CN101643794B - Dual real-time fluorescent RT-PCR identification and detection method of PRRSV classic strain and highly pathogenic mutant strain - Google Patents
Dual real-time fluorescent RT-PCR identification and detection method of PRRSV classic strain and highly pathogenic mutant strain Download PDFInfo
- Publication number
- CN101643794B CN101643794B CN2009100777048A CN200910077704A CN101643794B CN 101643794 B CN101643794 B CN 101643794B CN 2009100777048 A CN2009100777048 A CN 2009100777048A CN 200910077704 A CN200910077704 A CN 200910077704A CN 101643794 B CN101643794 B CN 101643794B
- Authority
- CN
- China
- Prior art keywords
- prrsv
- strain
- highly pathogenic
- pathogenic mutant
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention discloses a dual real-time fluorescent RT-PCR method for identifying and detecting a PRRSV classic strain and a highly pathogenic mutant strain, and an RT-PCR cation primer and a probe against the PRRSV classic strain and the highly pathogenic mutant strain for the method. Compared with the prior art, the method is characterized by rapidness, simplicity, strong specificity, high sensitivity and good reliability and can simultaneously carry out large batch sample analysis, and one-time reaction can identify and diagnose whether a sample is infected by the PRRSV classic strain or infected by the PRRSV highly pathogenic mutant strain or infected by the two strains, thereby providing a powerful technical support for monitoring and controlling a PRRS epidemic disease and having good application prospects.
Description
Technical field
The present invention relates to biological technical field, specifically is a kind of method that detects classical strain of porcine reproductive and respiratory syndrome virus and highly pathogenic mutant strain with Auele Specific Primer and probe simultaneously.
Background technology
Porcine reproductive and respiratory syndrome (Porcine reproductive and respiratory syndrome, PRRS) be by porcine reproductive and respiratory syndrome virus (Porcine reproductive and respiratory syndrome virus, the contagious disease that PRRSV) causes.PRRSV at first is separated in the Holland and the U.S., and respectively as the prototype strain of Europe class (LV) and american type (VR-2332).The countries and regions of PRRS each pig industry prosperity of extend over the entire globe have at present brought enormous economic loss for world's pig industry and relevant industries thereof.In recent years, China has separated strains such as PRRSVCH-1a, S1, HB-1 and HB-2 in succession, is american type PRRSV through evaluation.Since in June, 2006, the pig farm in the most of provinces of China, family outburst pig " hyperpyrexia disease " epidemic situation are feature with fever, sickness rate height, mortality ratio height clinically, have caused enormous economic loss for the pig industry of China.In January, 2007, definite its protopathy of the Ministry of Agriculture come from american type PRRSV, but its virulence is far above former domestic popular PRRSV strain because of being the strain of PRRSV highly pathogenic mutant.
The common method that detects PRRSV at present mainly contains viral isolation identification, serology detects and common RT-PCR, but these ordinary methods waste time and energy, susceptibility is low and occur false positive easily.Set up real-time fluorescent RT-PCR method for detecting both at home and abroad at all PRRSV, but can only detecting, this method whether have PRRSV to infect, can't judge it is that the classical strain of PRRSV is infected, or PRRSV highly pathogenic mutant strain infection, or both co-infected.In addition, existing real-time fluorescent RT-PCR method for detecting at the strain of PRRSV highly pathogenic mutant, can only detect the strain of PRRSV highly pathogenic mutant, can't judge it is that single PRRSV highly pathogenic mutant strain is infected, or classical strain of PRRSV and highly pathogenic mutant strain co-infected.Even existing two kinds of PRRSV real-time fluorescence RT-PCR methods are united use, still can't judge the problem that whether has co-infected, can't provide powerful technical support for China monitors the PRRSV epidemic situation quickly and efficiently.Therefore, it is significant with the detection method of highly pathogenic mutant strain " step " discriminating to set up the classical strain of PRRSV of a kind of fast and convenient, high specificity, susceptibility height, good reliability.
Summary of the invention
The objective of the invention is to overcome the prior art deficiency, provide classical strain of a kind of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT to differentiate detection method.This method only needs one-time detection can judge just whether sample contains the classical strain of PRRSV, perhaps contains the strain of PRRSV highly pathogenic mutant, or both co-infected.This method is fast and convenient, high specificity, susceptibility height, good reliability, can carry out large batch of sample analysis simultaneously, for monitoring, the prevention and control of PRRS epidemic situation provide powerful technical support, good application prospects is arranged.
The present invention is achieved by the following technical solutions:
The classical strain of PRRSV: american type PRRSV standard strain VR2332 and domestic strain isolated CH-1a are provided by Ministry of Agriculture's animal doctor's diagnositc center.
The strain of PRRSV highly pathogenic mutant: by the NVDC-JXA1 strain of China Animal Disease Control And Prevention Center's isolation identification, deposit number is CGMCC No.1964, and the patent No. that relates to is ZL200710086549.7.
Other strains of using in research process of the present invention comprise: Europe class PRRSV standard strain LV, equine arteritis virus (EAV), Pestivirus suis (CSFV), Japanese B encephalitis virus (JEV), pig circular ring virus (PCV1, PCV2), pig parvoviral (PPV) and PRV (Pseudorabies virus) (PRV) provide by Ministry of Agriculture's animal doctor's diagnositc center.
(1) virus-specific primer and probe design
Described virus-specific primer refers to: length is 20 oligonucleotide chains about base, with the identical or reverse complemental of specificity nucleotide fragments of the classical strain of PRRSV, PRRSV highly pathogenic mutant strain ORF1a gene high conservative region;
Described virus-specific probe, refer to: length is 13 to 21 oligonucleotide chains between the base, fluorescence excitation groups such as its 5 ' end flag F AM or HEX, the non-luminous quenching group of 3 ' end mark self, increase simultaneously a minor groove binders (minor groove binder in addition, MGB) molecule is with the identical or reverse complemental of specificity nucleotide fragments of the classical strain of PRRSV, highly pathogenic mutant strain ORF1a gene high conservative region.
The nucleotide sequence that this paper is listed is write to 3 ' extreme direction by 5 ' end.
1. the amplification oligonucleotide primer and the probe sequence that are used to detect the classical strain of PRRSV comprise:
It is right to classify the primer that the upstream primer PRRSV-F2 of CGCACCAGATGGRACCTACTT and downstream primer PRRSV-R3 that nucleotides sequence is classified ACGGTGTTCAGTGAGGGCTTT as form as by nucleotides sequence; And the primer of being made up of the reverse complementary sequence AAAGCCCTCACTGAACACCGT of the reverse complementary sequence AAGTAGGTYCCATCTGGTGCG of upstream primer and downstream primer is right; 49 bases are extended to 5 ' extreme direction, primer sequence and reverse complementary sequence thereof that downstream primer PRRSV-R3 position is extended 60 bases and obtained to 3 ' extreme direction in the right upstream primer PRRSV-F2 position of this primer in 5 ' extreme direction extends 33 base zone scopes.
The nucleotides sequence of probe PRRSV-P is classified CCAGTCAACGCAGCG as, and reverse complementary sequence is CGCTGCGTTGACTGG, and this probe probe sequence and the reverse complementary sequence thereof that obtain in 3 ' extreme direction extends 8 base zone scopes.
2. the amplification oligonucleotide primer and the probe sequence that are used to detect the strain of PRRSV highly pathogenic mutant comprise:
It is right to classify the primer that the upstream primer H-PRRSV-F2 of AGTGGGTCGGCACCAGTT and downstream primer H-PRRSV-R12 that nucleotides sequence is classified GCAGACAAATCCAGAGGCTCAT as form as by nucleotides sequence; And the primer of being made up of the reverse complementary sequence ATGAGCCTCTGGATTTGTCTGC of the reverse complementary sequence AACTGGTGCCGACCCACT of upstream primer and downstream primer is right; 28 bases are extended to 5 ' extreme direction, primer sequence and reverse complementary sequence thereof that downstream primer H-PRRSV-R12 position obtains in the right upstream primer H-PRRSV-F2 position of this primer in 3 ' extreme direction extends 39 base zone scopes.
The nucleotides sequence of probe H-PRRSV-P is classified CGTAGAACTGTGACAAC as, reverse complementary sequence is GTTGTCACAGTTCTACG, and this probe extends 6 bases and extends probe sequence and the reverse complementary sequence thereof that obtains in 12 base zone scopes to 3 ' end to 5 ' extreme direction.
The invention still further relates to a kind of Oligonucleolide primers that is used for detecting simultaneously classical strain of PRRSV and highly pathogenic mutant strain to the composition of probe, comprise above-mentioned primer to and probe.
In addition, also above-mentioned composition can be prepared into test kit.
Further, the invention still further relates to test kit and detect purposes in classical strain of PRRSV and the highly pathogenic mutant strain at the same time, probe wherein is fluorescein-labelled with any one, and the fluorescein that must be to use different sense channels of two kinds of probe marks all can be selected from FAM, VIC, HEX, JOE, NED, TAMRA, CY3, ROX or CY5.
A kind of dual real-time fluorescent RT method of utilizing above-mentioned composition to detect classical strain of PRRSV and highly pathogenic mutant strain simultaneously comprises:
(1) at the Auele Specific Primer and the probe sequence that can differentiate classical strain of PRRSV and highly pathogenic mutant strain of PRRSV ORF1a gene design;
(2) with the probe of the classical strain of fluorescein-labeled PRRSV, and the probe of the another kind of fluorescein-labeled PRRSV highly pathogenic mutant strain by different sense channels detections; Probe wherein is fluorescein-labelled with any one, and two kinds of probe marks must be the fluorescein that detects by different sense channels, all can be selected from FAM, VIC, HEX, JOE, NED, TAMRA, CY3, ROX or CY5.
(3) will be used to detect the primer and the probe sequence of classical strain of PRRSV or highly pathogenic mutant strain, or be used to differentiate the primer and the probe sequence of classical strain of PRRSV and highly pathogenic mutant strain, place same reaction tubes, use fluorescent PCR amplification instrument to carry out the real-time fluorescence RT-PCR reaction.
Distinguishing feature of the present invention is: fully use the efficient amplification of round pcr, the good specificity of nucleic acid hybridization technique and the quick susceptibility of detection technique of fluorescence, same sample is carried out the discriminating detection that the one-time detection operation can be finished classical strain of PRRSV and highly pathogenic mutant strain, can determine that sample is that the classical strain of PRRSV is infected, or PRRSV highly pathogenic mutant strain infection, or both co-infected.Having fast and convenient, high specificity, susceptibility height, good reliability, reduction detects cost, improves advantage such as detection efficiency.
Description of drawings
Fig. 1 is a single stage method RT-PCR method schematic diagram.
Fig. 2 is a TaqMan probe method schematic diagram.
Fig. 3 is double fluorescent RT-PCR primer and probe optimization combined sorting figure (A is the classical strain primer of a PRRSV probe The selection result, and B is a PRRSV highly pathogenic mutant strain primer probe The selection result). Curve 1,2,3,4 is that the classical strain probe of PRRSV and primer are to the combined sorting result among the A.Curve 1 is the amplification of primer to PRRSV-F2/PRRSV-R3 and probe PRRSV-P combination among the figure, and curve 2,3,4 is other combined sorting amplification situation.Curve 1,2,3,4 is that PRRSV highly pathogenic mutant strain probe and primer are to the combined sorting result among the B.Curve 1 is the amplification of primer to H-PRRSV-F2/H-PRRSV-R12 and probe H-PRRSV-P combination among the figure, and curve 2,3,4 is other combined sorting amplification situation.
Fig. 4 is the classical strain real-time fluorescence RT-PCR of a PRRSV detection specificity amplification curve diagram.Curve 1 is the classical strain VR2332 of a PRRSV specific amplification curve among the figure, and curve 2 is PRRSV highly pathogenic mutant strain (JXA1) and other virus (LV, EAV, CSFV, JEV, PCV1, PCV2, PPV and PRV) amplification situation.
Fig. 5 is a PRRSV highly pathogenic mutant strain real-time fluorescence RT-PCR detection specificity amplification curve diagram.Curve 1 is a PRRSV highly pathogenic mutant strain JXA1 specific amplification curve among the figure, and curve 2 is PRRSV classical strains (VR2332, CH-1a) and other viruses (LV, EAV, CSFV, JEV, PCV1, PCV2, PPV and PRV) amplification situation.
Fig. 6 is that classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT are differentiated detection method specific amplification graphic representation.Curve 1 is the classical strain VR2332 of a PRRSV specific amplification curve among the figure, and curve 2 is a PRRSV highly pathogenic mutant strain JXA1 specific amplification curve, and curve 3 is other viruses (LV, EAV, CSFV, JEV, PCV1, PCV2, PPV and PRV) amplification situations.
Fig. 7 is for differentiating that with classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT detection method detects the susceptibility amplification curve diagram of the classical strain of PRRSV.To represent VR2332 respectively be TCID5010 in concentration to curve 1-7 among the figure
5.5～10
0.5The time amplification.
Fig. 8 is for differentiating that with classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT detection method detects the susceptibility amplification curve diagram of PRRSV highly pathogenic mutant strain.To represent JXA1 respectively be TCID50 10 in concentration to curve 1-8 among the figure
5.6～10
1.4The time amplification.
Embodiment
Normal experiment method in the following example, referring to " molecular cloning experiment guide " third edition (Beijing: Science Press, 2002) that Sambrook etc. writes, the use of instrument is with reference to the instrumentation specification sheets.
The structure of standard substance RNA
(1) experiment reagent
Restriction Enzyme Pst I, enzyme are cut corresponding damping fluid 10 * H Buffer and DL2000Marker available from TaKaRa company;
-T Easy connects test kit, Taq archaeal dna polymerase, AMV ThermoScript II, RNA enzyme inhibitors, dNTPs available from Promega company;
DNA glue reclaims test kit, available from OMEGA company;
Efficient competent escherichia coli cell DH5 α is available from the Beijing Quanshijin Biotechnology Co., Ltd;
Primer is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd;
Other biochemical reagents are import packing or homemade analytical pure.
(2) laboratory apparatus
TGRANDIENT PCR instrument: available from HYBAID company;
DYFIII2 type electrophoresis apparatus: available from Bio-Rad company;
UVP gel imaging analysis system: available from Gene company;
Steril
Biohazard Safety Equipment: available from BAKER company;
Thermostat water bath: available from pHaramacia company;
Constant incubator: available from Kendro company.
(3) experimental procedure
1. on GeneBank, search known PRRSV genome sequence, determine the specificity high conservative region of the ORF1a gene of classical strain of PRRSV and highly pathogenic mutant strain by sequence alignment.Design comprises classical strain of PRRSV and the segmental primer of highly pathogenic mutant strain real-time fluorescence RT-PCR amplification of nucleotide, and primer sequence sees Table 1.RNA with classical strain of PRRSV and highly pathogenic mutant strain is a template, carry out the RT-PCR amplification, RT-PCR amplification system and amplification condition see Table 2, and the nucleotide fragments of the conserved sequence that contains classical strain of PRRSV or highly pathogenic mutant strain that will obtain by amplification is called gene PRRSV-Nsp3 and gene H-PRRSV-Nsp2;
2. gene PRRSV-Nsp3 that amplification is obtained and gene H-PRRSV-Nsp2 nucleotide fragments purifying reclaim, and are connected respectively to
-T Easy carrier (10 μ L linked systems: 3 μ L gene amplification products, 1 μ LpGEM-T Easy carrier, 1 μ L T4 dna ligase, 5 μ L T4 DNA connect damping fluid; 4 ℃ are spent the night), will connect product then and be transformed into DH5 α competent cell.By the purifying and the evaluation of plasmid, gene PRRSV-Nsp3 and gene H-PRRSV-Nsp2 segmental standard plasmid molecule called after pGEM-T/P-Nsp3 and pGEM-T/HP-Nsp2 will be contained respectively;
3. with Pst I with pGEM-T/P-Nsp3 and pGEM-T/HP-Nsp2 recombinant plasmid enzyme tangent line shapeization, be that template is carried out in-vitro transcription and (used Promega RiboMAX with the linearizing fragment again
TMLarge Scale RNA ProductionSystem-T7 test kit), reaction finishes the dna molecular that back adding RQ1 DNA enzyme in the in-vitro transcription product is removed remnants.Through extracting and purifying, obtain standard substance RNA molecule.
The amplimer sequence of table 1 PRRSV standard substance
The RT-PCR amplification system of table 2-1 PRRSV standard substance
| Reaction reagent | Volume (μ L) | |
| 5×Green? |
5 | 1× |
| 2.5 |
2 | |
| 10 μ M primer * | 1.25 | 500nM/each |
| 5U/ |
1 | 0.2U/μL |
| 10U/ μ LAMV ThermoScript II | 0.2 | 0.08U/μL |
| 40U/ μ L RNA enzyme inhibitors | 0.3 | 0.48U/μL |
| 10ng/ μ L RNA template | 2.5 | 1ng/μL |
| ddH 2O | Complement to 25 | --- |
Attached: the * the primer is corresponding with the primer in the table 1.
The RT-PCR amplification condition of table 2-2 PRRSV standard substance
The extraction of sample rna
According to manufacturer's suggestion,, utilize QIAGEN according to ordinary method
Mini Kit test kit (available from QIAGEN company), perhaps according to GTC method (guanidine isothiocyanate method) (
Total RNA IsolationSystem test kit is available from Promega company) extract the RNA of various sources sample to be checked.
The classical strain of PRRSV and highly pathogenic mutant strain real-time fluorescence RT-PCR method Auele Specific Primer and probe shaker test
(1) experiment reagent
One Step PrimeScript
TMRT-PCR Kit (Perfect Real Time) test kit is available from TaKaRa company;
Classical strain of PRRSV and highly pathogenic mutant strain TaqMan MGB probe and primer are synthetic by Jikang Biotechnology Co Ltd, Shanghai.
(2) laboratory apparatus
Applied?Biosystems?7500?Real-Time?PCR?System
(3) experimentation
1. the primer and the probe design of classical strain of PRRSV and highly pathogenic mutant strain
The Auele Specific Primer of classical strain of PRRSV and highly pathogenic mutant strain, refer to: length is 20 oligonucleotide chains about base, respectively with the identical or reverse complemental of specificity nucleotide fragments of the classical strain of PRRSV, highly pathogenic mutant strain ORF1a gene high conservative region;
The specific probe of classical strain of PRRSV and highly pathogenic mutant strain, refer to: length is 13 to 21 oligonucleotide chains between the base, fluorescence excitation groups such as its 5 ' end flag F AM or HEX, the non-luminous quenching group of 3 ' end mark self has increased minor groove binders (minor groove binder, MGB) molecule simultaneously in addition; Respectively with the identical or reverse complemental of specificity nucleotide fragments of the classical strain of PRRSV, highly pathogenic mutant strain ORF1a gene high conservative region.
According to the ORF1a gene specific high conservative zone that obtains, utilize Primer Express3.0 software design at a plurality of real-time fluorescence RT-PCR amplimers of classical strain of PRRSV and highly pathogenic mutant strain to the TaqManMGB probe, primer pair sees Table 3 with the concrete sequence of probe.
Table 3 is used for the primer and the probe of classical strain of PRRSV and the screening of highly pathogenic mutant strain real-time fluorescence RT-PCR
2. the reaction system and the condition of classical strain of PRRSV and highly pathogenic mutant strain real-time fluorescence RT-PCR method
The reaction system of classical strain of PRRSV and highly pathogenic mutant strain real-time fluorescence RT-PCR method and condition are with reference to TaKaRa One Step PrimeScript
TMRT-PCR Kit test kit specification sheets, concrete reaction system sees Table 4-1, and reaction conditions sees Table 4-2.
Classical strain of table 4-1 PRRSV and highly pathogenic mutant strain real-time fluorescence RT-PCR method reaction system
| Reaction reagent | Volume (μ L) | |
| 2×One?Step?RT-PCR?BufferIII | 12.5 | 1× |
| 5U/μL?TaKaRa?Ex?Taq TM?HS | 0.5 | 0.1U/μL |
| PrimeScript TM?RT?Enzyme?Mix?II | 0.5 | --- |
| 10 μ M primers are right | 1 | 400nM/each |
| 10 μ M probes | 0.5 | 200nM |
| 50×ROX?Reference?Dye?II | 0.5 | 1× |
| 10ngTotal?RNA | 2.5 | 1ng/μL |
| ddH 2O | 7 | --- |
| |
25 | --- |
The reaction conditions of classical strain of table 4-2 PRRSV and highly pathogenic mutant strain real-time fluorescence RT-PCR method
(4) result judges
1. interpretation of result condition enactment
Read detected result.The threshold setting principle is as the criterion with display result with the vertex of threshold line just above normal negative control product amplification curve.Or can adjust according to instrument noise situation.
2. the result describes and judges
Contrast the amplification situation of different primers pair and probe combinations, follow the specificity principle, susceptibility principle and the most efficient amplification principle, selected specificity is good, susceptibility height, the classical strain of the PRRSV of good reliability and highly pathogenic mutant strain are differentiated and are detected with primer pair and probe best of breed.
(5) shaker test method and result
The optimization screening method of primer and probe is as follows:
Select a pair of primer and a probe to make up arbitrarily and (to PRRSV-F0/PRRSV-R0, add probe PRRSV-P as primer; Primer adds probe PRRSV-P1 to PRRSV-F1/PRRSV-R1; Primer adds probe PRRSV-P2 to PRRSV-F2/PRRSV-R2, and primer adds probe H-PRRSV-P to H-PRRSV-F1/H-PRRSV-R1; Primer adds probe H-PRRSV-P1 to H-PRRSV-F2/H-PRRSV-R2; Primer adds probe H-PRRSV-P2 to H-PRRSV-F3/H-PRRSV-R3; Or the like), be screening criteria can obtain minimum Ct value and the highest amplification efficiency simultaneously, select best primer and probe combinations.
By repeatedly repeat, simultaneous test, the classical strain of selected PRRSV and highly pathogenic mutant strain are differentiated and are detected with the primer pair best of breed with probe, combined sorting result such as Fig. 3 A and 3B, specifically sequence sees Table 5.
The primer and the probe sequence of classical strain of table 5 PRRSV and highly pathogenic mutant strain real-time fluorescence RT-PCR method
The classical strain real-time fluorescent RT-PCR method for detecting of PRRSV
(1) experiment reagent
One Step PrimeScript
TMRT-PCR Kit (Perfect Real Time) test kit is available from TaKaRa company;
Classical strain TaqMan MGB probe of PRRSV and primer are synthetic by Jikang Biotechnology Co Ltd, Shanghai.
(2) laboratory apparatus
Applied?Biosystems?7500?Real-Time?PCR?System
(3) experimentation
1. the primer and the probe design of the classical strain real-time fluorescence RT-PCR of PRRSV method
The primer of the classical strain real-time fluorescence RT-PCR of PRRSV method and probe design are referring to embodiment 3, and concrete sequence sees Table 5.
2. the reaction system and the condition of the classical strain real-time fluorescence RT-PCR of PRRSV method
The optimization principles of the classical strain real-time fluorescence RT-PCR of PRRSV method is: make same sample obtain maximum amplification efficiency and minimum Ct value by optimizing following each condition.
Determining of a, best fluorescent primer concentration: fluorescent primer concentration is screened between the 800nM at 300nM.
Determining of b, best concentration and probe concentration: concentration and probe concentration is screened between the 500nM at 100nM.
Determining of c, best magnesium ion concentration: Mg
2+Concentration is screened between the 8mM at 3mM.
The consumption of d, ThermoScript II is determined: the consumption of ThermoScript II screens between the 5U at 1U.
The consumption of e, Taq archaeal dna polymerase is determined: the consumption of Taq polysaccharase screens between the 5U at 1U.
F, best dNTPs concentration are determined: dNTPs concentration is screened between 500 μ M at 100 μ M.
Through optimizing, the reaction system of the classical strain real-time fluorescence RT-PCR of PRRSV method sees Table 6-1; Reaction conditions sees Table 6-2.
The classical strain specificity fluorescent of table 6-1 PRRSV RT-PCR detection architecture
| Reaction reagent | Volume (μ L) | |
| 2×One?Step?RT-PCR?BufferIII | 12.5 | 1× |
| 5U/μL?TaKaRa?Ex?Taq TM?HS | 0.5 | 0.1U/μL |
| PrimeScript TM?RT?Enzyme?Mix?II | 0.5 | --- |
| 10μM?PRRSV-F2 10μM?PRRSV- |
1 | 400nM/each |
| 10μM?PRRSV-P | 0.5 | 200nM |
| 50×ROX?Reference?Dye?II | 0.5 | 1× |
| 10ng?Total?RNA | 2.5 | 1ng |
| ddH 2O | 7 | --- |
| |
25 | --- |
The classical strain specificity fluorescent of table 6-2PRRSV RT-PCR detects amplification condition
(4) result judges
1. interpretation of result condition enactment
Read detected result.The threshold setting principle is as the criterion with display result with the vertex of threshold line just above normal negative control product amplification curve.Or can adjust according to instrument noise situation.
2. quality control standard
Negative control does not have the Ct value and does not have the specific amplification curve;
The Ct value of positive control answers＜37, and the specific amplification curve occurs.Otherwise it is invalid that experiment this time is considered as.
3. the result describes and judges
Negative sample does not have the Ct value and does not have the specific amplification curve, the classical strain virus of no PRRS in the expression sample.
Positive sample Ct value＜37, and the specific amplification curve appears, the classical strain virus of PRRS is arranged in the expression sample.
Effective principle: sample Ct value need be carried out revision test between 37-45 the time.Ct value＜37 o'clock sample is positive as a result for revision test, otherwise negative.
(5) pattern detection test and result
Test is to PRRSV classical strains (VR2332), PRRSV highly pathogenic mutant strain (JXA1), Europe class PRRSV standard strain (LV), equine arteritis virus (EAV), Pestivirus suis (CSFV), Japanese B encephalitis virus (JEV), pig circular ring virus (PCV1, PCV2), pig parvoviral (PPV) and PRV (Pseudorabies virus) (PRV) increase, the result has only PRRSV classical strains (VR2332) to obtain specific amplified fluorescence curve (Fig. 4).
The optimization and the foundation of PRRSV highly pathogenic mutant strain real-time fluorescence RT-PCR method
(1) experiment reagent
One Step PrimeScript
TMRT-PCR Kit (Perfect Real Time) test kit is available from TaKaRa company;
PRRSV highly pathogenic mutant strain TaqMan MGB probe and primer are synthetic by Jikang Biotechnology Co Ltd, Shanghai.
(2) laboratory apparatus
Applied?Biosystems?7500?Real-Time?PCR?System
(3) experimentation
1. the primer and the probe design of PRRSV highly pathogenic mutant strain real-time fluorescence RT-PCR method
Primer that PRRSV highly pathogenic mutant strain specificity RT-PCR detects and probe design are referring to embodiment 3, and concrete sequence sees Table 5.
2. the reaction system and the condition of PRRSV highly pathogenic mutant strain real-time fluorescence RT-PCR method
The optimization principles of the classical strain real-time fluorescence RT-PCR of PRRSV method is: make same sample obtain maximum amplification efficiency and minimum Ct value by optimizing following each condition.
Determining of a, best fluorescent primer concentration: fluorescent primer concentration is screened between the 800nM at 300nM.
Determining of b, best concentration and probe concentration: concentration and probe concentration is screened between the 500nM at 100nM.
Determining of c, best magnesium ion concentration: Mg
2+Concentration is screened between the 8mM at 3mM.
The consumption of d, ThermoScript II is determined: the consumption of ThermoScript II screens between the 5U at 1U.
The consumption of e, Taq archaeal dna polymerase is determined: the consumption of Taq polysaccharase screens between the 5U at 1U.
F, best dNTPs concentration are determined: dNTPs concentration is screened between 500 μ M at 100 μ M.
Through optimizing, the reaction system of PRRSV highly pathogenic mutant strain real-time fluorescence RT-PCR method sees Table 7-1; Reaction conditions sees Table 7-2.
Table 7-1 PRRSV highly pathogenic mutant strain specificity RT-PCR detection architecture
| Reaction reagent | Volume (μ L) | |
| 2×One?Step?RT-PCR?BufferIII | 12.5 | 1× |
| TaKaRa?Ex?Taq TM?HS | 0.5 | 0.1U/μL |
| PrimeScript TM?RT?Enzyme?Mix?II | 0.5 | --- |
| 10μM?H-PRRSV-F2 10μM?H-PRRSV-R12 | 1.25 | 500nM/each |
| 10μM?H-PRRSV-P | 0.5 | 200nM |
| 50×ROX?Reference?Dye?II | 0.5 | 1× |
| 10ng?Total?RNA | 2.5 | 1ng/μL |
| ddH 2O | 6.75 | --- |
| |
25 | --- |
Table 7-2 PRRSV highly pathogenic mutant strain specificity RT-PCR detects amplification condition
(4) result judges
1. interpretation of result condition enactment
Read detected result.The threshold setting principle is as the criterion with display result with the vertex of threshold line just above normal negative control product amplification curve.Or can adjust according to instrument noise situation.
2. quality control standard
Blank does not have the Ct value and does not have the specific amplification curve;
The Ct value of positive control answers＜37, and the specific amplification curve occurs.Otherwise it is invalid that experiment this time is considered as.
3. the result describes and judges
Negative sample does not have the Ct value and does not have the specific amplification curve, no PRRS highly pathogenic mutant strain virus in the expression sample.
Positive sample Ct value＜37, and the specific amplification curve appears, contain PRRS highly pathogenic mutant strain virus in the expression sample.
Effective principle: sample Ct value need be carried out revision test between 37-45 the time.Ct value＜37 o'clock sample is positive as a result for revision test, otherwise negative.
(5) pattern detection test and result
Test is to PRRSV highly pathogenic mutant strain (JXA1), PRRSV classical strains (VR2332, CH-1a), Europe class PRRSV standard strain (LV), equine arteritis virus (EAV), Pestivirus suis (CSFV), Japanese B encephalitis virus (JEV), pig circular ring virus (PCV1, PCV2), pig parvoviral (PPV) and PRV (Pseudorabies virus) (PRV) increase, the result has only PRRSV highly pathogenic mutant strain (JXA1) to obtain specific amplified fluorescence curve (Fig. 5).
Classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT are differentiated detection method
(1) experiment reagent
One Step PrimeScript
TMRT-PCR Kit (Perfect Real Time) test kit is available from TaKaRa company;
Classical strain of PRRSV and highly pathogenic mutant strain TaqMan MGB probe and primer are synthetic by Jikang Biotechnology Co Ltd, Shanghai.
(2) laboratory apparatus
Applied?Biosystems?7500?Real-Time?PCR?System
(3) experimentation
1. the primer and the probe design of classical strain of PRRSV and highly pathogenic mutant strain real-time fluorescence RT-PCR method
The primer of classical strain of PRRSV and highly pathogenic dual real-time fluorescent RT method and probe are referring to embodiment 3.Concrete sequence sees Table 5.
2. the reaction system and the condition of classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT method
The optimization of the classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT discriminating detection method refer to by:
Determining of a, best fluorescent primer concentration: fluorescent primer concentration is screened between the 800nM at 300nM.
Determining of b, best concentration and probe concentration: concentration and probe concentration is screened between the 500nM at 100nM.
Determining of c, best magnesium ion concentration: Mg
2+Concentration is screened between the 8mM at 3mM.
The consumption of d, ThermoScript II is determined: the consumption of ThermoScript II screens between the 5U at 1U.
The consumption of e, Taq archaeal dna polymerase is determined: the consumption of Taq polysaccharase screens between the 5U at 1U.
F, best dNTPs concentration are determined: dNTPs concentration is screened between 500 μ M at 100 μ M.
Through optimizing, classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT differentiate that the reaction system of detection method sees Table 8-1; Reaction conditions sees Table 8-2.
Classical strain of table 8-1 PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT are differentiated detection architecture
| Reaction reagent | Volume (μ L) | |
| 2×One?Step?RT-PCR?BufferIII | 12.5 | 1× |
| TaKaRa?Ex?Taq TM?HS | 0.5 | 0.1U/μL |
| PrimeScript TM?RT?Enzyme?Mix?II | 0.5 | --- |
| 10μM?PRRSV-F2 10μM?PRRSV-R3 | 1.25 | 500nM/each |
| 10μM?H-PRRSV-F2 10μM?H-PRRSV-R12 | 1.25 | 500nM/each |
| 10μM?PRRSV-P | 0.5 | 200nM |
| 10μM?H-PRRSV-P | 0.5 | 200nM |
| 50×ROX?Reference?Dye?II | 0.5 | 1× |
| 10ng?Total?RNA | 2.5 | 1ng |
| ddH 2O | 5 | --- |
| |
25 | --- |
Classical strain of table 8-2 PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT are differentiated testing conditions
(4) result judges
1. interpretation of result condition enactment
Read detected result.The threshold setting principle is as the criterion with display result with the vertex of threshold line just above normal negative control product amplification curve.Or can adjust according to instrument noise situation.
2. quality control standard
Blank does not have the Ct value and does not have the specific amplification curve;
The Ct value of positive control answers＜37, and the specific amplification curve occurs.Otherwise it is invalid that experiment this time is considered as.
3. the result describes and judges
Negative sample does not have the Ct value and does not have the specific amplification curve, classical strain of no PRRS and highly pathogenic mutant strain virus in the expression sample.
Positive sample Ct value＜37 are if the classical strain specific amplification of PRRSV curve has the classical strain virus of PRRS in the expression sample; If PRRSV highly pathogenic mutant strain specific amplification curve has the highly pathogenic mutant strain virus in the expression sample; If occur classical strain of PRRSV and highly pathogenic mutant strain specific amplification curve simultaneously, contain classical strain of PRRS and highly pathogenic mutant strain virus in the expression sample simultaneously.
Effective principle: sample Ct value need be carried out revision test between 37-45 the time.Ct value＜37 o'clock sample is positive as a result for revision test, otherwise negative.
(5) pattern detection test and result
Test is to the classical strain virus (VR2332) of PRRS, PRRSV highly pathogenic mutant strain (JXA1), equine arteritis virus (EAV), Pestivirus suis (CSFV), Japanese B encephalitis virus (JEV), pig circular ring virus (PCV1, PCV2), pig parvoviral (PPV) and PRV (Pseudorabies virus) (PRV) increase, the result has only classical strain virus of PRRS (VR2332) and highly pathogenic mutant strain (JXA1) to obtain specific fluorescence curve (Fig. 6).
Classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT are differentiated the detection method sensitivity test
(1) experiment reagent
One Step PrimeScript
TMRT-PCR Kit (Perfect Real Time) test kit is available from TaKaRa company;
Classical strain of PRRSV and highly pathogenic mutant strain TaqMan MGB probe and primer are synthetic by Jikang Biotechnology Co Ltd, Shanghai.
(2) laboratory apparatus
Applied?Biosystems?7500?Real-Time?PCR?System
(3) experimentation
1. classical strain of PRRSV and the preparation of highly pathogenic mutant strain virus sample
Use the RNA extracting method among the embodiment 2 to extract the classical strain VR2332 of PRRSV virocyte culture (10
5.5TCID
50) and PRRSV highly pathogenic mutant strain JXA1 virocyte culture (10
5.6TCID
50) RNA.And resulting RNA carried out 10 times of serial dilutions respectively.
2. classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT are differentiated the detection method sensitivity test
Use classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT among the embodiment 6 to differentiate detection method, the classical strain of PRRS and 10 times of serial dilution RNA of highly pathogenic mutant strain virus are detected, with the susceptibility of decision method.
(4) result judges
1. interpretation of result condition enactment
Read detected result.The threshold setting principle is as the criterion with display result with the vertex of threshold line just above normal negative control product amplification curve.Or can adjust according to instrument noise situation.
2. quality control standard
Blank does not have the Ct value and does not have the specific amplification curve;
The Ct value of positive control answers＜37, and the specific amplification curve occurs.Otherwise it is invalid that experiment this time is considered as.
(5) gradient dilution pattern detection result
By test-results as seen, classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT differentiate that the susceptibility of the classical strain of detection method detection PRRSV reaches 3.2TCID
50The susceptibility that detects the strain of PRRSV highly pathogenic mutant reaches 0.4TCID
50, susceptibility very high (Fig. 7,8).
Classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT are differentiated detection method and existing PRRSV real-time fluorescent RT-PCR method for detecting simultaneous test
(1) experiment reagent
One Step PrimeScript
TMRT-PCR Kit (Perfect Real Time) test kit is available from TaKaRa company;
The classical strain of PRRSV of the present invention and highly pathogenic mutant strain TaqMan MGB probe and primer; the TaqMan probe and the primer of all PRRSV strains of existing detection, the TaqMan probe of existing detection PRRSV highly pathogenic mutant strain and primer are synthetic by Jikang Biotechnology Co Ltd, Shanghai.
(2) laboratory apparatus
Applied?Biosystems?7500?Real-Time?PCR?System
(3) experimentation
1. classical strain of PRRSV and the preparation of highly pathogenic mutant strain virus sample
RNA extracting method among the use embodiment 2 extracts the RNA of classical strain VR2332 virocyte culture of PRRS and PRRS highly pathogenic mutant strain JXA1 virocyte culture.
2. classical strain of PRRSV and highly pathogenic mutant strain dual real-time fluorescent RT are differentiated detection method and existing PRRSV real-time fluorescent RT-PCR method for detecting simultaneous test
Check the real-time fluorescence RT-PCR method (Kleiboeker of all PRRSV strains of existing detection on the ncbi database, S.B., et al, 2005.Simultaneous detection of North American and Europeanporcine reproductive and respiratory syndrome virus using real-time quantitative reversetranscriptase-PCR.J Vet Diagn Invest.17:165-170.), with the real-time fluorescence RT-PCR method (Xiao that detects the strain of PRRSV highly pathogenic mutant, X.L., et al, 2008.Rapid detection of a highly virulentChinese-type isolate of porcine reproductive and respiratory syndrome virus by real-timereverse transcriptase PCR.J Virol Methods.149:49-55.).Reaction system and amplification condition according to the associated materials explanation are set up this two kinds of methods.
Use the classical strain of PRRSV that the present invention sets up to differentiate the real-time fluorescence RT-PCR method of detection method, all PRRSV strains of existing detection simultaneously and detect the real-time fluorescence RT-PCR method of PRRSV highly pathogenic mutant strain, the mixing sample RNA of PRRSV classics strain VR2332 sample rna, PRRSV highly pathogenic mutant strain sample JXA1RNA and VR2332 and JXA1 is detected with highly pathogenic mutant strain dual real-time fluorescent RT.Detection method is referring to the data of embodiment 6 and existing two kinds of methods.
(4) experimental result
Utilize these three kinds of methods that this three increment detected result is originally seen Table 9.
Three kinds of methods of table 9 are to three kinds of different pattern detection results
The result:
Whether the real-time fluorescence RT-PCR method of as seen existing all PRRSV strains of detection can only detect has PRRSV to infect, and can't distinguish is that the classical strain of PRRSV is infected, and perhaps the strain of PRRSV highly pathogenic mutant is infected, perhaps both co-infected; Whether the real-time fluorescence RT-PCR method of existing detection PRRSV highly pathogenic mutant strain can only detect has the strain of PRRSV highly pathogenic mutant to infect, the classical strain of PRRSV be can't detect, classical strain of PRRSV and highly pathogenic mutant strain co-infected also can't be taken a decision as to whether.Therefore, even unite original two kinds of methods of using, can't be that single PRRSV highly pathogenic mutant strain is infected or the classical strain of PRRSV and highly pathogenic mutant strain co-infected are distinguished still to sample.
And classical strain of the PRRSV that the present invention sets up and highly pathogenic mutant strain dual real-time fluorescent RT differentiate that detection method can detect sample by the single step reaction judgement and whether have the classical strain of PRRSV to infect, perhaps the strain of PRRSV highly pathogenic mutant is infected, or both co-infected.
Claims (2)
- An Oligonucleolide primers that is used for detecting simultaneously classical strain of PRRSV and highly pathogenic mutant strain to the composition of probe, it is characterized in that, described composition comprise the primer that detects classical strain of PRRSV and highly pathogenic mutant strain to and probe, wherein detect the classical strain primer of PRRSV to forming by upstream primer PRRSV-F2 and downstream primer PRRSV-R3, the sequence of upstream primer PRRSV-F2 is that the sequence of CGCACCAGATGGRACCTACTT and downstream primer PRRSV-R3 is ACGGTGTTCAGTGAGGGCTTT, the probe that detects the classical strain of PRRSV is PRRSV-P, and sequence is CCAGTCAACGCAGCG; The primer that detects the strain of PRRSV highly pathogenic mutant is to being made up of upstream primer H-PRRSV-F2 and downstream primer H-PRRSV-R12, the sequence of upstream primer H-PRRSV-F2 is AGTGGGTCGGCACCAGTT, the sequence of downstream primer H-PRRSV-R12 is GCAGACAAATCCAGAGGCTCAT, the probe that detects the strain of PRRSV highly pathogenic mutant is H-PRRSV-P, and sequence is CGTAGAACTGTGACAAC.
- 2. test kit that comprises the described composition of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100777048A CN101643794B (en) | 2009-02-12 | 2009-02-12 | Dual real-time fluorescent RT-PCR identification and detection method of PRRSV classic strain and highly pathogenic mutant strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100777048A CN101643794B (en) | 2009-02-12 | 2009-02-12 | Dual real-time fluorescent RT-PCR identification and detection method of PRRSV classic strain and highly pathogenic mutant strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101643794A CN101643794A (en) | 2010-02-10 |
| CN101643794B true CN101643794B (en) | 2011-11-09 |
Family
ID=41655855
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100777048A Active CN101643794B (en) | 2009-02-12 | 2009-02-12 | Dual real-time fluorescent RT-PCR identification and detection method of PRRSV classic strain and highly pathogenic mutant strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101643794B (en) |
Families Citing this family (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102140527B (en) * | 2010-12-24 | 2012-11-21 | 中国动物疫病预防控制中心 | Real-time fluorescence reverse transcription-polymerase chain reaction (RT-PCR) detection method and kit for highly pathogenic porcine reproductive and respiratory syndrome live vaccine |
| CN102220435B (en) * | 2011-04-06 | 2015-06-03 | 珠海出入境检验检疫局检验检疫技术中心 | Method for detecting American-type porcine reproductive and respiratory syndrome virus (PRRSV) and mutant strains thereof by realtime fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) |
| CN102297969A (en) * | 2011-05-25 | 2011-12-28 | 福建省农业科学院畜牧兽医研究所 | Preparation method of immunofluorescent reagent for differential diagnosis of traditional American type and variant porcine reproductive and respiratory syndrome |
| CN103205507A (en) * | 2013-03-08 | 2013-07-17 | 广西壮族自治区动物疫病预防控制中心 | RT-PCR primers and kit for detecting high-pathopoiesia porcine reproductive andrespiratory syndrome and classic porcine reproductive andrespiratory syndrome |
| CN103290142B (en) * | 2013-03-29 | 2015-03-11 | 云南农业大学 | A fluorescent quantitative RT-PCR method for detection of a porcine reproductive and respiratory syndrome (PRRS) attenuated vaccine virus content |
| CN103333970B (en) * | 2013-05-21 | 2015-02-04 | 广西壮族自治区动物疫病预防控制中心 | Reverse transcription-polymerase chain reaction (RT-PCR) primers for detecting highly pathogenic porcine reproductive and respiratory syndrome (HP-PRRS) viruses and HP-PRRS virus TJ strain and kit with the RT-PCR primers |
| CN104232789A (en) * | 2014-08-21 | 2014-12-24 | 大连大学 | RT-PCR (reverse transcription-polymerase chain reaction) technique capable of simultaneously identifying porcine reproductive and respiratory syndrome virus (PRRSV) |
| CN104450970A (en) * | 2014-12-22 | 2015-03-25 | 上海创宏生物科技有限公司 | Kit and method for identifying porcine reproductive and respiratory syndrome viruses |
| CN105238881A (en) * | 2015-10-30 | 2016-01-13 | 中国农业科学院兰州兽医研究所 | Taqman Real-time RT-PCR kit for detecting PRRSV classic vaccine strain and using method of kit |
| CN106755575A (en) * | 2016-12-27 | 2017-05-31 | 湖南新南方养殖服务有限公司 | A kind of real-time fluorescence RT PCR kits for detecting piglet Cord blood highly pathogenic PRRSV variant and application thereof |
| CN106868224A (en) * | 2017-04-20 | 2017-06-20 | 西南民族大学 | The RT PCR methods of detection pig blue-ear disease poison classical strainses, highly pathogenic mutant strain and the strains of NADC 30 |
| CN108977577A (en) * | 2018-06-28 | 2018-12-11 | 暨南大学 | Primer and probe and its kit and method based on digital pcr technology detection PRRSV Europe class virus |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101045917A (en) * | 2007-03-14 | 2007-10-03 | 中国动物疫病预防控制中心 | Swine reproduction and respiration syndrome vaccine and its prepn process and application |
| CN101186949A (en) * | 2007-05-08 | 2008-05-28 | 深圳太太基因工程有限公司 | Primer and probe sequence for detecting swine breeding and breath syndrome virus nucleic acid fragment |
| CN101280292A (en) * | 2008-05-13 | 2008-10-08 | 中国农业科学院哈尔滨兽医研究所 | Virus velogen strain for porcine reproductive and respiratory syndrome, attenuated vaccine strain thereof and application thereof |
-
2009
- 2009-02-12 CN CN2009100777048A patent/CN101643794B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101045917A (en) * | 2007-03-14 | 2007-10-03 | 中国动物疫病预防控制中心 | Swine reproduction and respiration syndrome vaccine and its prepn process and application |
| CN101186949A (en) * | 2007-05-08 | 2008-05-28 | 深圳太太基因工程有限公司 | Primer and probe sequence for detecting swine breeding and breath syndrome virus nucleic acid fragment |
| CN101280292A (en) * | 2008-05-13 | 2008-10-08 | 中国农业科学院哈尔滨兽医研究所 | Virus velogen strain for porcine reproductive and respiratory syndrome, attenuated vaccine strain thereof and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101643794A (en) | 2010-02-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101643794B (en) | Dual real-time fluorescent RT-PCR identification and detection method of PRRSV classic strain and highly pathogenic mutant strain | |
| WO2021196498A1 (en) | Primer, probe and kit for detecting novel coronavirus | |
| CN110791590B (en) | Dual real-time fluorescence detection primer probe set, kit and method for genes VP72 and CD2V of African swine fever virus | |
| CN111020064A (en) | Novel coronavirus ORF1ab gene nucleic acid detection kit | |
| CN102140551B (en) | General real-time fluorescent RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) method and kit for detecting porcine reproductive and respiratory syndrome virus | |
| CN105695634A (en) | PCR primer for detecting African swine fever virus, kit and application thereof | |
| CN100359022C (en) | Fluorescence quantitative PCR detection reagent for Asf virus and preparation method and use thereof | |
| CN110699489B (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| CN109234456B (en) | Kit capable of simultaneously detecting 6 respiratory pathogens and application thereof | |
| CN110724769A (en) | PCR primer group, kit and detection method for detecting African swine fever virus MGF360-505R gene | |
| CN111676327B (en) | Dual fluorescent quantitative PCR (polymerase chain reaction) detection composition, method and kit for African swine fever virus wild virus infection and gene deletion strain | |
| CN105567872A (en) | RT-RPA detection reagent kit for quickly detecting pest des petits ruminant viruses and application thereof | |
| CN110699490B (en) | RAA constant-temperature fluorescence detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| CN102382905A (en) | Method for synchronously detecting porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV) and porcine reproductive and respiratory syndrome virus (PRRSV) | |
| CN1724686B (en) | Target sequence used for detecting mycoplasma pnoumoniae and reagent box | |
| CN105779650A (en) | Triple fluorescent quantitative PCR primer, probe and kit for identifying pseudorabies virus strains | |
| CN102140527B (en) | Real-time fluorescence reverse transcription-polymerase chain reaction (RT-PCR) detection method and kit for highly pathogenic porcine reproductive and respiratory syndrome live vaccine | |
| CN112921126A (en) | Human respiratory syncytial virus typing detection multiplex RT-qPCR kit, primer probe composition and use method thereof | |
| CN102876813B (en) | Real-time fluorescence RT-HDA (Reverse Transcriptase-Helicase-Dependent Isothermal Amplification) kit and primer for detecting avian influenza virus | |
| CN101748197A (en) | Target sequence for detection of yersinia enterocolitica and kit | |
| CN102286644B (en) | Kit for genotyping hepatitis C virus (HCV) | |
| CN112725475A (en) | Mycobacterium tuberculosis detection primer, probe composition, kit and application | |
| CN1873024A (en) | Fluorescence quantitative kit PCR for quick testing fine | |
| CN102605103B (en) | Primer, probe and method for detecting Norwalk virus nucleotide | |
| CN116254371A (en) | Primer molecular beacon combination for wild type and mutant molecular typing of monkey pox virus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |