKO) with second antibody, clean and in ABC Elite Reagent (Vector), hatched 30 minutes with TBST, afterwards at metal strengthening DAB (Pierce, Rockford is hatched and is redyed with the MayerShi haematoxylin in IL).Employed first antibody be rabbit polyclonal anti-Ki-67 (SP6,1: 200, Lab Vision, Fremont, CA).Employed second antibody be biotinylated goat antirabbit (7.5 μ g/ml, Vector).Carry out institute in steps in room temperature.

In the tumor of the mice that comes personal contrast IgG or handle with mAb G6-31, quantitative analysis shows the Ki-67 positive cell of analog quantity.Equally, the proliferation index of the mucosa of normal vicinity suitable (Fig. 3 K) between two kinds of processing.From using Ariol SL50 microscope slide scanning microscope system (Applied Imaging, Inc., San Jose, CA) the imagery exploitation Kisight of the paraffin section of 5 μ m of tumor tissues of Huo Deing and normal mucosa measures (Ariol Review (v2.6)) quantitatively proliferation index.Delimit the zone of tumor tissues and normal mucosa by the artificial discriminated union of unwitting examiner.Quantitative in automanual mode according to the definition of positive threshold value with being measured as Ki-67 positive cell nuclear phase based on the nucleus color for the proliferation index of total nuclear percentage ratio.The proliferation index measurement comprises 29 tumors in the mAb G6-31 processed group (n=3) of all handling for 6 weeks and contrasts the analysis of 44 tumors in the IgG group (n=3).

In order to detect the variation on the expression of molecular moiety whether growth inhibited by mAb G6-31 be accompanied by main signal transduction pathway, carried out western blot analysis.The mice that jejunum adenoma and normal contiguous mucosa are handled from mAb G6-31 and control antibodies with surgical knife is gathered and with the mechanical homogenate the RIPA lysis buffer of OMNI TH115 homogenizer.Employed first antibody be rabbit polyclonal anti-p38MAPK, phosphorus-p38MAPK, p42/p44MAPK, phosphorus-p42/p44MAPK, PTEN, Akt, phosphorus-Akt and phosphorus-GSK3 α/β (be 1: 1000, Cell Signaling, Danvers, MA).Employed second antibody be the horseradish peroxidase yoke anti-rabbit of closing (1: 5000, Chemicon).

Although the expression of many molecules of testing remains unchanged when handling with mAb G6-31, phosphorus (phospho)-p38MAPK level of observing among three in four tumor samples is restored (Fig. 3 L to the appropriateness of the level of being found in normal mucosa; P-p38 is with T5-T8 and N5-N8 contrast).

The tumor medium vessels density that mAb G6-31 handles reduces

Consider that known VEGF-A is the mitogen via the vascular endothelial cell of VEGFR-2 signal transduction, we are by checking the blood vessel network (Fig. 4 A-B) of tumor in the mice of handling with Mab G6-31 and contrast IgG to the immunohistochemical staining of thick tissue slice with the antibody of anti-CD31.Purpose for confocal microscopic imaging, with mice with 1% the paraformaldehyde (PFA) that is dissolved in PBS isoflurane (isofluorane) anesthesia down perfusion fix, intestinal is open and flat on filter paper, and be embedded in O.C.T. and fix with 4% PFA before freezing on the dry ice and in 4 ℃ of 30% sucrose that are being dissolved in PBS submergence spend the night.Carry out the lyophilizing section with 80 μ m, in 4% PFA, fix 10 minutes, change thoroughly, and sealed 30 minutes with the 5% normal lowlenthal serum that is dissolved in the PBS that contains 0.2%Triton-X-100 with the 0.2%Triton-X-100 that is dissolved in PBS.With first antibody overnight incubation in the sealing buffer, second antibody 5-6 hour, clean and with Hoechst 33342 (0.5mg/ml with PBS; Sigma, St.Louis MO) redyes.Employed first antibody is hamster monoclonal anti CD31 (1: 500, Chemicon, Temecula, CA), rat monoclonal anti E-cadherin is (1: 2500, Zymed, South San Francisco, CA) and the anti-smooth muscle actin of mouse monoclonal that closes of Cy3 yoke (1: 1000, Sigma).Employed second antibody be the anti-armenian hamster that closes of Cy5 yoke (1: 500, JacksonImmunoresearch, Cambridgeshire, UK) and the ALEXA 488 yokes Chinese People's Anti-Japanese Military and Political College Mus of closing (1: 500, Molecular Probes, Eugene, OR).

From (Thornwood NY) goes up in the digital picture that obtains quantitatively from Apc at Zeiss Axioplan2 fluorescence microscope with the CCD photographing unit ^Min/+Vessel density in the tumor of mice.Each group in four groups (handling the mice in 3 or 6 weeks with contrast IgG or mAb G6-31) is made up of two mices, and has analyzed 11-22 tumor from every group.Use ImageJ v.1.36 (http://rsb.info.nih.gov/ij/) calculate blood vessel area in the tumor biopsy of 80 μ m via the segmentation based on threshold value of the positive fluorescence of CD31.Afterwards vessel density is calculated as the ratio of the positive pixel of CD31 than overall tumor area.Will be from the value of all tumors of each group on average with the meansigma methods of generation group.

Comparing seen in the quantitative demonstration of vessel density and the mice of handling at contrast IgG, the vasculature part of the tumor of the mice of handling from mAb G6-31 reduces (Fig. 4 C).Using three all backs average tumor blood vessel area densities with contrast IgG is 23.2%, and it is reduced to 18.6% and use the back with mAb G6-31.The mean vascular area of handling the tumor in six weeks with contrast IgG is 25.5%, and the mean vascular area density of the tumor of the mice that the mAb G6-31 that uses by oneself handles is 19.7%.

Discuss

We use Apc ^Min/+Mice is with the effect of research VEGF-A in optimum intestinal neoplasms takes place.In first, contrived experiment is handled the effect of the enteric adenoma that builds up that experience is grown vigorously with measurement short-term and long-term anti-VEGF-A.We have showed that the mAbG6-31 processing with anti-VEGF-A has significantly reduced tumor load and prolonged Apc ^Min/+The life cycle of mice.

Diet and chemopreventive agent are comprised that nonsteroidal anti-inflammatory drug (NSAID) is to Apc ^Min/+Several studies (summarizing in people such as Corpet, among the CancerEpidemiol.Biomarkers Prev.12:391-400 (2003)) has been carried out in the effect of the tumor load of mice, Http:// corpet.net/minIts up-to-date tabulation is arranged.Many remarkable declines of having reported on the tumor number in these researchs.Except the celecoxib (people such as Jacoby for example of cox 2 inhibitor optionally, Cancer Res.60:5040-5044 (2000)) and A-285969 (people such as Wagenaar-Miller, Br.J.Cancer88:1445-1452 (2003)), for example piroxicam and sulindac (it is a target with COX-1 and COX-2) are suppressing Apc to NSAID ^Min/+(people such as Boolbol among the most strong dose that tumor forms in the mice, Cancer Res.56:2556-2560 (1996), people such as Chiu, Cancer Res.57:4267-4273 (1997), people such as Hansen-Petrik, Cancer Lett.175:157-163 (2002), people such as Ritland, Carcinogenesis 20:51-58 (1999)).Also successfully used therapeutic alliance to reduce the tumor number.People such as Torrance utilize the combination of special epidermal growth factor receptor inhibitor EKI-785 and sulindac and have shown and almost completely eliminate tumor number people such as (, Nat.Med.6:1024-1028 (2000)) Torrance.Similarly, the synergy of chemotherapeutant Raltitrexed (RTX) and 5-fluorouracil (FU) causes Apc ^Min/+The significantly reduction of (37%) of number of tumors purpose people such as (, Cancer Biol.Ther.3:1169-1176 (2004)) Murphy.Recently, the short-term of receptor tyrosine kinase (RTK) inhibitor AZD2171 is used and is demonstrated at Apc ^Min/+Reduce tumor load (people such as Goodlad, Carcinogenesis27:2133-2139 (2006)) in the model.They notice and use early handling beginning (when 6 weeks) and can reducing the tumor number of AZD2171, and later intervention (when 10 weeks) only reduce the tumor size (people such as Goodlad, as above).Yet, handle to not effect of vessel density (people such as Goodlad, as above).AZD2171 suppresses some RTK, includes but not limited to VEGFR-1 ,-2 and-3 (people such as Wedge, Cancer Res.65:4389-4400 (2005)).

As if the Mab G6-31 that we observe the anti-VEGF-A that uses the time in 13 weeks does not reduce the number of existing tumor, but it has reduced the tumor size and has suppressed the formation of new adenoma.These results are with life cycle, upward observed increase was relevant.Yet, we believe anti-VEGF specific tumour prevention method (handle beginning early) may be comparable in our research employed tumor interference method (it is later to handle beginning) more effectively to reduce the tumor number be possible.In any case it is all effective that anti-VEGF specificity is suppressed at all periods of tumor growth.

Our research shows that at last targeting VEGF-A is at Apc ^Min/+Be enough to obtain deep therapeutic effect in the model.VEGF-A with Mab G6-31 system suppresses and Apc ^Min/+VEGF ^LoxIn the Villin-Cre mice only in the enteric epithelium compartment contrast to the genetic defect of VEGF-A show that except epithelial cell the VEGF-A in other cells sources is at Apc ^Min/+Play an important role in the adenoma growth.Other source of these of VEGF-A may comprise mononuclear cell (people such as Sunayama, Carcinogenesis 23:1351-1359 (2002)) and substrate fibroblast (people such as Seno, Cancer Res.62:506-511 (2002), (people such as Williams, J.Clin.Invest.105:1589-1594 (2000)).Our original position analysis demonstrates extra-epithelial VEGF-A expression in adenoma and the normal fine hair, supports described observed result.

Based on lot of data, the antitumous effect that can expect a large amount of viewed mAb G6-31 is the (people such as Wise by the inhibition of angiogenesis mediation, Proc.Natl.Acad.Sci USA96:3071-3076 (1999), people such as Zachary, Cardiovasc Res.49:568-581 (2001)).In fact, people such as (, Prostate 35:1-10 (1998)) Borgstrom supplied with and reduced to the blood vessel of having observed the anti-VEGF-A monoclonal antibody of response in tumor xenotransplantation research.Consistent with this, compare with the tumor of the mice that comes personal contrast IgG to handle, mAb G6-31 observes Apc after using for three and six weeks ^Min/+Minimizing on the blood vessel area density of enteric adenoma.

The significant accumulation of viewed adenoma less than 1mm shows at Apc when VEGF-A suppresses ^Min/+In the enteric adenoma of mice, as at Apc ^{δ 716}Seen in the model, angiogenic switch (angiogenic switch) can take place the angiogenic switch of growing than the common tumor of thinking more Zao people such as (, Cancer Res.62:506-5112002) Seno).

Important and beat all conclusion is that the monotherapy of the angiogenesis inhibitor of the single angiogenesis factor of targeting can suppress tumor growth efficiently and can produce the benefit of surviving in our research.As if this be to make tumor vessel " normalization " so that promote chemotherapeutic viewpoint of sending people such as (, Nat.Med.7:987-989 (2001)) Jain difference with the principal benefits of this therapy of being understood from the research of malignant tumor at first.Can expect that the tendency minimizing that benign tumor obtains sudden change may produce the treatment resistance, this can explain difference at least to a certain extent.Therefore, our tables of data is understood the carcinoid probability of non-operative treatment that does not need chemotherapeutant.

Embodiment 2. anti-VEGF-A monoclonal antibody in the mouse model of multiple endocrine adenomas suppresses the growth of pituitary adenoma and reduces serum prolactin antagonist and level of growth hormone

Multiple endocrine adenomas (MEN) is that a kind of being characterized as relates to the tumorigenic disease of two or more endocrine gland.The uniting when taking place of tumor in having identified parathyroid gland, islet cells and antepituitary, the patient is categorized as 1 type MEN (MEN1).Sudden change in the MEN1 gene of finding generally to cause the truncate of albumen menin or lacking has caused described disease (summarizing in people such as Pannett, among the Endocr.Relat.Cancer 6:449-473 (1999)).Along with more multiple existing (people such as Bystrom about remaining allelic frequent disappearance in the tumor, Proc.Natl.Acad.Sci USA 87:1968-1972 (1990), people such as Debelenko, Cancer Res.57:2238-2243 (1997), people such as Larsson, Nature 332:85-87 (1988)), MEN1 has been classified as tumor suppressor gene.Although to a great extent by heredity, the fresh mutation of MEN1 gene has been accredited as the cause of MEN1 Sporadic cases to MEN1 as the disease of autosomal dominant.

The function of menin is also unknown to a great extent.Shown that 610 amino acid whose protein that mainly are distributed in the nucleus of expressing participate in transcriptional regulatory, DNA processing and reparation everywhere, and the external interactional cytoskeletal organization (summarizing in people such as Agarwal, among the Horm.Metab.Res.37:369-374 (2005)) of the protein portion by itself and path referred to above.Yet there is not a kind of protein interaction of having identified that the explanation of the oncogenicity among the MEN1 is provided up to now.

The existing standard of pancreas tumor (it surpasses 50% is that gastrinoma and 10-30% are insulinomas) treatment is the minimizing of basal acid output under the situation of gastrinoma, and operation is counted as the optimal treatment of insulinoma.The treatment of pituitary tumor is made of the optionally operation that is accompanied by the different pharmacotherapy that depends on the hormone overview, and the treatment of the definitiveness of parathyroidoma is the too active gland of exenterate.But has transmutability (summarizing in people such as Brandi, among the J.Clin.Endocrinol.Metab.86:5658-5671 (2001)) on the degree of parathyroidectomy and opportunity.Recently the latest developments in the generation of the new method of diagnosis and treatment MEN1 have been carried out summarizing people such as (, Curr.Opin.Oncol.17:24-27 (2005)) Viola.

By homologous recombination, with the exon 3-8 of mice gene M en1 as the target of disappearance people such as (, Proc.Natl.Acad.Sci.USA 98:1118-1123 (2001)) Crabtree.By nine months when big, other normal observed parathyroid adenoma is followed in the development islets of langerhans damage that is in the news of the Men1 mice of heterozygosis.Observed the tumor (people such as Crabtree of bigger greater number in islets of langerhans, parathyroid gland, thyroid, adrenal cortex and the hypophysis when big by 16 months, Proc.Natl.Acad.Sci USA 98:1118-1123 (2001)), feature and human disorders are closely similar.

When being used to processing derived from the various preclinical models of the pernicious cancerous cell line of the mankind, anti-VEGF-A method (summarizes in people such as Geber, Cancer Res.60:2178-2189 (2000)), exist a large amount of evidence to show that the blocking-up of the angiogenesis of VEGF-A mediation causes tumor suppression (people such as Gerber, Cancer Res.60:6253-6258 (2000), people such as Holash, Proc.Natl.Acad.Sci.USA 99:11393-11398 (2002), people such as Millauer, Nature 367:576-579 (1994), people such as Prewett, Cancer Res.59:5209-5218 (1999), people such as Wood, Cancer Res.60:2178-2189 (2000)).Yet under natural situation, tumor xenogeneic graft is difficult to reproduce tumor and grows.In addition, on the growth of tumor that suppresses benign tumor or endocrine gland origin, do not attempt anti-VEGF-A antibody therapy so far.In order to study the effect of VEGF-A in the growth of endocrine tissue's specificity adenoma, we have examined or check the Men1 of anti-angiogenic therapy to abiogenous non-malignant tumors model M EN1 ^+/-The effect of mouse model.Handling post analysis Men1 with the anti-VEGF-A monoclonal antibody of exemplary VEGF specific antagonists (mAb) short-term ^+/-The volume of subcutaneous pituitary tumor graft in the gross tumor volume of pituitary adenoma and the Balb/c nude mouse in the mice.In addition, studied the probability that reduces the hormonal readiness of the rising relevant with the mAb of anti-VEGF-A with MEN1.

For hereinafter described experiment, (Bar Harbor ME) obtains Men1 from The Jackson Laboratory ^+/-Mice (stock numbering 004066) and (Wilmington MA) obtains the Balb/c nude mouse from Charles River Laboratories Inc..The experimental Men1 that mixes the 129-FVB background ^+/-Female mice is by with Men1 ^+/-Male and female mice hybridization acquisition.Be housed in mice in little isolator cage in the barrier facility and random feeding.The maintenance of carrying out animal and the experimental program ratified according to federal government's regulations and Institutional Animal Care and Use Committee (management of laboratory animal with use committee).

MAb G6-31 handles and suppresses Men1 ^+/-The growth of pituitary adenoma

Whether effective in the growth that suppresses pituitary adenoma in order to study anti-VEGF-A therapy, make 125 11 to 13 months big female Men1 ^+/-Mice is stood MRI has pituitary tumor with discriminating mice.Make the mice that has tumor stand imaging once more after 14 and 28 days to determine the growth rate of adenoma.The average tumor growth and the 15.58 ± 4.0mm that have every day 12.4% when making the research beginning ³The winding of nine mices of the mean tumour volume of (± SEM) is contrasted IgG, and makes average tumor growth and the 16.70 ± 5.7mm that has every day 10.2% when studying beginning ³The winding of eight mices of mean tumour volume is subjected to the mAb G6-31 of anti-VEGF-A, all reaches 67 days or up to finding that mice is dying.For the processing of using mAb G6-31 and contrast IgG antibody, the peritoneal injection of the contrast IgG (anti-GP120) of mAb G6-31 people such as (, J.Biol.Chem.281:951-961 (2005)) Liang of the anti-VEGF of 5mg/kg or isotype coupling is provided once in a week with the 100-200 μ l volume that is dissolved in PBS.Began eight (mAb G6-31) or nine (contrast IgG) Men1 when big to suffering from the original position pituitary adenoma at 13.5-14.5 month ^+/-Using and lasting 67 days or dying of mice up to the discovery mice.Began to have the processing of 23 (contrast IgG) of subcutaneous pituitary adenoma graft or 35 (mAb G6-31) Balb/c nude mouses in back 4 months and continued 35 days or in transplanting up to finding that the dying or gross tumor volume of mice has reached 3000mm ³Volume.

Per two weeks grow the animal imaging with MRI with pituitary adenoma in the tracking body.At the horizontal bore-type magnet of 9.4T (9.4T horizontal bore magnet, Oxford Instruments Ltd., Oxford, UK) obtain and be used to 3cm volume molded lines circle (volume the coil) (Varian that transmits and receive by use, Inc.) Varian Inova control station (Varian, Inc., Palo Alto, CA) control MRI image.With 4 seconds repetition time, 8 echo train length, the echo sounding of 12ms, the effective echo time of 48ms, six average quick spin echo imaging sequences of using.Image array is 128 ², have the visual field (20mm) ²Slice thickness with 0.5mm.Mice is retrained with 2% isoflurane in medical air with prone position, and monitor body temperature and during 15 minutes Image Acquisition, remain on 37 ℃ with warm air with rectal probe.After the imaging, animal is restored, afterwards they are sent back to the stable breeding facility.Use Analyze software (AnalyzeDirect, Inc., Lenexa, KS) the target 3D region of Hui Zhiing is from former pituitary tumor volume of MRI data computation.

When 39 days of handling, compare with the group that contrast IgG handles, in the group that mAb G6-31 handles, observe descend significantly on the statistics of average pituitary tumor volume (Fig. 5 A).At the terminal point (67 days) of research, handling back mean tumour volume with mAb G6-31 has on the statistics significant 72% reduce or subtract 1/3.7, has the p value less than 0.016.The Men1 that handles as great majority (in 9 6) contrast IgG ^+/-When tumor continues to grow vigorously during entire process, 7 growth in the pituitary adenoma that 8 mAb G6-31 handle significantly slow down (Fig. 5 B).The mice that four contrast IgG and three mAb G6-31 handle before the research terminal point is because unhealthy and by euthanasia, and it is included in the mice that contrast IgG handles of handling before the imaging in the 25th day.Significantly increased the life cycle of no tumor multiplication in the group that mAb G6-31 handles, and has sequential p＜0.019 (Fig. 5 C), shows with the mice of handling with contrast IgG to compare, and the inhibition of pituitary tumor growth has improved the health of those mices.Do not double when the gross tumor volume of two mices was to the 67th day of processing in the group that mAb G6-31 handles.

Anti-VEGF-A antibody suppresses the growth of subcutaneous pituitary adenoma graft

In order to detect anti-VEGF-A antibody treatment to Men1 ^+/-The effectiveness of pituitary adenoma transplantation model is set up Subcutaneous tumor according to follow procedure in the flank of big female Balb/c nude mouse of 6-8 week.For these experiments, will be from Men1 ^+/-About 1mm is taken out and be cut into to the one original position pituitary adenoma of mice ³Piece, (BD, Bedford MA) mix and with 200 μ l volumes the dorsal part of Balb/c nude mouse are carried out subcutaneous vaccination with BD Matrigel Matrix Basement Membrane (Matrigel matrigel basement membrane).After four months, with one Subcutaneous tumor (about 900mm ³Volume) taking-up, chopping mix with Matrigel also inoculates the group that has the mice of pituitary adenoma graft with foundation as mentioned before.

(Fred V.Fowler Co.Inc., Newton is MA) by gathering the tumor size of maximum diameter of tumor and the perpendicular subcutaneous pituitary adenoma graft of diameter measurement to use caliper tool.Use following formula to calculate gross tumor volume: V=π ab ²/ 6 (the maximum diameter of tumor of a=, b=perpendicular diameter).

Use above-described method, make when handling beginning, to have 515 ± 42mm ³The winding of 35 mices of mean tumour volume is subjected to mAb G6-31, has 527 ± 64mm and make when the research beginning ³The winding of 23 mices of mean tumour volume is contrasted IgG, all reaches 35 days.In research during terminal point, the tumor that contrast IgG handles near their four times of volume to 2071 ± 152mm ³Meansigma methods, and the tumor growth in the mice of handling with mAb G6-31 has stopped basically, the mean tumour volume in the time of the 35th day is 556 ± 89mm ³(Fig. 5 D).Mean tumour volume when mAb G6-31 handles has on the statistics significant 73% reduce or subtract 1/3.7, has p＜1.9x10 ^-12

The mAb G6-31 of the anti-VEGF-A of these data acknowledgements is effective in the growth of pituitary adenoma that suppresses easily to suffer from owing to the heterozygosity of Men1 and similar subcutaneous pituitary adenoma graft.

VEGF-A, VEGFR-1 and VEGFR-2 are in Normal Pituitary Gland and the expression in the pituitary tumor tissue

For study VEGF-A, VEGFR-1 and VEGFR-2 in pituitary tissue expression and the expression of checking them whether be subjected to the influence that mAb G6-31 handles, we have contrasted (average external volume 96.2 ± the 8.7mm that handles at five contrast IgG ³) and five (35.2 ± 4.0mm that mAb G6-31 handles ³) the original position pituitary adenoma is together with the little untreated (9.7 ± 2.9mm of five age-matched ³) pituitary adenoma, from Men1 ^+/-The Normal Pituitary Gland of four age-matched of mice, and the average relative expression of VEGF-A, VEGFR-1 and VEGFR-2 in the wild type pituitary gland sample of eight age-matched.Also contrast (average external volume 2063 ± 205mm that IgG handle from five ³) and five (577 ± 45mm that mAb G6-31 handles ³) expression of pituitary adenoma graft research VEGF-A, VEGFR-1 and VEGFR-2.

For these experiments, with RNeasy test kit (Qiagen, Hilden, Germany) RNA for preparing total no DNA from the pituitary adenoma or the Normal Pituitary Gland of quick freezing according to the scheme of manufacturer.With SuperScript III Platinum one step qRT-PCR test kit (Invitrogen, Carlsbad, CA), every kind of PCR primer of total RNA, the 45nM of 100ng and 12.5nMTaqman probe carry out a step quantitative RT-PCR with the cumulative volume of 50 μ l.In order to detect interested expression of gene, following TaqMan gene expression analysis primer and probe mixture (Applied Biosystems have been used, Foster City, CA): VEGF-A (measuring ID:Mm00437304_m1), VEGFR-1 (measuring ID:Mm00438980_m1) and VEGFR-2 (measuring ID:Mm00440099_m1).Use is synthetic primer and Taqman probe (forward primer sequence: ATGTTCCAGT ATGACTCCAC TCACG (SEQ ID NO:3) in internal unit; Reverse primer sequence: GAAGACACCA GTAGACTCCACGACA (SEQ ID NO:4); Taqman probe sequence: AAGCCCATCACCATCTTCCA GGAGCGAGA (SEQ ID NO:5)) detect GAPDH and express.

Use Applied Biosystems 7500 real-time PCR systems, react with following condition: reverse transcription step (in 48 ℃ 15 minutes), denaturing step (95 ℃ 2 minutes) and 40 95 ℃ 15 seconds and 60 ℃ of circulations of 1 minute afterwards.(Clontech, Mountain View CA) as a reference, measure the level of gene expression in every kind of sample with the method (ddCt method) of relative quantification as endogenous contrast and the total RNA of mice Placenta Hominis to use the GAPDH gene.

It should be noted that and contrast pituitary tumor that IgG handles, little untreated tumor and from wild type or Men1 ^+/-The Normal Pituitary Gland of mice is compared, and the average relative expression of VEGF-A is by significantly raise (Fig. 6) in the adenoma in situ that mAb G6-31 handles.VEGF-A expresses similar high in two Subcutaneous tumor graft samples.To transcribe may be the result of the compensation mechanism of covering via the system to VEGF-A of mAb G6-31 to viewed high-caliber VEGF-A in the tumor that mAb G6-31 handles.As if yet the VEGF-A deficiency that raises is so that tumor growth.

Although the average relative expression of VEGFR-1 shows to such an extent that considerably do not change in different tissue samples, and in tumour transplatation thing, the little tumor or of being untreated from wild type and Men1 ^+/-As if that is found in the Normal Pituitary Gland of mice compares, the average relative expression of VEGFR-2 descended (Fig. 6) in the tumor in situ sample of handling with contrast IgG or mAb G6-31.

MRI makes and can follow the trail of tumor growth in the body

Use MRI as described above follows the trail of the growth of original position pituitary adenoma during entire process by making animal stand imaging week about.To be photographed and handle the beginning back 9,39 and 67 days, have from a contrast IgG and the Men1 that mAb G6-31 handles ^+/-The diagram of the coronal section of the brain of the representational adenoma of mice is shown in Fig. 7.

The histology of hypophysis and pancreas tumor

Men1 in the mice of mAb G6-31 and contrast IgG processing ^+/-The pituitary gland adenoma is that the histology goes up similar (Fig. 8 A-B).For these experiments, with the tissue dewatering of formalin fixed and be embedded in the paraffin, section and with haematoxylin-Yihong (H﹠amp; E) dyeing is so that carry out histologic analysis according to standard scheme.Usually, tumor cell is little (～10 microns diameters), has high nucleus/Cytoplasm ratio, and usually mitosis is active, and the visual field with per ten 625 micron diameters reaches 40 mitotic figures.Tumor is entity or capsule erratically, with former hemorrhage conforming to, blood vessel with multiple endotheliocyte liner, the zone of the acute hemorrhage (intact red cells in the space of non-endothelium liner, lacking fibrin or cell forms), and the macrophage of dispersive year full hemosiderin.Have variable unicellular necrosis and minimum fibrosis.Tumor vessel separates brokenly, and the common diameter of 5-10 micron (but seldom greatly to 50 microns) does not almost have the circumvascular stromal cell of non-tumor.

Between the tumor of contrast IgG and mAb G6-31 processing, observe vascular pattern (Fig. 8 C-D) by using the indirect immunohistochemical staining of general endothelial cell marker antibody MECA-32.For these experiments, stop endogenic peroxidase activity and block avidin and biotin (Vector, Burlingame CA) before, take off paraffin with formalin fixed, paraffin-embedded tissue slice.With the normal rabbit serum that is dissolved in 10% among the PBS with 3%BSA will cut into slices the sealing 30 minutes.Afterwards tissue slice and first antibody were hatched 60 minutes, hatched 30 minutes with biotinylated second antibody, and at ABC reagent (Vector, Burlingame was hatched 30 minutes in CA), afterwards at the enhanced DAB (Pierce of metal, Rockford was hatched 5 minutes in IL).To cut into slices afterwards and redye with the MayerShi haematoxylin.Employed first antibody is the goat anti-mouse prolactin antagonist (R﹠amp of 0.1 μ g/ml; D systems, Minneapolis, MN) and the general endotheliocyte antigen of rat anti-mouse of 2 μ g/ml (clone MECA32) (BDBiosciences, San Jose, CA).Employed second antibody be 7.5 μ g/ml the anti-goat of biotinylated rabbit (Vector, Burlingame, CA) and the biotinylated rabbit Chinese People's Anti-Japanese Military and Political College Mus of 2.5 μ g/ml (Vector, Burlingame, CA).Dyeing need (CA) pretreatment be 20 minutes for Dako, Carpenteria with Target Retrieval in 99 ℃ for general endotheliocyte antigen.Other carry out in room temperature in steps.

Mab G6-31 handles 46% (p value=0.009 that vessel density significantly is reduced to the vessel density of the tumor that contrasts the IgG processing; Fig. 8 I).In two processed group, tumor vessel distributed than lacking in the antepituitary of normal vicinity.For quantitative vessel density, with Ariol SL-50 microscope slide scan table (Ariol SL-50slide scanning platform, Applied Imaging; SanJose CA) uses the object lens of 10x to analyze the painted section of MECA-32.Manually identify and mark the pituitary tumor zone.Dyeing is determined pixel color and is correspondingly measured the blood vessel area corresponding to MECA-32.Differentiate neoplastic cell nuclei by pixel color and body form.Afterwards with the blood vessel area with respect to the standardization of pituitary tumor cell number.Except area that MECA-32 is dyeed with respect to the pancreatic islet tumor area standardization, similarly analyze islets of langerhans.

Except pituitary tumor, the Men1 through being everlasting and handling ^+/-Differentiate pancreatic islet tumor in the mice and pancreatic islet tumor is carried out histologic analysis at the research terminal point.Pancreatic islet tumor (is defined on the slice plane greater than 10 ⁵μ m ²) entity normally, do not have significant hemorrhage or downright bad.The tumor (n=32 tumor) of six animals that the Mab G6-31 of anti-VEGF-A of using by oneself handles on average has only those tumors (n=45 tumor of five animals of personal contrast IgG processing; P value=0.026) 39% of area.More than adenoma of handling with mAb G6-31 (diameter of tumor reaches 5.0mm on the slice plane) big (reaching 7.0mm on the slice plane) and blood vessel usually with pancreas adenoma (Fig. 8 E-F) performance that contrast IgG handles.Merely hitting with four in seven mices of contrast IgG processing, pancreas tumor contains the nearly space of expansible, congested, thin-walled, the endothelium liner of 300 μ m of diameter, and usually lacks significant vascularity (Fig. 8 G-H) with the pancreas adenoma in the mice of mAb G6-31 processing.One pancreas tumor in eight mices that the mAb G6-31 that uses by oneself handles manifests expansible blood vessel.Intermittently find to carry the macrophage of expiring hemosiderin from the pancreas tumor that uses any processing, the hint islets of langerhans is hemorrhage.

G6-31 handles the 56% (p value=2*10 that the vessel density in the pancreatic islet tumor significantly is reduced to the vessel density in the pancreatic islet tumor that contrasts the IgG processing ^-7).Equally, " normally " islets of langerhans of the mice of handling from Mab G6-31 is (on slice plane less than 10 ⁵μ m ²) have vessel density (p value=4*10 of 76% with the vessel density that is reduced to the animal that contrast IgG handles more by a small margin ^-7Referring to Fig. 8 J).A buck of handling with contrast IgG has the adrenocortical tumor of unique 12mm diameter, and it is the tumor type of generally acknowledging in the MEN1 syndrome gland.

The histology of the histology of subcutaneous pituitary adenoma graft and original position pituitary tumor is suitable, shows that endocrine tumors is grown in the reproduction of the success of remote location.

The Men1 pituitary adenoma is a prolactinoma

About 60 percent pituitary adenoma secretion prolactin antagonist (PRL) among the MEN1 patient is less than 25% growth hormone (GH) and 5% thyroliberin (ACTH, people such as Trump, QJM 89:653-669 (1996)).In order to study Men1 ^+/-Whether the pituitary adenoma of mice secretes PRL, uses anti-PRL antibody to carry out immunohistochemical staining on original position pituitary adenoma that contrasts IgG and mAb G6-31 processing and pituitary tumor graft.In five pituitary adenomas that in six pituitary adenomas that contrast IgG handles six and mAb G6-31 handle five the special male dyeing that demonstrate in the cell of about 50-95% prolactin antagonist confirm that they are prolactinoma (Fig. 9 A-9B).Consistent with this result, people such as Crabtree report Men1 ^TSM/+Pituitary tumor is the PRL positive (people such as Crabtree, Proc.Natl.Sci USA 98:1118-1123 (2001)) in immunohistochemical staining.Prolactin antagonist dyeing also is male (Fig. 9 C, 9D) in the pituitary adenoma graft that uses any processing.Consistent with functional prolactin antagonist secretion from these tumors, in the animal that contrast IgG and anti-VEGF-A handle, have breast tissue in the female mice of pituitary adenoma of transplanting always show moderate to significant lactogenic change (Fig. 9 E, F).

As by the immunohistochemical staining assessment, in 11 untreated former pituitary tumors 6 are focal and to growth hormone p+ (Figure 14 A), and have only one to show focal weak dyeing (Figure 14 B) in the pituitary tumor of four transplanting.All exist in the original position pituitary tumor that G6-31 and contrast IgG handle growth hormone express (Fig. 6 C, D).Normal antepituitary shows strong reactivity (Figure 14 A) in the cell of～20-30%.

Be untreated with contrast the mice that IgG handles in the serum prolactin level relevant with the pituitary tumor volume and by mAb G6-31 processing reduction

Consider by immunohistochemical analysis from Men1 ^+/-All contrast IgG that checked of mice and the pituitary adenoma that all mAb G6-31 handle all are that prolactin antagonist is male, and we have studied the levels of serum PRL level at Men1 ^+/-Have in the mice of pituitary adenoma and whether raise.For this purpose, we are at first to 46 untreated female Men1 ^+/-Mice has been analyzed their the pituitary tumor state and the levels of serum PRL level of the littermate contrast of levels of serum PRL level and five female wild types.(Torrance is CA) by U.S.'s hormone and peptide plan (National Hormone ﹠amp at Harbor UCLA; Peptide Program) amount of serum analysis prolactin antagonist.

The range of age in these mices is 15.6 to 10.5 months, 13.3 months mean aves.Average serum PRL level in the wild-type mice is 43.8 ± 25.3 (± SEM) ng/ml.46 Men1 ^+/-27 in the mice do not have detectable pituitary tumor in MRI analyzes.Average serum PRL level in these mices is 69.0 ± 24.6ng/ml.One group of ten mice has 1.7 ± 0.6mm ³The little pituitary tumor of average external volume.The levels of serum PRL level is raised to the meansigma methods of 188.7 ± 61.9ng/ml in these mices.Has big pituitary tumor (average external volume 83.1 ± 23.8mm ³) nine mices have the levels of serum PRL of average 13239.8 ± 3466.5ng/ml.These data acknowledgements Men1 ^+/-The positive correlation (Figure 10 A) that has Pearson's correlation coefficient R=0.94 in the mice between levels of serum PRL level and the pituitary tumor volume shows that the levels of serum PRL level may be useful as the diagnostic tool in the assessment that confirms the pituitary tumor state.

Whether influential to the levels of serum PRL level in order to check that anti-VEGF-A handles, we have analyzed seven contrast IgG and seven Men1 with original position pituitary adenoma that mAb G6-31 handles when research terminal point (the 67th day) ^+/-The serum of mice.In the mice that contrast IgG handles, average serum PRL level is raised to 12566.7 ± 3047.4ng/ml and common along with the gross tumor volume (116.2 ± 18.5mm that increases gradually ³Meansigma methods) and increase R=0.80 (p＜0.03).Men1 in the mAb G6-31 processing of being analyzed ^+/-In the mice, it is lower that the levels of serum PRL level keeps, and is 5163.7 ± 1608.9ng/ml, still with gross tumor volume (mean tumour volume 35.3 ± 6.5mm ³) there are not a tangible statistic correlation, R=-0.12 and p＜0.80 (Figure 10 B).But these data show with the mice of contrast IgG processing to be compared, and mAb G6-31 is when suppressing the pituitary adenoma growth, and it also causes average serum PRL to reduce p＜0.053.

Anti-VEGF-A handles and reduces the levels of serum PRL level in the mice with subcutaneous pituitary tumor graft

Though data show is above having the Men1 of tumor ^+/-Anti-VEGF-A antibody treatment reduces the serum levels of PRL in the mice, under the situation of our subcutaneous pituitary adenoma graft in the Balb/c nude mouse further to its research.From the sample in measurement levels of serum PRL of when handling (the 1st day) and research terminal point (the 35th day), gathering that contrasts the mice of IgG and 35 mAb G6-31 processing from 23.Although the average serum PRL between two kinds of processing the 1st day the time is suitable, in the time of the 35th day the processing of mAb G6-31 significantly reduced the levels of serum PRL level (Figure 10 C and D, respectively).

Although the existing treatment of MEN1 prolactinoma comprises Drug therapy or is radiotherapeutic optionally hypophysectomy subsequently, our data show that mAb G6-31 handles the PRL serum levels that causes following significant tumor growth to suppress and reduces, and the possible new Therapeutic Method to MEN1 patient is provided.

Men1 ^+/-Serum insulin levels raises in the mice

For checking Men1 ^+/-Whether serum insulin levels raises in the mice, having analyzed the mice of six non-fasting that personal contrast IgG handles and with the blood serum sample of the mice of six non-fasting of mAb G6-31 processing, described mice all is accredited as pancreatic disorders in histologic analysis.(Mercodia, Uppsala Sweden) have analyzed serum insulin levels from the wild-type mice of the age-matched of five non-fasting according to the description of manufacturer also to use the plain ELISA test kit of super quick mouse islets.The dependency of not observing and handling, but compare Men1 with wild-type mice (1.4 ± 0.7ng/ml (± SEM)) ^+/-The average serum insulin has been raise significantly and (has been contrasted IgG, 3.8 ± 2.6ng/ml in the mice; MAb G6-31,3.7 ± 2.4ng/ml).

Discuss

Our data show the growth needs VEGF-A of optimum pituitary gland adenoma in the mouse model of MEN1, are enough to suppress tumor growth because show the therapy of the monoclonal antibody of using anti-VEGF-A.

Based on obtainable document, most of antitumor action that may viewed mAb G6-31 is the (people such as Wise by the inhibition mediation of VEGFR-2 dependency angiogenesis, people such as Proc.Natl.Acad.Sci.96:3071-3076 (1999) and Zachary, Cardiovasc.Res.49:568-581 (2001)).Although the average relatively expression of VEGFR-2mRNA is not subjected to the appreciable impact (Fig. 6) that anti-VEGF-A handles in big pituitary adenoma, the immunohistochemical staining of MECA-32 demonstrates the decline (about 50% minimizing) with the highly significant in the pituitary tumor of Mab G6-31 processing and the distribution of pancreas tumor medium vessels.Noticed all in pituitary adenoma and the pancreas adenoma that the tumor growth that anti-VEGF-A handles reduces accordingly.Vessel density in the normal islets of langerhans is also handled significantly by anti-VEGF-A and is reduced, although the amplitude that changes (contrast IgG handle 25% reduce) is less than seen in the pancreas adenoma.

To transcribe may be the result of the compensation mechanism of covering via the system to VEGF-A of Mab G6-31 to viewed high-caliber VEGF-A in the tumor that Mab G6-31 handles.As if yet the VEGF-A deficiency that so raises is so that tumor growth.

Except the monotherapy of the processing of the mAb G6-31 that show to use anti-VEGF-A has significantly reduced Men1 by suppressing the adenoma growth effectively ^+/-The tumor load of mice, we have showed that also the serum prolactin level also is lowered.Therefore, our tables of data is understood endocrine carcinoid non-operative treatment and is not used chemotherapeutant and stop the probability of disease progression.Selectively, this VEGF-A blocking-up can be made up with pharmacologic agent.For example, for the adenoma of secretion prolactin antagonist, can be with VEGF-A antagonist and dopamine agonist combination.

Embodiment 3. anti-VEGF in the RIP-T of carcinogenesis of many phases β Ag model intervenes effectiveness and degeneration/existence is renderd a service

In order better to understand the effect in the anti-VEGF therapy of the different times of tumor growth, we comprise RIP-T β Ag by means of many preclinical tumor models.RIP-T β Ag (Exelixis, Inc.) be the form with good conditionsi that produces the mouse islets tumor model of (driven) by the transgene expression of SV40 large T antigen (TAg) (the β cell of targeted pancreatic, wherein TAg is by playing potent oncogene in conjunction with p53 and Rb).RIP-T β Ag and the RIP-TAg model (Hanahan, the Nature 315:115-122 (1985) that had described before; People such as Bergers, Science 284 (808-811), 1999) be similar on the phenotype.We have found that the development of this model through a series of more and more aggressive periods, activation and " angiogenic switch " (forming the beginning of the process of neovascularity) of VEGF signal transduction when being included in about 5 weeks.Little tumor forms during to 10 weeks, and is consistent with the beginning of its vicious transformation.Big diffusible cancer forms during to 12 weeks.Therefore, in ten weeks big before, the cell growth in the mice is considered to not be pernicious or metastatic.Time period between 10-12 week is big generally includes the formation of diffusible cancer.

For these experiments, recommend stable breeding and handle RIP-T β Ag mice according to the IACUC of standard, the symptom of the hyperinsulinemia that the sucrose water with 5% provides high sugar to mice food causes with the β cytosis of alleviating by excreting insulin in the pancreas.In 9-9.5 or 11-12 week when big, handle mice twice weekly with the peritoneal injection of the anti-artemisiifolia contrast monoclonal antibody of the VEGF antibody of the 5mg/kg in the phosphate buffered saline (PBS) that is dissolved in sterilization or isotype coupling.In " intervention experiment ", the mice that 9-9.5 week is big is handled and checked then in 14 days.In " experiment of degenerating ", the mice that 11-12 week is big is checked after handling 7,14 and 21 days.For checking life cycle, another group mice processing is shown morbidity or dead up to mice.Intervene and the experiment of degenerating in each time point of determining, the pancreas of every mice and spleen taken out and take pictures.Cut each ball-type tumor and count the tumor number of determining in the pancreas by separating.Determine tumor load and measure each tumor two maximums diameter and use spheroid volume calculation result (x2 multiply by y) to take advantage of 0.52 to come volume calculated.All tumor size in the mice pancreatic are determined overall tumor load mutually.Calculating mean value and standard deviation, and (Microsoft Inc.) maps data to use the v11.3.3 of Microsoft Excel.Use Student ' s t check carry out from not on the same group the tumor number and the statistics between load relatively.(SAS Institute Inc.) generates the Kaplan-Meier curve of analyzing life cycle and use Time-Series analysis to carry out statistics relatively to use JMP 6.0.

The processing of the animal that 9 weeks of use VEGF antibody are big (" intervention " experiment) produces the remarkable minimizing (Figure 11) on the tumor-blood-vessel growth.The reduction (Figure 12 A) that the processing of the animal that 11 weeks are big (" experiment of degenerating ") produces tumor vessel distribution and propagation.But different with intervention experiment, only detect the of short duration minimizing of tumor growth and to not influence (Figure 12 B) life cycle.These studies have shown that compares these infantile tumours to being that the therapeutic agent of purpose is more responsive with anti-VEGF with late tumor.

Embodiment 4. anti-VEGF and chemotherapy are effective in preclinical models

Operation may stay the tuberosity of the micrometastasis of residual tumor cell or dormancy, and it has the potentiality that reactivate " angiogenesis program " and promote more exponential tumor growth.

We are by using potent chemotherapy scheme and anti-VEGF therapy parallel or sequentially " cell reduces (cytoreduce) " tumor and the maintenance therapy that uses anti-VEGF monoclonal antibody subsequently, with mice hereditary tumor and human xenograft to imitate the tumor dormancy.Therefore, we handle the recurrence of mice with prophylaxis of tumours, rather than form or form again in tumor and (comprise, in some cases) pursue and attack (chasing) tumor after the tumor refractory, recurrence or that the processing that more comprises the anti-VEGF therapy of targeting is had resistance.Figure 13 show Docetaxel reduce on the tumor load very effective, yet after about 2 months the observed result of rest cell regrowth.Yet to suppress tumor regrowth long with the simultaneous treatment of anti-VEGF, even they almost do not influence the bigger growth of tumor of building up more when independent.Other data show that secular anti-VEGF therapy also suppresses the regrowth of tumor after the cell that uses taxane or gemcitabine reduces.These results show that anti-VEGF can be used to block effectively the growth or the regrowth of dormancy tumor or micrometastasis.These find that with neovascularization be that the fact of the prerequisite of the rapidly clonal expansion relevant with the formation of macroscopic tumor conforms to, and supported VEGF specific antagonists (VEGF antibody for example, include but not limited to G6 or B20 series antibody) after the initial treatment of tumor and new tumor form, before the reactivating of dormancy tumor, malignant tumor or micrometastasis the tumor dormancy keep with the long inhibition of tumor regrowth in application.

Embodiment 5. uses the neoadjuvant of bevacizumab

This embodiment exemplary illustration the use of bevacizumab in the patient's who suffers from tangibly and the breast carcinoma that can perform the operation neoadjuvant.

New assistant chemical therapy has been widely used in the treatment of big breast carcinoma partial late period or that may be able to perform the operation.The verified new assistant chemical therapy of experiment has at random reduced needs (keeping breast thus) to mammectomy with the overall survival rate similar to the assistant chemical therapy.People such as Powles, J.Clin.Oncol.13:547-52 (1995); People such as Fisher, J.Clin.Oncol.16:2672-85 (1998).

The topmost purpose of present therapy is by increase the clinical benefit that bevacizumab provides improvement to chemotherapy in the patient of the breast carcinoma of suffering from tangibly and can performing the operation.Especially, one of to measure can be that pathology is alleviated (pathologic complete response, pCR) rate fully for the clinical efficacy of neoadjuvant topmost.Measuring of other comprises overall relief rate (OR), clinical complete remission rate (cCR), disease free survival phase (DFS) or overall life cycle (OS).In addition, can and come the side effect of monitor therapy to the side effect of cardiac function by for example postoperative complication ratio, toxicity.Some gene expression or other biomarker activity also can be used as the labelling to the response of treatment.

Pathology is alleviated (pCR) fully and has been used as the prognostic markers that treatment is renderd a service.PCR is meant the histology's evidence that does not have residual tumor behind the neoadjuvant when operation.Research has shown that the patient who reaches pCR has the life cycle of remarkable improvement.Whether can be used as the surrogate markers of effectiveness still disputable but the method that does not have a standard is alleviated classification and pCR with pathology.

Select to be suitable for to use the patient of the neoadjuvant of VEGF specific antagonists based on predetermined standard and guilding principle, described standard and guilding principle depend on the specific cancer type under the treatment and change.For example, can be based on histology, hematology/liver and the cardiac function of patient's life expectancy, age, cancer, treatment history, bearing status and plan and psychiatry or addiction situation are selected the patient.The more important thing is that primary tumo(u)r should measurable and maybe can be performed the operation.

Therapeutic scheme comprises that chemotherapy adds for example bevacizumab of VEGF specific antagonists.Randomly, other therapeutic agent also can be used to described scheme.Usually, the chemotherapy scheme (as the standard treatment scheme) that generally is used for specific cancer type is used in combination with bevacizumab.For example, for new adjuvant treatment of breast cancer, Docetaxel, paclitaxel or amycin/cyclophosphamide (AC) scheme and bevacizumab can be used in combination.Selectively, can will use in order as chemotherapy based on Docetaxel or based on the scheme of paclitaxel and AC scheme with the bevacizumab combination.In order to treat nonsmall-cell lung cancer, cisplatin (for example gemcitabine, Docetaxel or vinorelbine make up separately or with other chemical agents) can be used as the main chemical agent with the bevacizumab combination.On the other hand, be the treatment colorectal carcinoma, the scheme (for example FOLFOX) based on 5-FU can be used in combination with bevacizumab.

Can be to the patient with given dosage with use at interval chemotherapeutant and VEGF specific antagonists many cycles of bevacizumab for example.For example, can provide 4 cycles with per three all 15mg/kg with bevacizumab, or per two all 10mg/kg provide 6 cycles.In another example, with per two weeks of 7.5mg/kg or once use for example bevacizumab of VEGF specific antagonists three weeks.Monitoring patient's response during treating.When neoadjuvant was finished, patient experience operation to be removing primary tumo(u)r, described tumor be before neoadjuvant, can perform the operation or become and can perform the operation in response to neoadjuvant.After the operation, make the patient continue for example bevacizumab of VEGF specific antagonists therapy, with or not with chemotherapy (particular condition that depends on the patient).Randomly, the patient also can be through receiving radiation therapy.The treatment and the treatment after whole during the monitoring patient progress.

The adverse events (AE) relevant with anti-VEGF treatment also should be detected closely and be controlled.Comprise hypertension, albuminuria, hemorrhage, thromboembolic events, gastric-intestinal perforation/fistula and wound healing complication from the known main AE of research before.Available medicine is controlled for example hypertension of some AE.If AE is serious and uncontrollable, then treatment should be interrupted.

Embodiment 6. uses the complementary therapy of bevacizumab

The explanation that this embodiment is exemplary in the patient's of the cancer of suffering from excision auxiliary treatment with the use of the bevacizumab of chemotherapy combination.

Select to be suitable for to use the patient of the complementary therapy of bevacizumab based on predetermined standard and guilding principle, described standard and guilding principle depend on the specific cancer type under the treatment and change.For example, can select the patient based on histology, hematology/liver and cardiac function, life style history, treatment history, bearing status and the plan of patient's life expectancy, age, cancer and psychiatry or addiction situation.The more important thing is that the patient must experience the excision fully of their cancer before auxiliary treatment.The type of the excision of being accepted depends on specific tumor type.Equally, for the analysis and the efficacy determinations of initial period, represent enough pathology materials of patient's cancer to get.When treatment, operation should be very approaching, but the patient must restore from operation fully.For example, the patient must be no less than 3-6 week after operation and no more than 8-12 begins auxiliary treatment during week.

Therapeutic scheme comprises that chemotherapy adds bevacizumab.Randomly, other therapeutic agent also can be used to described scheme.Usually using the chemotherapeutant with the bevacizumab combination during the phase I of treatment, is bevacizumab as the treatment of keeping of single dose Remaining Stages afterwards.For example, with a chemotherapeutant and the about 4-12 of a bevacizumab treatment patient cycle, reach 1 to 2 year with bevacizumab treatment separately afterwards.The persistent period in each cycle of the treatment of chemotherapeutant+bevacizumab is depended on employed specific agent and dosage.For example, can per three weeks provide bevacizumab with 15mg/kg, or per two weeks provide bevacizumab for one-period with 5mg/kg for one-period.In another example, per two the week or per three weeks provide bevacizumab with 7.5mg/kg or 10mg/kg.

The chemotherapy scheme (for example standard treatment scheme) that is generally used for the particular cancer type is used in combination with bevacizumab.For example, for the complementary therapy of breast carcinoma, Docetaxel, paclitaxel or amycin/cyclophosphamide (AC) scheme and bevacizumab can be used in combination.Selectively, can will use in order as chemotherapy based on Docetaxel or based on the scheme of paclitaxel and AC scheme with the bevacizumab combination.In order to treat nonsmall-cell lung cancer, cisplatin (for example gemcitabine, Docetaxel or vinorelbine make up separately or with other chemical agents) can be used as the main chemical agent with the bevacizumab combination.On the other hand, be the treatment colorectal carcinoma, the scheme (for example FOLFOX) based on 5-FU can be used in combination with bevacizumab.

Using the purpose of the auxiliary treatment of bevacizumab is to improve survival time of patients, preferably the disease free survival phase.Simultaneously, especially because auxiliary treatment is secular, therefore any adverse events relevant with bevacizumab all should be monitored closely.Can be by Kaplan-Meier method assessment life cycle, and use stratified sequence check to calculate any difference on life cycle.Effect when the multivariate analysis of use Cox proportional hazard model is used to the estimating prognosis factor to life cycle.With the interaction of Cox proportional hazard model inspection with the prognosis factor.SAS statistics software kit is used for all calculating.When the P value be 0.05 or more hour data be considered on the statistics significant.All statistical test all are bilaterals.

The adverse events (AE) relevant with anti-VEGF treatment should be monitored closely and be controlled.Comprise hypertension, albuminuria, hemorrhage, thromboembolic events, gastric-intestinal perforation/fistula and wound healing complication from the known main AE of research before.Available medicine is controlled for example hypertension of some AE.If AE is serious and uncontrollable, then treatment should be interrupted.

Other embodiments

From description before, be apparent that and make changes and modifications so that it is fit to (adopt) various uses and condition invention described herein.These embodiments are also in the scope of following claim.

All publications, patent application and the patent mentioned in this manual comprise U.S. Provisional Application the 60/870th, No. 741 (December was submitted on the 19th in 2006); The 60/870th, No. 745 (December was submitted on the 19th in 2006); The 60/877th, No. 267 (December was submitted on the 27th in 2006); The 60/919th, No. 638 (submission on March 22nd, 2007); The 60/958th, No. 384 (submission on July 5th, 2007) and the 60/989th, No. 397 (submission on November 20th, 2007) all incorporates this paper by reference into, and it quotes degree just as pointing out that independently publication, patent or patent application clearly and are individually incorporated into by reference with each.

Sequence table

＜110〉Genentech, Inc. (US) 460 Point San Bruno Blvd, South San Francisco, CA, 94080

＜120〉be used for the VEGF specific antagonists of the treatment of auxiliary and neoadjuvant and infantile tumour

<130>50474/014WO6

<150>US?60/989,397

<151>2007-11-20

<150>US?60/958,384

<151>2007-07-05

<150>US?60/919,638

<151>2007-03-22

<150>US?60/877,267

<151>2006-12-27

<150>US?60/870,745

<151>2006-12-19

<150>US?60/870,741

<151>2006-12-19

<160>5

<170>PatentIn?version?3.3

<210>1

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic

<400>1

caacgtcact?atgcagatca?tgcg 24

<210>2

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic

<400>2

ggtctagttc ccgaaaccctgag 23

<210>3

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic

<400>3

atgttccagt atgactccactcacg 25

<210>4

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic

<400>4

gaagacacca?gtagactcca cgaca 25

<210>5

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic

<400>5

aagcccatca ccatcttcca?ggagcgaga 29

Claims (38)

1. treat method benign among the curee, cancer cancer preceding or non-metastatic for one kind, it comprises the VEGF specific antagonists of described curee being used effective dose.

2. method according to claim 1, wherein said VEGF specific antagonists described are used canceration before described benign, the cancer of prevention or non-metastatic and are become diffusibility or metastatic cancer.

3. method according to claim 1, cancer before wherein said benign, the cancer or non-metastatic is 0 phase, I phase or II phase cancer.

4. method according to claim 3, wherein said VEGF specific antagonists described are used cancer before described benign, the cancer of prevention or non-metastatic to III phase or the development of IV phase cancer.

5. method according to claim 1, described the using of wherein said VEGF specific antagonists reduces the tumor size.

6. a treatment has the curee's of cancer, polyp or the syndromic family history of hereditary cancer method, it comprise to described curee use that the VEGF specific antagonists of effective dose is benign among the described curee to prevent, the generation or the recurrence of cancer before the cancer or non-metastatic.

7. the generation or the recurrence of cancer before method according to claim 6, the prevention of wherein said method never suffer from the curee of detectable cancer clinically or only suffer from benign described in the curee of optimum cancer, cancer or non-metastatic.

8. method that in having the curee of unresectable tumor, reduces the tumor size, it comprises the VEGF specific antagonists of described curee being used effective dose, and described the using of wherein said VEGF specific antagonists reduces the excision fully that described tumor size allows described tumor thus.

9. method according to claim 8, it further is included in and excises the step of described curee being used after the described tumor VEGF specific antagonists of effective dose fully.

10. a treatment suffers from the curee's of the cancer that can perform the operation method, and it is included in uses the VEGF specific antagonists of effective dose to described curee before the operation and undergo surgery so as to excising described cancer.

11. method according to claim 10, it further is included in the VEGF specific antagonists of operation back described curee the being used effective dose step with the recurrence that prevents described cancer.

12. according to claim 9 or 11 described methods, the described propagation of using the prevention micrometastasis of wherein said VEGF specific antagonists.

13. a method of carrying out neoadjuvant in the curee who suffers from the cancer that can perform the operation, it comprises uses the VEGF specific antagonists to described curee.

14. a method of preventing the recurrence of cancer among the curee, it comprises uses the VEGF specific antagonists to described curee, the wherein said cancer recurrence of using among the described curee of prevention.

15. a method that reduces the probability of cancer recurrence among the curee, it comprises uses the VEGF specific antagonists to described curee, the wherein said probability that reduces cancer recurrence among the described curee of using.

16. according to claim 14 or 15 described methods, the described probability that stops or reduce the generation of detectable clinically tumor or its transfer of using of wherein said VEGF specific antagonists.

17. according to any one the described method in claim 14 or 15, wherein said curee has stood the definitiveness operation before using the described step of VEGF specific antagonists.

18. according to any one the described method in the claim 1,6,8,10,13,14,15 or 17, wherein said VEGF specific antagonists is a monotherapy.

19., wherein before treat described curee with anti-cancer therapies according to any one the described method in the claim 1,6,8,10,13,14,15,17 or 18.

20. method according to claim 19, wherein said anti-cancer therapies comprises anti-angiogenic therapy.

21. one kind is prevented the long method of tumor regrowth among the curee, it comprises the step of removing described tumor and afterwards described curee being used the VEGF specific antagonists.

22. a prevention has the method for the recurrence of cancer among the curee of tumor, it comprises the step of removing described tumor and afterwards described curee being used the VEGF specific antagonists.

23. according to claim 21 or 22 described methods, it further is included in the removal of described tumor and uses a period of time between the described VEGF specific antagonists, wherein said a period of time is greater than 2 weeks.

24. method according to claim 23, wherein said a period of time is greater than two weeks and less than 1 year.

25. according to claim 21 or 22 described methods, it further is included in the removal of described tumor and uses a period of time between the described VEGF specific antagonists, wherein said a period of time is 28 days.

26. according to claim 21 or 22 described methods, it further is included in the removal of described tumor and uses a period of time between the described VEGF specific antagonists, and wherein said a period of time is enough to the risk that operative incision fully healed or reduce wound dehiscence.

27. according to claim 21 or 22 described methods, wherein said VEGF specific antagonists is a monotherapy.

28. according to any one the described method in the claim 1,6,8,10,13,14,15,18 or 22, it further comprises the recurrence of the described cancer of monitoring described curee.

29. according to any one the described method in the claim 1,6,8,10,13,14,15,18,21 or 22, wherein said cancer or tumor are the cancer or the tumors of gastrointestinal, colorectum, mammary gland, ovary, lung or kidney.

30. according to any one the described method in the claim 1,6,8,10,13,14,15,18,21 or 22, it further comprises the anti-cancer therapies of using other.

31. method according to claim 30, wherein said other anti-cancer therapies is a chemotherapy.

32. according to any one the described method in the claim 1,6,8,10,13,14,15,18,21 or 22, wherein said VEGF specific antagonists is selected from by examining base oligomer, small RNA molecular and the fit group of forming with the bonded polypeptide of VEGF specificity, ribozyme, peptide body, antisense.

33. method according to claim 32, the wherein said and bonded polypeptide of VEGF specificity is soluble vegf receptor protein or its VEGF binding fragment or chimeric vegf receptor protein.

34. method according to claim 33, wherein said chimeric vegf receptor protein is Flt-1/Fc, KDR/Fc or Flt/KDR/Fc.

35. method according to claim 32, the wherein said and bonded polypeptide of VEGF specificity is VEGF antibody or its Fab.

36. method according to claim 35, wherein said VEGF antibody is a monoclonal antibody.

37. method according to claim 36, wherein said monoclonal antibody are chimeric, humanized or complete human antibodies.

38. according to the described method of claim 37, wherein said monoclonal antibody is a bevacizumab.

Images