CN101638666A - Pichia pastoris engineered strain constructing method and dextranase preparing process - Google Patents

Abstract

The invention relates to the field of genetic engineering and the field of protein secretion expression and provides a method for constructing a pichia pastoris engineered strain used for preparing dextranase. The method comprises the following steps: (1) designing an oligonucleotides primer and taking lipomyces 1390 genome DNA as a template; cloning to obtain dextranase genes; (2) utilizing a secretion expression carrier pPIC9K to insert the dextranase genes into multi-cloning sites (EcoRI and NotI) of the pPIC9K so as to construct an integral secretion-type expression carrier pPIC9K-139; and(3) linearizing the reconstructed expression carrier pPIC9K-139 so as to realize the high-efficiency secretion expression of the dextranase, and obtaining the reconstructed pichia pastoris engineeredstrain GS115-139 by means of selection. The method successfully realizing the effective expression of the dextranase genes in pichia pastoris, constructs the engineered strain which can efficiently secrete and express the dextranase, and realizes the expansion of a fermentation process of the dextranase.

Description

The construction process of pichia pastoris engineered strain and the preparation technology of dextranase

Technical field

The present invention relates to genetically engineered field and field of protein secretion expression, the preparation technology of the particularly structure of the pichia pastoris engineered strain of secreting, expressing dextranase, and dextranase.

Background technology

In sugar industry, owing to be subjected to the influence of sugar cane breed, weather, soil and sugar refinery production environment, all contain the dextran of different amounts in the material, cause direct sugar loss up to about 1.0%; The existence of dextran increases sugar refining technology process difficulty, existence, the increase of liquid glucose viscosity, filtration difficulty, the crystallization that is mainly reflected in false specific rotation is undesired, energy consumption increase, quality reduction etc., therefore the sugar loss that causes especially directly the 3-5 of sugar loss doubly cause sugar loss about 4% because of the dextran reason in promptly traditional sugaring process.Therefore, how to reduce dextran and to control its negative impact be problem that presses for solution of China's sugar industry circle.

The sugar enterprise of China more than 90% adopts the sulfurous method sugar refining technology, this technology is in order to eliminate the influence of macromolecular substance such as dextran, the cleaning technique that adopts adds lime usually, sulfurous gas, polyacrylamide (flocculation agent), tensio-active agent, number of substances such as sterilant and discoloring agent is used as purificant and is removed dextran, starch etc., but its purification effect is not high, cause environmental pollution, the purity difference of peace and quiet front and back, and increased the nonsugar of external source, cause the content of dextran in the white sugar of output higher, this has also just determined back operation crystallization not go out high-quality sugar; Directly influence its processing trait, as cause the beverage muddiness, influence the shaping of candies such as chocolate and packing etc. as food raw material.Along with people are more and more higher to the requirement of the food quality of sugar and interpolation sugar, the negative impact of dextran seems more and more serious.Therefore, improve existing cleaning technique, loss that the efficient of raising cleaning technique, the dextran that reduces cause and negative impact thereof are one of gordian technique bottlenecks of China's sugar manufacturing industry upgrading.

Dextranase is a kind of active protein with the degraded of catalysis dextran, can be under relatively mild condition, remove dextran, convert it into micromolecular monose or oligosaccharides, reduce viscosity, accelerate the sedimentation filtration velocity, reduce cooking time, reduce steam consumption, improve the quality of sugar etc., increase the rate of recovery of sucrose.The action effect highly significant of dextranase in sugaring, according to sugaring expert James, behind the adding dextranase, sugar reclaims and improves 3-5% in the sugaring process, and the quality of sugar also obviously improves.The application of dextranase can promote the quality and the competitive power of sugaring industry significantly.The enzyme process cleaning technique has unusual effect for raising the efficiency, cut down the consumption of energy and reducing blowdown, is typical Green Chemistry treatment process.Succeeding in developing of efficient dextranase and compound enzymic preparation, can realize saving energy and reduce the cost, promoting quality, promote competitive power, can effectively eliminate the negative impact of dextran, undoubtedly sugar manufacturing industry cleaner production, technical progress and promotion industry development be had significant and positive significance in sugar manufacturing industry.

Dextranase mainly is to obtain from thin mould (Penicillium lilacinum) and thin beautiful Chaetomium strain culturing such as (Chaetomiumsp.) at present, the gene in the above-mentioned source of also favourable usefulness carries out the report that engineering bacteria makes up, but the dextranase of preparation can not adapt to temperature and pH in the sugaring process well, and the preparation cost height, so Shang Weiyou is widely used in the report of the dextranase in the sugar industry.

Summary of the invention

The objective of the invention is:

(1) construction process of proposition energy secreting, expressing pichia pastoris engineered strain;

(2) propose to utilize pichia pastoris engineered strain to prepare the technology of dextranase, it has the culture medium carbon source common, inexpensive, and processing condition are simple, advantages such as low cost of manufacture.

Technical scheme of the present invention is as follows:

A kind of construction process of pichia pastoris engineered strain is characterized in that comprising the steps:

(1). design oligonucleotides primer (Primer1:GCGCGAATTCATGACATTAATCT and Primer2:ATCGCGGCCGCGTTTATGGACCATTG), introducing restriction enzyme EcoRI and NotI in the primer respectively, is template with saccharomyces oleaginosus 1390 genomic dnas; The clone obtains dextranase genes, and the evaluation of checking order.

(2). utilize secretion expression carrier pPIC9K, dextranase genes behind EcoRI and the NotI double digestion is inserted the multiple clone site (EcoRI and NotI) of pPIC9K, and cut the equimolecular biology techniques by connection, conversion, enzyme and operate, construct and integrate secreted expression carrier (pPIC9K-139).

(3). with restriction enzyme Bgl II, to recombinant expression vector (pPIC9K-139) linearizing, electric shock transforms pichia spp GS115, by α-facor secreting signal peptide, realize the efficient secretory expression of dextranase,, measure the dextranase enzyme and live at the dull and stereotyped enterprising row filter of the YEPD that contains G418, obtain recombinant yeast pichia pastoris engineering strain (GS115-139), the dextranase of this pichia pastoris engineered strain (GS115-139) can be multiple copied.

A kind of technology of utilizing above-mentioned pichia pastoris engineered strain (GS115-139) preparation dextranase, its feature comprises following operation:

(1) culture medium prescription: basic medium is made up of 10 * Basal salt+250 * PTM1+5% (w/v) glucose+0.02% bubble enemy;

(2) inoculate: pichia pastoris engineered strain (GS115-139) is inoculated in the above-mentioned substratum cultivates;

(3) induce: behind the inoculation culture certain hour, miscarriage adds the methanol induction dextranase in substratum, and methanol concentration is in 0～1% scope;

(4) separate the purification dextranase: adopts centrifugal, filtering method isolated cell, select then that suitable ultra-filtration membrane dams, concentrated broth, carry out low temperature spray drying or carrier adsorbs, obtain dextranase.

Compared with prior art, the present invention has following substantive distinguishing features and marked improvement:

(1) successfully realize the effective expression of dextranase genes in pichia spp, made up the engineering strain of energy efficient secretory expression dextranase, expression amount is higher more than 6 times than original this Da Shi saccharomyces oleaginosus strains A S2.1390.

(2) the present invention realizes the secreting, expressing of dextranase in engineering bacteria by BRP excretory system and α-facor secreting signal peptide; The cloning host bacterium is adopted clearly pichia spp of fast growth, genetic background.

(3) by to the molecular orientation evolvement and the transformation of dextranase genes, and the structure of secreting, expressing recombinant vectors, realize the efficient secretory expression of dextranase, and be raw material with the cheap carbon source, realize that the zymotechnique of dextranase amplifies; Reduce cost to greatest extent.

Embodiment

The present invention is further detailed explanation below in conjunction with embodiment:

Enzyme work is defined as: 1 unit enzyme is lived, and (U) to be expressed as the 1ml enzyme be 5.0 at PH, and under 55 ℃ of the temperature, 1min decomposes dextran (dextran) T2000 and produces 1 μ mol glucose.

The cultivation of this Da Shi saccharomyces oleaginosus AS2.1390:

(1) culture medium prescription: basic medium is made up of 10 * Basal salt+250 * PTM1+5% (w/v) glucose;

(2) processing condition: temperature is 25～35 ℃, PH5.0～7.0, and dissolved oxygen amount is greater than 20%;

(3) inductive condition: after cultivating 24～48 hours, add dextran as inductor.

Cultivate and measure the dextranase enzyme 5U of being alive in the nutrient solution after 96 hours.

Embodiment 1

A kind of construction process of pichia pastoris gene engineering bacterial strain of high yield dextranase, it comprises the steps:

(1) the few nuclear of design acid anhydride acid primer Primer1:GCGCGAATTCATGACATTAATCT and Primer2:ATCGCGGCCGCGTTTATGGACCATTG, introduce restriction enzyme EcoRI and NotI in the primer respectively, with saccharomyces oleaginosus 1390 genomic dnas is template, and the clone obtains dextranase genes;

(2) utilize secretion expression carrier pPIC9K, dextranase genes behind the double digestion is inserted the multiple clone site (EcoRI and NotI) of pPIC9K, and cut the equimolecular biology techniques by connection, conversion, enzyme and operate, construct and integrate secreted expression carrier pPIC9K-139;

(3) with restriction enzyme Bgl II, to recombinant expression vector pPIC9K-139 linearizing, electric shock transforms pichia spp GS115, adopt α-factor, realize the secreting, expressing of dextranase, at the dull and stereotyped enterprising row filter of the YEPD that contains G418, obtain recombinant yeast pichia pastoris engineering strain GS115-139, the dextranase genes of this pichia pastoris engineered strain GS115-139 is a multiple copied.

Embodiment 2

A kind of technology (shake flask fermentation cultivation) for preparing dextranase, its step is as follows:

(1) culture medium prescription: basic medium is made up of 10 * Basal salt+250 * PTM1+5% (w/v) glucose+0.02% glycerine;

(2) inoculation: the pichia pastoris engineered strain GS115-139 of embodiment 1 is arrived above-mentioned culture medium culturing by planting, and culture condition is: temperature is 28～30 ℃, PH5.0～5.6, rotating speed 250r/min;

(3) induce the product dextranase: after 24 hours, add methyl alcohol as inductor in inoculation culture, methanol concentration is in 0～1% scope.Cultivate and measure the dextranase enzyme 26U of being alive in the nutrient solution after 96 hours.

(4) separate the purification dextranase: adopts centrifugal, filtering method isolated cell, select then that suitable ultra-filtration membrane dams, concentrated broth, carry out low temperature spray drying or carrier absorption, obtain dextranase (measure that its enzyme live be 200U).

Embodiment 3

A kind of technology (shake flask fermentation cultivation) for preparing dextranase, its step is as follows:

(1) culture medium prescription: basic medium is made up of 10 * Basal salt+250 * PTM1+5% (w/v) glucose+0.02% bubble enemy;

(2) inoculation: the pichia pastoris engineered strain GS115-139 of embodiment 1 is arrived above-mentioned culture medium culturing by planting, and culture condition is: temperature is 30～33 ℃, PH5.0～5.5, rotating speed 200r/min;

(3) induce the product dextranase: after 48 hours, add methyl alcohol as inductor in inoculation culture, methanol concentration is in 0～1% scope.Cultivate and measure the dextranase enzyme 30U of being alive in the nutrient solution after 96 hours.

(4) separate the purification dextranase: adopts centrifugal, filtering method isolated cell, select then that suitable ultra-filtration membrane dams, concentrated broth, carry out low temperature spray drying or carrier absorption, obtain dextranase (measure that its enzyme live be 200U).

Embodiment 4

A kind of technology (30L ferment tank) for preparing dextranase, its step is as follows:

(1) culture medium prescription: basic medium is made up of 10 * Basal salt+250 * PTM1+5% (w/v) glucose+0.02% glycerine;

(2) inoculation: the pichia pastoris engineered strain GS115-139 of embodiment 1 is arrived above-mentioned culture medium culturing by planting, and culture condition: temperature is 30～32 ℃, PH6.0～6.5, dissolved oxygen amount 20%;

(3) inductive condition: after 24 hours, stream adds methyl alcohol in inoculation culture, and methanol concentration is in 0～1% scope.Cultivate and measure the dextranase enzyme 150U of being alive in the nutrient solution after 96 hours.

(4) separate the purification dextranase: adopts centrifugal, filtering method isolated cell, select then that suitable ultra-filtration membrane dams, concentrated broth, carry out low temperature spray drying or carrier absorption, obtain dextranase (measure that its enzyme live be 1000U).

Embodiment 5

A kind of technology (30L ferment tank) for preparing dextranase, its step is as follows:

(1) culture medium prescription: basic medium is made up of 10 * Basal salt+250 * PTM1+5% (w/v) glucose+0.02% bubble enemy;

(2) inoculation: the pichia pastoris engineered strain GS115-139 of embodiment 1 is arrived above-mentioned culture medium culturing by planting, and culture condition: temperature is 28～32 ℃, PH5.0～7.0, dissolved oxygen amount 23%;

(3) inductive condition: after 48 hours, stream adds methyl alcohol in inoculation culture, and methanol concentration is in 0～1% scope.Cultivate and measure the dextranase enzyme 165U of being alive in the nutrient solution after 96 hours.

(4) separate the purification dextranase: adopts centrifugal, filtering method isolated cell, select then that suitable ultra-filtration membrane dams, concentrated broth, carry out low temperature spray drying or carrier absorption, obtain dextranase (measure that its enzyme live be 1180U).

Sequence table

＜110〉Guangzhou Inst of Cane Sugar

＜120〉preparation technology of the construction process of pichia pastoris engineered strain and dextranase

<140>200910039057.1

<141>2009-04-28

<160>2

<210>1

<211>23

<212>DNA

＜213〉few nuclear acid anhydride acid primer

<400>Primer1

GCGCGAATTC?ATGACATTAA?TCT 23

<210>2

<211>26

<212>DNA

＜213〉few nuclear acid anhydride acid primer

<400>Primer2

ATCGCGGCCG?CGTTTATGGA?CCATTG 26

Claims (3)

1. the construction process of a pichia pastoris engineered strain is characterized in that comprising the steps:

(1) the few nuclear of design acid anhydride acid primer Primer1:GCGCGAATTCATGACATTAATCT and Primer2:ATCGCGGCCGCGTTTATGGACCATTG, introduce restriction enzyme EcoRI and NotI in the primer respectively, with saccharomyces oleaginosus 1390 genomic dnas is template, and the clone obtains dextranase genes;

(2) utilize secretion expression carrier pPIC9K, dextranase genes behind the double digestion is inserted the multiple clone site (EcoRI and NotI) of pPIC9K, and cut the equimolecular biology techniques by connection, conversion, enzyme and operate, construct and integrate secreted expression carrier (pPIC9K-139);

(3) with restriction enzyme Bgl II, to recombinant expression vector (pPIC9K-139) linearizing, electric shock transforms pichia spp GS115, adopt α-factor, realize the secreting, expressing of dextranase, at the dull and stereotyped enterprising row filter of the YEPD that contains G418, obtain recombinant yeast pichia pastoris engineering strain (GS115-139).

2. the construction process of pichia pastoris engineered strain according to claim 1, it is characterized in that: the dextranase genes of described pichia pastoris engineered strain (GS115-139) is a multiple copied.

3. technology for preparing dextranase, its feature comprises that following operation is:

(1) culture medium prescription: basic medium is made up of 10 * Basal salt+250 * PTM1+5% (w/v) glucose+0.02% bubble enemy;

(2) inoculate: pichia pastoris engineered strain as claimed in claim 1 or 2 (GS115-139) is inoculated in the above-mentioned substratum cultivates, culture condition is: 25～35 ℃ of temperature, and PH5.0～7.0, dissolved oxygen amount is greater than 20%;

(3) induce product dextranase: inoculation culture 24-48 hour after, stream adds methyl alcohol, methanol concentration is in 0～1% scope;

(4) separate the purification dextranase: adopts centrifugal, filtering method isolated cell, select then that suitable ultra-filtration membrane dams, concentrated broth, carry out low temperature spray drying or carrier adsorbs, obtain dextranase.