CN101643941A - High-efficiency directed evolution method of lipase gene - Google Patents
High-efficiency directed evolution method of lipase gene Download PDFInfo
- Publication number
- CN101643941A CN101643941A CN200910063845A CN200910063845A CN101643941A CN 101643941 A CN101643941 A CN 101643941A CN 200910063845 A CN200910063845 A CN 200910063845A CN 200910063845 A CN200910063845 A CN 200910063845A CN 101643941 A CN101643941 A CN 101643941A
- Authority
- CN
- China
- Prior art keywords
- expressing
- presenting
- saccharomyces cerevisiae
- lipase
- yeast saccharomyces
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a high-efficiency directed evolution method of a lipase gene. The method comprises the following steps: (1) constructing a display expression vector of saccharomyces cerevisiae;(2) constructing display expression recombinant plasmids of the saccharomyces cerevisiae of a lipase; (3) obtaining vector-carried lipase gene fragments in a homologous sequence and constructing an expression mutation library; and (4) analyzing the display expression mutation library and mutants. The method synchronizes the construction of the mutation library and the expression of the mutants ina general directed evolution technology and overcomes the defects that directed evolution of lipase molecules has complicated operation steps, difficult mutant selection, and the like in the prior art.
Description
Technical field
The present invention utilizes the yeast saccharomyces cerevisiae homologous recombination in conjunction with microorganism cells surface display technology, sets up directed evolution method of lipase gene efficiently, relates to the technology of enzyme gene orthogenesis, molecular modification, belongs to biological technical field.
Background technology
Enzyme gene orthogenesis is zymologic property one of the effective means the most that improves enzyme.The DNA shuffling technology of the nineties has been started new era of directed molecular evolution.DNA reorganization is meant the vitro recombination of dna molecular, is the sexual reorganization that gene carries out on molecular level.By changing the original nucleotide sequence of individual gene (or gene family), create new gene, and give expression product with new function.
Though conventional DNA shuffling technology reaches the mutation frequency that can improve goal gene with the improved technology of laggard mistake effectively, but its all dna molecular experimental implementation step all is to be undertaken by round pcr in the living body biological extracellular, and resulting mutant also must effectively transform enter could realize in the live body host cell screening, the experimental implementation complex steps has limited the high flux screening of mutant.
Orthogenesis can be divided into random mutation (mutant acquisition) and two stages of orthoselection (screening mutant), the orthogenesis technical development is to today, the acquisition of mutant no longer is the factor that limits its development, at present can very effective acquisition mutant by technology such as erroneous tendancy PCR, DNA shuffling, the general using intestinal bacteria carry out the mutant library structure for the host then.Pertinent literature report, a lot of enzymes often with the formal representation of inclusion body, are that the sudden change library that the host makes up just is difficult to realize high flux screening with intestinal bacteria in intestinal bacteria like this.Which kind of DNA shuffling technology no matter it is worthy of note, be, its effect must be verified by the function of reorganization back gene expression product.Therefore, sensitive selection reliably or screening method are the keys of DNA shuffling technology success or not.Particularly at the orthogenesis of lipase gene, obtain to make these sudden change physical efficiency effective expressions obtain activated lipase behind the mutant library, could realize the high flux screening of mutant, therefore expressing the sudden change library construction efficiently is the key point of lipase molecular orientation evolvement.
The orthogenesis of lipase gene mainly divides mutant acquisition and two steps of mutant expression to carry out at present.The routine techniquess such as the wrong tendency of method PCR, DNA shuffing that mutant obtains, the method that is adopted all can't be avoided extracellular DNA operation, experimental procedure complexity.The expression aspect of mutant, the expression system that is adopted mainly is an escherichia expression system, a lot of lipase all can't be realized secreting, expressing in this system, or to express what obtain be the active inclusion body of abiology.So just can not carry out directly effective screening mutant, the more impossible high flux screening that carries out mutant.Change (answering) the property separation that need carry out cytoclasis, inclusion body obtains lipase, carries out screening mutant then, and related step complexity is loaded down with trivial details, is difficult to realize the high flux screening of mutant.
Summary of the invention
The objective of the invention is to propose a kind of characteristic of yeast saccharomyces cerevisiae homologous recombination of utilizing in conjunction with microorganism cells surface display technology, the lipase gene of different sources is realized that in cell live body DNA reorganization obtains mutant, and simultaneously various mutant have been obtained bioactive lipase in the expression of microorganism cells surface display.The present invention realizes the structure in sudden change library in the conventional orthogenesis technology and the expression of mutant to overcome shortcomings such as lipase molecular orientation evolvement operation steps complexity, screening mutant difficulty in the prior art synchronously.Present method also can be applicable to the orthogenesis of other enzyme molecules.
Below be the technological line of realizing the object of the invention:
1. yeast saccharomyces cerevisiae presenting and expressing vector construction: utilize yeast cell Flop membranin or a-lectin, α-lectin, etc. membranin make up and be fit to the presenting and expressing carrier that lipase is expressed.
2. lipase yeast saccharomyces cerevisiae presenting and expressing construction of recombinant plasmid: utilize yeast saccharomyces cerevisiae presenting and expressing carrier, make up lipase gene (having certain homology) recombinant vectors of presenting and expressing in yeast saccharomyces cerevisiae of different sources.
3. the lipase gene fragment of band carrier homologous sequence obtains and express the structure in sudden change library: according to presenting and expressing carrier sequences Design primer, pcr amplification has the different sources lipase gene fragment of yeast saccharomyces cerevisiae presenting and expressing carrier homologous sequence; The lipase gene fragment that will have the carrier homologous sequence is mixed with linearizing presenting and expressing carrier, and transformed saccharomyces cerevisiae obtains expressing the sudden change library.
4. presenting and expressing sudden change library and mutant analysis: the lipase gene of different sources is realized homologous recombination in yeast saccharomyces cerevisiae, obtains presenting and expressing sudden change library, illustrates as Fig. 1.(concrete operations see embodiment for details)
The present invention utilizes the homologous nucleotide sequence that this characteristic of homologous recombination can take place in yeast saccharomyces cerevisiae, utilize yeast saccharomyces cerevisiae presenting and expressing carrier to import brewing yeast cell the lipase gene (having certain sequence homology) of different sources, make these lipase genes realize that in brewing yeast cell homologous recombination obtains mutant, these mutant of while presenting and expressing effectively obtain activated lipase on the brewing yeast cell surface.So promptly avoided extracellular genetic manipulation complicated in the conventional gene orthogenesis, can realize simultaneously the presenting and expressing of various mutant genes again on the brewing yeast cell surface, be convenient to the high flux screening of mutant, thereby realize that lipase gene is at intracellular live body orthogenesis.This method utilizes the character of yeast saccharomyces cerevisiae homologous recombination to express the sudden change library in conjunction with microorganism cells surface display technique construction first, carry out live body DNA reorganization (in-vivo DNA shuffling) in the cell, saved the manipulation in vitro of dna moleculars such as the nuclease digestion of gene, sexual PCR generation mutant, and make mutant realize presenting and expressing synchronously, improved the efficient of lipase molecular orientation evolvement greatly, for the high flux screening of realizing mutant in the enzyme orthogenesis is opened up new technological line.The present invention obtains heterozygosis lipase gene lipMix1, and the lipase mutant of its coding has been realized the presenting and expressing on the brewing yeast cell surface simultaneously, obtains full cellular fat enzyme.The lipase mutant zymologic property makes moderate progress than its parent, can be applied to lipase-catalyzed various biocatalytic reactions.
Description of drawings:
Fig. 1, different enzyme gene be the homologous recombination signal in yeast,
Fig. 2, yeast saccharomyces cerevisiae presenting and expressing carrier pLHJ042 collection of illustrative plates,
Fig. 3, recombinant plasmid pLHJ044 collection of illustrative plates,
Fig. 4, recombinant plasmid pLHJ042-B68 collection of illustrative plates,
Fig. 5, recombinant plasmid pLHJ052 collection of illustrative plates,
Fig. 6, recombinant plasmid pLHJ053 collection of illustrative plates,
Fig. 7, dull and stereotyped active detection of recon sweet oil substrate,
The sequence of Fig. 8, lipase gene lipMix1 and lipJ02 compares,
The sequence of Fig. 9, lipase gene lipMix1 and lipJ03 compares,
The sequence of Figure 10, lipase gene lipMix1 and lipB68 compares,
The sequence of Figure 11, lipase gene lipMix1 and lipB52 compares,
Figure 12, lipase gene lipMix1 sequence source,
Embodiment
The present invention is further elaborated below in conjunction with specific examples, but embodiment does not limit protection scope of the present invention, and concrete embodiment is as follows:
The structure of the yeast saccharomyces cerevisiae display carrier of embodiment 1:Flop membranin mediation
Albumen Flo1p is by the cell wall protein of a similar lectin of FL01 genes encoding in S.cerevisiae, according to the FL01 gene of having reported (GenBank NO.NC_01133) complete sequence, the primer of the functional zone encoding sequence of wadding a quilt with cotton with fixed attention of design Flo1p: FOLf-Hind III and FOLr-Bgl II (FOLf-Hind III:5 '-acataagcttatgacaatgcctcatcgctatatgtttttg-3 ' FOLr-Bgl II:5 '-gatagatctggtgatttgtcctgaagatgatgatgacaaa-3 '), total DNA with Saccharomyces Cerevisiae in S .cerevisiae ATCC 60715 is the functional zone coding sequence fragment of wadding a quilt with cotton with fixed attention that the template pcr amplification obtains Flo1p, with this sheet cracked ends Hind III, behind the Bg1 II double digestion with through Hind III, the yeast saccharomyces cerevisiae expression vector pYES2/NT of BamH I double digestion connects (Bg1 II and BamHI be isocaudarner each other) under the effect of T4DNA ligase enzyme, obtaining with the Flo1p functional zone of wadding a quilt with cotton with fixed attention is the yeast saccharomyces cerevisiae presenting and expressing carrier pLHJ042 of mediation anchor hop protein, as Fig. 2.
Embodiment 2: lipase gene yeast saccharomyces cerevisiae presenting and expressing construction of recombinant plasmid
2.1, fluorescent pseudomonas source lipase gene yeast saccharomyces cerevisiae presenting and expressing vector construction
With its full-length gene primer of lipase gene lipB52 (Genbank NO.AY623009) sequences Design LipB52Pf (5 '-aaagaattcccaacaaaaagagaggcaacagcaatg-3 '), LipB52Pr (5 '-aaagcgcgcgctccctccccacccttgtcgtcagg-3 '), with P.fluorescens B52 genomic dna is that the template pcr amplification obtains lipB52 full-length gene fragment, use restriction enzyme Eco RI behind this segment purifying, Not I double digestion, glue reclaim the lipB52 gene fragment of double digestion with through Eco RI, the yeast saccharomyces cerevisiae presenting and expressing carrier pLHJ042 of Not I double digestion connects under the effect of T4DNA ligase enzyme, obtain lipB52 gene yeast saccharomyces cerevisiae presenting and expressing plasmid pLHJ044, as Fig. 3.
Make up the yeast saccharomyces cerevisiae presenting and expressing recombinant plasmid pLHJ042-B68 that obtains lipase gene lipB68 (GenBank NO.AY694785) according to above-mentioned similar flow process, as Fig. 4.
2.2 environmental sample (can not culturing micro-organisms) source lipase gene yeast saccharomyces cerevisiae presenting and expressing vector construction
With the plasmid of fatty enzyme gene lipJ02 (GenBank NO.AY673674) restriction enzyme Eco RI, Not I double digestion, glue reclaims the lipJ02 gene fragment and is connected under the effect of T4DNA ligase enzyme with yeast saccharomyces cerevisiae presenting and expressing carrier pLHJ042 through Eco RI, Not I double digestion, obtain lipJ02 gene yeast saccharomyces cerevisiae presenting and expressing plasmid pLHJ052, as Fig. 5.
Similar with above-mentioned flow process, plasmid pLHJ025 restriction enzyme Eco RI, Not I double digestion with fatty enzyme gene lipJ03 (GenBank NO.AY700013), glue reclaims the lipJ03 gene fragment and is connected under the effect of T4DNA ligase enzyme with yeast saccharomyces cerevisiae presenting and expressing carrier pLHJ042 through Eco RI, Not I double digestion, obtain lipJ03 gene yeast saccharomyces cerevisiae presenting and expressing plasmid pLHJ053, as Fig. 6.
Embodiment 3: the lipase gene fragment of band carrier homologous sequence obtains and expresses the structure in sudden change library
3.1 the lipase gene fragment of band carrier homologous sequence obtains
Sequence according to yeast saccharomyces cerevisiae presenting and expressing carrier pLHJ042 designs primer pLHJ042F, the pLHJ042R that is positioned at the multiple clone site two ends respectively.The sequence of primer pLHJ042F (5 '-cactgaaccatggaccggaacttt-3 ') is positioned at the Flo1p functional zone encoding sequence of wadding a quilt with cotton with fixed attention, and the sequence of primer pLHJ042R (5 '-ggggggagggcgtgaatgta-3 ') is positioned at terminator CYCC1TT sequence.Being template with pLHJ044, pLHJ052, pLHJ053 and pLHJ042-B68 respectively, is that primer is right with pLHJ042F, pLHJ042R, and pcr amplification obtains having the segment of the different sources lipase gene of yeast saccharomyces cerevisiae presenting and expressing carrier homologous sequence.
3.2 the different sources lipase gene is expressed the structure in sudden change library
With the segment of the different sources lipase gene of band yeast saccharomyces cerevisiae presenting and expressing carrier homologous sequence with through the linearizing yeast saccharomyces cerevisiae presenting and expressing of double digestion carrier pLHJ042 mixture, transformed saccharomyces cerevisiae INVSc1, coating contains the SC-U flat board (URA of glucose
-), 30 ℃ of cultivations, after waiting to grow transformant, the switching transformant is to the dull and stereotyped 30 ℃ of cultivation 24h of the SC-U that contains glucose, transformant is forwarded to adds dull and stereotyped 30 ℃ of cultivations of SC-U that 1% sweet oil and 0.002%Rhodamine B contain 2% semi-lactosi, utilize semi-lactosi to induce the expression of target protein.The rear section periphery of bacterial colonies had tangible color reaction in 2～3 days, as Fig. 7.
The color reaction that periphery of bacterial colonies has shows that lipase gene realizes expressing in the host bacterium, can judge that thus homologous recombination takes place in yeast saccharomyces cerevisiae the lipase gene of different sources, obtains expressing the sudden change library.
Embodiment 4: the lipase gene mutant is analyzed
Picking is expressed 10 transformants (transformant that color reaction occurs early, color range is bigger) that lipase activity is higher in the sudden change library, it activated in containing the SC-U liquid nutrient medium of glucose, and in 30 ℃ of overnight incubation.Collect the yeast saccharomyces cerevisiae thalline and extract plasmid and transformed into escherichia coli regeneration, the picking thalline sample presentation that contains plasmid is used primer pLHJ042F, its complete sequence of pLHJ042R sequencing analysis respectively at random.Show have 1 gene to reset in 10 samples by sequential analysis, all the other are parent's single-gene and same reorganization takes place carrier, the mutant lipase gene called after lipMix1 that will comprise normal frame, and submit GenBank (GenBank NO.GQ383920) to.
4.1 the sequence of lipase gene mutant lipMix1 and lipase gene lipJ02 relatively
Show have three sections sequences of 205bp～237bp, 342bp～653bp and 838bp～872bp and lipase gene lipJ02 sequence in full accord in the sequence of lipase gene lipMix1, as Fig. 8 by sequential analysis.
These three sections sequences of inferring lipase gene lipMix1 thus may come from lipase gene lipJ02.
4.2 the sequence of lipase gene mutant lipMix1 and lipase gene lipJ03 relatively
Show have 67bp～221bp, 442bp～489bp, 674bp～708bp and four sections sequences of 835bp～881bp and lipase gene lipJ03 sequence in full accord in the sequence of lipase gene lipMix1, as Fig. 9 by sequential analysis.
These four sections sequences of inferring lipase gene lipMix1 thus may come from lipase gene lipJ03.
4.3 the sequence of lipase gene mutant lipMix1 and lipase gene lipB68 relatively
Show have 1bp～106bp, 208bp～364bp, 366bp～395bp and four sections sequences of 640bp～1432bp and lipase gene lipB68 sequence in full accord in the sequence of lipase gene lipMix1, as Figure 10 by sequential analysis.
These four sections sequences of inferring lipase gene lipMix1 thus may come from lipase gene lipB68.
4.4 the sequence of lipase gene mutant lipMix1 and lipase gene lipB52 etc. relatively
By sequential analysis, the on all four sequence of the not big section of lipase gene lipMix1 and lipB52 sequence is as Figure 11.Show that lipase gene mutant lipMix1 sequence may not come from the sequence of these lipase genes or have only the base of few part to recombinate.
4.5 lipase gene mutant lipMix1 sequence source analysis
Find that from above-mentioned sequence alignment the sequence of lipase gene mutant lipMix1 may derive from lipJ02, lipJ03 and lipB68, as Figure 12.Lipase gene lipMix1 full length sequence comprises 1431bp, and size is consistent with fluorescent pseudomonas source lipase gene lipB68 (1431bp) size, has complete ORF.
Experiment analysis results shows that the lipase gene of different sources can be realized homologous recombination effectively in this yeast saccharomyces cerevisiae presenting and expressing system, obtain the heterozygosis lipase gene.
Sequence table
＜110〉Hubei University
＜120〉a kind of directed evolution method of lipase gene efficiently
＜130〉(folder reference number)
＜140〉(number of patent application)
<141>2009-8-30
<160>8
<210>1
<211>1431
<212>DNA
＜213〉be the heterozygosis lipase gene lipMix1 (GenBank NO.GQ383920) that the parent obtains by orthogenesis that sets out with the lipase gene of different sources.
<400>
1 atgggtatct?ttgactataa?aaacctcggc?accgagggct?ccaaaacgct?gttcgccgat
61 gccatcgcga?tcacgctgta?ttcctaccac?aacctggata?acggccttgc?cgtgggttac
121?caacacaacg?gcctggggct?gggcttgccg?gcgacgttgg?tcggtgcgct?gctgggcagc
181?acgaactccc?agggcgtgat?ccctggcatt?ccctggaacc?ccgactcgga?aaaagctgcg
241?ctggaagcgg?tgcaaaaagc?cggctggacg?cccatcagcg?ccagtgacct?gggctatggc
301?ggcaaggtcg?atgggcgcgg?cactttcttt?ggcgaaaagg?ccggctacac?cacggcccag
361?gtcgaagtgc?tcggcaagta?cgatgacgcc?ggcaagctgc?tggaaattgg?catcggtttt
421?cgtggtactt?caggcccacg?ggaaagcctg?atcagcgact?ccatcggcga?tctggtcagc
481?gatctgctcg?cggccctggg?gcccaaggat?tacgcgaaaa?actacgccgg?cgaagccttc
541?ggcggtttgc?tcaagaacat?cgctgactac?gccagtgccc?acggcctcag?cggccacgag
601?gtggtagtca?gcggccacag?cctgggtggc?cttgcggtga?acagcatggc?ggatttaagc
661?aacaacaaat?ggtcggggtt?ctacaaggac?gccaactacg?tggcctatgc?ctcaccgacc
721?cagagcgcgg?gcgataaagt?gttgaacatc?ggctacgaaa?acgacccggt?gttccgcgcg
781?cttgacggct?catccttcaa?cttgtcgtcc?ctgggcgtgc?acgacaaacc?ccacgagtcg
841?accaccgaca?atatcgtcag?cttcaacgac?cactacgcct?cgacgctgtg?gaatatcctg
901?ccgttttcga?tcgtcaacct?gccgacctgg?gtctcgcatt?tgcccaccgg?ctatggcgac
961?ggcatgacgc?gcatcctcga?gtccggcttc?tacgaccaga?tgacccgcga?ctccacggtg
1021atcgtcgcca?acctgtccga?cccggcgcgg?gccaccacct?gggtgcaaga?cctcaaccgc
1081aatgccgaac?cccacaagag?caacaccttc?atcatcggca?gccacggcaa?tgacctgatc
1141cagggcggca?agggcgcaga?ctttatcgaa?ggcggcaaag?gcaatgacac?gatccgcgac
1201aacagtgggc?ataacacctt?cctgttcagc?ggtaattttg?gcaatgatcg?ggtgatcggc
1261taccaaacca?cggacaagct?ggtgttccag?aacgtggagg?gcagcaccga?cctgcgcgac
1321catgccaaag?tggtcggtgc?cgacacggtg?ctcacttttg?gcgccgactc?ggtgaccctg
1381gtcggcgttg?ggcatggcgg?cctgtgggcg?gacggggtca?gcatcggctg?a
<210>2
<211>476
<212>PRT
＜213〉heterozygosis lipase gene lipMix1 amino acid sequence coded
<400>
1 MGIFDYKNLG?TEGSKTLFAD?AIAITLYSYH?NLDNGLAVGY?QHNGLGLGLP
61 ATLVGALLGS?TNSQGVIPGI?PWNPDSEKAA?LEAVQKAGWT?PISASDLGYG
101?GKVDGRGTFF?GEKAGYTTAQ?VEVLGKYDDA?GKLLEIGIGF?RGTSGPRESL
161?ISDSIGDLVS?DLLAALGPKD?YAKNYAGEAF?GGLLKNIADY?ASAHGLSGHE
201?VVVSGHSLGG?LAVNSMADLS?NNKWSGFYKD?ANYVAYASPT?QSAGDKVLNI
261?GYENDPVFRA?LDGSSFNLSS?LGVHDKPHES?TTDNIVSFND?HYASTLWNIL
301?PFSIVNLPTW?VSHLPTGYGD?GMTRILESGF?YDQMTRDSTV?IVANLSDPAR
361?ATTWVQDLNR?NAEPHKSNTF?IIGSHGNDLI?QGGKGADFIE?GGKGNDTIRD
401?NSGHNTFLFS?GNFGNDRVIG?YQTTDKLVFQ?NVEGSTDLRD?HAKVVGADTV
461?LTFGADSVTL?VGVGHGGLWA?DGVSIG
<210>3
<211>40
<212>DNA
＜213〉FL01 gene (GenBank NO.NC_001133)
＜223〉primers F OLf-Hind III
<400>
<210>4
<211>40
<212>DNA
＜213〉FL01 gene (GenBank NO.NC_001133)
＜223〉primers F OLr-Bgl II
<400>
gatagatctggtgatttgtcctgaagatgatgatgacaaa
40
<210>5
<211>36
<212>DNA
＜213〉lipase gene lipB52 (Genbank NO.AY623009)
＜223〉primer LipB52Pf
<400>
aaagaattcccaacaaaaagagaggcaacagcaatg 36
<210>6
<211>35
<212>DNA
＜213〉lipase gene lipB52 (Genbank NO.AY623009)
＜223〉primer LipB52Pr
<400>
aaagcggccgctccctccccacccttgtcgtcagg 35
<210>7
<211>24
<212>DNA
＜213〉sequence of yeast saccharomyces cerevisiae presenting and expressing carrier pLHJ042
＜223〉primer pLHJ042F
<400>
cactgaaccatggaccggaacttt
24
<210>8
<211>20
<212>DNA
＜213〉sequence of yeast saccharomyces cerevisiae presenting and expressing carrier pLHJ042
＜223〉primer pLHJ042R
<400>
Claims (4)
1, a kind of directed evolution method of lipase gene efficiently is characterized in that step is:
1) yeast saccharomyces cerevisiae presenting and expressing vector construction:
Utilize yeast cell Flop membranin or a-lectin, α-lectin, etc. membranin make up and be fit to the presenting and expressing carrier that lipase is expressed;
2) lipase yeast saccharomyces cerevisiae presenting and expressing construction of recombinant plasmid:
Utilize yeast saccharomyces cerevisiae presenting and expressing carrier, make up different sources, have the recombinant vectors of lipase gene presenting and expressing in yeast saccharomyces cerevisiae of certain homology;
3) the lipase gene fragment of band carrier homologous sequence obtains and expresses the structure in sudden change library:
According to presenting and expressing carrier sequences Design primer, pcr amplification has the different sources lipase gene fragment of yeast saccharomyces cerevisiae presenting and expressing carrier homologous sequence; The lipase gene fragment that will have the carrier homologous sequence is mixed with linearizing presenting and expressing carrier, and transformed saccharomyces cerevisiae obtains expressing the sudden change library;
4) presenting and expressing sudden change library and mutant analysis: the lipase gene of different sources is realized homologous recombination in yeast saccharomyces cerevisiae, obtains presenting and expressing sudden change library.
2, a kind of directed evolution method of lipase gene efficiently according to claim 1, it is characterized in that yeast saccharomyces cerevisiae presenting and expressing vector construction is: utilize yeast cell Flop membranin, the primer of the functional zone encoding sequence of wadding a quilt with cotton with fixed attention of design Flo1p: FOLf-Hind III and FOLr-Bgl II (FOLf-Hind III:5 '-acataagcttatgacaatgcctcatcgctatatgtttttg-3 ' FOLr-Bgl II:5 '-gatagatctggtgatttgtcctgaagatgatgatgacaaa-3 '), total DNA with Saccharomyces Cerevisiae in S .cerevisiae ATCC 60715 is the functional zone coding sequence fragment of wadding a quilt with cotton with fixed attention that the template pcr amplification obtains Flo1p, with this sheet cracked ends Hind III, behind the Bgl II double digestion with through Hind III, the yeast saccharomyces cerevisiae expression vector pYES2/NT of BamH I double digestion connects (Bgl II and BamH I be isocaudarner each other) under the effect of T4 dna ligase, obtaining with the Flo1p functional zone of wadding a quilt with cotton with fixed attention is the yeast saccharomyces cerevisiae presenting and expressing carrier pLHJ042 of mediation anchor hop protein.
3, a kind of directed evolution method of lipase gene efficiently according to claim 1, it is characterized in that lipase yeast saccharomyces cerevisiae presenting and expressing construction of recombinant plasmid is: with its full-length gene primer of lipase gene lipB52 (Genbank NO.AY623009) sequences Design LipB52Pf (5 '-aaagaattcccaacaaaaagagaggcaacagcaatg-3 '), LipB52Pr (5 '-aaagcggccgctccctccccacccttgtcgtcagg-3 '), with P.fluorescens B52 genomic dna is that the template pcr amplification obtains lipB52 full-length gene fragment, use restriction enzyme Eco RI behind this segment purifying, Not I double digestion, glue reclaim the lipB52 gene fragment of double digestion with through Eco RI, the yeast saccharomyces cerevisiae presenting and expressing carrier pLHJ042 of Not I double digestion connects under the effect of T4 dna ligase, obtains lipB52 gene yeast saccharomyces cerevisiae presenting and expressing plasmid pLHJ044.
4, a kind of directed evolution method of lipase gene efficiently according to claim 1, it is characterized in that with the lipase gene fragment acquisition of carrier homologous sequence and the structure in expression sudden change library being: the sequence according to yeast saccharomyces cerevisiae presenting and expressing carrier pLHJ042 designs the primer pLHJ042F that is positioned at the multiple clone site two ends respectively, pLHJ042R, the sequence of primer pLHJ042F (5 '-cactgaaccatggaccggaacttt-3 ') is positioned at the Flo1p functional zone encoding sequence of wadding a quilt with cotton with fixed attention, the sequence of primer pLHJ042R (5 '-ggggggagggcgtgaatgta-3 ') is positioned at terminator CYC1TT sequence, respectively with pLHJ044, pLHJ052, pLHJ053 and pLHJ042-B68 are template, with pLHJ042F, pLHJ042R is that primer is right, and pcr amplification obtains having the segment of the different sources lipase gene of yeast saccharomyces cerevisiae presenting and expressing carrier homologous sequence;
With above-mentioned segment and through the linearizing yeast saccharomyces cerevisiae presenting and expressing of double digestion carrier pLHJ042 mixture, transformed saccharomyces cerevisiae INVSc1, coating contains the SC-U flat board (URA of glucose
-), 30 ℃ of cultivations, after waiting to grow transformant, the switching transformant is to the dull and stereotyped 30 ℃ of cultivation 24h of the SC-U that contains glucose, transformant is forwarded to adds dull and stereotyped 30 ℃ of cultivations of SC-U that 1% sweet oil and 0.002%Rhodamine B contain 2% semi-lactosi, utilize semi-lactosi to induce the expression of target protein, obtain expressing the sudden change library.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910063845A CN101643941A (en) | 2009-09-07 | 2009-09-07 | High-efficiency directed evolution method of lipase gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910063845A CN101643941A (en) | 2009-09-07 | 2009-09-07 | High-efficiency directed evolution method of lipase gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101643941A true CN101643941A (en) | 2010-02-10 |
Family
ID=41655996
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910063845A Pending CN101643941A (en) | 2009-09-07 | 2009-09-07 | High-efficiency directed evolution method of lipase gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101643941A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102242106A (en) * | 2010-05-14 | 2011-11-16 | 浙江大学 | Method for improving persistency of glutamic acid decarboxylase activity |
| CN102660517A (en) * | 2011-12-08 | 2012-09-12 | 上海交通大学 | Lipase mutant with improved heat stability, and construction method thereof |
| CN114058526A (en) * | 2021-11-18 | 2022-02-18 | 广西科学院 | Saccharomyces cerevisiae engineering bacterium for displaying alkaline lipase on cell surface as well as preparation method and use method thereof |
| CN114134130A (en) * | 2021-10-11 | 2022-03-04 | 南京大学 | Method for high-throughput screening of nuclease |
-
2009
- 2009-09-07 CN CN200910063845A patent/CN101643941A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102242106A (en) * | 2010-05-14 | 2011-11-16 | 浙江大学 | Method for improving persistency of glutamic acid decarboxylase activity |
| CN102660517A (en) * | 2011-12-08 | 2012-09-12 | 上海交通大学 | Lipase mutant with improved heat stability, and construction method thereof |
| CN102660517B (en) * | 2011-12-08 | 2013-04-03 | 上海交通大学 | Lipase mutant with improved heat stability, and construction method thereof |
| CN114134130A (en) * | 2021-10-11 | 2022-03-04 | 南京大学 | Method for high-throughput screening of nuclease |
| CN114134130B (en) * | 2021-10-11 | 2023-06-27 | 南京大学 | Method for high-throughput screening of nuclease |
| CN114058526A (en) * | 2021-11-18 | 2022-02-18 | 广西科学院 | Saccharomyces cerevisiae engineering bacterium for displaying alkaline lipase on cell surface as well as preparation method and use method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gullo et al. | Exploring K2G30 genome: a high bacterial cellulose producing strain in glucose and mannitol based media | |
| Schallmey et al. | Developments in the use of Bacillus species for industrial production | |
| Han et al. | Kinetic analysis of a crude enzyme extract produced via solid state fermentation of bakery waste | |
| EP3091070B1 (en) | Genetic recombinant saccharomyces cerevisiae capable of degrading and utilizing kitchen wastes | |
| CN107794252A (en) | The genetic engineering bacterium for PET of degrading | |
| CN110055204B (en) | Method for improving fermentation enzyme production of bacillus licheniformis by knocking out spo II Q and pcf genes and application | |
| Romero et al. | Characterization of an ethanol‐tolerant 1, 4‐β‐xylosidase produced by Pichia membranifaciens | |
| CN101643941A (en) | High-efficiency directed evolution method of lipase gene | |
| CN116240121A (en) | Kluyveromyces marxianus, fermentation method, composition and application thereof | |
| CN106635920A (en) | High-yield fucoidanase ocean alternating pseudomonas and application thereof | |
| Wang et al. | Enhanced protein glutaminase production from Chryseobacterium proteolyticum combining physico‐chemical mutagenesis and resistance screening and its application to soybean protein isolates | |
| CN104726432B (en) | A kind of D types β glucosides enzyme mutant and its expression plasmid and recombinant bacterium | |
| CN104789586B (en) | Genome of E.coli integration vector, genetic engineering bacterium and the application in xylitol is produced | |
| CN104630184A (en) | Alkaline xylanase as well as encoding gene and application thereof | |
| CN105274041B (en) | One plant of recombination bacillus coli and its application in production 2- butanol | |
| CN101487019A (en) | Candida utilis expression vector and construction method thereof | |
| CN102559622A (en) | Method for high-efficiency production of recombinant lipoxygenase by using Bacillus subtilis | |
| CN105602914B (en) | It is a kind of from the alkyl peroxide reductase and thioredoxin reductase of kluyveromyces marxianus and its application | |
| CN104726388A (en) | Pullulanase enzyme-producing strain and method for improving enzyme-producing capacity thereof | |
| CN101643740A (en) | Anabaena PCC7120 fat oxygenase gene | |
| CN104087604A (en) | Genetic expression sequence of inulin fructotransferase | |
| CN103911337A (en) | High adhesion clostridium butyricum and its preparation method | |
| CN103290039B (en) | Alpha-amylase derived from animal feces metagenome and gene of the alpha-amylase | |
| CN101302559A (en) | Rapid plasmid rescue method for screening directional evolution mutant enzyme | |
| Sun et al. | Phenotypic and genotypic characterisation of Lactobacillus and yeast isolates from a traditional New Zealand Māori potato starter culture |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20100210 |